KR100957773B1 - Novel Copolymer of [Poly3-hydroxypropionate-co-lactate] and Method for Preparing the Same - Google Patents

Abstract

The present invention relates to a novel 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)] and a method for preparing the same, and more particularly, lactate (lactate) to lactyl-CoA (lactyl). Genes and polyhydroxyalkanoate of enzymes that convert to -CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA PHA) A method for producing a novel copolymer (3-hydroxypropionate-lactate copolymer) consisting of monomers of lactate and 3-hydroxypropionate using cells or plants having the synthetase gene at the same time and A novel 3-hydroxypropionate-lactate copolymer.

The novel 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)] according to the present invention is a biodegradable polymer that can replace the use of conventional synthetic plastics and is also suitable for medical use. It is possible.

Lactate, 3-hydroxypropionate, copolymer

Description

Novel Copolymer of [Poly (3-hydroxypropionate-co-lactate)] and Method for Preparing the Same

Figure 1 is a schematic diagram showing a system of constant expression of the operon form in which PHA synthase and CP-PCT are expressed together.

Figure 2 shows a sequence map of the recombinant plasmid pPs619C1300-CPPCT comprising the PHA synthase gene and CP-PCT gene according to the present invention.

Figure 3 shows a sequence map of the recombinant plasmid pTacCpPctNCvEC comprising the PHA synthase gene and CP-PCT gene according to the present invention.

Figure 4 shows the gas chromatogram results of analyzing the components of the copolymer biosynthesized by recombinant E. coli transformed with the pPs619C1300-CPPCT plasmid.

Figure 5 shows the gas chromatogram results of analyzing the components of the copolymer biosynthesized by recombinant E. coli transformed with the pTacCpPctNCvEC plasmid.

Field of invention

The present invention relates to a novel 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)] and a method for preparing the same, and more particularly, lactate (lactate) to lactyl-CoA (lactyl). Genes and polyhydroxyalkanoate of enzymes that convert to -CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA PHA) A method for producing a novel copolymer (3-hydroxypropionate-lactate copolymer) consisting of monomers of lactate and 3-hydroxypropionate using cells or plants having the synthetase gene at the same time and A novel 3-hydroxypropionate-lactate copolymer.

Background of the Invention

Polylactate (PLA), a polymer having lactate as a monomer, is a representative biodegradable polymer and has high applicability as a general purpose polymer or a medical polymer. Currently, PLA is produced by polymerizing lactate produced by microbial fermentation, but only low molecular weight (1000-5000 Daltons) PLA is produced by the direct polymerization of lactate. In order to synthesize 100,000 Daltons or more PLA, there is a method of polymerizing PLA from a low molecular weight PLA obtained by direct polymerization of lactate to a PLA having a higher molecular weight using a chain coupling agent. The method of preparing the amount of PLA has a disadvantage in that the process is complicated by the addition of an organic solvent or a coupling agent, and it is not easy to remove them. Currently commercially available high molecular weight PLA production process is a chemical synthesis method of converting lactate to lactide (lactide), and then synthesize the PLA through the ring-opening condensation reaction of the lactide ring.

On the other hand, PHAs are polyesters that microorganisms accumulate inside as energy or carbon source storage materials when there are excessive carbon sources and other nutrients such as phosphorus, nitrogen, magnesium, and oxygen are insufficient. PHA is regarded as a material to replace conventional synthetic plastics because it has properties similar to synthetic polymers derived from petroleum and shows complete biodegradability.

Conventionally known PHAs can be classified into short-chain-length PHAs (SCL-PHAs) and medium-chain-length PHAs (MCL-PHAs) with long carbon atoms. The gene of the enzyme that synthesizes PHA is Ralstonia It was isolated from eutropha , Pseudomonas, etc., and PHA composed of various kinds of monomers was synthesized through the recombinant microorganism transformed with the enzyme gene synthesizing the PHA (Qi et al ., FEMS Microbiol . Lett ., 157: 155, 1997; Qi et al ., FEMS Microbiol . Lett ., 167: 89, 1998; Langenbach et al ., FEMS Microbiol . Lett ., 150: 303, 1997; WO 01/55436; US 6,143,952; WO 98/54329; WO 99/61624).

