KR20110023129A - Method for inducing neural precursor cells from melanocytes and a composition for treating damage of central or peripheral nervous system comprising said neural precursor cells - Google Patents

Abstract

PURPOSE: A composition for containing neural progenitor cells is provided to be used as a cell therapeutic agent for central or peripheral nerve damage. CONSTITUTION: A neural progenitor cell is induced by culturing melanocytes in a culture medium containing neurotrophin 3, neuregulin 1-beta1, and forskolin. The culture medium further contains PDGF-aa(platelet-derived growth factor-aa) and bFGF(basic fibroblast growth factor). The melanocytes are isolated from human skin epidermis, foreskin, or hair follicle. A composition for treating central or peripheral nerve damage contains the induced neural progenitor cells as active ingredients.

Description

Method for inducing neural precursor cells from melanocytes and a composition for treating damage of central or peripheral nervous system including said neural precursor cells}

The present invention induces neuronal progenitor cells by culturing melanocytes in a culture medium containing neurotrophin 3 (NT3), neuroregulin 1-beta1 (NRG1-beta1) and forskolin. How to; A composition for treating central or peripheral nervous system damage comprising neuroprogenitor cells induced according to the method as an active ingredient; And NT3, neuregulin 1-beta1, and a culture medium for inducing neural progenitor cells from melanocytes containing forskolin.

Central or peripheral nervous system damage can result from accidents, genetic factors or chronic inflammatory diseases. The conjugation and repair of the site of injury is limited, and the types and numbers of cells capable of healing are very limited. In general, the surgery depends on the surgery, but if the damage site is large, the success rate is not high, the recovery of nerve function is limited after the surgery.

Embryonic stem cells with pluripotent potential are more differentiated than other cells. However, ethical limitations have not been overcome, and due to tumor formation after cell transplantation, there are currently limitations for use as cell therapy.

Likewise, neural stem cells in the hippocampus or subventricular zone also differentiate and proliferate into neurons or glial cells in vitro or in vivo. It is known to be capable. However, since the neural stem cells are located in an inaccessible position in the brain, there is a limit to the commercialization of the cell therapeutics. Recently, many studies have been conducted to find a cell source that can be used in other tissues that are not easily accessible to neural tissue.

In recent years, there have been many reports of cross-differentiation and transplantation of mesenchymal stem cells derived from bone marrow into neurons or Schwann cells in vivo (Caddick J et al., 2006; Keilhoff G et al., 2006; Mimura T et al., 2004; Dezawa M et al., 2001). However, there are problems in the reproducibility of cross-differentiated mesenchymal stem cells and engraftment after transplantation. Recently, these cells are known to promote the recovery of nerve damage by providing a trophic factor to other nerve repairing cells rather than functioning as neurons or Schwann cells in the body environment, creating an environment favorable for repairing damage. have. Therefore, research on other cell sources other than mesenchymal stem cells derived from bone marrow is urgently needed.

Melanocytes are cells that secrete melanin, which protects or colors the body from UV rays, and are present in the skin, hair, cornea of the eye, inside the ear, and in the leptomeninges (Goding CR, 2007). Takeda K et al., 2007). Melanocells, like neurons and Schwann cells in the peripheral nervous system, are neural crest stem cells formed in the neural crest site during embryonic and fetal development, and migrated around to differentiate.

Recently published studies on the neurotransmitter function of melanocytes (Takeda K et al., 2007) and the use of melanocytes in the treatment of brain diseases (Papageorgiou N et al., 2008) show that melanocytes can be used to treat neuronal damage. This suggests that melanocytes can perform neuronal cell function under certain environmental conditions.

Based on the results of these previous studies, the present inventors conducted continuous research to find new cell sources that can be used as cell therapeutics. As a result, melanocytes isolated from human skin tissue contain NT3, neuregulin 1-beta1 and forskolin. When culturing in the culture medium to confirm that the ability to differentiate to melano cells and differentiated into neural precursor cells expressing specific genes expressed only in neurons, Schwann cells and neural stem cells, the present invention was completed.

Accordingly, a first object of the present invention is to provide a method for inducing neural progenitor cells by culturing melanocytes in a culture medium containing NT3, neuregulin 1-beta1 and forskolin.

