KR101081424B1 - External Skin Composition Containing Extract of Medicinal Plants - Google Patents

External Skin Composition Containing Extract of Medicinal Plants Download PDF

Info

Publication number
KR101081424B1
KR101081424B1 KR1020040097817A KR20040097817A KR101081424B1 KR 101081424 B1 KR101081424 B1 KR 101081424B1 KR 1020040097817 A KR1020040097817 A KR 1020040097817A KR 20040097817 A KR20040097817 A KR 20040097817A KR 101081424 B1 KR101081424 B1 KR 101081424B1
Authority
KR
South Korea
Prior art keywords
extract
skin
igf
cosmetic composition
composition
Prior art date
Application number
KR1020040097817A
Other languages
Korean (ko)
Other versions
KR20060058829A (en
Inventor
최규호
손의동
이소희
이창훈
이병곤
황재성
장이섭
Original Assignee
(주)아모레퍼시픽
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)아모레퍼시픽 filed Critical (주)아모레퍼시픽
Priority to KR1020040097817A priority Critical patent/KR101081424B1/en
Publication of KR20060058829A publication Critical patent/KR20060058829A/en
Application granted granted Critical
Publication of KR101081424B1 publication Critical patent/KR101081424B1/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations

Abstract

본 발명은 지모(Anemarrhenae Rhizoma), 원지(Polygalae Radix), 쇄양(Cynomorii Herba) 및 오수유(Evodiae Fructus) 중 선택된 1종 이상의 추출물을 함유하는 피부 외용제에 관한 것으로서, 인슐린 유사 성장인자-1 (Insulin-like Growth Factor-1; IGF-1)의 생체내 분비를 촉진하여 피부노화와 관련된 여러 인자들을 증진 혹은 억제하여 피부 주름 및 탄력 개선 효과를 나타내어 궁극적으로 피부 노화를 지연시킬 수 있는 부작용이 없는 조성물을 제공한다.
The present invention relates to an external preparation for skin containing at least one extract selected from anemarrhenae Rhizoma, Polygalae Radix, Cynomorii Herba, and Evodiae Fructus, which is an insulin-like growth factor-1. like Growth Factor-1; IGF-1) promotes in vivo secretion of various factors related to skin aging to improve or reduce skin wrinkles and elasticity, which ultimately delays skin aging. to provide.

지모, 원지, 쇄양, 오수유, IGF-1, 성장촉진, 피부노화방지, 주름개선, 탄력개선Hair, base, sessile, sewage, IGF-1, growth promotion, skin aging prevention, wrinkle improvement, elasticity improvement

Description

생약재 추출물을 함유하는 피부 외용제 조성물{External Skin Composition Containing Extract of Medicinal Plants} External Skin Composition Containing Extract of Medicinal Plants             

도 1은 각 추출물의 prolidase 활성 증진에 대한 그래프이다.1 is a graph of the prolidase activity enhancement of each extract.

도 2는 각 추출물의 prolyl-4-hydroxylase에 대한 western blot이다.2 is a western blot for prolyl-4-hydroxylase of each extract.

도 3은 각 추출물의 type I 프로콜라겐 생성 증진에 대한 그래프이다.3 is a graph of type I procollagen enhancement of each extract.

도 4는 각 추출물의 무모생쥐 도포시 주름개선에 대한 replica 분석 결과 그래프이다.Figure 4 is a replica analysis of the results of the wrinkles of the wrinkles when applying the hairless mice of each extract.

도 5는 각 추출물의 혼합물의 무모생쥐 도포시 주름개선에 대한 replica 분석 결과 그래프이다.
5 is a replica analysis result graph for wrinkle improvement when applying the mixture of each hairless mouse.

본 발명은 생체 내 인슐린 유사 성장인자-1 (Insulin-like growth factor-1; 이하 "IGF-1"라 함)의 분비를 촉진하는 조성물에 관한 것으로서, 보다 상세하게는 종래부터 생약재로 쓰여온 지모(Anemarrhenae Rhizoma), 원지(Polygalae Radix), 쇄양(Cynomorii Herba), 오수유(Evodiae Fructus)의 추출물을 1종 이상 함유함으로써 IGF-1의 생체내 분비를 촉진하는 피부 외용제 조성물에 관한 것이다. The present invention relates to a composition for promoting the secretion of insulin-like growth factor-1 (hereinafter referred to as "IGF-1") in vivo, and more specifically, conventionally used as a herbal medicine The present invention relates to an external skin composition for promoting IGF-1 in vivo secretion by containing at least one extract of Anemarrhenae Rhizoma, Polygalae Radix, Cynomorii Herba, Evodiae Fructus.

1950년대 이후로 임상에서 널리 이용되어 온 성장호르몬(Growth hormone, GH)은 뇌하수체와 시상하부에 의해서 분비 및 조절되는 호르몬으로서 191개의 아미노산으로 이루어져 있고 신체의 대부분의 조직과 반응하는데, 특히 간에서 생성되는 IGF-1은 성장호르몬의 생체 내 분비를 제어할 뿐 아니라 성장호르몬과 밀접하게 연결되어 세포의 성장과 분화 및 활성유도에 중요한 역할을 한다고 알려져 있다.Growth hormone (GH), which has been widely used in the clinic since the 1950s, is a hormone secreted and regulated by the pituitary gland and hypothalamus. IGF-1 is known to not only control the secretion of growth hormone in vivo, but is also closely linked to growth hormone, and plays an important role in cell growth, differentiation and induction of activity.