In order to produce PHA in microorganisms, enzymes for converting metabolites of microorganisms to PHA monomers and PHA synthase synthesizing PHA polymers using PHA monomers are essential. PHA synthase synthesizes PHA using hydroxyacyl-CoA as a substrate, and Ralstonia is an enzyme capable of providing hydroxyacyl-CoA, a substrate of PHA. α-ketothiolase (PhaA) derived from eutropha et al., acetoacetyl-CoA reductase (PhaB), 3-hydroxydecanoyl-ACP: CoA transferase derived from Pseudomonas (3- hydroxydecanoyl-ACP: CoA transferase: PhaG), Aeromonas caviae and Pseudomonas The (R) derived from a specific enol aeruginosa -CoA hydroxy latte rise [(R) -specific enoyl-CoA hydratase: PhaJ] (Fukui et al ., J. Bacteriol ., 180: 667, 1998; Tsuge et al ., FEMS Microbiol. Lett ., 184: 193, 2000), Escherichia coli and Pseudomonas 3-ketoacyl-ACP reductase (FabG) derived from aeruginosa et al. is known (Taguchi et. al ., FEMS Microbiol. Lett ., 176: 183, 1999; Ren et al ., J. Bacteriol ., 182: 2978, 2000; Park et al ., FEMS Microbiol. Lett ., 214: 217, 2002). Various enzymes have been synthesized using hydroxyalkanoates hydroxylated at various carbon positions (mostly 3, 4, 5, 6) using these enzymes.

However, it has been reported that there is little reactivity of PHA synthase to hydroxylated hydroxyalkanoates at position 2 (Zhang et al. al ., Appl . Microbiol . Biotechnol ., 56: 131, 2001; Valentin and Steinbuchel, Appl. Microbiol. Biotechnol., 40: 699, 1994). To date in the PHA polymerase for raktil -CoA Although there have been reports of the reactivity of PHA synthase to lactyl-CoA through in vitro activity measurement, the reactivity of PHA synthase to lactyl-CoA is very weak (Zhang et al. al ., Appl . Microbiol . Biotechnol ., 56: 131, 2001; Valentin and Steinbuchel, Appl . Microbiol. Biotechnol ., 40: 699, 1994). That is, hydroxyalkanoates, such as 2-carbon-hydroxylated lactate, are not suitable for the substrate specificity of PHA synthase, so that PHA and its copolymers are produced naturally or using recombinant cells or plants. There is no example.

US Patent Publication No. 20040076982 discloses a method of synthesizing lactate in glucose, biosynthesizing lactate with lactyl-CoA, and biosynthesis of 3-hydroxyalkanoate-CoA with lactyl-CoA. A method for preparing copolymers using lactyl-CoA and 3-hydroxyalkanoate-CoA is not disclosed.

Accordingly, the present inventors have made intensive efforts to prepare high molecular weight 3-hydroxypropionate-lactate copolymer [poly (3-hydroxyalkanoate-co-lactate)] using microorganisms. lactinyl-CoA), a propynol-CoA transfer derived from Clostridium propionicum , an enzyme gene that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA By culturing recombinant E. coli transformed with a propionyl-CoA transferase gene ( pct ) and a gene of PHA synthase, a 3-hydroxypropionate-lactate copolymer [Poly (3-hydroxypropionate-co- lactate)] was produced to complete the present invention.

It is an object of the present invention to provide a novel polymer, 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)].

Another object of the present invention is to provide a method for preparing the 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)].

In order to achieve the above object, the present invention is a 3-hydroxypropionate-lactate copolymer containing a lactate and 3-hydroxypropionate as a repeating unit [poly (3-hydroxypropionate-co-lactate)] To provide.

The invention also converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. 3-hydroxypropionate-lactate copolymers characterized by culturing or cultivating cells or plants having both the gene of the enzyme and the polyhydroxyalkanoate (PHA) synthase gene converting to (3-hydroxypropionate-co-lactate)] is provided.

In the present invention, the cell or plant converts lactate to lactyl-CoA and converts 3-hydroxyalkanoate to cells or plants that do not have a PHA synthase gene. It may be characterized in that it is obtained by converting the gene of the enzyme to convert to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) and PHA synthase gene.

In the present invention, the lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate (3-hydroxyalkanoate) 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA The gene of the enzyme to convert to) may be characterized in that the propionyl-CoA transferase gene ( pct ).

