KR101012590B1 - A corynebacterium having enhanced L-lysine productivity and a method of producing L-lysine using the corynebacterium - Google Patents

Abstract

The present invention relates to a microorganism of the genus Corynebacterium with improved lysine production, and preferably a regulatory gene for regulating a gene encoding aspartate kinase (lysC) and a gene encoding dihydrodipicolinate synthase (dapA). The present invention relates to a microorganism of the genus Corynebacterium, in which the activity of phosphorus aspR is reduced or destroyed, and a method for producing lysine using the microorganism.

L-lysine, Corynebacterium, aspR, lysC, dapA

Description

A corynebacterium having enhanced L-lysine productivity and a method of producing L-lysine using the corynebacterium

The present invention relates to a microorganism of the genus Corynebacterium with improved lysine production, and preferably a regulatory gene for regulating a gene encoding aspartate kinase (lysC) and a gene encoding dihydrodipicolinate synthase (dapA). The present invention relates to a microorganism of the genus Corynebacterium, in which the activity of phosphorus aspR is reduced or destroyed, and a method for producing lysine using the microorganism.

Microorganisms of the genus Corynebacterium are traditionally the most widely used microorganisms for the production of amino acids and nucleic acid-related substances, mainly L-lysine, L-threonine, L-arginine, It is a Gram-positive bacterium used to produce chemicals having various uses in fields such as feed, pharmaceuticals and foods including amino acids such as L-threonine and glutamic acid and various nucleic acids, and requires biotin for growth. It has a characteristic that it bends at right angles during cell division, and its low degradation activity on the generated metabolite is one of the advantages of this bacterium.

L-lysine is one of L-amino acids and is used commercially as a feed supplement for animals due to its ability to improve the quality of feed by increasing the absorption of other amino acids, and especially in human medicine as a component of injectable solutions. It is used in the pharmaceutical industry. Therefore, industrial production of lysine has become an economically important industrial process.

As a method for improving the production efficiency of lysine, a corynebacterium strain enriched in lysine biosynthesis-related genes and a L-lysine production method using the same have been known (US Pat. No. 6,746,855, US Pat. No. 6,221,636). In addition, as a method of enhancing lysine biosynthesis-related genes without antibiotic resistance sequences, it has been reported to increase the copy number of genes and to increase enzyme activity by mutation.

Another method is to enhance by manipulation of genes that regulate the transcription of lysine biosynthesis related genes. Regulatory genes come in two forms: activation regulators and inhibition regulators. Activation control parameters can be used a method of enhancing the active through the amplifier, control parameters can be inhibited through the method of the deletion enhancing the activity is used (Functional determinants of transcription factors in Escherichia coli: protein families and binding sites , Robert Hoffmann. TRENDS in Genetics Vol. 19 75-79, 2003). Enhancing lysine biosynthesis genes through manipulation of regulatory genes has several advantages over existing methods. First, there is no modification of the lysine biosynthetic gene, so it does not affect activity. Second, the method of increasing the copy number of genes is unstable because the number of copies is easily reduced due to the interaction of homologous sites, but the manipulation through the deletion of regulatory genes is relatively stable. Third, lysine biosynthesis genes can achieve the desired effect when a plurality of genes are continuously manipulated, but regulatory genes can have the same effect with only one genetic manipulation.

On the other hand, it is well known that the lysC gene plays an important role in Corynebacterium in lysine biosynthesis, and lysC genes are regulated at the transcription level as a result of comparing transcripts using DNA chips of lysine and wild strains. A leuC mutation leading to increased L-lysine production and rel-independent global expression changes in Corynebacterium. glutamicum ., Masato Ikeda, Appl Microbiol Biotechnol 72: 783-789, 2006). In addition, there have been no reports of enhancing the lysine biosynthesis gene by manipulating the regulatory gene, since no studies have been made on the regulatory proteins that regulate lysine biosynthesis genes, particularly the lysC gene and dapA gene, in Corynebacterium.

Accordingly, the present inventors have conducted extensive research on the production method of L-lysine which can lower the production cost and increase the yield in producing L-lysine using the Corynebacterium strain, and as a result, Coryne The present invention has been accomplished by discovering that the destruction of aspR in bacterium strains can improve the productivity of L-lysine producing microorganisms.