It is a second object of the present invention to provide a composition for treating central or peripheral nervous system damage, comprising neuroprogenitor cells induced according to the above method as an active ingredient.

A third object of the present invention is to provide a culture medium for inducing nerve precursor cells from melanocytes containing NT3, neuregulin 1-beta1 and forskolin.

When the melanocytes isolated from human skin tissues are cultured in a culture medium containing NT3, neuregulin 1-beta1, forskolin, PDGF-aa, and bFGF, in particular, the ability to differentiate into melanocytes under the action of NT3 and nerves By expressing specific genes expressed only in cells, Schwann cells and neural stem cells, it was first confirmed that they are induced into neural progenitor cells, a stage prior to full differentiation.

The neural progenitor cells thus induced are under the action of other neurotrophic factors including BMP2, BDNF, GDNF, etc., such as GABAgernic neurons, dopaminergic neurons, serototonin neurons, and the like. Neurons and glial cells such as oligoendrocytes and schwan cells can be differentiated and used as cell therapy for the treatment of central or peripheral nervous system damage.

In particular, the present invention uses melanocytes isolated from human skin tissue as donor sources of neural progenitor cells, and thus has excellent accessibility compared to neural stem cells or embryonic stem cells of the central nervous system, and provides a sufficient donor area for clinical application. In addition, it has a great advantage in that scarring can be minimized to the donor after donation. Therefore, cell therapies including neuroprogenitor cells derived from melanocytes are very useful for the treatment of central or peripheral nervous system damage.

The first aspect of the present invention relates to a method for inducing neural progenitor cells by culturing melanocytes in a culture solution containing NT3, neuregulin 1-beta1 and forskolin.

Second aspect of the present invention relates to a composition for treating central or peripheral nervous system damage, comprising the neural precursor cells induced according to the method as an active ingredient.

A third aspect of the present invention relates to a culture medium for inducing neuroprogenitor cells from melanocytes containing NT3, neuregulin 1-beta1 and folscholine.

In the present invention, melanocytes are derived from organs with the widest distribution in the human body and easily accessible skin tissue. Melanocells are contained in large amounts in the skin epidermis, foreskin or hair follicle and do not decrease with age. Therefore, in the present invention, melanocytes are preferably those isolated from human skin epidermis, foreskin or hair follicle. The melanocytes can be isolated very easily from the skin removed during surgery, foreskin removed during circumcision, or hair follicles taken from the scalp and other hair areas. The melanocytes isolated in this way can be passaged to secure sufficient cell numbers, thereby making a safe cell bank applicable to clinical practice.

In the present invention, the culture medium for inducing neural progenitor cells from melanocytes is characterized in that it contains NT3, neuregulin 1-beta1 and folscholine. The culture may further contain platelet-derived growth factor-aa (PDGF-aa) and / or further contain basic fibroblast growth factor (bFGF). Most preferably, the culture medium for inducing neural progenitor cells from melanocytes of the present invention contains NT3, neuregulin 1-beta1, folscholine, PDGF-aa and bFGF.

The method for inducing neural progenitor cells of the present invention is characterized by culturing melanocytes in a culture solution containing NT3, neuregulin 1-beta1, and folscholine. In order to secure a greater amount of neural progenitor cells derived from melanocytes, first, the melanocytes can be passaged in melanocyte growth media (MGM) to expand the number of cells.

Therefore, one embodiment of the method of inducing neural progenitor cells of the present invention comprises: a) first culturing melanocytes in melanocyte growth medium (MGM), and b) culturing melanocytes in NT3, neuregulin 1-beta1, and Paul's choline. It includes culturing in a culture solution containing.

In addition, when culturing melanocytes in a culture medium containing NT3, neuregulin 1-beta1, and folscholine, which induce neuronal progenitor cells, some of the cultured cells were completely differentiated into melanocytes. After the cells were separated, only cells induced to differentiate into the remaining neural progenitor cells were replaced with DMEM / F-12 culture medium containing NT3, neuregulin 1-beta1, folscholine, PDGF-aa and bFGF to induce neural progenitor cells. can do.

In particular, NT3 plays a very important role. When NT3 is added, melanocytes are gradually differentiated in culture, leaving only neural progenitor cells with high purity.

