KR101145616B1 - DNA chip and PNA chip for respiratory infectious pathogen differential diagnosis and simultaneous antibiotics resistance analysis, diagnostic kit comprising the same - Google Patents

Abstract

The present invention relates to a composition for simultaneously discriminating respiratory infection disease pathogens and determining the presence or absence of antibiotic resistance thereof, comprising SEQ ID NOs: 5 to 8 and SEQ ID NOs: 11 to 29 and SEQ ID NOs: 32 to 37 and SEQ ID NOs: 42 to Upper respiratory tract infection of nasal cold, pharyngitis and laryngitis caused by bacteria or viruses comprising DNA oligonucleotides 49 and SEQ ID NOS: 52-75, complications of sinusitis, otitis media and bronchitis, pneumonia According to the present invention, there is provided a DNA chip, a PNA chip, and a diagnostic kit including a species-specific species-specific discrimination of antibiotics and antibiotic resistance.

The present invention utilizes probes that can specifically identify 10 bacterial pathogens, 13 viral pathogens, and 19 genes for antibiotic resistance analysis, to identify accurate respiratory infection pathogens at the beginning of infection. It is possible to avoid antibiotic prescriptions and to determine whether they have antibiotic resistance, thereby contributing to the reduction of antibiotic resistance.

Description

DNA chip, PNA chip for respiratory infectious disease pathogens and diagnosis of antibiotic resistance thereof, and DNA kit, PNA chip and diagnostic kit comprising the same {DNA chip and PNA chip for respiratory infectious pathogen differential diagnosis and simultaneous antibiotics resistance analysis, diagnostic kit comprising the same}

The present invention relates to a composition for discriminating respiratory infection disease pathogens and simultaneously determining the presence or absence of antibiotic resistance thereof, and more specifically, specifically identifying 10 bacterial pathogens, 13 viral pathogens and 19 genes for antibiotic resistance analysis. The present invention relates to a discrimination method including multiple probes, a multiplex kit, and a chip.

delete

According to the main statistics of health insurance in 2006, pneumonia representing respiratory infections was classified as the most common hospitalization among elderly patients 65 years or older following senile cataract and cerebral infarction. Domestic pneumonia mortality rate is increasing from 17th in 1994 to 10th in 2004 (National Health Insurance Service, http://www.nhic.or.kr/). The world's total annual death toll is 57 million, of which 27% die from infectious diseases (US Census Bureau, International Data Base, 2007). Pneumonia is the sixth cause of death in the United States and the first cause of death among infectious diseases (The American Thoracic Society Am Rev Respir Dis (1993) 148: 1426-1478). According to the statistics of the cause of death of a university hospital in Korea, the leading cause of death was malignant tumors, but the direct cause of death was uninfected (inpublished data). This means that many patients with underlying diseases die from infection.
Pneumonia, a typical respiratory infection, can be classified according to pathogens or classified as secondary or primary pneumonia according to the presence or absence of existing respiratory diseases, and alveolar pneumonia according to chest X-ray findings. , Bronchial pneumonia and interstitial pneumonia. Community-acquired pneumonia refers to pneumonia acquired in the community as opposed to hospital-acquired pneumonia. Hospital-acquired pneumonia, on the other hand, refers to pneumonia that occurred 48 hours after admission, although no infection was present at admission. Numerous bacteria, viruses, fungi and protozoa can cause outbreaks of pneumonia (The American Thoracic Society Am J Respir Crit Care Med (2001) 163: 1730-1754, Harrison's online http://www.access-medicine.com /resourceToc.aspx?resourceID=4).

The path of infection during pneumonia, micro-aspiration of microscopic aspiration after colonization of pathogens in the nasal cavity, oral cavity, pharynx, larynx and colonization of the upper respiratory tract is recognized as the main path of bacterial pneumonia. After inhalation of the pathogen, the respiratory disease-causing viruses infect type 1 alveolar epithelial cells, causing diffuse alveolar damage and then progressing to interstitial pneumonia, while bacteria are acute It develops and causes inflammatory exudates in the alveolar cavity and then progresses to lobar or bronchial pneumonia. However, clinicians prefer to treat respiratory diseases through the prescription of empirical antibiotics because the symptoms of viral pneumonia and bacterial pneumonia are similar. However, the increase in antibiotic resistance bacteria is an urgent issue to be solved in regions with high antibiotic resistance rates such as in Korea due to unnecessary antibiotic prescription or nonspecific antibiotic prescription which is less susceptible to pathogens.

Streptococcus pneumoniae is the most common causative agent of bacterial pneumonia. Staphylococcus aureus, Klebsiella pneumoniae and Pseudomonas aeruginosa are one of the most common causative organisms. Mycoplasma pneumoniae, Chlamydia pneumoniae, and Legionella pneumoniae are important causes of atypical pneumonia. The causative organisms include acute bronchitis in adults, Bordetella pertussis, which causes chronic cough in adults, Moraxella catarrhalis mainly in the upper respiratory tract, Legionella pneumophila in 35 serotypes, and Haemophilus influenza, which is airborne and propagated in the pharynx.

Respiratory Syncytial Virus A, B, and Parainfluenza Virus Types 1, 2, and 3, Influenza Virus, a major cause of acute respiratory tract infections. A, B, Adenovirus and human metapneumovirus (Human Metapneumovirus) has recently emerged as a cause of acute lower respiratory tract infection in children. Viral respiratory disease is difficult to distinguish the causative virus based on clinical findings because it does not show distinct clinical features (Ruest A et al. J Clin) . Microbiol (2003) 41: 3487-3493). The rapid identification of the causative virus early in the disease can result in immediate administration of the appropriate antiviral agent and prevent unnecessary antibiotic abuse.

Immediately after the introduction of penicillin antibiotics in the 1940's, antibiotic-resistant bacteria began to develop. The rate of expression and diffusion of antibiotic resistance is very fast and outpaces the development of new antibiotics, which is a problem in clinical practice. According to the current status of antibiotic resistance of major pathogens, more than 55% of Streptococcus pneumoniae is penicillin-resistant pneumococci, and about 57% of Staphylococcus aureus is methicillin-resistant. In terms of the amount of antibiotics used in Korea, cephalosporin is the largest group, and penicillin and fluoroquinolone antibiotics are the next most used (Uh Y et al. Yonsei) . Med J (2007) 48: 773-778).

In March 2008, the US Food and Drug Administration (FDA) approved the sale of the xTAG Respiratory Viral Panel (RVP) (Luminex Molecular Diagnostics, Inc., Toronto, Canada), a diagnostic kit that can detect 12 respiratory viral infections. . Although it is faster than conventional tests, it is specific to only 12 kinds of viruses and should be used in combination with other diagnostic methods such as bacterial culture, chest X-ray, and rapid antigen test. In addition, there is a clear disadvantage that the detected virus may not be the cause of the disease or symptom of the patient even if a positive reaction is not necessarily excluded.