One object of the invention to provide an improved aspR gene is Corynebacterium (Corynebacterium) in microbial production ability, lysine, characterized in that the reduced compared to the intrinsic regulatory activity.

Another object of the present invention is to provide a method for producing L-lysine, comprising culturing the microorganism and recovering L-lysine from the culture solution.

In order to achieve the above object, the present invention as one embodiment is directed to improved Corynebacterium (Corynebacterium) in lysine-producing ability microorganism, characterized in that the aspR gene is reduced relative to the intrinsic regulatory activity.

The aspR gene is a gene whose nucleic acid sequence is already known to the National Institutes of Health gene bank NIH GenBank under NCBI accession numbers NC_003450 and NCgl2886 (SEQ ID NO: 15), but its function is unknown. The inventors of the present invention first identified that the gene is a gene encoding a transcriptional regulatory protein that binds to the promoter regions of the lysC and dapA genes and regulates the transcription of lysC and dapA and named it aspR, hereinafter referred to as asPR. do.

We have demonstrated that aspR is a transcriptional regulator protein in the following manner.

Specifically, lysine biosynthesis genes aspB (gene encoding aspartate aminotransferase), lysC (gene encoding aspartate kinase), asd (gene encoding aspartate semialdehyde dehydrogenase), dapA ( Wild lines and lysine for genes encoding dehydrodipicolinate synthase), dapB (gene encoding dihydrodipicolinate reductase) and lysA (gene encoding diaminodipimelate decarboxylase) As a result of using DNA chips to compare the transcriptional regulation of production strains, it was confirmed that only lysC, dapA and lysA genes were enhanced in mRNA level compared to wild strains. This suggests that the genes are being regulated at the level of transcription and that there is a corresponding regulatory gene.

Thus, using 300 to 500 base pairs of DNA of the promoter regions of the lysC and dapA genes, the present inventors searched for a regulatory protein that binds to the specific DNA.

Specifically, the regulatory protein that regulates a specific gene was searched for by using a property of transcription level regulatory gene binding to a specific DNA. First, the lysC gene and dapA gene DNA were amplified by PCR using biotin-labeled primers, and then attached to a material coated with streptabin on the agarose surface. Since biotin and streptabin have strong binding properties, specific DNA is labeled on the surface of agarose by connecting streptabin and biotin on the surface of agarose. By mixing the whole protein solution extracted from Corynebacterium, the proteins that bind to the lysC gene and dapA gene DNA are combined to separate the proteins that bind to the lysC gene and dapA gene DNA. The separated protein can be separated by size using SDS-PAGE and identified using a mass spectrometer.

As a result of this study, the gene aspR (SEQ ID NO: 15), which encodes a transcriptional regulatory protein that binds to the promoter regions of the lysC and dapA genes, was found.

In the present invention, the intrinsic regulatory activity refers to the active state of the enzyme that the microorganism of Corynebacterium in its natural state, specifically, to control the lysC and dapA naturally possessed by the microorganism of Corynebacterium It means activity. AspR is a regulatory gene that inhibits the expression of the regulatory form, thereby reducing the regulatory activity of aspR, thereby enhancing the expression of lysC and dapA of the microorganism, resulting in increased lysine productivity.

Preferably, the present invention reduces the activity of aspR by genetic engineering such as deletion, substitution or insertion of the microorganism of the genus Corynebacterium contained in the aspR gene having the nucleotide sequence of SEQ ID NO: 15, more preferably, By introducing a recombinant vector pDZ-aspR having a cleavage map of 1, the activity of aspR is disrupted to provide a microorganism of the genus Corynebacterium with improved lysine production capacity. Insertion of the gene into the chromosome can be by any method known in the art, eg, homologous recombination.

Corynebacterium strains used in the present invention may include any microorganism of the genus Corynebacterium. For example, in the Corynebacterium microorganism, Corynebacterium glutamicum ATCC13032, Corynebacterium glutamicum, Corynebacterium thermoaminogenes amino to Ness (thermoaminogenes) FERM BP-1539, Brevibacterium Brevibacterium flavum ATCC 14067, Brevibacterium lactofermentum ATCC 13869, L-amino acid producing mutants or strains prepared therefrom, eg, Corynebacterium glutamicum KFCC10881, Coryne Bacterium glutamicum KFCC11001 and lysine biosynthetic gene enrichment strain Corynebacterium glutamicum KCCM10770, preferably Corynebacterium glutamicum with accession number KFCC10881. In addition, the most preferred embodiment of the microorganism of the genus Corynebacterium produced as described above to reduce the intrinsic regulatory activity of the aspR gene regulating the genes of lysC and dapA, Corynebacterium glutamicum KFCC having accession number KCCM 10953P Corynebacterium glutamicum, -10881-aspR.