Therefore, another embodiment of the method for inducing neural progenitor cells of the present invention comprises: a) first cultured melanocytes in melanocyte growth medium (MGM), b) cultured melanocytes NT3, neuregulin 1-beta1 and Fouls C) cultured in a culture containing choline, c) the cells differentiated completely into melanocytes of the cultured cells were subcultured, and then only the cells induced to differentiate into the remaining neural progenitor cells were NT3, neuregulin 1-beta1, Inducing neuronal progenitor cells by replacing with a culture solution containing foscholine, PDGF-aa and bFGF.

In the present invention, the components of the culture medium for proliferation of melanocytes and the culture medium for induction into neural progenitor cells may be replaced with other components having the same effect as necessary. These components are known to those skilled in the art and can be appropriately selected by those skilled in the art as needed. It is also apparent that the content of these components may vary depending on the purpose or extent to which those skilled in the art intend to culture or differentiate.

Taking the foreskin as a source of melanocytes, the method for inducing neural progenitor cells according to the present invention and a process for confirming whether or not differentiation is induced are as follows.

(1) melanocytes isolated from human foreskin were cultured in MGM to purely expand the number of melanocytes (step 1),

(2) the cells cultured in step 1 were induced into neuroprogenitor cells in α-MEM culture medium containing NT3, neuregulin 1-beta1, forskolin, PDGF-aa and bFGF (step 2),

(3) In step 2, cells differentiated into neural progenitor cells and cells fully differentiated into melanocytes grow together, but when cells are detached and grown through subculture, only completely differentiated melanocytes are separated and induce differentiation into neural progenitor cells. Only the cells left are left (step 3),

(4) Incubate the cells passaged in step 3 in DMEM / F-12 medium containing NT3, neuregulin 1-beta1, folscholine, PDGF-aa and bFGF for 8-10 days to induce differentiation into neuroprogenitor cells. (Step 4),

(5) Immunofluorescence analysis with neuronal cell specific markers, mRNA (messenger RNA) extraction and gene expression analysis by reverse transcriptase-polymerase chain reaction (RT-PCR) to determine whether the differentiation into neuronal progenitor cells (Step 5),

(6) The cell membrane of step 4 was labeled in vitro with PKH26 fluorescent substance and micro-injected into the rat sciatic nerve injury site for 8 weeks to estimate the effect of gastric cells in the body. (Step 6).

The neural progenitor cells thus induced are under the action of other neurotrophic factors including BMP2, BDNF, GDNF, etc., such as GABAgernic neurons, dopaminergic neurons, serototonin neurons, and the like. The cells can be differentiated into glial cells such as oligodendrocytes and schwan cells and used as cell therapy for the treatment of central or peripheral nervous system damage.

By the method of the present invention, it was confirmed that melanocytes can be induced into neural progenitor cells. In the present invention, the neural progenitor cells derived from the melanocytes do not express the melano cell specific genes Sox10, MITF, TYR and EDNRB.

Instead, these cells express immature neurons, Schwann cells and neural stem cell specific markers. Specifically, these cells constantly express neuronal specific genes βIII-tubulin, NEF3 and Nurr1. These cells are also Schwann cell specific gene MBP. Continuous expression of S100, pmp22 and NCAM1. These cells also express the neural stem cell specific genes nestin and NSE.

The neural progenitor cells induced according to the method of the present invention express neuronal, Schwann and neural stem cell specific markers and thus can be used as cell therapeutics. The present inventors confirmed in vivo experiments that the neural progenitor cells derived from melanocytes were implanted into the rat sciatic nerve injury site to play an important role in repairing nerve damage.

Therefore, the present invention includes a composition for treating central or peripheral nervous system damage, which comprises neuroprogenitor cells induced according to the above method as an active ingredient. The central or peripheral nervous system damage includes, but is not limited to, dementia, Alzheimer's disease, multiple sclerosis, Parkinson's disease, stroke, muscular dystrophy, cerebral or spinal cord injury due to trauma, motor nerve damage or peripheral nerve damage.

Administration of the composition for treating central or peripheral nervous system damage of the present invention is preferably parenteral or topical administration, and may be administered by intravenous administration, intraarterial administration, intracranial spinal fluid, or the like. For this purpose, the active ingredient can be suspended or dissolved in a pharmaceutically acceptable carrier according to conventional methods, wherein it is preferable to use a water soluble carrier such as physiological saline.