IGF-1은 뼈, 근육, 신경, 혈관, 조직들을 형성하게 하고 손상된 세포의 재생을 도와주며 세포사멸(apoptosis)을 억제한다고 알려져 있다. 또한 뇌하수체의 노화를 지연시키며 혈당안정과 인슐린 저항성을 정상화시키며, 당대사, 단백질대사, 지방대사에 관여하여 세포와 조직의 성장과 분화에 깊숙이 관여하고 있다고 알려져 있다(D.L. Roith. et al., Endocrine Reviews 22(1):53(2001)). 생체내 IGF-1은 주로 간에서 만들어지나 신체 각 조직에서도 또한 자가분비(autocrine)/측분비(paracrine)를 통해서 분비된다고 보고되었는데(D'Ercole AJ. et al., Dev. Biol 1980;75:315), 이것은 성장호르몬과 IGF-1은 밀접하게 관련되어 작용하기도 하지만 각기 독자적으로 반응을 할 수도 있다는 것을 말해준다. 그리고 간에서 만들어지는 IGF-1은 성장호르몬과의 피드백 루프(feedback loop)를 제어하는데 관여하고 각 조직에서 국소적으로 분비되는 IGF-1이 세포의 성장과 분화를 유도한다는 보고가 있다. 이것은 간 특이적 igf-1 유전자 결핍 쥐 모델(liver specific igf-1 gene-deleted mouse model)을 통해 알 수 있었는데, 해당 유전자의 결핍으로 인해 간에 서 분비되어 전신 순환하는 IGF-1 양이 현저하게 감소하였는데도 불구하고 조직의 성장과 분화는 정상적으로 나타났다(sjogren K. et al., Proc Natl Acad Sci 1999;USA 96:7088). 이것은 전신순환을 고려하지 않더라도 국소적으로 IGF-1의 분비를 촉진시켜 세포의 성장 촉진과 활성을 강화시킬 수 있다는 것을 말해준다. IGF-1 is known to help form bones, muscles, nerves, blood vessels and tissues, help regenerate damaged cells and inhibit apoptosis. In addition, it is known to delay aging of the pituitary gland, normalize blood sugar stability and insulin resistance, and be involved in the growth and differentiation of cells and tissues by being involved in glucose metabolism, protein metabolism, and fat metabolism (DL Roith. Et al ., Endocrine Reviews 22 (1): 53 (2001)). In vivo IGF-1 is produced primarily by the liver but has also been reported to be secreted through autocrine / paracrine in body tissues as well (D'Ercole AJ. Et al ., Dev. Biol 1980; 75: 315) This suggests that growth hormone and IGF-1 may be closely related, but each may respond independently. In addition, IGF-1 produced in the liver is involved in controlling the feedback loop with growth hormone, and IGF-1, which is secreted locally in each tissue, has been reported to induce cell growth and differentiation. This could be seen in the liver specific igf-1 gene-deleted mouse model, which significantly reduces the amount of IGF-1 that is secreted from the liver and systemically circulated due to the lack of that gene. Despite this, tissue growth and differentiation were normal (sjogren K. et al., Proc Natl Acad Sci 1999; USA 96: 7088). This suggests that even without systemic circulation, localized growth of IGF-1 can promote cell growth and activity.

한편, IGF-1과 피부와의 관련성에 대한 연구도 다양하게 진행되어 왔다. 세포의 성장과 분화 및 활성인자 유도에 중요한 역할을 하는 IGF-1은 세포주기를 촉진시킴으로써 피부 세포 성장에 중요한 역할을 하며, 진피내 세포외기질(Extracellular matrix;ECM) 성분인 콜라겐, 파이브로넥틴, GAG 합성에 중요한 기능을 하는 TGFβ-1의 발현을 증가시키고(Ghahary A et al, Journal of Cellular Physiology 1998;174:301-309), 진피내 ECM 성분을 분해하는 MMP 효소의 발현을 억제한다고 알려져 있다(Ghahary A et al, Growth Factors, 2000;17(3):167-76). 그리고 콜라겐 섬유구조형성에 중요한 lysyl oxidase, lysyl hydroxylase 및 콜라겐 리사이클링에 작용하는 prolidase 발현도 촉진시키는 것으로 알려져 있다(Reiser K et al, Am J Physiol, 1996;271(3pt2):R696-703). Meanwhile, various studies have been conducted on the relationship between IGF-1 and skin. IGF-1, which plays an important role in cell growth, differentiation and activator induction, plays an important role in skin cell growth by promoting the cell cycle, and collagen and fibronectin, which are extracellular matrix (ECM) components in the dermis. Is known to increase the expression of TGFβ-1, which plays an important role in GAG synthesis (Ghahary A et al , Journal of Cellular Physiology 1998; 174: 301-309) and inhibit the expression of MMP enzymes that degrade ECM components in the dermis. (Ghahary A et al , Growth Factors, 2000; 17 (3): 167-76). In addition, it is known to promote the expression of lysyl oxidase, lysyl hydroxylase and collagen recycling, which are important for collagen fiber structure formation (Reiser K et al , Am J Physiol, 1996; 271 (3pt2): R696-703).

상술한 바와 같이, 생체 내에서 다양하고 중요한 기능을 하는 IGF-1은 성장호르몬과 연결되어 혹은 독자적인 기전을 통해 분비되고 또한 그 작용을 나타냄을 알 수 있다. 또한 성장호르몬과 독립된 IGF-1의 분비는 신체 각 조직의 성장에 직접적으로 혹은 다른 활성인자의 작용을 매개하는 간접적인 기능을 통해 중요하게 관여함을 알 수있다. 따라서, 인체에 안전하면서도 효과적인 IGF-1 분비능을 가진 물질의 확보는 성장촉진, 노화억제의 관점에서 볼 때 중요한 일이라 할 수 있다.As described above, it can be seen that IGF-1, which has various and important functions in vivo, is secreted and exhibits its function in connection with growth hormone or through its own mechanism. In addition, the secretion of IGF-1 independent of growth hormone is important to the growth of each tissue through direct or indirect function of mediating the action of other activators. Therefore, it is important to secure a substance having IGF-1 secretion ability that is safe and effective for the human body in terms of growth promotion and aging inhibition.