Until recently, there has been controversy over whether tests that identify pathogens of respiratory infections should be performed. Even if various tests are used, only about 50% of the causative organisms are found. Failure of empirical antibiotic therapy is accompanied by side effects of increased resistant bacteria (Meehan TP et al. JAMA (1997) 278: 2080-4,). By identifying and coping with pathogens early through high sensitivity / specificity tests, new tests are needed to suppress the spread of antibiotic resistance, improve the compliance of the disease, and enable early cure.
In diagnosing and treating these respiratory infections, clinicians prefer empirical antibiotic prescriptions, leading to a sharp increase in the incidence and spread of antibiotic-resistant pathogens, similar to those of viral pneumonia and bacterial pneumonia. It is often difficult to discriminate easily, and even in the case of rapid culture test, it takes a minimum of several days to screen pathogens, and the causative organisms are difficult or difficult to cultivate, and gram staining can make an error in interpretation. For this reason, the additional diagnosis test is required, such as due to the disadvantages of the conventional test method is large. Below we look at the limitations of the conventional culture test method.
Limitations of sputum culture
Tests to find out the causative agents of outbreaks of pneumonia are low in awareness of the necessity to date. The main reason is that empirical antibiotic treatment (macrolead or fluoroquinolone) is mostly effective. Because.
Most blood cultures, sputum gram staining and culture tests are performed in hospitalized patients with pneumonia but there is some controversy about their usefulness (Gleason PP et al. Arch Intern Med (1999) 159: 2562-2572). It is because these tests do not help to identify the causative organism in many cases, with a report that the probability of finding the causative organism is about 20% (J Korean Acad Fam Med (2008) 29 (4): S41-). S46).
Streptococcus pneumoniae and Haemophilus influenza are common pathogens, but they are often difficult to culture due to their difficult culture. On the contrary, staphylococcus and gram-negative bacillus, which are less common, are easily cultured.
Limitations of Virus Culture Test
The virus culture test can confirm the presence of the virus by observing the cytopathic effect, but for genotyping, additional methods such as immunofluorescence staining or hemadsorption are required, which takes up to 14 days. There are disadvantages (Petric M et al. J Infect Dis (2006) 194 Suppl. 2: S98-S110).
Limitations of chest X-ray examination
If pneumonia is suspected, patients will have a chest X-ray. Lobar pneumonia is known to be caused by typical bacteria, and interstitial pneumonia is known to be caused by viruses. However, chest X-ray findings alone make it difficult to distinguish bacterial and non-bacterial properties.
Limitations of Serum Tests
M. pneumoniae, C. pneumoniae, and Legionella may help diagnose the antibody titers by more than fourfold in the recovery phase compared to the acute phase, but may be nonspecific, with titers more than fourfold higher when infected with other bacteria. Genotyping is impossible and early diagnosis is difficult. Rapid antigen test is a test that can quickly and easily detect respiratory syncytial virus (RSV) or influenza virus, but has a low sensitivity and low negative predictive value.
As mentioned above, the culture test (sputum, virus), chest X-ray, and serum antibody / antigen test used for the diagnosis of respiratory infections may take too long time or are unclear, requiring further tests. There are clearly disadvantages or limitations, such as low sensitivity (see FIG. 1).
The signs of viral pneumonia and bacterial pneumonia are rapidly increasing, since local clinicians prefer to use antibiotics for the diagnosis and treatment of respiratory infections. Similarly, it is often difficult to discriminate easily, and about 30% of pneumonia patients do not release the sputum necessary for the culture test, the culture is difficult or difficult, and Gram staining can make an error in interpretation. In addition, there are difficulties in the medical field that empirical treatment is inevitable when first-time patients are treated because additional confirmation tests are required for clear results (Moon WK Korean J Med (1995) 48: 719-726).

The present invention has been made to solve the above problems, it is possible to avoid the antibiotic prescription by experience by identifying the exact cause by discriminating respiratory infection pathogens through high-throughput chip analysis in the early stage of infection, furthermore, By determining whether or not they have antibiotic resistance, the selection of specific antibiotics can contribute to the reduction of antibiotic resistance.

delete

delete

delete

delete

delete

delete

delete

delete

delete

delete

delete

delete

In order to achieve the above object, the present invention is a DNA oligonucleotide (deoxyribonucleic) of SEQ ID NO: 5 to 8 and SEQ ID NO: 11 to 29 and SEQ ID NO: 32 to 37 and SEQ ID NO: 42 to 49 and SEQ ID NO: 52 to 75 Specific pathogen-specific species of respiratory diseases caused by upper respiratory tract infections of nasal colds, pharyngitis and laryngitis and associated sinusitis, otitis media, and lower respiratory tract infections of bronchitis and pneumonia caused by bacteria or viruses containing acid oligonucleotide An object of the present invention is to provide a DNA chip and a PNA chip for discrimination and antibiotic resistance.
In addition, the present invention is an upper respiratory tract infection of nasal cold, pharyngitis, laryngitis and sinusitis, otitis media and complications of bronchitis and pneumonia caused by bacteria or viruses characterized in that it comprises the DNA chip or PNA chip It is an object of the present invention to provide a diagnostic kit for species-specific differentiation of respiratory diseases caused by pathogens and for determining antibiotic resistance.

delete

delete

delete

delete

delete

delete

delete

delete

In detail, high-throughput analysis at the outset of respiratory infections helps to determine the exact cause of the disease, avoiding antibiotic prescriptions, and determining the presence of antibiotic resistance in infectious pathogens. We offer analytical methods, multiplex kits, and chips to reduce antibiotic resistance.

Respiratory infectious diseases are very important because the treatment period, antibiotic type, and complications vary according to the infectious agents. Accordingly, the present invention derives the results of differential diagnosis of bacterial or viral respiratory infection disease pathogens within 4 hours by only one sample collection, and provides a result of determining the presence or absence of resistance by antibiotic groups of the corresponding pathogens, thereby providing antimicrobial activity at the initial stage of infection. It is possible to provide a respiratory infection differential diagnosis and antibiotic resistance discrimination method which can be selected as the best antibiotic in terms of excellent and pharmacokinetics.

Hereinafter, preferred embodiments of the present invention will be described in detail with reference to the drawings and tables. Configurations shown in the drawings, tables and examples described herein are only one of the most preferred embodiments of the present invention and do not represent all of the technical idea of the present invention, various modifications that can be substituted for them at the time of the present application It should be understood that there may be equivalents and variations.

Also, within the scope of the present invention, various modifications may be made by those skilled in the art to which the present invention pertains, and such modifications are within the scope of the present invention.