In the composition of the present invention, the effective dose of neuronal progenitor cells derived from melanocytes is 1 × 10 ⁴ to 1 × 10 ⁷ cells / kg, but appropriately by those skilled in the art according to the weight, age, sex, and severity of symptoms of the patient. Can be adjusted.

Hereinafter, the present invention will be described in more detail based on the following examples. However, these examples are only for the understanding of the present invention and should not be construed as limiting the scope of the present invention.

Example

Example  1: human From foreskin Melanocyte  Isolation and Cultivation

Human melanocytes were isolated from the donor's foreskin with written consent from donors age 15 to 39 years old. First, the foreskin was washed three times with Dulbecco's phosphate buffered saline (DPBS) containing 5% penicillin. After separating finely using a microsurgical scissors to a width of about 0.5cm × 0.5cm and treated with a disperse at 4 ℃ for 24 hours. Then, the dermis was separated from the epidermis and then removed, and the epidermis was treated with 2.5% trypsin / trypsin-EDTA (1: 1) at 37 ° C. for 30 minutes, followed by an enzyme reaction, which was filtered through a filter, and melanocyte culture medium, MGM (melanocyte growth). medium) and isolated and cultured melanocytes from the epidermis.

Melanocyte Basal Medium-4 (calcium chloride, hFGF-B, phenyl mercuric acetate (PMA), rh-insulin, hydrocortisone, BPE, fetal bovine serum (FBS) and gentamycin / amphotericin-B for culturing human melanocytes) ) Was added melanocyte growth medium-4 BulletKit (MGM-4) (Lonza), but MGM M2 (PromoCell), which was developed to avoid using PMA, which is now known as a carcinogen. The isolated cells were diluted in MGM medium and seeded in 75 cm ² flasks (Nunc) at a density of 3 × 10 ⁴ cells / ml and cultured at 37 ° C. and 5% CO ₂ incubator conditions. When cells were found to be 90% cold in the flask, the cells were subdivided at 1: 3 and passaged. Figure 1 shows a typical appearance when the isolated melanocytes are cultured.

Example  2: In melanocytes  Induction of differentiation into neural progenitor cells

In order to differentiate the melanocytes obtained in Example 1 into neural progenitor cells, 10% FBS (Lonza), 5 μm forskolin (R & D Systems Inc, Minneapolis, MN), 100ng / ml human in α-minimal essential medium (αMEM, Gibco) Neuregulin-beta1-b1 (R & D Systems Inc), 5 ng / ml PDGF (R & D Systems Inc), 10 ng / ml NT3 (R & D Systems Inc), 10 ng / ml basic F & R (R & D Systems Inc), 2 μg / ml laminin (Sigma-Aldrich ) And 2 μg / ml heparin incubated for 3 days. As a result, it was possible to see the cell morphology as shown in FIG. In addition, when 10 days have elapsed, fully differentiated melanocytes and cells induced by differentiation into neural progenitor cells coexist as shown in FIG. 3. After detaching and seeding the cells through subculture, the fully divided melanocytes do not adhere to the flask Get off After that, replace αMEM with Dulbecco`s modified minimal essential medium and Ham's F12 3: 1 mix (DMEM / F12 (3: 1), Lonza) and add neurotrophic factors to induce neuronal progenitor differentiation. Subculture was observed, cells as shown in FIG.

Example  3: RT - PCR  Differentiation confirmed through analysis

RNeasy Mini Kit (Qiagen, USA) was used to separate the RNA of the melanocytes of Figure 1 melanocytes and the differentiation induced cells in the melanocytes of Figure 4. cDNA was synthesized using a SuperScript ^TM first-strand system for reverse transcription polymerase chain reacton (Ivitrogen, USA) using 2 μg of RNA. Primers for PCR were cited in neurological research reports or prepared from Primer 3 input software. The primer set used was as follows.