본 발명자들은 생체내 IGF-1의 분비를 촉진시키면서 생체 내에서 안전한 천연물질을 계속 연구하여 선별한 결과, 종래부터 생약제로 사용되었던 지모, 원지, 쇄양, 오수유로부터 얻은 추출물이 생체내 IGF-1의 분비를 촉진시킨다는 것을 시험관(In vivo) 연구를 통해 확인하였고, 또한 이러한 특성을 갖고 있는 각 추출물이 노화억제의 효능을 나타내는 것을 확인하였다. 그리고 각 추출물을 포함하는 조성물의 예로써 피부 외용제를 만들어 동물모델에 도포한 결과 피부내 ECM 성분이 강화되어 주름생성이 억제 및 탄력이 증가되는 것을 확인하여 본 발명을 완성하게 되었다. The present inventors continued to study and select safe natural substances in vivo while promoting the secretion of IGF-1 in vivo, and as a result, extracts obtained from conventionally used herbal medicines such as hair, raw paper, stiletto, and filthy milk were extracted from in vivo IGF-1. In vitro studies have confirmed that it promotes secretion, and it was also confirmed that each extract having these characteristics showed the effect of anti-aging. And as an example of the composition comprising each extract and applied to the animal model to the external preparation of the skin as a result of strengthening the ECM components in the skin to confirm that the wrinkle formation and suppression is increased to complete the present invention.

본 발명에서는 IGF-1의 분비를 촉진시키는 효능을 가진 지모, 원지, 쇄양, 오수유 추출물을 제공하고자 한다. In the present invention, it is intended to provide a hair, a base, a stiletto, sewage extract having an effect of promoting the secretion of IGF-1.

또한, 본 발명은 피부의 노화를 지연시키는 효능을 가진 지모, 원지, 쇄양, 오수유 추출물을 제공하고자 한다.
In addition, the present invention is to provide a hair, raw paper, scalpel, sewage extract having an effect of delaying the aging of the skin.

본 발명은 생체 내 인슐린 유사 성장인자-1 (Insulin-like growth factor-1; 이하 “IGF-1"라 함)의 분비를 촉진하는 조성물에 관한 것으로서, 보다 상세하게는 종래부터 생약재로 쓰여온 지모(Anemarrhenae Rhizoma), 원지(Polygalae Radix), 쇄양(Cynomorii Herba), 오수유(Evodiae Fructus)의 추출물을 1종 이상 함유함으로써 IGF-1의 생체내 분비를 촉진하는 피부 외용제 조성물에 관한 것이다. The present invention relates to a composition for promoting the secretion of insulin-like growth factor-1 (hereinafter referred to as "IGF-1") in vivo, and more specifically, conventionally used as a herbal medicine The present invention relates to an external skin composition for promoting IGF-1 in vivo secretion by containing at least one extract of Anemarrhenae Rhizoma, Polygalae Radix, Cynomorii Herba, Evodiae Fructus.                     

본 발명에서 사용하는 지모(Anemarrhenae Rhizoma)는 백합과 식물인 지모(Anemarrhena asphodeloides Bunge)의 땅속줄기로서 폐와 위, 신장에 작용하여 열을 내리고 진액이 부족해지는 것을 촉촉하게 적셔주며 약리작용으로는 해열, 진정, 항균, 혈당량 저하 등이 알려져 있다.Anemarrhenae Rhizoma used in the present invention is a subterranean stem of Anemarrhena asphodeloides Bunge, a liliaceae plant, acting on the lungs, stomach, and kidneys to lower the heat and moisturize the lack of essence. , Sedation, antibacterial, hypoglycemic is known.

원지(Polygalae Radix)는 원지과 식물인 세엽원지(Polygala tenuifolia Willd.)의 뿌리로서 신경쇠약, 심계, 건망, 해수, 불면 등의 치료에 응용되며 약리작용으로는 항균, 자궁수축력 및 긴장도 등의 증가, 항염작용 등이 알려져 있다.Polygalae Radix is the root of Polygala tenuifolia Willd., Which is applied to the treatment of nervous breakdown, heart system, forgetfulness, sea water, insomnia, etc. Anti-inflammatory action is known.

쇄양(Cynomorii Herba)은 쇄양과 식물 다년생 육질기생 초본 쇄양(Cynomorium songaricum Rupr.)의 육질 줄기로서 유정과 양기 부족 및 허리와 무릎의 무력 증상을 개선시키고, 생리불순과 변비에도 효력을 나타내는 것으로 알려져 있다.Cynomorii Herba is a fleshy stem of the herbaceous and perennial herbaceous herbaceous herbaceous cyst ( Cynomorium songaricum Rupr.), Which is known to improve oil and yang deficiency, weakness in the lower back and knee, and to be effective in menstrual irregularities and constipation. .

오수유(Evodiae Fructus)는 운향과 식물 오수유(Evodia rutaecarpa Benth.)의 미성숙 과실로서 거담, 건위, 지통, 고혈압, 습진 등에 사용되며 약리작용으로는 항균, 중추흥분작용, 자궁수축작용 등이 알려져 있다.Evodiae Fructus is an immature fruit of rhyme and plant erectile oil ( Evodia rutaecarpa Benth.). It is used in expectoration, dry stomach, pain , hypertension, eczema, and pharmacological action is known as antibacterial, central excitement, and uterine contraction.

상기 물질에 대한 성장과 피부노화 관련 특허를 살펴본 결과, 지모의 경우 한국 특허공개 제99-0080969호에서 ‘성장호르몬 분비자극 활성을 가지는 수용성지모 추출물 및 그로부터 분리한 성장호르몬 분비촉진 인자’의 내용으로, 원지의 경우는 한국 특허공개 제2000-0038805호에서 다른 물질들과의 조성물 형태로 성장촉진제로서의 특허가 있었으나 이는 뇌하수체 세포를 이용한 실험을 통해 성장호르몬의 양의 증가에 따른 성장촉진을 언급한 것이다. 이는 본 발명에서 제시되는 피부 에서의 직접적인 IGF-1의 발현 촉진과 이를 통한 피부노화 관련인자들의 변화를 통해 구현되는 노화억제 및 성장촉진과는 접근방식이 상이하다고 할 수 있다. 따라서, 본 발명은 직접적 성장인자 생성 촉진을 통한 새로운 피부노화억제 기능을 밝히고 또한 성장촉진물질로서의 가능성을 보여주는 것에 의의를 가질 수 있다.As a result of examining the growth and skin aging-related patents for the substance, in the case of Jimo, Korean Patent Publication No. 99-0080969 describes the contents of 'soluble soluble extract having growth hormone secretion stimulating activity and growth hormone secretion factor isolated therefrom'. In the case of the original paper, Korean Patent Publication No. 2000-0038805 has a patent as a growth accelerator in the form of a composition with other substances. . This can be said that the approach is different from the aging inhibitory and growth promotion implemented through the direct expression of IGF-1 in the skin and changes in skin aging-related factors through the present invention. Therefore, the present invention can be meaningful to reveal a new skin aging inhibitory function through the direct growth factor production promotion and to show the potential as a growth accelerator.