< Example  1> Multiplex for Differential Diagnosis of Respiratory Infectious Disease Pathogen and Analysis of Antibiotic Resistance of Infectious Pathogen PCR  Included in the reaction primer ( primer A) design and synthesis

The primers included in the multiplex polymerase chain reaction (PCR) reaction that is carried out earlier for high-throughput chip reactions for differential diagnosis of pathogens causing respiratory infections are US NCBI. GenBank, a base sequence database from the National Center for Biotechnology Information, The DNA Data Bank of Japan, and 10 species of bacteria from the European Molecular Biology Laboratory (EMBL) sequence database of the European Union, More than 10 viruses and 20 kinds of antibiotic resistance-related major strains were produced by analyzing the target gene sequences (see Fig. 2).

Primers were selected for target regions to enable gene-specific or species-specific amplification by pathogens, ie bacteria, viruses, fungi or protozoa. In addition, if necessary, the target site sequence for each pathogen was subjected to multiple alignments using the ClustalW method, and thus, specific primer target sites for each pathogen were selected. Subsequently, primer primer (Primer premier version 5, Premier Biosoft International, Palo Alto, Calif., USA) and DNAiSmax (DNASIS MAX Version 2.7, MiraiBio Group, South San Francisco, CA, USA) programs were selected from the selected primer target sites. Application was made to design species-specific or gene-specific primers. The basic requirements for primer selection are as follows; Primer length (19-24 base pair), melting temperature [Tm (℃), 58-62 ℃], GC content at 3 'end should not be high, and hairpin should not be complementary for more than 4 consecutive bases in primer sequence Secondary structure formation was prevented, and the formation of primer dimers was prevented by preventing three or more identical bases from being consecutively located at the 3 ′ end. In addition, single specific polymorphism (SNP) was not included in the target site to ensure high specificity. In addition, the primer sequence is not cross-reactive with other genes or pathogen sequences constituting the target chip of the present invention using various base sequence search tools such as the US NCBI sequence database. It was. Primers used in the present invention were synthesized through US IDT (Integrated DNA Technologies, Inc., San Jose, CA, USA).

 According to a preferred embodiment of the present invention, the primer for diagnosing bacterial pathogens of respiratory infectious diseases uses a primer labeled with fluorescent dye at the 5 'end or 3' end of the DNA sequence, or a general primer not labeled with the fluorescent dye. Both methods of labeling amplification products were identified by inducing the insertion of fluorescent dye-labeled deoxyribonucleotide triphosphate into the amplification products during the multiplex PCR reaction. In addition, reverse transcriptase-PCR (RT-PCR) is performed for the diagnosis of viral pathogens. Therefore, fluorescent dye-labeled primers are used in the second PCR step after reverse transcriptase reaction, or fluorescent dyes are amplified during amplification reaction. It will be labeled. Fluorescent dyes used in the present invention are 6-FAM (6-carboxyfluorescein), Cy5, Cy3, Cy5.5, JOE (6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein), Rhodamine Green TAMRA NHS (N-hydroxysuccinimide) Ester, Texas Red. The concentration of the primer was checked with an ND-1000 spectrophotometer (NanoDrop Technologies, Rockland, Maine, USA) and resuspended in tertiary deionized sterile distilled water to a final range of 50-200 pmole / uL and aliquots. Frozen at -70 ° C.

< Example  2> Clinical sample collection and from DNA  And RNA  detach

For non-invasive diagnosis of the present invention, nasopharyngeal swab and nasopharyngeal aspirate (NPA) with superior nucleic acid separation rate, throat swab, bronchial lavage fluid Efficient DNA isolation from samples such as bronchoalveolar lavage (BAL), nasal swab, and induced sputum was one of the major prerequisites . Specimens collected within 2 days after onset of symptoms of respiratory infection were used. In general, nucleic acid isolation rates were high in the early stages of infection. Samples were collected and transferred to a laboratory under refrigerated conditions in viral transport media. The collected blood was delivered at room temperature. According to the 2006 Clinical and Laboratory Standards Institute's M41-A 'viral culture' guidelines, viral samples should be particularly careful of the sample transport temperature, and in the case of RSV and CMV, the viral titer decreases dramatically when transported above room temperature. After thawing, thawing alone reduced survival rates by up to 90%.

For differential diagnosis of bacterial causative agents of respiratory infections, bacterial genomic DNA was isolated from the sample, and a commercialized DNA extraction kit (LaboPass ™ Tissue kit, Cosmojintech, Seoul, Korea) was used. If bodily fluid samples, including bronchial lavage fluids, were low in viscosity and were ready for pipetting, 0.5-1.0 mL of the sample was transferred to a 1.5 mL Eppendorf tube without using 2N sodium hydroxide (NaOH). For samples with high viscosity, as in the case of sputum, 2N NaOH was added in the same amount as the sample to liquefy the sample. When NaOH was added, the sample should be released while stirring with a tip. The pipette was released to the point where 0.5 mL was taken accurately. The Eppendorf tube containing the sample was centrifuged at 12,000 rpm (revolutions per minute) using a Denville 260D high-speed centrifuge (Denville Scientific Inc., Metuchen, NJ, USA) for 1 minute. . The supernatant was removed, the precipitate was dissolved in 500 uL of PBS solution, and centrifuged again under the same conditions. When the volume of the sample was small, 500 uL of 1X PBS solution was added and high-speed centrifugation was carried out under the same conditions. The 1 × PBS solution was formulated with 8 g NaCl, 0.2 g KCl, 1.44 g Na ₂ HPO ₄ , 0.24 g KH ₂ PO ₄ in 1 L of tertiary sterile distilled water to a final pH of 7.4. After adding 200 uL of TL buffer to decompose the precipitate, add 20 uL of proteinase K (100 mg / mL), gently stir (vortex), and then 56 ° C for 10 minutes. Reacted. Then 400 uL TB buffer was added to the reaction and stirred to mix the reaction. The reaction was then loaded onto the top of the spin column and centrifuged at 8,000 rpm for 1 minute. A new collection tube was replaced and 700 uL of BW buffer, which acts to bind the DNA extracted from the sample to the membrane of the column, was added and centrifuged under the same conditions. The collection tube was freshly replaced and 500 uL of NW buffer was added to remove impurities from the membrane and centrifuged at 13,000 rpm for 2 minutes. The top of the spin column was then transferred to a new Eppendorf tube, loaded with 100 uL of de-ionized sterile tertiary distilled water to elute DNA, treated for 5 minutes at room temperature, centrifuged at 8,000 rpm for 2 minutes, and purified pure DNA. Separated.