In a specific embodiment of the present invention, a transformant obtained by introducing a vector pDZ-aspR comprising a portion of aspR into Corynebacterium glutamicum KFCC-10881 is named KFCC-10881-aspR, and it was June 4, 2008. As of date it was deposited with the accession number KCCM 10953P to the Korean Culture Center of Microorganisms (hereinafter abbreviated as "KCCM").

As another aspect, the present invention relates to a method for producing L- lysine, comprising the step of culturing the microorganism and recovering L- lysine in the culture obtained in the step of culturing the microorganism.

 The culture may be carried out according to well-known methods, and conditions such as the culture temperature, the culture time and the pH of the medium may be appropriately adjusted. These known culture methods are described in Chmiel; Bioprozesstechnik 1. Einfuhrung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991), and Storhas; Bioreaktoren und periphere Einrichtungen (Vieweg Verlag, Braunschweig / Wiesbaden, 1994). In addition, the culture method includes a batch culture, a continuous culture (cintinuous culture) and a fed-batch culture, preferably a batch process or an injection batch or a repeated batch batch process (fed batch or Repeated fed batch process) may be cultured continuously, but is not limited thereto.

The medium used for cultivation must meet the requirements of the particular strain in an appropriate manner. Culture media for Corynebacterium strains are known (eg, Manual of Methods for General Bacteriology. American Society for Bacteriology.Washington D.C., USA, 1981). Sugar sources that can be used include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid Fatty acids such as linoleic acid, alcohols such as glycerol, ethanol, and organic acids such as acetic acid. These materials can be used individually or as a mixture. Nitrogen sources that can be used include peptone, yeast extract, gravy, malt extract, corn steep liquor, soybean wheat and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources can also be used individually or as a mixture. Personnel that may be used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts. In addition, the culture medium should contain metal salts such as magnesium sulfate or iron sulfate required for growth. Finally, in addition to the above substances, essential growth substances such as amino acids and vitamins can be used. In addition, suitable precursors to the culture medium may be used. The above-mentioned raw materials may be added batchwise or continuously by a suitable method for the culture during the culture.

Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid can be used in an appropriate manner to adjust the pH of the culture. In addition, antifoaming agents such as fatty acid polyglycol esters can be used to inhibit bubble generation. Inject oxygen or oxygen-containing gas (eg, air) into the culture to maintain aerobic conditions. The temperature of the culture is usually 20 ° C to 45 ° C, preferably 25 ° C to 40 ° C. Incubation is continued until the maximum amount of L-amino acid desired is produced. For this purpose it is usually achieved in 10 to 160 hours. L-lysine may be excreted in culture medium or contained in cells.

The method for recovering L-lysine can separate L-lysine from cells or culture medium by methods well known in the art. Examples of L-lysine recovery methods include, but are not limited to, filtration, anion exchange chromatography, crystallization, and HPLC.

In the present invention, a regulatory protein that regulates the transcription of the lysC and dapA genes and a gene encoding the same have been found and named aspR. aspR has been shown to function as an inhibitory regulatory protein and provides a way to enhance the transcription of aspartate kinase (lysC) and dihydrodipicolinate synthase (dapA) genes by depleting the aspR gene. This method is characterized by the ability to increase genes of the lysine biosynthetic pathway directly without manipulation.

Using the microorganism with improved lysine production capacity, characterized in that the aspR gene according to the present invention is reduced compared to the intrinsic regulatory activity, it is possible to stably and easily operate only one regulatory gene without directly manipulating a plurality of genes involved in the lysine biosynthetic pathway. Lysine production rate can be improved.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are only for carrying out the present invention by way of example, but the scope of the present invention is not limited to these examples.