Gene Left primer (5'-3 ') Right primer (5'-3 ') size  ( bp ) A.T.
(° C) MITF CCGTCTCTCACTGGATTGGTG CGTGAATGTGTGTTCATGCCTGG 367 56 TYR CATTCTTCTCCTCTTGGCAGA CCGCTATCCCAGTAAGTGGA 267 62 EDNRB TGGCCATTTGGAGCTGAG CTGAACGGGATGAAGCAAGCA 285 61 Sox10 GAACAGGCTGGACAGAGGAG CGTCTCAAGGTCATGGAGGT 510 57 β-III-tubulin TGGCCAGATCTTCAGACCAG GTAAGTTCAGGCACAGTGAG 600 58 NEF3 GAGCGCAAAGACTACCTGAAGA CAGCGATTTCTATACCAGAGCC 429 58 Nurr1 TTCTCCTTTAAGCAATCGCCC AAGCCTTTGCAGCCCTCACAG 332 58 Nestin CAGCTGGCGCACCTCAAGATG AGGGAAGTTGGGCTCAGGACTGG 208 60 NSE CCCACTGATCCTTCCCGATACAT CCGATCTGGTTGACCTTGAGCA 254 58 MBP ATCCAAGTACCTGGCCACAG TGTGAGTCCTTGCCAGAGC 475 59 S100 GGAAATCAAAGAGCAGGAGGT ATTAGCTACAACACGGCTGGA 253 55 Pmp22 AGGGAGGAAGGGAAAACAGA CTCCAGTTTGGGCATTTTGT 528 54 NCAM1 GGCATCCTCATCGTCATCTT GGTGTTGGAAATGCTCTGGT 474 55 GAPDH CCACCCATGGCAAATTCCATGGCA TCTAGACGGCAGGTCAGGTCCACC 598 60

PCR using Maxime PCR Premix using i -StarTaqTM DNA polymerase (hot-strat) (Intronbio, Korea) Was implemented. Each sample was amplified under the following conditions (denatured 94 ° C. 40 sec; annealing temperature see table above 40 sec; amplification 72 ° C. 40 sec; 35 cycles).

Example  4: RT - PCR  Analysis

As a result of analysis using RT-PCR, melanocytes of FIG. 5 express all of the melanocyte marker genes MITF, TYR, EDNRB, and Sox10, but not all of them after induction of differentiation into neural progenitor cells as shown in FIG. 6. In addition, cells induced by differentiation into melanocytes and neural precursor cells include Schwann cell markers (Pmp22, MBP, NCAM1, S100), neuronal cell markers (βIII-tubulin, NEF3, Nurr1) and neural stem cell markers (nestin, NSE). It was confirmed that the expression in Figures 5 and 6. Most importantly, the expression of these melanocyte markers was completely lost after induction of differentiation into neuroprogenitor cells. In addition, as shown in FIG. 7, the expression of melanocyte markers TYR, EDNRB, and Sox10 was maintained when NT3 was not added when compared with the condition induced with and without NT3 among neurotrophic factors for inducing neural precursor cell differentiation. I could see it. Thus, NT3 could be judged to be a neurotrophic factor that plays an important role in inducing melanocytes into neural progenitor cells using the method of the present invention.

Example  5: Immunofluorescence assay  Differentiation Confirmation

After 15 days of culturing the cells according to Example 2, cells in 24 wells were fixed for 30 minutes in cold 4% formaldehyde in PBS before immunofluorescence. Cells immobilized on the cover slip were washed three times with PBS for 10 minutes, infiltrated in 0.2% Trypton X-100 for 10 minutes and then washed three times with PBS for 10 minutes. Cover slip was blocked with 10% normal horse serum at room temperature for 1 hour. Primary antiserum (mouse anti-HMB45 (1:50, abCam); goth anti-ETBR (1:50 Santa Cruz); mouse anti-β-III-tubulin (1: 100, Chemicon); mouse anti-neufilament 70 kd (1: 300, Chemicon); mouse anti-CNPase (1: 100, abCam); mouse anti-Oligodendrocytes 4 (1: 100, Chemicon)) were diluted in 5% normal horse serum and left overnight at 4 ° C. After removing the primary antibody and washing the cells three times for 10 minutes, fluorescein-mouse Ig (H + L) antibody or -Gout Ig 1: 200 at 5% normal horse serum for 1.5 hours. Diluted at room temperature. The slip was then washed three times with PBS for 10 minutes, the nuclei stained with DAPI, the slips placed on the slides and visualized using Leica Microsystem.