Viral DNA and RNA were isolated from the sample for differential diagnosis of viral pathogens of respiratory infections, and a commercially available viral spin kit (Easy-spin total RNA extraction kit, Intron biotechnology, Korea, Cat. No 17221) was used. Sputum samples were pretreated with 2N NaOH under the same conditions as before. The low-viscosity bronchial washing solution was used without NaOH, and 150-200 uL of the sample was transferred to a 1.5 mL Eppendorf tube pre-dispensed with 350 uL of RNA extraction buffer and stirred for 1 minute. It was allowed to stand at room temperature for 5 minutes, and 80 uL of chloroform was added thereto, followed by stirring for 10 seconds and mixing. After standing at room temperature for 3 minutes, the mixture was centrifuged at 13,000 rpm for 10 minutes at room temperature. About 250 uL of clear supernatant portion was transferred to a RNase-free sterile Eppendorf tube. Then 250 uL of isopropanol was added and gently shaken to mix. After standing for 10 minutes, the mixture was centrifuged at 13,000 rpm for 15 minutes at room temperature, and the supernatant was removed by careful not to suck the pellet. If the precipitate is not visible, it does not disappear, so the supernatant was left behind about 20 uL without completely removing the supernatant. Add 1 mL of 75% ethanol stored at -20 ° C, centrifuge at 13,000 rpm for 5 minutes at room temperature, remove supernatant carefully to prevent pellet from being sucked out, and open the Eppendorf tube cap at room temperature. The pellet was dried naturally and immediately extracted 15% of 30 dl of sterile distilled water without DNase / RNase contamination.

< Example  3> multiplex PCR Chip for diagnosing respiratory infection disease through chip )of target  Gene amplification

Prior to high-throughput chip analysis, target genes of the chip reaction were amplified by multiplex PCR reactions with bacterial, fungal DNA and viral RNA and DNA isolated from clinical samples. Subsequently, the amplified multiplex amplicons form duplexes with DNA or PNA probes on the chip surface to confirm the differential diagnosis results of pathogens of respiratory infections, and at the same time, whether the pathogens are resistant to specific antibiotics. The analysis results can be derived simultaneously. The multiplex PCR according to a preferred embodiment of the present invention includes a human beta-globin gene, a bacterial 16S rRNA gene, or a viral NS1 gene as an internal control. Constitutional composition and PCR reaction conditions of the pre-made PCR mastermix of 10 respiratory infection disease bacterial pathogens multiplex PCR described in this embodiment are shown in Table 1 below.

Respiratory Tract Infection Bacterial Pathogen 10 Multiplex PCR Master mix  Composition and PCR  Condition
PCR reaction solution composition

Volume (uL)
PCR reaction conditions

Deionized Tertiary Sterilized Distilled Water

4.3
Initial denaturation
(Initial denaturation)
95 ° C., 15 minutes
1 time
10 kinds of primers
Prime premix


5.7

denaturalization
(Denaturation)

95 ° C, 40 seconds




Episode 37




2X Multiplex PCR Premix

15

Combination
(Annealing)
57 ° C, 40 seconds
Bacterial Genomic DNA (over 50 ng)

5

extension
(Extension)
72 ° C., 40 seconds
Final volume

30

Last extension
(Extension)
72 ° C., 7 minutes
1 time

The composition and PCR reaction conditions of the pre-made PCR mastermix of 19 multiplex PCR for respiratory infection disease antibiotic resistance analysis described in this embodiment are also shown in Table 2 below.

19 multiplexes for respiratory infections PCR Master mix  Composition and PCR  Condition
PCR reaction solution composition

Volume (uL)
PCR reaction conditions

Deionized Tertiary Sterilized Distilled Water

2.5
Initial denaturation
(Initial denaturation)
95 ° C., 15 minutes
1 time
19 kinds of primer
Prime premix


7.5

denaturalization
(Denaturation)

95 ° C, 45 seconds




40 times




2X Multiplex PCR Premix

15

Combination
(Annealing)
57 ° C., 60 seconds
Bacterial Genomic DNA (over 100 ng)

5

extension
(Extension)
72 ° C., 60 seconds
Final volume

30

Last extension
(Extension)
72 ° C., 7 minutes
1 time

Final concentration of PCR buffer in the multiplex PCR reaction mixture is 50 mM KCl, 3.5 mM MgCl ₂ , 10 mM Tris-HCl, pH 8.2, 2.5 unit Taq polymerase, 300 uM dNTPs (Boehringer Mannheim, Mannheim, Germany), 10 mg / mL Bovine serum albumin. Sense primers of individual genes included in multiplex PCR for differential diagnosis of respiratory infections are synthesized by labeling Cy3 or Cy5 fluorescent dyes at the 5'- or 3'-end, or modification at both ends. ) Was synthesized with nascent oligonucleotides (Integrated DNA Technologies, Inc., Coralville, IA, USA).

In a multiplex PCR kit including a primer having no fluorescent dye modification at the terminal according to a preferred embodiment of the present invention, Cy3 fluorescent dye-labeled deoxycytosine triphosphate (Cy3-dCTP) constitutes an amplification product during PCR. By adding to the nucleotides to improve the sensitivity and specificity of the reaction. The PCR buffer used for 11 multiplex PCR reactions using Cy3-dCTP had a final concentration of 50 mM KCl, 3.5 mM MgCl ₂ , 10 mM Tris-HCl, pH 8.2, 2.5 units of Taq polymerase, 300 uM dATP , 300 uM dGTP, 300 uM dTTP, 25 uM dCTP, 275 uM Cy3-dCTP (FluoroLink Cy3-dCTP, Amersham Pharmacia Biotech AB, Piscataway, NJ, USA), 10 mg / mL Bovine serum albumin Target genes were specifically amplified.

And compositional composition, reaction conditions and secondary PCR of a pre-made RT-PCR mastermix of 13 respiratory infectious diseases viral pathogens multiplex RT (reverse trasnscription) -PCR, which are also described in the present embodiment. The reaction conditions are shown in Tables 3 and 4 below.

RT-PCR reaction solution composition

Volume (uL)
RT-PCR Reaction Conditions


Deionized Tertiary Sterilization DEPC-Distilled Water

1.5
Reverse transcription reaction

55 ℃, 3 minutes
1 time
42 ° C, 40 minutes
1 time
95 ° C, 5 minutes
1 time
RT-PCR Primer
Prime premix


One First PCR Reaction

denaturalization
(Denaturation)

95 ° C, 30 seconds




Episode 33




2X RT-PCR Premix

11

Combination
(Annealing)
58 ° C., 40 seconds
Viral RNA and DNA (greater than 1 mcg)

8.5

extension
(Extension)
72 ° C., 40 seconds
Final volume

22

Last extension
(Extension)
72 ° C., 7 minutes
1 time

8.5 uL of viral RNA and DNA product, 11 uL of 2X RT-PCR premix with RNase inhibitor and AMV reverse transcriptase, 1 ul of RT-PCR primer premix with random hexamer, diethylpyrocarbonate ) -Treated tertiary sterile distilled water was prepared RT-PCR mastermix containing 1.5 uL and reverse transcription enzyme reaction under the same reaction conditions as above. Thereafter, the second PCR reaction was performed using RT-PCR reaction product 3 uL, and the reaction composition and conditions are as follows.