또한, 본 발명은 상기 지모, 원지, 쇄양, 오수유 추출물을 유효성분으로 하나 이상 함유하여 피부노화를 지연시키는 IGF-1 분비 촉진용 피부 외용제 조성물을 제공한다.In another aspect, the present invention provides a skin external preparation composition for promoting IGF-1 secretion by delaying skin aging by containing one or more of the hair, base paper, yangyang, sewage extract as an active ingredient.

본 발명에 의한 지모, 원지, 쇄양, 오수유 추출물은 in vitro 실험 및 in vivo 실험을 근거로 볼 때 피부 외용제 조성물 총 중량에 대하여 0.001∼10 중량%, 바람직하게는 0.01∼5 중량%의 양으로 함유되는 것이 좋다.The hair, base, sesame and sesame oil extract according to the present invention are contained in an amount of 0.001 to 10% by weight, preferably 0.01 to 5% by weight, based on the total weight of the external preparation for skin, based on in vitro and in vivo experiments. It is good to be.

본 발명에 따른 피부 외용제의 제형 형태로는 유연화장수, 영양화장수, 마사지크림, 영양크림, 팩, 젤 또는 피부 점착타입 화장료의 제형을 갖는 화장료 조성물을 들 수 있으며, 또한 로션, 연고, 겔, 크림, 패취 또는 분무제와 같은 경피 투여형의 제형을 들 수 있다. 또한, 각 제형의 외용제 조성물에 있어서, 상기한 필수 성분 이외의 다른 성분들은 기타 외용제의 제형 또는 사용목적 등에 따라 당업자가 어려움 없이 적의 선정하여 배합할 수 있다. 상기 조성물은 피부 주름 방지용 또는 개선용으로 사용된다.Formulation form of the external preparation for skin according to the present invention includes a cosmetic composition having a formulation of a flexible cosmetics, nourishing cosmetics, massage creams, nutrition creams, packs, gels or skin adhesive type cosmetics, and also lotions, ointments, gels, creams Formulations of transdermal dosage forms such as, patches or sprays. In addition, in the external preparation composition of each formulation, other components than the essential components described above can be appropriately selected and blended by those skilled in the art without difficulty according to the formulation or purpose of use of other external preparations. The composition is used for preventing or improving skin wrinkles.

본 발명에서 상기 추출물은 지모, 원지, 쇄양, 오수유에서 선택된 어느 하나 이상을 건조분쇄한 후 95% 에탄올에서 환류가열하여 추출하는 단계, 냉각 후 여과지를 이용하여 여과하는 단계, 여과 후 여과한 여액을 감압 증발기를 사용하여 완 전히 증발시키는 단계를 통하여 추출한다.
In the present invention, the extract is dried, pulverized any one or more selected from jimo, raw paper, yangyang, sewage and extracted by heating under reflux in 95% ethanol, filtering using a filter paper after cooling, filtered filtrate after filtration Extraction is carried out through evaporation using a reduced pressure evaporator.

이하, 실시예 및 시험예를 들어 본 발명의 구성 및 작용효과를 보다 상세하게 설명한다. 그러나, 본 발명이 이들 실시예로만 한정되는 것은 아니다.
Hereinafter, the structure and the effect of the present invention will be described in more detail with reference to Examples and Test Examples. However, the present invention is not limited only to these examples.

[실시예 1] Example 1

지모, 원지, 쇄양, 오수유 추출물의 제조Preparation of Hair, Raw Grass, Ambush and Sewage Extract

지모, 원지, 쇄양, 오수유 각 1kg을 건조분쇄한 후 중량(Kg)비 4배량의 95% 에탄올을 가한 후 80℃에서 2시간 가열하여 유효성분을 추출하였다. 이를 하루동안 상온에서 방치하여 불순물을 침전시킨 후, 여과지를 이용하여 2회 여과한 여액을 감압 증발기를 사용하여 완전히 증발시켜 농축하였다.
After drying and grinding 1kg each of gimo, paper, sediment, and sewage oil, 95% ethanol was added at a weight (Kg) ratio of 4 times and then heated at 80 ° C. for 2 hours to extract the active ingredient. This was allowed to stand at room temperature for 1 day to precipitate impurities, and the filtrate was filtered twice using a filter paper and concentrated by completely evaporating using a reduced pressure evaporator.

[시험예 1] [Test Example 1]

IGF-1 프로모터(promoter) 활성 증진 관찰Enhancement of IGF-1 Promoter Activity

Dr. Peter Rotein (Washington University of medicine)으로부터 기증받은 IGF-1 promoter를 가지고 있는 plasmid를 HEK 293 세포에 transfection 한 후 reporter gene assay를 통하여 사인추출물의 IGF-1 promoter 활성을 관찰하였다. 24-well plate에 105 세포를 넣고 10% 우태아 혈청이 들어있는 DMEM 배지에서 24시간동안 배양한 후 실시예 1에서 제조한 각 추출물을 1ppm, 10ppm의 농도로 처리하 였다. 24시간 후에 PBS로 세척한 후 세포를 파쇄하여 상징액을 얻었다. 이어 Promega 사에서 제조 판매하는 Dual-LuciferaseR Reporter Assay System kit를 사용하여 실시예 1에서 제조한 각 추출물을 처리한 샘플과 동일한 조성에 추출물만을 처리하지 않은 음성대조군의 루시페라아제 활성(luciferase activity)을 측정하여 하기 표 1에 나타내었다. 그 결과 각 추출물은 음성대조군에 비하여 높은 IGF-1 promoter 활성을 가지는 것을 확인하였다.Dr. After transfection of HEK 293 cells with plasmid containing IGF-1 promoter donated by Peter Rotein (Washington University of Medicine), IGF-1 promoter activity was observed by reporter gene assay. 10 5 cells were added to a 24-well plate and incubated in DMEM medium containing 10% fetal bovine serum for 24 hours, and each extract prepared in Example 1 was treated at a concentration of 1 ppm and 10 ppm. After 24 hours, washed with PBS, cells were disrupted to obtain a supernatant. Subsequently, luciferase activity of the negative control group not treated with the extract only in the same composition as the sample treated with the extract prepared in Example 1 using the Dual-Luciferase R Reporter Assay System kit manufactured by Promega was measured. It is shown in Table 1 below. As a result, each extract was confirmed to have higher IGF-1 promoter activity than the negative control group.