Example  6: Immunofluorescence  result

Melanosome specific markers HMB-45 and endothelin binding receptor (ETBR) were expressed in melanocytes as shown in FIG. On the other hand, as shown in Figure 9 did not express after differentiation into neuronal progenitor cells. Schwann cell markers Oligodendrocyte 4 (Oligodendrocyte 4) and CNPase when compared to Figure 9, when compared to Figure 9, was found to be stronger expression after induction of differentiation into neural precursor cells. Similarly, the neuronal markers β-III-tubulin, neurofilament 70kD (neurofilament 70kD) also, when compared with Figure 8 and 9, it can be seen that the stronger expression after induction of differentiation into neuronal progenitor cells.

The above results indicate that melanocytes cultured in vitro are melanocytes, neurons, and Schwann cells expressed only in melanocyte markers at the protein level (FIG. 8), but when they induce differentiation into neural precursor cells, unique mRNA markers and protein markers. Common expression in (FIG. 9). It was interpreted that the cells lost the characteristics of melanocytes and dedifferentiated into cells having dual characteristics of neurons and Schwann cells.

Experimental Example : Sciatic nerve Rat  Cell transplantation experiment

1. Sciatic Nerve Injury Process and Cell Transplantation

Mature female rats Sprague-Dawley rats (weight 250g-300g, n = 20) were divided into three groups as follows.

Group A: Group to be transplanted with PKH labeled melanocytes

Group B: Group to be transplanted with differentiation-induced cells from PKH labeled melanocytes to neuroprogenitor cells

Group C: Group to transplant PBS (Negative Control)

Animals were anesthetized by mixing ketamine (80 mg / kg) (Yuhan, Korea) and lumpoon (7.4 mg / kg) (Bayer, Korea). After anesthesia, the sciatic nerve was exposed by sequentially dissecting the skin and muscle in the left right thigh. Under high magnification dissection microscopy, 10 sutures were marked with two knots on the sciatic epicardium at 4 mm intervals, and the forceps (Dumont # 5) (WPI) were placed horizontally between the two knots. After that, the sciatic nerve area to be damaged is positioned at a forceps width of 2 mm, and then pressed evenly with a high force for 30 seconds to injure. After injury, the prepared cells (5.0 × 10 ⁷ cells / ml, 1 μl) were injected into the injury site using a glass pipette (40 μm tip diameter) attached to a 1 μl Hamilton syringe. Muscles and skin layers were sutured in turn muscles and skin using a 6-0 suture. After surgery, the rats were cared for on a warm pad, confirmed that the anesthesia was completely awake and returned to the cage. After transplantation, the remaining cells were diluted in DMEM / F12 (3: 1) medium containing 10% FBS, seeded in 75T flasks, and over 90% of cells survived after 24 hours of observation. In the negative control group, the same amount of PBS was put in place of the cells to be transplanted and operated in the same manner as the transplanted group. Cefazoline (Cefazolinc) (CKD, Korea) was administered for one week with antibiotics. All rats were injected subcutaneously with 1 mg / 100 g of cyclosporine (CKD) every day from 3 days prior to transplantation for immunosuppression.

2. Confirmation of the effect of cell transplantation through immunological and immunohistochemical analysis of tissue samples

(1) Preparation of Tissue Samples

A mixture of ketamine (80 mg / kg) and rumoon (7.4 mg / kg) was anesthetized and the right atrium was opened. Immediately, 200 ml PBS to which 1 μl / ml heparin was added was injected into the left ventricle using a pump at a rate of 28 ml / min, followed by infusion of 4% formaldehyde solution and 0.1 M PBS mixed solution stored at 4 ° C. to pulfusion. Sciatic nerve tissue was cut out and placed in 4% formaldehyde solution and stored at 4 ° C. for 24 hours, then immersed in 30% Sucrose (Sigma) and stored at 4 ° C. for 3 days. The sciatic nerve tissue including the 5 mm long length, and the area marked with the micro suture was separated, and the nerve tissue 8 weeks after the transplantation experiment is illustrated in FIGS. 10 to 12. FIG. 10 is an organization of Group A, FIG. 11 is an organization of Group B, and FIG. 12 is an organization of Group C. In FIG. 10, melanin was secreted from the transplanted melanocytes. 10 and 11 it can be seen that the appearance of the tumor appearance is not visible. Lastly, the sciatic nerve tissue was cut vertically with an OCT compound (Sakura, Japan) or cut vertically with a razor vertically and stored at -80 ° C.