2nd PCR reaction solution composition

Volume (uL)
Secondary PCR Reaction Conditions

Deionized Tertiary Sterilized Distilled Water

4.9
Initial denaturation
(Initial denaturation)
95 ° C., 15 minutes
1 time
13 kinds of primers
Prime premix


7.1

denaturalization
(Denaturation)

95 ° C, 30 seconds




30 times




2X Multiplex PCR Premix

15

Combination
(Annealing)
60 ℃, 40 seconds
Reverse Transcriptase Product

3

extension
(Extension)
72 ° C., 40 seconds
Final volume

30

Last extension
(Extension)
72 ° C., 5 minutes
1 time

< Example  4> Differential diagnosis for respiratory infection and antibiotic resistance chip ( chip Probes that make up probe A) design and synthesis

In order to provide a respiratory infectious disease diagnosis and antibiotic resistance analysis chip for the preferred embodiment of the present invention, 10 bacterial pathogens, 13 viral pathogens and 19 genes for antibiotic resistance analysis can be discriminated with high specificity. Probes were designed.

Specifically, probes included in the stroke DNA or PNA chip according to a preferred embodiment of the present invention, Primer premier (Designer Premier) to be designed to specifically bind to the target gene of the multiplex PCR amplicon (amplicon) version 5, Premier Biosoft International, Palo Alto, Calif., USA, DNASIS MAX Version 2.7, MiraiBio Group, South San Francisco, Calif., USA, or OligoArray 2.0, http: // cbr-rbc .nrc-cnrc.gc.ca) program is applied and the details are shown in Table 5. Probes modified to place amine or thiol groups at the 5 'or 3' end of the DNA or PNA probe sequence of interest were synthesized (MWG-Biotech AG, Ebersberg, Germany). When modifying the amino modifier at the 5 'end of the probe, spacers of 6 to 9 carbons or 12 to 15 thymine bases were added to promote the reaction efficiency. No spacer was used when modifying the amino modifier at the 3 'end of the probe. The amine groups of the probe have the properties of primary amine groups and are attached to the aldehyde-activated or carboxyl-activated chip surface. The concentration of the probe was converted to absorbance values at 260 nm, and it was checked for impurities by Maldi-TOF (MALDI-TOF, Matrix Assisted Laser Desorption / Ionization Time-of-Flight), and high performance liquid chromatography (HPLC) After pure purification through liquid chromatography) was prepared so that the final concentration in sterile tertiary distilled water 100-250 pM.

Respiratory infectious disease differential diagnosis and antibiotic analysis chip ( chip Make up) Probe ( probe ) Combination order
List
number Probe target identification,
(Reaction strain name),
Target gene name Probe orientation, (wild or variant),
Sequence (5'-3 ') Length One Antibiotic resistance,
TEM Forward, GAATAAGGGCGACACGGAAA 20 2 Reverse, TTTCCGTGTCGCCCTTATTC 20 3 Antibiotic resistance,
SHV Reverse, CAGCACGGAGCGGATCAACG 20 4 Forward, CGCCCTGCTTGGCCCGAATA 20 5 Antibiotic resistance,
CTX-M Reverse, AGTTCTGCCAGCGTCATTGTGCC 23 6 Reverse, GCGCCGGTCGTATTGCCTTTGA 22 7 Antibiotic resistance,
OXA-1 Forward, TTGCGATGCTCTATGAGTGGCT 22 8 Forward, GGCGATGAGCGAAATGTAGTGC 22 9 Antibiotic resistance,
AmpC Forward, GACCGTTACGCCGCTGATGAA 21 10 Forward, TGACAGGCAAGCAGTGGCAGG 21 11 Antibiotic resistance,
PBP2B Forward, (wild type), TTGTTCCAGGTTCGGTTGTCAA 22 12 Forward, (variable), AATTGGCATATGGATCTTTTCCTAT 25 13 Antibiotic resistance,
PBP1A Forward, (wild type), TAACTGGGATAGGGGCTACTTTGGC 25 14 Forward, (variant), GGACGATGCCAGACGGACTT 20 15 Antibiotic resistance,
gyrA Forward, (wild type), GGTATTTACCCATGACATCCCCT 23 16 Forward, (variable), GGTATTTACCCATGACATTCCCT 23 17 Antibiotic resistance,
parC Forward, (wild type), TCCACCCACACGGGGATTCTTC 22 18 Forward, (variant 1), TCCACCCACACGGGGATTTTTC 22 19 Forward, (variant 2), TCCACCCACACGGGGATTATTC 22 20 Antibiotic resistance,
parE Forward, (wild type), AAGGCCAAGATGGCGGATATCCTC 24 21 Forward, (variant), AAGGCCAAGATGGCGGATGTCCTC 24 22 Antibiotic resistance,
qnrA Forward, GGGGCTGTGACCTAACCTTTGC 22 23 Reverse, ATCGGCAAAGGTTAGGTCACAGC 23 24 Antibiotic resistance,
qnrB Reverse, AGTCGTGCGATGCTGAAAGATG 22 25 Forward, TTTTCGCCAACGAGTGCCAG 20 26 Antibiotic resistance,
qnrS Forward, TGCCCATCAAGTGAGTAATCGTAT 24 27 Reverse, AGGTTCGTTCCTATCCAGCG 20 28 Antibiotic resistance,
ermA Forward, AAATGAGTCAACGGGTGAATGCTA 24 29 Reverse, ATTTTTCGGGTTTTTCTGTTTCAT 24 30 Antibiotic resistance,
ermB Forward, CATCAAGCAATGAAACACGCCA 22 31 Forward, TCAAGCAATGAAACACGCCAATG 23 32 Antibiotic resistance,
ermC Forward, TCGTGGAATACGGGTTTGCTAA 22 33 Reverse, CTTTTAGCAAACCCGTATTCCAC 23 34 Antibiotic resistance,
mef Forward, ATGGGCAGGGCAAGCAGTAT 20 35 Reverse, GCAATCACAGCACCCAATACG 21 36 Antibiotic resistance,
mecA Reverse, CGTTGCGATCAATGTTACCGTAGT 24 37 Forward, ACTACGGTAACATTGATCGCAACG 24 38 Bacterial,
S. pneumoniae, lytA Forward, GAAGCGGATTATCACTGGCGG 21 39 Forward, GGCGGTTGGAATGCTGAGAC 20 40 Bacterial,
S. aureus, entC1 Forward, GCCAACCAGACCCTACGCCAG 21 41 Reverse, CTGGCGTAGGGTCTGGTTGGCTC 23 42 Bacterial,
H. influenzae, P6 Forward, TTGGCGGATACTCTGTTGCTGAT 23 43 Reverse, CCTAATGCGATGTTGTATTCTGGTG 25 44 Bacterial,
B. pertussis, IS481 Forward, TAGACGACGCCTACCGCACCCT 22 45 Forward, ACGACGCCTACCGCACCCTGAT 22 46 Bacterial,
M. catarrhalis, CopB Forward, CCAAAGATGTGCCCAAAGAGATA 23 47 Reverse, ACCACATCATTGCCCAACAGA 21 48 Bacterial,
L. pneumophila, mip Forward, AGCGTTGGCGGACCTATTGG 20 49 Reverse, CCACTTGGTAATACAACAACGCC 23 50 Bacterial,
M. pneumoniae, P1 Forward, CACCACCGCAACAAGGGACG 20 51 Reverse, CGAACCGCCTGTAATCATCGTCT 23 52 Bacterial,
C. pneumoniae, ompA Forward, CATTTGCTGGTTCTGTCGGCTCC 23 53 Forward, ACTGCCGTAGATAGACCTAACCCG 24 54 Bacterial,
K. pneumoniae, 16S rRNA Forward, GGACGGGTGAGTAATGTCTGGGA 23 55 Forward, CGGCGGACGGGTGAGTAATGT 21 56 Viral,
Influenza A, M2 Forward, CCCTTGTTGTTGCTGCGAGTATC 23 57 Reverse, GATACTCGCAGCAACAACAAGGG 23 58 Viral,
Influenza B, M1 Reverse, TCTTTCCTGGTCTTTGGGCTT 21 59 Reverse, GTTTCTCGCACAAAGCACAGAGC 23 60 Viral,
PIV1, neuraminidase Forward, TATGCTCCTTGCCCACTGTGAATG 24 61 Forward, AACTCCGCTCCAAGGCGACACTAA 24 62 Viral,
PIV2, neuraminidase Reverse, CACCCGTTGGGAGATGTTGCTGA 23 63 Forward, ATGAGTCCAACCGAACCAACCCCA 24 64 Viral,
PIV3, neuraminidase Reverse, CTCATTGCCAGCATCCTTTCCGT 23 65 Reverse, AAGTAACCTTCCTTCTGACCCCCA 24 66 Viral,
RSV A, fusion protein Reverse, ACGGCCTTGTTTGTGGATAGTAGAG 25 67 Forward, GTGCTCTACTATCCACAAACAAGGC 25 68 Viral,
RSV B, fusion protein Forward, TTCTGGGCTTCTTGTTAGGTGTAGG 25 69 Forward, ATTCCAGCAGAAGAACAGCAGATTG 25 70 Viral,
hMPV, matrix protein Reverse, GATCATAATCAATCCCGCATAAGGT 25 71 Reverse, CATCCCGTATGGTTTCATGGTTGT 24 72 Viral,
Adenovirus, hexon gene Forward, AAACTCCCTCMCTCGGCTCGG 21 73 Reverse, ATGGTRGGTGCGAGGTAGCCG 21 74 Viral,
CMV, IE gene Forward, AGTTYTGTCGGGTGCTGTGCTGC 23 75 Forward, CGGGTGCTGTGCTGCTATRTCTT 23 76 Viral,
HSV-1 & -2, glycoprotein Forward, CACATCAAGGTGGGCCAGCCG 21 77 Reverse, CTGCGGCTGGCCCACCTTGAT 21 78 Viral,
HSV-2, glycoprotein Forward, TGGGACTGGGTGCCGAAGCGA 21 79 Reverse, CGGTCGCTTCGGCACCCAGTC 21