[표 1]TABLE 1

Figure 112004055462886-pat00001

Figure 112004055462886-pat00001

[시험예 2] [Test Example 2]

RT-PCR를 이용한 IGF-1 mRNA 발현양 관찰IGF-1 mRNA expression level using RT-PCR

인체 섬유아세포를 100 mm-Dish 에 105개의 농도로 넣은 후 10% 우태아 혈청이 들어있는 DMEM 배지에서 배양한 후, 상기 네가지 추출물을 10ppm 포함한 배지로 교체하였다. 배양 8시간째 세포로부터 total RNA를 얻은 후 First strand cDNA synthesis kit (MBI Fermentas)을 이용하여 cDNA를 합성하였고 이어 human IGF-1 primer (Forward-GACAGGGGCTTTTATTTCAAC, Reverse- CTCCAGCCTCCTTAGATCAC)를 이용하여 94℃ 1min, 57℃ 1min, 72℃ 1min의 반응조건으로 35사이클을 수행하여 human IGF-1 밴드를 얻었다. 그 결과를 표 2에 나타내었다. 표 2에 나타낸 것처럼 음성대조군에 비해 상대적인 IGF-1 mRNA 발현양이 증가함을 알 수 있었는데, 이 결과를 통해 각 추출물은 IGF-1 분비 촉진능을 가짐을 알 수 있다.Human fibroblasts were placed in 100 mm-Dish at a concentration of 10 5 and then cultured in DMEM medium containing 10% fetal calf serum, and the four extracts were replaced with a medium containing 10 ppm. After 8 hours of culture, total RNA was obtained from the cells, and then cDNA was synthesized using a first strand cDNA synthesis kit (MBI Fermentas), followed by 94 ° C 1min, 57 using a human IGF-1 primer (Forward-GACAGGGGCTTTTATTTCAAC, Reverse-CTCCAGCCTCCTTAGATCAC). 35 cycles were carried out under the reaction conditions of 1 min at 72 ° C. and 1 min at 72 ° C. to obtain a human IGF-1 band. The results are shown in Table 2. As shown in Table 2, it was found that the relative amount of IGF-1 mRNA expression was increased compared to the negative control group, and through this result, each extract has an ability to promote IGF-1 secretion.

[표 2]TABLE 2

Figure 112004055462886-pat00002

Figure 112004055462886-pat00002

[시험예 3] [Test Example 3]

프로릴데이즈(prolidase) 활성 증진 관찰Enhancement of Prolidase Activity

인체 섬유아세포를 100mm-dish에 106 개의 농도로 넣은 후 10% 우태아 혈청이 들어있는 DMEM 배지에서 37℃로 배양한 후, 실시예 1에서 제조한 각 추출물을 1ppm, 10ppm 포함한 배지로 교체하였다. 배양 24시간 후 세포를 얻어서 Myara의 prolidase 활성 측정법(Myara et al, Clin. Chim. Acta 125, 1982)에 따라 각 시험군의 효소활성 변화를 측정한 후 음성대조군과 비교하였고 그 결과를 도 1에 나타내었다. 실시예 1에서 제조한 각 추출물을 처리한 샘플은 음성대조군과 비교했을 때 높은 효소활성을 보였다. Prolidase는 세포내에서 콜라젠 합성에 중요한 아미노 산인 프롤린의 재공급 기능을 하는 효소로 알려져 있어 당 효소의 활성 증가는 콜라겐 합성 증가와 밀접하게 관련이 있는 것으로 알려져 있으므로 피부 주름개선에 중요하게 작용할 것으로 보인다.
Human fibroblasts were placed in 100 mm-dish at a concentration of 10 6 and incubated at 37 ° C. in DMEM medium containing 10% fetal bovine serum, and each extract prepared in Example 1 was replaced with a medium containing 1 ppm and 10 ppm. . After 24 hours of culture, the cells were obtained and the change of enzyme activity of each test group was measured according to the prolidase activity measurement method of Myara (Myara et al, Clin. Chim. Acta 125, 1982), and compared with the negative control group. Indicated. Samples treated with each extract prepared in Example 1 showed high enzymatic activity as compared to the negative control. Prolidase is known to be an enzyme that acts as a reproducing function of proline, an amino acid that is important for collagen synthesis in the cell. Therefore, the increase of glycoenzyme activity is known to be closely related to the increase in collagen synthesis.

[시험예 4] [Test Example 4]

prolyl-4-hydroxylase (P4H) 생성 증가 관찰increased production of prolyl-4-hydroxylase (P4H)