Example  One: DNA chip Using Wild wines and  Comparing experiments on warrior expression of lysine producers

Corynebacterium glutamicum ATCC13032 and lysine producer Corynebacterium glutamicum KFCC-10881 were incubated in a 5L fermenter, and the cells were collected. The cells were compared and examined for mRNA expression of about 3,000 genes using genomic DNA chips (Genomic Tree, Inc., cDNA chip). Quantitative Monitoring of Gene Expression Patterns with a Complementary DNA Microarray, Patrick O. Brown (1995), Science Vol. 270. 467-470.

As a result of comparing the expression of lysine biosynthetic pathway genes among the genes, the expressions of lysC (gene encoding aspartate kinase) and dapA (gene encoding dehydrodipicolinate synthase) genes were compared with those of wild lines. Stronger in lysine producers.

gene Expression ratio (production / wild wine) 1 batch 2 batch Average lysC 2.18 3.21 2.69 dapA 2.74 2.90 2.82

Example  2: Ligand fishing  Using lysC , dapA Regulatory proteins  quest

LysC based on the National Institutes of Health Gene Bank NIH GenBank Nucleotide sequence information (NCBI accession number NC_003450, lysC: NCgl0247, dapA: 1896) of the gene (SEQ ID NO: 13) and dapA gene (SEQ ID NO: 14) were obtained. Based on the reported base sequence for amplifying the predicted promoter (SEQ ID NO: 1 lysC promoter, SEQ ID NO: 2: dapA promoter) located in the front of the open reading frame (ORF) of the protein, two pairs of primers as shown in Table 2 below. (Table 2, SEQ ID NOs: 3 to 6) were synthesized. At this time, the lysC-PR primer and dapA-PR primer were labeled with biotin at the 5 'end.

primer Sequence SEQ ID NO: lysC-P-F gattgttaatgccgatgctagggcg 3 lysC-P-R ctttgtgcacctttcgatctacgtg 4 dapA-P-F ctgttttcggtgattttgag 5 dapA-P-R tccggtcttagctgttaaac 6

PCR was performed using the chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template and oligonucleotides of SEQ ID NO: 3 and 4 and SEQ ID NO: 5 and 6 as primers, respectively. The polymerase was PfuUltra ^™ high-trust DNA polymerase (Stratagene), and PCR conditions were denatured 96 ° C., 30 seconds; Annealing 52 ° C., 30 seconds; And the polymerization reaction was repeated 30 times at 72 ℃, 3 minutes. As a result, two pairs of predicted promoter sites (lysC-P and dapA-P) were obtained, including a promoter site of about 300 bp. lysC-P (SEQ ID NO: 1) is amplified using the primers of SEQ ID NOS: 3 and 4, dapA-P (SEQ ID NO: 2) is amplified using the SEQ ID NOs: 5 and 6.

DNA of the promoter predicted regions of the lysC and dapA genes prepared above was attached to a substance coated with streptabin on agarose surface (PIERCE, NeutraAvidin). Since biotin and streptabin have strong binding properties to each other, streptabin and biotin on the surface of agarose are linked to the DNA produced on the surface of agarose. The whole protein solution extracted from Corynebacterium glutamicum ATCC13032 was mixed, the proteins bound to the promoter DNA of each gene were combined, and the proteins bound to the promoter were separated through washing and elution. The separated proteins were separated by size using 12% SDS-PAGE, hydrolyzed with pepsin using different protein bands, and the hydrolyzate was identified by mass spectrometry.

As a result, it was found that the same protein binds to the promoter region of the lysC gene and dapA gene, and the protein has been identified as a putative transcriptional regulator that has not yet been identified. In the present invention, the gene encoding this protein is named aspR. aspR gene is based on the National Institutes of Health gene bank NIH GenBank Nucleotide sequence information (NCBI accession numbers NC_003450, NCgl2886) of the gene (SEQ ID NO: 15) was obtained.

Example  3: Corynebacterium Glutamicum ATCC13032 origin aspR gene Cloning  And recombinant vector ( pDZ - aspR ) Production, aspR  defect Strain development

Secured in Example 2 aspR A pair of primers (Table 3, SEQ ID NOs: 7 to 10) were synthesized based on the gene sequence information.