In order to improve the discrimination ability of the probe, various conditions such as probe length, stringency of chip cleaning process and chip hybridization reaction temperature were checked, and chip hybridization reaction temperature and fluorescence signal were controlled to prevent false positive and false negative results. A good discrimination condition could be confirmed through possible additives.

< Example  5> Differential diagnosis of respiratory infection disease and antibiotic resistance analysis chip ( chip Production

DNA or PNA chip for the differential diagnosis and antibiotic resistance analysis of respiratory infectious disease pathogens provided as a preferred embodiment of the present invention is a high- There are a total of 42 probes that can be determined by their specificity. As an internal control, probes for human beta-globin gene, bacterial 16S rRNA gene, or viral NS1 gene are immobilized. The chip layout was designed to include eight grids for a total of 42 genes for high-throughput analysis on a single chip substrate, and eight individual specimens were placed in an eight well hybridization reaction chamber. It was designed to proceed with the analysis at the same time (see Figure 3). After thawing at 70 ° C., the probe stock was stored at room temperature, and then diluted with deionized sterile tertiary distilled water to a final concentration of 100 μM and used as a working stock. Each probe with 50-fold dilution of working stock was subjected to a 1: 5-10 ratio (v / v) with 3X SSC spotting solution (500 mM NaCl, 3 mM sodium citrate, 1.5 MN, N, N-trimethylglycine, pH 6.8). By mixing, the concentration range of the probe dispensed into the final 96 well plate was 20-30 pmole / uL. The plate was mounted on a Microssys 5100 microarrayer (Cartesian Technologies, Ann Arbor, MI, USA) from which an aldehyde-, thioisocyanate-activated glass slide (CEL associates Inc., Houston, TX, USA) The probes were spotted in duplicate on the surface of the epoxy-activated plastic chip or gold film. The average diameter of the spots is 80-140 micrometers and the distance between spots was maintained at 350-500 micrometers to minimize cross-talk effects between spots. Chip fabrication was carried out in a class 10,000 room maintaining 75% humidity. The chip spotted with the probe was baked at 120 ° C. for 1 hour, and then washed for 3 minutes in 0.25% SDS (Sodium dodecyl sulfate) solution, and then again washed with sterile tertiary distilled water. The probe was then blocked by reacting the chip with a solution containing 0.2% sodium borohydride (NaBH ₄ ). After washing twice with 3 distilled water, the water was removed and stored in a desiccator (dessicator) until the point of use.

< Example  6> Differential diagnosis of respiratory infectious disease and antibiotic resistance analysis chip ( chip ) Hybridization ( hybridization ) Response and result analysis

10-20 uL each of 10 bacterial and 10 viral pathogens according to a preferred embodiment of the present invention and 19 multiplex PCR amplification products for analyzing the antibiotic resistance of infected pathogens A total of 30-60 uL was added to this volume of 1.5 mL eppendorf tubes pre-added with deionized tertiary sterile distilled water. The mixture was softly vortexed, thermally denatured at 95 ° C. for 5 minutes, preserved on ice for 5 minutes, and spun down with a centrifuge. An 8 well hybridization chamber was placed on the chip surface and the well top was covered with a well cover. Thereafter, 60-80 uL of a hybridization reaction solution (3X SSC, 0.1% SDS, 0.2 mg / mL bovine serum albumin, pH 7) was preheated to the reaction mixture solution at 56 ° C. in the reaction mixture solution. ) Was added and mixed, and then the reaction mixture was injected through the hole of the well cover, and care was taken not to generate bubbles. After fixing the chamber lid, hybridization reaction was performed at 56 ° C. for 30 minutes to induce specific nucleotide complementary binding between the probe on the chip surface and the multiplex PCR reaction product. The well cover of the chip surface where the hybridization reaction was completed was removed, the chip was immersed in the washing buffer 1 (0.1X SSC, 0.05% SDS) solution, washed with stirring at 2,000 rpm for 2 minutes, and repeated. After washing with washing solution 2 (2X SSC, 0.1% SDS) solution at 2,000 rpm for 2 minutes (washing) was repeated. Thereafter, the chips were dried by immersion in deionized tertiary sterile distilled water twice and centrifuged at 1,000 rpm. The chip was read using a ScanArray Lite (Packard Instrument Co., Meriden, CT, USA) scanner, and the mean fluorescence intensity and standard of the positive control spots using the analysis software (QuantArray 2.0). Signal-to-noise (S / R) ratio was obtained by comparing the error with the values around the spot, and when the value was 4 or more, scoring was performed as a positive value (see FIGS. 5, 6, and 7).