인체 섬유아세포를 100mm-dish에 106 개의 농도로 넣은 후 10% 우태아 혈청이 들어있는 DMEM 배지에서 37℃로 배양한 후, 실시예 1에서 제조한 각 추출물을 1ppm, 10ppm 포함한 배지로 교체하였다. 배양 48시간 후 세포를 파쇄하여 단백질 얻은 후 전기영동하여 P4H에 특이적인 항체를 이용하여 western blot을 실시하였고 그 결과를 도 2에 나타내었다. 실험결과 vehicle을 처리한 대조군에 비해 발현양이 증가한 것으로 보아 각 추출물은 P4H 발현 증가에 영향을 주는 것으로 생각된다. P4H는 세포내에서 프로콜라겐의 프롤린 잔기에 수산화기를 붙임으로써 이후 올바른 3차 구조 형성에 관여하는 콜라겐 생성의 율속효소로서 작용하므로 당 효소의 생성 증가는 피부 주름개선에 중요한 기여를 할 것으로 생각된다.
Human fibroblasts were placed in 100 mm-dish at a concentration of 10 6 and incubated at 37 ° C. in DMEM medium containing 10% fetal bovine serum, and each extract prepared in Example 1 was replaced with a medium containing 1 ppm and 10 ppm. . After 48 hours of culture, cells were disrupted to obtain proteins, followed by electrophoresis, and western blot was performed using an antibody specific for P4H. The results are shown in FIG. 2. As a result of the experiment, the expression level was increased compared to the control group treated with the vehicle, and each extract was considered to influence the increase of P4H expression. Since P4H attaches hydroxyl groups to proline residues of procollagen in the cell, it acts as a rate of collagen production rate that is involved in the formation of correct tertiary structure. Therefore, increased production of sugar enzymes may contribute to skin wrinkle improvement.

[시험예 5] [Test Example 5]

피부세포의 콜라겐 생합성 효능 측정Measurement of Collagen Biosynthesis Efficacy of Skin Cells

인체 섬유아세포를 24-well plate에 104 개의 농도로 넣은 후 10% 우태아 혈 청이 들어있는 DMEM 배지에서 배양한 후, 실시예 1에서 제조한 각 추출물을 1ppm, 10ppm 포함한 배지로 교체하였다. 배양 48시간 후 상징액을 수확해서 ELISA (Takara MK101) 방법을 사용하여 생성된 프로콜라겐의 양을 정량하였고 그 결과, 대조군을 100으로 한 비교치를 도 3에 나타내었다. 그 결과, 실시예 1에서 제조한 각 추출물이 타입 I 콜라겐 생합성을 증가시킴을 알 수 있었다. 이는 각 추출물이 피부노화 개선에 효과를 나타내는 것으로 보인다.
Human fibroblasts were placed in a 24-well plate at a concentration of 10 4 and then cultured in DMEM medium containing 10% fetal bovine serum, and then each extract prepared in Example 1 was replaced with a medium containing 1 ppm and 10 ppm. After 48 hours of culture, the supernatant was harvested, and the amount of procollagen produced was quantified using the ELISA (Takara MK101) method. As a result, a comparison value of the control 100 was shown in FIG. 3. As a result, it was found that each extract prepared in Example 1 increased type I collagen biosynthesis. It seems that each extract is effective in improving skin aging.

[시험예 6] [Test Example 6]

자외선에 의한 타입 I 콜라게나제(MMP-1)의 생합성 억제능 관찰Inhibition of Biosynthesis of Type I Collagenase (MMP-1) by UV Light

인체 섬유아세포를 24-well plate에 104 개의 농도로 넣은 후 10% 우태아 혈청이 들어있는 DMEM 배지에서 37℃로 배양한 후, 실시예 1에서 제조한 각 추출물을 1ppm, 10ppm 포함한 배지로 교체하였다. 배양 48시간 후 상징액을 수확해서 ELISA(AP biotech RPN2610) 방법을 사용하여 생성된 타입 I 콜라게나제의 양을 정량하였고, 아무것도 처리하지 않은 대조군을 100으로 하여 측정한 비교치를 표 3에 나타내었다. 실험 결과, 실시예 1에서 제조한 각 추출물이 자외선에 의한 타입 I 콜라게나제의 생합성을 감소시킴을 알 수 있었고 이는 각 추출물이 피부기질의 분해를 효과적으로 막아주어 피부 주름개선에 기여할 수 있을 것으로 보인다. Human fibroblasts were placed in a 24-well plate at a concentration of 10 4 , incubated at 37 ° C. in DMEM medium containing 10% fetal bovine serum, and each extract prepared in Example 1 was replaced with a medium containing 1 ppm and 10 ppm. It was. After 48 hours of culture, the supernatant was harvested to quantify the amount of type I collagenase produced using ELISA (AP biotech RPN2610) method. As a result, it can be seen that each extract prepared in Example 1 reduces the biosynthesis of type I collagenase by UV rays, which can effectively prevent the decomposition of skin substrates and contribute to skin wrinkle improvement. .

[표 3][Table 3]

Figure 112004055462886-pat00003

Figure 112004055462886-pat00003

[시험예 7] [Test Example 7]

동물모델을 이용한 주름개선 효과 확인Confirmation of wrinkle improvement effect using animal model

피부에서 실시예 1의 추출물들의 피부 주름개선 효능을 알아보기 위해서 약 7주령의 무모생쥐(SKH-1 female hairless mouse)를 이용하여 도포시험을 실시하였다. 시험에 사용하기 위하여 하기 표 4와 같이 제조한 각 추출물을 함유하는 크림 제형예 1∼4를 제조하여 시료로 사용하였고, 대조군으로 사용되는 시험군으로는 상기 추출물 중 어느것도 함유하지 않은 크림 비교제형예 1을 만들어 같은 용량으로 처리하였다. 각 구성성분의 함량은 중량%이다. In order to determine the skin wrinkle improvement effect of the extracts of Example 1 in the skin, the application test was carried out using about 7 weeks old hairless mouse (SKH-1 female hairless mouse). Cream formulations 1 to 4 containing each extract prepared as shown in Table 4 for use in the test were prepared and used as a sample, and the test group used as a control group did not contain any of the extracts. Example 1 was made and treated at the same dose. The content of each component is weight percent.                     

[표 4][Table 4]

Figure 112004055462886-pat00004
Figure 112004055462886-pat00004

표 4에서와 같이 시험물질을 조제하여 무모생쥐의 등부위에 자외선조사와 함께 11주간 도포하였다. 자외선 조사는 격일로, 물질도포는 매일 진행하였고 이후 replica 주름 분석방법을 통해 주름개선 효과를 확인하였다. 도 4에서 볼 수 있듯이 분석결과 네가지 추출물 모두 주름개선 효과가 있음을 알 수 있었다.As shown in Table 4, test materials were prepared and applied to the back of the hairless mice for 11 weeks with UV irradiation. Ultraviolet irradiation was carried out every other day, and the material was applied every day. Afterwards, the effect of wrinkle improvement was confirmed by replica wrinkle analysis. As can be seen in Figure 4, the analysis results showed that all four extracts have an anti-wrinkle effect.