(2) Immunology and Immunohistochemical Analysis

The fixed sciatic nerve tissue samples were sliced using a frozen slicer with a thickness of 16 μm in the longitudinal and longitudinal directions and coated on a Superfrost Plus Slide (VWR, UK, http://uk.vwr.com). . Frozen sections were completely dried for fluorescence immunostaining experiments, and then treated with 0.1M PBS added with 0.3% Triton X-100 for 1 hour. After washing three times with PBS, the samples were blocked with 10% serum at room temperature, treated with primary antibody and stored overnight at 4 ° C. Primary antibodies used were mouse anti-neufilament 200 kD (Chemicon, 1: 500) and Gout anti-P0 (Santa Cruz, 1:50). The next day samples were washed three times with 0.1 M PBS and treated with FITC or Tax red for 1 hour at room temperature with secondary antibody (horse anti mouse, rabbit anti goat, 1: 200, Vector, Bulingame, CA). Thereafter, the sample was washed three times with 0.1 M PBS and dropped onto the Vecta shield mounting medium (Vector, Burlingame, CA) with DAPI. Staining results were observed using a normal fluorescence microscope (Leica CTR 4000) and a confocal microscope Zeiss LSM 510 META confocal microscope.

(3) Immunology and Immunohistochemical Analysis

Fig. 13 is a confocal micrograph of longitudinal (cross-section) sections of neural tissues after 8 weeks of group A in which melanocytes are transplanted. The transplanted cells are red and are myelin markers of peripheral nerves in P0 (myelin). sheath protein is shown in green. As shown in FIG. 13, the transplanted cells were not related to myelin formation without overlapping with myelin.

Fig. 14 is a confocal micrograph of the terminal section of the neural tissue after 8 weeks of group A in which the melanocytes were transplanted, where the neuron filament 200kD, which is an axon marker in red color of the transplanted cells, is shown in green. Shows. As shown in FIG. 14, the transplanted cells were along the axons, but there was no overlapping site.

Fig. 15 is a confocal micrograph of terminal sections of neural tissues after 8 weeks of group B transplantation of melanocytes induced with differentiation-induced neuronal progenitor cells, wherein the transplanted cells are red myelin sheath markers. P0 (myelin sheath protein) is shown in green. As shown in FIG. 15, the transplanted cells appeared yellow when overlapped with the myelin sheath.

Figure 1 shows the appearance of melanocytes isolated from human foreskin (foreskin) in culture in MGM culture.

Figure 2 is a cell appearance after 3 days of induction of neuronal progenitor cells in α-MEM culture containing melanocytes containing NT3, neuregulin 1-beta1, PDGF-aa, bFGF and forskolin.

Figure 3 is a cell appearance after 10 days of induction of neuronal progenitor cells in α-MEM culture containing melanocytes containing NT3, neuregulin 1-beta1, PDGF-aa, bFGF and forskolin.

FIG. 4 shows that the cells differentiated into melanocytes in cultured cells are subcultured, and then only NT3, neuregulin 1-beta1, PDGF-aa, bFGF, and forskolin are again induced into different neuronal progenitor cells. The cells were replaced with DMEM / F-12 medium containing 15 days after induction into neural progenitor cells.

5 is a result of RT-PCR analysis of the cultured melanocytes of FIG.

MITF: Microphthalmia-associated transcription factor

TYR: Tyrosinase

EDNRB: Endothelin receptor B

Sox10: sex determining region Y-box 10

β-III tubulin: beta-III tubulin

NEF3: neurofilament 3 (150kDa medium)

Nurr1: Nuclear receptor related 1

Nestin: Nestin

NSE: Neuron Specific Enolase

MBP: Myelin Basic Protein

S100: A family of highly acidic calcium-binding proteins

Pmp22: Peripheral myelin protein 22

NCAM1: Neural Cell Adhesion Molecule 1

GAPDH: Glyceraldehyde 3-phosphate dehydrogenase

FIG. 6 shows the results of RT-PCR analysis of cells differentiated into neural progenitor cells of FIG. 4.

7 is a comparative analysis result of RT-PCR between cells induced by differentiation into neural progenitor cells of FIG. 4 and cells induced by differentiation into α-MEM culture medium except NT3.