1 is a time required for diagnosis of respiratory infection pathogens and antibiotic resistance analysis time according to the present invention (4 hours) and chest X-ray, gram staining test, antibiotic resistance test, including culture test, which is a conventional gold standard test method (4). It is a schematic diagram comparing work).

Figure 2 shows the resistance genes analyzed by infectious agents and antibiotics groups that can be analyzed through the respiratory infection disease differential diagnosis and antibiotic resistance analysis chip (chip) constituting the present invention. The target gene names for the analysis of 10 bacterial and 12 viral pathogens and beta-lactam, penicillin, quinolone, macrolide and methicillin antibiotic resistance were shown.

Figure 3 is a schematic diagram of a chip capable of differential diagnosis and antibiotic resistance analysis of each respiratory infection disease pathogens prepared according to the present invention. The chip grid shows the array of target probes for antibiotic resistance analysis and the bacterial and viral pathogens, and the hybridization reaction between the fluorescent DNA-labeled target DNA and the probes arranged on the chip is performed. An 8 well hybridization reaction chamber was schematically shown.

4 is amplified by a multiplex PCR or RT-PCR reaction of the target gene as a template after the preparation of the chip immobilized probe according to the present invention, a template of reverse-transcribed cDNA (complementary DNA) from DNA or viral RNA isolated from the sample This is a flow chart showing the main steps of the chip analysis process to discriminate between respiratory infection pathogens and determine their antibiotic resistance by performing hybridization with selective probes on the chip.

Figure 5 shows a chip scan image (left picture) and chip grid (right picture) showing the results of analyzing the differential diagnosis of respiratory infection pathogens and their antibiotic resistance according to the present invention. Bacterial respiratory infections were infected with pneumococci, H. influenza, and M. pneumoniae, and plasmid beta-lactam antibiotic resistance was positive for CTX-M and OXA-1, and penicillin according to PBP2B mutant System resistance is expected, and the analysis results show that there are gyrA mutants and quinolone resistance according to qnrA and qnrB positive and macrolide resistance according to ermA positive.

Figure 6 shows another chip scan image (left picture) and chip grid (right picture) showing the results of the differential diagnosis of respiratory infection pathogens and their antibiotic resistance according to the present invention. Bacterial and viral respiratory infections occurred in H. influenza, M. pneumoniae and K. pneumoniae, and influenza B, parainfluenza 2, 3 and respiratory syncytial virus type A were viral. Infected. TEM, CTX-M positive plasmid beta-lactam antibiotic resistance is present, penicillin resistance according to PBP2B and PBP1A mutant is expected, quinolone resistance according to gyrA and parC mutant and qnrA positive, Analysis results confirming methicillin resistance according to mecA positive.

Figure 7 shows another chip scan image (left picture) and chip grid (right picture) showing the results of the differential diagnosis of respiratory infection pathogens and their antibiotic resistance according to a preferred embodiment of the present invention. Viral respiratory infections include influenza A, B, respiratory syncytial virus A, B, adenovirus and cytomegalovirus.