또한 표 5와 같이 네가지 추출물의 혼합물 형태로 크림제형을 만든 후 무모생쥐를 이용하여 상기와 같은 시험방법으로 주름개선 효과를 확인하였다. 자외선 조사와 물질도포 및 분석방법은 동일하게 진행하였다. 도 5에서 볼 수 있듯이 네가 지 추출물 모두를 도포했을 때 주름개선 효과가 가장 좋았음을 알 수 있었다.
In addition, after making the cream formulation in the form of a mixture of four extracts as shown in Table 5, the effect of wrinkle improvement was confirmed by the same test method using the hairless mice. Ultraviolet irradiation, material application and analysis were performed in the same way. As can be seen in Figure 5 it can be seen that the wrinkle improvement effect was the best when all four extracts were applied.

[표 5]TABLE 5

Figure 112004055462886-pat00005

Figure 112004055462886-pat00005

이와 같이, 상기 시험예 2 내지 시험예 7의 결과로 볼 때, 본 발명에서 제조한 지모, 원지, 쇄양, 오수유 추출물이 피부노화와 관련된 여러 지표인자를 효과적으로 조절함으로써 피부노화를 지연시킬 수 있음을 확인하였다.As described above, according to the results of Test Examples 2 to 7, the hair, raw paper, yangyang, sewage extract prepared in the present invention can delay skin aging by effectively controlling various indicator factors related to skin aging. Confirmed.

따라서, 본 발명에 의한 지모, 원지, 쇄양, 오수유 추출물을 함유하는 피부 외용제 조성물은 세포내에서 IGF-1의 발현을 증가시키고 이것은 콜라겐 생성에 중 요하게 작용하는 prolidase와 prolyl-4-hydroxylase의 활성과 생성을 증가시켜 콜라겐 합성을 촉진시키고 궁극적으로는 피부 노화억제에 기여하는 것으로 판단된다.
Therefore, the composition for external application of the skin containing the hair, raw paper, stiletto and sesame oil extracts according to the present invention increases the expression of IGF-1 in cells, which is associated with the activity of prolidase and prolyl-4-hydroxylase, which are important for the production of collagen. Increasing production promotes collagen synthesis and ultimately contributes to skin aging.

이상에서 살펴본 바와 같이, 본 발명에 의한 지모, 원지, 쇄양, 오수유 추출물 및 피부 외용제 조성물은 IGF-1의 생체내 분비를 촉진하였다. 또한 본 발명에서 제조한 피부 외용제 조성물은 생약제로 알려진 지모, 원지, 쇄양, 오수유 추출물을 하나이상 유효성분으로 함유하고 있으므로 인체에 안전성을 가지며, 피부노화와 관련된 여러 인자들을 증진 혹은 억제하여 주름 개선 및 탄력 개선 효과를 나타내어 궁극적으로 피부 노화를 지연시키는 것으로 생각된다. 또한 본 발명에 의한 각 추출물은 유효성분으로 하나이상을 함유하여 노화억제 및 성장촉진 효과를 지닌 조성물 제조에 사용될 수 있다.As described above, the hair, base paper, stingray, sesame oil extract and external skin composition according to the present invention promoted the in vivo secretion of IGF-1. In addition, the external preparation composition for skin used in the present invention contains one or more active ingredients of hair, raw paper, yangyang and sesame oil extracts known as herbal medicines, thus having safety to the human body and improving or inhibiting various factors related to skin aging to improve wrinkles and It is thought to exhibit an elasticity improvement effect and ultimately delay skin aging. In addition, each extract according to the present invention can be used to prepare a composition having one or more as an active ingredient with anti-aging and growth promoting effect.

Claims (6)

쇄양, 오수유 또는 이 둘의 혼합 추출물을 함유하는 인슐린 유사 성장인자(IGF-1) 분비 촉진을 특징으로 하는 피부 외용제 화장료 조성물.A skin external preparation cosmetic composition characterized by promoting the secretion of insulin-like growth factor (IGF-1) containing sessile sheep, sessile oil or a mixed extract of both. 제1항에 있어서, The method of claim 1, 상기 추출물은 조성물 총 중량에 대하여 0.001∼10 중량%로 함유되는 것을 특징으로 하는 피부 외용제 화장료 조성물. The extract for external application cosmetic composition, characterized in that contained in 0.001 to 10% by weight relative to the total weight of the composition. 제 1항에 있어서, The method of claim 1, 상기 조성물은 피부 주름 방지용 또는 개선용임을 특징으로 하는 피부 외용제 화장료 조성물.The composition for external application cosmetic composition for skin wrinkle prevention or improvement. 제 1항에 있어서, The method of claim 1, 상기 추출물은 지모, 원지 또는 이 둘의 혼합 추출물이 더 혼합된 것을 특징으로 하는 피부 외용제 화장료 조성물.The extract is a cosmetic composition for external application to the skin, characterized in that the mixed extract of the hair, base paper or both. 제 1항에 있어서, The method of claim 1, 상기 추출물은 The extract is (a) 쇄양, 오수유 또는 이 둘의 혼합을 건조분쇄한 후 95% 에탄올에서 환류 가열하여 추출하는 단계; (a) dry grinding the amount of sewage, sewage oil or a mixture of the two and extracting by heating under reflux in 95% ethanol; (b) 상기 단계(a)에서의 추출물을 냉각 후 여과지를 이용하여 여과하는 단계; 및 (b) filtering the extract in step (a) using a filter paper after cooling; And (c) 상기 단계(b)에서 여과된 여액을 감압 증발기를 사용하여 완전히 증발시키는 단계; 를 포함하여 추출되는 것을 특징으로 하는 피부 외용제 화장료 조성물.(c) completely evaporating the filtrate filtered in step (b) using a reduced pressure evaporator; Skin external preparation cosmetic composition characterized in that it is extracted. 제 5항에 있어서,The method of claim 5, 상기 추출물은 지모, 원지 또는 이 둘의 혼합 추출물이 더 혼합된 것을 특징으로 하는 피부 외용제 화장료 조성물.The extract is a cosmetic composition for external application to the skin, characterized in that the mixed extract of the hair, base paper or both.
KR1020040097817A 2004-11-26 2004-11-26 External Skin Composition Containing Extract of Medicinal Plants KR101081424B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020040097817A KR101081424B1 (en) 2004-11-26 2004-11-26 External Skin Composition Containing Extract of Medicinal Plants