PCR was performed using chromosomal DNA of Corynebacterium glutamicum ATCC13032 as a template and oligonucleotides of SEQ ID NOS: 7 to 10 as primers. The polymerase was PfuUltra ^™ high-trust DNA polymerase (Stratagene), and PCR conditions were denatured 96 ° C., 30 seconds; Annealing 52 ° C., 30 seconds; And the polymerization reaction was repeated 30 times at 72 ℃, 3 minutes.

primer Sequence SEQ ID NO: aspR-A-F gccgaccaatgaaacgaccc 7 aspR-A-R tcacagagcggcggaaatag 8 aspR-B-F aagacctggtggatatcatt 9 aspR-B-R gaggaagacggccaagggcg 10

As a result, two pairs of aspR genes (aspR-A and aspR-B) of about 300 bp were obtained. aspR-A (SEQ ID NO: 11) is amplified by using SEQ ID NO: 7 and 8 as a primer, aspR-B (SEQ ID NO: 12) is amplified by using SEQ ID NO: 9 and 10 as a primer. The amplified product was cloned into pDZ vector previously treated with SalI restriction enzyme using BD In-Fusion kit (BD) to obtain pDZ- aspR vector. 1 is a diagram showing a vector pDZ- aspR for corynebacterium chromosome insertion.

After transforming the produced pDZ- aspR vector to the lysine producing strain Corynebacterium glutamicum KFCC-10881 (using the transformation method according to Appl. Microbiol. Biotechnol. 52: 541-545, 1999) Strains inserted by homology with homologous genes on chromosomes were selected in a selection medium containing 25 mg / L kanamycin. Successful chromosomal insertion of the vector was made possible by checking whether it was blue in solid media, including X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactosid).

The primary chromosome-inserted strains were shaken in nutrient medium (30 ° C., 8 hours), diluted from 10 ⁻⁴ to 10 ⁻¹⁰ , respectively, and plated on solid medium containing X-gal. While most colonies were blue, white colonies appearing at a low rate, and strains from which vector sequences on chromosomes inserted by secondary crossover were removed were selected. AspR after 2nd intersection The lysine producing strain Corynebacterium glutamicum KFCC-10881-aspR, which lacked the gene, was obtained. Final confirmation by PCR using primers (Table 4).

primer Sequence SEQ ID NO: aspR-A-F gccgaccaatgaaacgaccc 7 aspR-B-R gaggaagacggccaagggcg 10

Example  4: DNA chip and qRT - PCR Using aspR  With missing strains Mother strain  Transcriptional Expression Comparison Experiment

Corynebacterium glutamicum KFCC-180881 and Corynebacterium glutamicum KFCC-10881-aspR were incubated in flasks, and the cells were collected. The cells were compared and examined for mRNA expression of about 3,000 genes using genomic DNA chips (Genomic Tree, Inc., cDNA chip) as in Example 1.

As a result of comparing the expression of the lysC gene and dapA gene among the total genes, it was confirmed that the expression of the parent strain was increased in the strain deleted aspR gene as shown in Table 5 below.

gene Expression ratio
(KFCC-10881-aspR / KFCC-10881) lysC 1.4 dapA 1.2

To reconfirm the DNA chip results, the amount of lysC mRNA was compared using qRT-PCR method (Quantitative RT-PCR: pitfalls and potential, KE Vrana, BioTechniques 26: 112-125. 1999). As shown in FIG. 2, it was confirmed that the amount of mRNA was large in the strain in which aspR was deleted as in the DNA chip result.

Example  5: aspR  In the missing strain Aspartate Kinase  Active measurement

Aspartyl kinase activity of lysine producing strain Corynebacterium glutamicum KFCC-10881-aspR using Aspartyl Hydroxamate (Pecher JF, Capony JP (1968) On the colorimetric determination of acyl phosphates.Anal Biochem 22 : 536-539) confirmed that the aspR-deficient strain had 1.77 times higher activity than the parent strain.

Strain
Active (nmole / mg / min) Primary Secondary 3rd Average Fold KFCC-10881 10.34 13.51 13.31 12.39 One KFCC-10881-aspR 22.36 21.29 21.95 21.86 1.77

Example  6: aspR  Lysine Production in Deficient Strains

Corynebacterium glutanicum KFCC-10881-aspR, the L-lysine producing strain finally prepared in Example 3, was incubated in the following manner for L-lysine production.