FIG. 8 shows the cultured melanocytes of FIG. 1 as melanocytic and neuronal specific markers HMB45, ETBR, βIII-tubulin, neurofilament 70kD, CNPase, and oligoendrocytes 4 It is the result of immunofluorescence analysis using.

HMB45: Melanoma antibody

ETBR: endothelin binding receptor

NF70kd: Neurofilament 70kd

CNPase: 2 ', 3'-Cyclic Nucleotide 3'-Phosphodiesterase

O4: antibody name

FIG. 9 is immunofluorescence assayed for the differentiation-induced cells of neural progenitor cells of FIG. 4 using melanocytes and neuronal specific markers HMB45, ETBR, βIII-tubulin, neurofilament 70kD, CNPase and oligodendrosite 4 The result is.

FIG. 10 is a gross photograph of tissue taken from the embryonic melanocytes of FIG. 1 after 8 weeks after implantation into a sciatic nerve injury rat.

FIG. 11 is a gross photograph of tissue taken from the neuron progenitor cells of FIG. 4 after 8 weeks of transplantation into sciatic nerve-damaged rats.

FIG. 12 is a gross photograph of tissues taken from 8 weeks after transplanting only DMEM / F-12 cultures into sciatic nerve injury rats without cell transplantation as a control.

FIG. 13 is a confocal micrograph showing the results of immunofluorescence analysis of a longitudinal (cross-section) section of the tissue shown in FIG. 10 using a myelin sheath protein (P0), a peripheral nerve myelin marker (red: transplanted cells). , Green: PO).

NF200kd: Neurofilament 200kd

P0: zero, antibody name

Figure 14 is a confocal micrograph showing the results of immunofluorescence analysis of the terminal section of the tissue shown in Figure 10 using axon marker neurofilament 200kD (red: transplanted cells, green: neurofilament).

FIG. 15 is a confocal micrograph showing the results of immunofluorescence analysis of the terminal sections of the tissue shown in FIG. 11 using the peripheral nerve myelin marker P0 (red: transplanted cells, green: PO, yellow: transplanted) Cells and myelin overlap).

Claims (15)

Method of inducing neural progenitor cells by culturing melanocytes in a culture containing neurotrophin 3 (NT3), neuroregulin 1-beta1 (NRG1-beta1) and foskolin (forskolin). The method of claim 1, wherein the melanocytes are isolated from human skin epidermis, foreskin or hair follicle. The method of claim 1, wherein the culture further contains platelet-derived growth factor-aa (PDGF-aa). The method of claim 1 wherein the culture further contains a basic fibroblast growth factor (bFGF). The method of claim 1, further comprising first passing melanocytes in melanocyte growth media (MGM) prior to culturing. The method according to claim 1, wherein the cells differentiated into melanocytes completely differentiated into melanocytes in the cultured cells, and then only the cells induced to differentiate into remaining neuronal progenitor cells are NT3, neuregulin 1-beta1, PDGF-aa, bFGF. And replacing with a culture medium containing forskolin to induce neuronal progenitor cells. The method of claim 1, wherein the neural progenitor cells do not express the melanocell specific genes Sox10, MITF, TYR and EDNRB. 8. The method of claim 7, wherein the neural progenitor cells continuously express the neuron specific genes βIII-tubulin, NEF3 and Nurr1. The method according to claim 8, wherein the neural progenitor cells are Schwann cell specific gene MBP. A method characterized by the continuous expression of S100, pmp22 and NCAM1. 10. The method of claim 9, wherein the neural progenitor cells express neural stem cell specific genes nestin and NSE. A composition for treating central or peripheral nervous system damage, comprising neuroprogenitor cells derived according to any one of claims 1 to 10 as an active ingredient. 12. The composition of claim 11, wherein the central or peripheral nervous system injury is dementia, Alzheimer's disease, multiple biblosis, Parkinson's disease, stroke, amyotrophic lateral sclerosis, cerebral or spinal cord injury from trauma, motor neuron injury or peripheral nerve injury. A culture medium for inducing nerve precursor cells from melanocytes containing NT3, neuregulin 1-beta1 and forskolin. The culture medium according to claim 13, further comprising platelet-derived growth factor-aa (PDGF-aa). The culture medium of claim 13, further comprising a basic fibroblast growth factor (bFGF).

Images