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020040097817A KR101081424B1 (en) 2004-11-26 2004-11-26 External Skin Composition Containing Extract of Medicinal Plants

Publications (2)

Publication Number Publication Date
KR20060058829A KR20060058829A (en) 2006-06-01
KR101081424B1 true KR101081424B1 (en) 2011-11-08

Family

ID=37156203

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020040097817A KR101081424B1 (en) 2004-11-26 2004-11-26 External Skin Composition Containing Extract of Medicinal Plants

Country Status (1)

Country Link
KR (1) KR101081424B1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016007601A1 (en) * 2014-07-11 2016-01-14 Mary Kay Inc. Pore minimizer
KR20200011804A (en) * 2018-07-25 2020-02-04 (주)옥천당 Composition for prevention or improvement of muscular fuctions comprising extract of evodiaefructus and use therof

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6320034B2 (en) * 2013-12-26 2018-05-09 日本メナード化粧品株式会社 Sebum synthesis accelerator
KR101689318B1 (en) * 2015-01-08 2016-12-23 부산대학교 산학협력단 Compositions for prevention or treatment of skin-aging comprising Evodiamine
KR101964837B1 (en) * 2016-02-17 2019-04-03 강원대학교산학협력단 Composition for improving skin wrinkle comprising Cynomorium songaricum extract or its fraction as effective component

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100422419B1 (en) * 2001-09-26 2004-03-11 코스맥스 주식회사 Whitening cosmetic composition containing herb extracts
KR100451387B1 (en) * 2001-10-29 2004-10-06 주식회사 나우코스 Cosmetic compositions containing Polygala tenuifolia Willd, Platycodon grandiflorum and Centella asiatica extract

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100422419B1 (en) * 2001-09-26 2004-03-11 코스맥스 주식회사 Whitening cosmetic composition containing herb extracts
KR100451387B1 (en) * 2001-10-29 2004-10-06 주식회사 나우코스 Cosmetic compositions containing Polygala tenuifolia Willd, Platycodon grandiflorum and Centella asiatica extract

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016007601A1 (en) * 2014-07-11 2016-01-14 Mary Kay Inc. Pore minimizer
US10251833B2 (en) 2014-07-11 2019-04-09 Mary Kay Inc. Pore minimizer
US11033487B2 (en) 2014-07-11 2021-06-15 Mary Kay Inc. Pore minimizer
US11833243B2 (en) 2014-07-11 2023-12-05 Mary Kay Inc. Pore minimizer
KR20200011804A (en) * 2018-07-25 2020-02-04 (주)옥천당 Composition for prevention or improvement of muscular fuctions comprising extract of evodiaefructus and use therof
KR102188013B1 (en) 2018-07-25 2020-12-07 (주)옥천당 Composition for prevention or improvement of muscular fuctions comprising extract of evodiaefructus and use therof

Also Published As

Publication number Publication date
KR20060058829A (en) 2006-06-01

Similar Documents

Publication Publication Date Title
ES2702388T3 (en) Peptides derived from the WNT family and uses of these
JP2002538802A (en) Food supplement and method for cosmetic treatment based on grape extract rich in polyphenols
JP2006524236A (en) Slimming composition
WO2006000226A1 (en) Compositions suitable for treating cutaneous signs of aging
CN107308020B (en) Stable polypeptide composition and application thereof
CN103347531A (en) Skin collagen production promoter
JP2010001282A (en) Isothiocyanate-containing composition, food, foodstuff, medicine, cosmetic, daily necessary and miscellaneous good
KR101081424B1 (en) External Skin Composition Containing Extract of Medicinal Plants
KR20090064743A (en) Composition of the skin external application or the food for accelerating proline recycling containing theanine
KR20030024932A (en) Cosmetic composition containing centella asiatica extracts
KR101798632B1 (en) Cosmetic composition containing stellera chamaejasme extract or fraction thereof and use thereof
CN103269707A (en) Skin collagen production-romoting agent
KR20100031839A (en) Skin external composition containing tussilago farfara and hibiscus mutabilis flower extract
CN113633585B (en) External hair care composition and preparation with effects of preventing alopecia, promoting hair growth and blackening hair and preparation method thereof
KR20030062605A (en) Hair growth compositions using natural fermentation extract of herbs
KR20200021709A (en) Melanocyte migration promoting composition comprising asparagus extract
JP2016079154A (en) Skin cosmetic, hair cosmetic, and food and drink
KR101375783B1 (en) Composition for preventing and treating vitiligo
WO2018021847A1 (en) Composition for preventing hair loss or stimulating hair growth, containing amla extract
KR100619437B1 (en) A composition for external applications to the skin and health supplement foods containing Amomi Semen extract for promoting the secretion of IGF-1
KR102010345B1 (en) Cosmetic materials composition having inhibitor of skin photo-aging and regeneration of skin wound-cell, Cosmetic materials using the same and Manufacturing method thereof
KR20100000391A (en) Neurocosmetic skin care method, method for screening skin cosmetic material, and skin cosmetic material
WO2015141926A1 (en) Composition for inhibiting or alleviating skin aging caused by stress stimulation, containing trapa japonica as active ingredient
KR101778654B1 (en) Use of Dihydrodehydrodiisoeugenol and preparations comprising Dihydrodehydrodiisoeugenol
JP5798294B2 (en) Collagen gel shrinking agent

Legal Events

Date Code Title Description
N231 Notification of change of applicant
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20151030

Year of fee payment: 5

FPAY Annual fee payment

Payment date: 20161010

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20181002

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20190926

Year of fee payment: 9