A 250 ml corner-baffle flask containing 25 ml of the following species medium was inoculated with Corynebacterium glutamicum strains, KFCC-10881 and KFCC-10881-aspR, and incubated at 200 rpm for 20 hours at 200 rpm. . A 250 ml corner-baffle flask containing 24 ml of the following production medium was inoculated with 1 ml of the seed culture and shaken at 120C for 120 hours (200 rpm).

After the incubation, the production amount of L-lysine was measured by the method using HPLC. The results for L-lysine in the culture of Corynebacterium glutamicum KFCC-10881 and KFCC-10881-aspR are shown in Table 7 below.

Strain
Lysine (g / l) Batch 1 Batch 2 Batch 3 KFCC-10881 17.34 17.55 16.70 KFCC-10881-aspR 18.32 18.45 18.70

Species  ( pH  7.0)

20 g raw sugar, 10 g peptone, 5 g yeast extract, 1.5 g urea, KH ₂ PO ₄ 4 g, K ₂ HPO ₄ 8 g, MgSO ₄ 7H ₂ O 0.5 g, biotin 100 μg, thiamine HCl 1000 μg, calcium- 2000 μg pantothenic acid, 2000 μg nicotinamide (based on 1 liter of distilled water)

Production medium  ( pH  7.0)

Glucose 100 g, (NH ₄ ) ₂ SO ₄ 40 g, Soy Protein 2.5 g, Corn Steep Solids 5 g, Urea 3 g, KH ₂ PO ₄ 1 g, MgSO ₄ 7H ₂ O 0.5 g, Biotin 100 μg, thiamine hydrochloride 1000 μg, calcium-pantothenic acid 2000 μg, nicotinamide 3000 μg, CaCO ₃ 30 g (based on 1 liter of distilled water)

As shown in Table 7, the Corynebacterium glutamicum KFCC-10881-aspR lacking the aspR gene was confirmed to have increased about 10% lysine production compared to the parent strain KFCC-10881.

1 is a diagram showing a vector pDZ-aspR for Corynebacterium aspR gene deletion.

2 is a graph showing relative lysC mRNA expression levels of Corynebacterium glutamicum KFCC10881 and Corynebacterium glutamicum KFCC 10881-aspR.