<110> PARK, MinKoo <120> Respiratory infectious pathogen differential diagnosis and          simultaneous antibiotics resistance analysis, kit and chip          configure same <160> 79 <170> KopatentIn 1.71 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for TEM gene, beta-lactam antibiotics resistance <400> 1 gaataagggc gacacggaaa 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for TEM gene, beta-lactam antibiotics resistance <400> 2 tttccgtgtc gcccttattc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for SHV gene, beta-lactam antibiotics resistance <400> 3 cagcacggag cggatcaacg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for SHV gene, beta-lactam antibiotics resistance <400> 4 cgccctgctt ggcccgaata 20 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for CTX-M gene, beta-lactam antibiotics resistance <400> 5 agttctgcca gcgtcattgt gcc 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for CTX-M gene, beta-lactam antibiotics resistance <400> 6 gcgccggtcg tattgccttt ga 22 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for OXA-1 gene, beta-lactam antibiotics resistance <400> 7 ttgcgatgct ctatgagtgg ct 22 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for OXA-1 gene, beta-lactam antibiotics resistance <400> 8 ggcgatgagc gaaatgtagt gc 22 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for AmpC gene, beta-lactam antibiotics resistance <400> 9 gaccgttacg ccgctgatga a 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for AmpC gene, beta-lactam antibiotics resistance <400> 10 tgacaggcaa gcagtggcag g 21 <210> 11 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for PBP2B gene, wild type, penicillins resistance <400> 11 ttgttccagg ttcggttgtc aa 22 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for PBP2B gene, mutant type, penicillins resistance <400> 12 aattggcata tggatctttt cctat 25 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for PBP1A gene, wild type, penicillins resistance <400> 13 taactgggat aggggctact ttggc 25 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for PBP1A gene, mutant type, penicillins resistance <400> 14 ggacgatgcc agacggactt 20 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for gyrA gene, wild type, quinolone resistance <400> 15 ggtatttacc catgacatcc cct 23 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for gyrA gene, mutant type, quinolone resistance <400> 16 ggtatttacc catgacattc cct 23 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for parC gene, wild type, quinolone resistance <400> 17 tccacccaca cggggattct tc 22 <210> 18 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for parC gene, mutant type, quinolone resistance <400> 18 tccacccaca cggggatttt tc 22 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for parC gene, mutant type, quinolone resistance <400> 19 tccacccaca cggggattat tc 22 <210> 20 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for parE gene, wild type, quinolone resistance <400> 20 aaggccaaga tggcggatat cctc 24 <210> 21 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for parE gene, mutant type, quinolone resistance <400> 21 aaggccaaga tggcggatgt cctc 24 <210> 22 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for qnrA gene, quinolone resistance <400> 22 ggggctgtga cctaaccttt gc 22 <210> 23 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for qnrA gene, quinolone resistance <400> 23 atcggcaaag gttaggtcac agc 23 <210> 24 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for qnrB gene, quinolone resistance <400> 24 agtcgtgcga tgctgaaaga tg 22 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for qnrB gene, quinolone resistance <400> 25 ttttcgccaa cgagtgccag 20 <210> 26 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for qnrS gene, quinolone resistance <400> 26 tgcccatcaa gtgagtaatc gtat 24 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for qnrS gene, quinolone resistance <400> 27 aggttcgttc ctatccagcg 20 <210> 28 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for ermA gene, macrolides resistance <400> 28 aaatgagtca acgggtgaat gcta 24 <210> 29 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for ermA gene, macrolides resistance <400> 29 atttttcggg tttttctgtt tcat 24 <210> 30 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for ermB gene, macrolides resistance <400> 30 catcaagcaa tgaaacacgc ca 22 <210> 31 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for ermB gene, macrolides resistance <400> 31 tcaagcaatg aaacacgcca atg 23 <210> 32 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for ermC gene, macrolides resistance <400> 32 tcgtggaata cgggtttgct aa 22 <210> 33 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for ermC gene, macrolides resistance <400> 33 cttttagcaa acccgtattc cac 23 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for mef gene, macrolides resistance <400> 34 atgggcaggg caagcagtat 20 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for mef gene, macrolides resistance <400> 35 gcaatcacag cacccaatac g 21 <210> 36 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for mecA gene, methicillin resistance <400> 36 cgttgcgatc aatgttaccg tagt 24 <210> 37 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for mecA gene, methicillin resistance <400> 37 actacggtaa cattgatcgc aacg 24 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Streptococcus pneumoniae <400> 38 gaagcggatt atcactggcg g 21 <210> 39 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for Streptococcus pneumoniae <400> 39 ggcggttgga atgctgagac 20 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Staphylococcus aureus <400> 40 gccaaccaga ccctacgcca g 21 <210> 41 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Staphylococcus aureus <400> 41 ctggcgtagg gtctggttgg ctc 23 <210> 42 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Haemophilus influenzae <400> 42 ttggcggata ctctgttgct gat 23 <210> 43 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for Haemophilus influenzae <400> 43 cctaatgcga tgttgtattc tggtg 25 <210> 44 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for Bordetella pertussis <400> 44 tagacgacgc ctaccgcacc ct 22 <210> 45 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe for Bordetella pertussis <400> 45 acgacgccta ccgcaccctg at 22 <210> 46 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Moraxella catarrhalis <400> 46 ccaaagatgt gcccaaagag ata 23 <210> 47 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Bordetella pertussis <400> 47 accacatcat tgcccaacag a 21 <210> 48 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for Legionella pneumophila <400> 48 agcgttggcg gacctattgg 20 <210> 49 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Legionella pneumophila <400> 49 ccacttggta atacaacaac gcc 23 <210> 50 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> probe for Mycoplasma pneumoniae <400> 50 caccaccgca acaagggacg 20 <210> 51 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Mycoplasma pneumoniae <400> 51 cgaaccgcct gtaatcatcg tct 23 <210> 52 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Chlamydiae pneumoniae <400> 52 catttgctgg ttctgtcggc tcc 23 <210> 53 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for Chlamydiae pneumoniae <400> 53 actgccgtag atagacctaa cccg 24 <210> 54 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Klebsiella pneumoniae <400> 54 ggacgggtga gtaatgtctg gga 23 <210> 55 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Klebsiella pneumoniae <400> 55 cggcggacgg gtgagtaatg t 21 <210> 56 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Influenza A <400> 56 cccttgttgt tgctgcgagt atc 23 <210> 57 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Influenza A <400> 57 gatactcgca gcaacaacaa ggg 23 <210> 58 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Influenza B <400> 58 tctttcctgg tctttgggct t 21 <210> 59 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Influenza B <400> 59 gtttctcgca caaagcacag agc 23 <210> 60 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for Parainfluenza virus 1 <400> 60 tatgctcctt gcccactgtg aatg 24 <210> 61 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for Parainfluenza virus 1 <400> 61 aactccgctc caaggcgaca ctaa 24 <210> 62 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Parainfluneza virus 2 <400> 62 cacccgttgg gagatgttgc tga 23 <210> 63 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for Parainfluenza virus 2 <400> 63 atgagtccaa ccgaaccaac ccca 24 <210> 64 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Parainfluenza virus 3 <400> 64 ctcattgcca gcatcctttc cgt 23 <210> 65 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for Parainfluenza virus 3 <400> 65 aagtaacctt ccttctgacc ccca 24 <210> 66 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for Respiratory syncytial virus A <400> 66 acggccttgt ttgtggatag tagag 25 <210> 67 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for Respiratory syncytial virus A <400> 67 gtgctctact atccacaaac aaggc 25 <210> 68 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for Respiratory syncytial virus B <400> 68 ttctgggctt cttgttaggt gtagg 25 <210> 69 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for Respiratory syncytial virus B <400> 69 attccagcag aagaacagca gattg 25 <210> 70 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> probe for human metapneumovirus <400> 70 gatcataatc aatcccgcat aaggt 25 <210> 71 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> probe for human metapneumovirus <400> 71 catcccgtat ggtttcatgg ttgt 24 <210> 72 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Adenovirus <400> 72 aaactccctc mctcggctcg g 21 <210> 73 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Adenovirus <400> 73 atggtrggtg cgaggtagcc g 21 <210> 74 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Cytomegalovirus <400> 74 agttytgtcg ggtgctgtgc tgc 23 <210> 75 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> probe for Cytomegalovirus <400> 75 cgggtgctgt gctgctatrt ctt 23 <210> 76 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Herpes simplex virus 1 & 2 <400> 76 cacatcaagg tgggccagcc g 21 <210> 77 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Herpes simplex virus 1 & 2 <400> 77 ctgcggctgg cccaccttga t 21 <210> 78 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Herpes simplex virus 2 <400> 78 tgggactggg tgccgaagcg a 21 <210> 79 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> probe for Herpes simplex virus 2 <400> 79 cggtcgcttc ggcacccagt c 21  

Claims (13)

delete delete delete delete delete delete To a bacterium or virus comprising a DNA oligonucleotide of SEQ ID NOs 5 to 8 and SEQ ID NOs 11 to 29 and SEQ ID NOs 32 to 37 and SEQ ID NOs 42 to 49 and SEQ ID NOs 52 to 75 DNA chips for differentiation of species-specific species and respiratory disease of respiratory diseases caused by upper respiratory tract infection of nasal cold, pharyngitis and laryngitis caused by sinusitis, otitis media and bronchitis and lower respiratory tract infection of pneumonia . To a bacterium or virus comprising a DNA oligonucleotide of SEQ ID NOs 5 to 8 and SEQ ID NOs 11 to 29 and SEQ ID NOs 32 to 37 and SEQ ID NOs 42 to 49 and SEQ ID NOs 52 to 75 PNA chip for pathogen specific discrimination and antibiotic resistance determination of upper respiratory tract infections caused by nasal congestion, pharyngitis and laryngitis caused by sinusitis, otitis media and complications of bronchitis and pneumonia . The upper respiratory tract infection of nasal cold, pharyngitis, laryngitis and associated sinusitis, otitis media and complications of bronchitis and pneumonia, comprising the DNA chip of claim 7 or the PNA chip of claim 8 Diagnostic kit for species-specific discrimination of antibiotics and antibiotic resistance resistance by respiratory diseases. delete delete delete delete

Images