<110> CJ Cheiljedang Corporation <120> A corynebacterium having enhanced L-lysine productivity and a          method of producing L-lysine using the corynebacterium <130> PA080171 / KR <160> 15 <170> KopatentIn 1.71 <210> 1 <211> 300 <212> DNA <213> Corynebacterium glutamicum <220> <221> promoter (222) (1) .. (300) <223> lysC promoter <400> 1 gattgttaat gccgatgcta gggcgaaaag cacggcgagc agattgcttt gcacttgatt 60 cagggtagtt gactaaagag ttgctcgcga agtagcacct gtcacttttg tctcaaatat 120 taaatcgaat atcaatatat ggtctgttta ttggaacgcg tcccagtggc tgagacgcat 180 ccgctaaagc cccaggaacc ctgtgcagaa agaaaacact cctctggcta ggtagacaca 240 gtttataaag gtagagttga gcgggtaact gtcagcacgt agatcgaaag gtgcacaaag 300                                                                          300 <210> 2 <211> 310 <212> DNA <213> Corynebacterium glutamicum <220> <221> promoter (222) (1) .. (310) <223> dapA promoter <400> 2 ctgttttcgg tgattttgag attgaaactt tggcagacgg atcgcaaatg gcaacaagcc 60 cgtatgtcat ggacttttaa cgcaaagctc acacccacga gctaaaaatt catatagtta 120 agacaacatt tttggctgta aaagacagcc gtaaaaacct cttgctcgtg tcaattgttc 180 ttatcggaat gtggcttggg cgattgttat gcaaaagttg ttaggttttt tgcggggttg 240 tttaaccccc aaatgaggga agaaggtaac cttgaactct atgagcacag gtttaacagc 300 taagaccgga 310 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> forward primer for amplification of lysC promoter <400> 3 gattgttaat gccgatgcta gggcg 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for amplification of lysC promoter <400> 4 ctttgtgcac ctttcgatct acgtg 25 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for amplification of dapA promoter <400> 5 ctgttttcgg tgattttgag 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for amplification of dapA promoter <400> 6 tccggtctta gctgttaaac 20 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for amplification of aspR-A <400> 7 gccgaccaat gaaacgaccc 20 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for amplification of aspR-A <400> 8 tcacagagcg gcggaaatag 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer for amplification of aspR-B <400> 9 aagacctggt ggatatcatt 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for amplification of aspR-B <400> 10 gaggaagacg gccaagggcg 20 <210> 11 <211> 300 <212> DNA <213> Artificial Sequence <220> <223> aspR-A <400> 11 gccgaccaat gaaacgaccc tctagaagca tcgtttagaa ttgcttttaa gtgaataagg 60 aacagcacag aattaaggcc tcggagttat cgctcacgct acttctcaag tgacgccaag 120 gtaagttgta ctttttctgt ccaaattatt gctttttccg tagataggtt atcgaacgga 180 aattacttgg caataccgct atgctggcag gcatgcctaa tttaaacgct gaggagctag 240 cagtccgcgt gcgacccgcg ctgacaaaac tctacgttct ctatttccgc cgctctgtga 300                                                                          300 <210> 12 <211> 274 <212> DNA <213> Artificial Sequence <220> <223> aspR-B <400> 12 aagacctggt ggatatcatt actgagcttg cagaggtgta cggtagctgg aaagagaccg 60 acagcggttc ttaacagttt tctccatctc aactccggaa tttgatgaaa caaccccttc 120 gcgtacttat ttcttgtcga cccgaagaaa attcgggtgg caaacgtagt gaacaaaatg 180 atgctgtttt tgagttcgcc gcatggctag ctcgtacttc agacatcaat gttcgtggaa 240 tcacaacttt catacgccct tggccgtctt cctc 274 <210> 13 <211> 1266 <212> DNA <213> Corynebacterium glutamicum <220> <221> gene (222) (1) .. (1266) <223> lysC gene <400> 13 gtggccctgg tcgtacagaa atatggcggt tcctcgcttg agagtgcgga acgcattaga 60 aacgtcgctg aacggatcgt tgccaccaag aaggctggaa atgatgtcgt ggttgtctgc 120 tccgcaatgg gagacaccac ggatgaactt ctagaacttg cagcggcagt gaatcccgtt 180 ccgccagctc gtgaaatgga tatgctcctg actgctggtg agcgtatttc taacgctctc 240 gtcgccatgg ctattgagtc ccttggcgca gaagcccaat ctttcacggg ctctcaggct 300 ggtgtgctca ccaccgagcg ccacggaaac gcacgcattg ttgatgtcac tccaggtcgt 360 gtgcgtgaag cactcgatga gggcaagatc tgcattgttg ctggtttcca gggtgttaat 420 aaagaaaccc gcgatgtcac cacgttgggt cgtggtggtt ctgacaccac tgcagttgcg 480 ttggcagctg ctttgaacgc tgatgtgtgt gagatttact cggacgttga cggtgtgtat 540 accgctgacc cgcgcatcgt tcctaatgca cagaagctgg aaaagctcag cttcgaagaa 600 atgctggaac ttgctgctgt tggctccaag attttggtgc tgcgcagtgt tgaatacgct 660 cgtgcattca atgtgccact tcgcgtacgc tcgtcttata gtaatgatcc cggcactttg 720 attgccggct ctatggagga tattcctgtg gaagaagcag tccttaccgg tgtcgcaacc 780 gacaagtccg aagccaaagt aaccgttctg ggtatttccg ataagccagg cgaggctgcg 840 aaggttttcc gtgcgttggc tgatgcagaa atcaacattg acatggttct gcagaacgtc 900 tcttctgtag aagacggcac caccgacatc accttcacct gccctcgttc cgacggccgc 960 cgcgcgatgg agatcttgaa gaagcttcag gttcagggca actggaccaa tgtgctttac 1020 gacgaccagg tcggcaaagt ctccctcgtg ggtgctggca tgaagtctca cccaggtgtt 1080 accgcagagt tcatggaagc tctgcgcgat gtcaacgtga acatcgaatt gatttccacc 1140 tctgagattc gtatttccgt gctgatccgt gaagatgatc tggatgctgc tgcacgtgca 1200 ttgcatgagc agttccagct gggcggcgaa gacgaagccg tcgtttatgc aggcaccgga 1260 cgctaa 1266 <210> 14 <211> 906 <212> DNA <213> Corynebacterium glutamicum <220> <221> gene (222) (1) .. (906) <223> dapA gene <400> 14 atgagcacag gtttaacagc taagaccgga gtagagcact tcggcaccgt tggagtagca 60 atggttactc cattcacgga atccggagac atcgatatcg ctgctggccg cgaagtcgcg 120 gcttatttgg ttgataaggg cttggattct ttggttctcg cgggcaccac tggtgaatcc 180 ccaacgacaa ccgccgctga aaaactagaa ctgctcaagg ccgttcgtga ggaagttggg 240 gatcgggcga agctcatcgc cggtgtcgga accaacaaca cgcggacatc tgtggaactt 300 gcggaagctg ctgcttctgc tggcgcagac ggccttttag ttgtaactcc ttattactcc 360 aagccgagcc aagagggatt gctggcgcac ttcggtgcaa ttgctgcagc aacagaggtt 420 ccaatttgtc tctatgacat tcctggtcgg tcaggtattc caattgagtc tgataccatg 480 agacgcctga gtgaattacc tacgattttg gcggtcaagg acgccaaggg tgacctcgtt 540 gcagccacgt cattgatcaa agaaacggga cttgcctggt attcaggcga tgacccacta 600 aaccttgttt ggcttgcttt gggcggatca ggtttcattt ccgtaattgg acatgcagcc 660 cccacagcat tacgtgagtt gtacacaagc ttcgaggaag gcgacctcgt ccgtgcgcgg 720 gaaatcaacg ccaaactatc accgctggta gctgcccaag gtcgcttggg tggagtcagc 780 ttggcaaaag ctgctctgcg tctgcagggc atcaacgtag gagatcctcg acttccaatt 840 atggctccaa atgagcagga acttgaggct ctccgagaag acatgaaaaa agctggagtt 900 ctataa 906 <210> 15 <211> 474 <212> DNA <213> Corynebacterium glutamicum <220> <221> gene (222) (1) .. (474) <223> aspR gene <400> 15 atgctggcag gcatgcctaa tttaaacgct gaggagctag cagtccgcgt gcgacccgcg 60 ctgacaaaac tctacgttct ctatttccgc cgctctgtga attctgacct ctcgggtcca 120 cagctcacta ttttgagtcg cctggaagaa aacggcccat cccgaattag tcgcatcgcg 180 gaacttgaag atattcgtat gccaaccgct tcgaatgctc tgcatcagct ggagcaactc 240 aacctggttg agcgtatccg cgacaccaaa gaccgccgag gcgtgcaggt tcagctcact 300 gatcatggac gcgaagagct tgagcgcgtg aacaatgaac gaaacgcaga gatggctcga 360 ctccttgaaa tgctcacccc agagcagctg gaacgtaccg aagacctggt ggatatcatt 420 actgagcttg cagaggtgta cggtagctgg aaagagaccg acagcggttc ttaa 474  

Claims (9)

A microorganism of the genus Corynebacterium , wherein the aspR gene is reduced compared to endogenous regulatory activity. The microorganism of claim 1, wherein the aspR gene is a regulatory gene having an activity of regulating a gene encoding aspartate kinase (lysC) and a gene encoding dehydrodipicolinate synthase (dapA). The microorganism of claim 1, wherein the aspR gene has a nucleotide sequence of SEQ ID NO: 15. 3. The microorganism according to claim 1, wherein the aspR gene of the microorganism of the genus Corynebacterium is reduced by intrinsic regulatory activity due to deletion, substitution or insertion. The microorganism according to claim 1, wherein a recombinant vector comprising a part of the aspR gene is introduced into a microorganism of the genus Corynebacterium, thereby reducing intrinsic regulatory activity. The microorganism of claim 5, wherein the recombinant vector is a vector pDZ-aspR having a cleavage map of FIG. 1. The microorganism according to claim 5, wherein the vector is introduced into Corynebacterium glutamicum which has accession number KFCC10881. The microorganism of claim 1, wherein the microorganism of the genus Corynebacterium having improved lysine production capacity is Corynebacterium glutamicum KFCC-10881-aspR (Accession No. KCCM 10953P). Culturing the microorganism according to any one of claims 1 to 8; And recovering L-lysine from the culture obtained in the step of culturing the microorganisms.

Images