In the present invention, the polyhydroxyalkanoate (PHA) synthase gene is Pseudomonas sp. It may be characterized in that the phaC1 _{ps6 -19} derived from 6-19, wherein the polyhydroxyalkanoate (PHA) synthase gene is an amino acid sequence of E130D, S325T and Q481M mutated in the amino acid sequence of SEQ ID NO: 7 It may be characterized in that the gene coding for.

In the present invention, the cell may be characterized in that the microorganism, the microorganism may be characterized in that the E. coli.

In the present invention, the culture or cultivation may be characterized in that it is carried out in an environment containing 3-hydroxypropionate (3-HP).

A cell or plant having the ability to produce the 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)] is a cell or plant (i) a cell or plant that does not have both genes Of enzymes that convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Obtained by transforming the gene with a PHA synthase gene using lactyl-CoA as a substrate, or (ii) a cell or plant having a gene of PHA synthase using lactyl-CoA as a substrate. Obtained by transformation with a gene of an enzyme that converts to lactyl-CoA and converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. Or (iii) converting lactate to lactyl-CoA. ) Cells or plants with the gene of the enzyme that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA and lactyl-CoA to the substrate. It may be characterized by being obtained by transforming the gene of the PHA synthase to be used, but is not limited thereto.

Various microorganisms are known as cells having the gene of the PHA synthase (KR 10-250830 B1). For example,Achromobacter sp.,Achromobacter xylosoxidans IncludingAchromobacter Microorganisms,Acidovorax delafieldii,Acidovax facilis,Acinetobacter sp.,Acinetobacter calcoaceticus,Acinetobacter lwoffii IncludingAcinetobacter Microorganisms,Actinomyces sp.,Aeromonas caviae,Aeromonas hydrophila,Aeromonas salmonicida IncludingAeromonas Microorganisms,Alcaligenes aestus,Alcaligenes denitrificans,Alcaligenes eutrophus (Ralstonia eutrophaRenamed back toWautersia eutrophaRenamed to),Alcaligenes faecalis,Alcaligenes latus,Alcaligenes pacificus Alcaligenes paradoxus,Alcaligenes venestus IncludingAlcaligenes Microorganisms,Alteromonas macleodii,Amoebobacter roseu,Amoebobacter pendens IncludingAmoebobacter Microorganisms,Aphanocapa sp.,Aphanothece sp.Aquaspirillum autotrophicum,Azorhizobium caulinodans,Azospirillum sp.,Azospirillum brasilense,Azospirillum lipoferum IncludingAzospirillum Microorganisms,Azotobacter sp.,Azotobacter agilis,Azotobacter chroococcum,Azotobacter macrocytogenes,Azotobacter vinelandii IncludingAzotobacter Microorganisms,Bacillus anthracis , Bacillus cereus , Bacillus megaterium , Bacillus subtillus, Bacillus thuringiensis IncludingBacillus Microorganisms,Beggiatoa sp.,Beggiatoa alba IncludingBeggiatoa Microorganisms,Beijerinckia indicus , Beijerinckia mobilis IncludingBeijerinckia Microorganisms,Beneckia natrigens , Beneckea pelagia IncludingBeneckea Microorganisms,Bordetella pertussis , Bradyrhizobium japonicum , Caryophamon latum , Caulobacter bacteroides, Caulobacter crescentus IncludingCaulobacter Microorganisms,Chlororoflexus aurantiacus, Chlorogloea fritschii IncludingChlorogloea Microorganisms,Chromatium minutissimum, Chromatium okenii , Chromatium tepidum IncludingChromatium Microorganisms,Chromobacterium violaceum IncludingChromobacterium Microorganisms,Clostridium botulinum, Clostridium sphenoides IncludingClostridium Microorganisms,Comamonas acidovorans, Comamonas testosteroni IncludingComamonas Microorganisms,Corynebacterium autotrophicum, Corynebacterium hydrocarboxydans IncludingCorynebacterium Microorganisms,Cyanobacteria,Derxia gummosaContainingDerxia Microorganisms,Desulfococcus multivorans , Desulfonema limicola , Desulfonema magnum IncludingDesulfonema Microorganisms,Desulfosacina variabilis , Desulfovibrio sapovorans , Ectothiorhodospira halochloris , Ectothiorhodospira mobilis , Ectothiorhodospira vacuolata IncludingEctothiorhodospira Microorganisms,Ferrobacillus ferroxidans , Flavobacterium sp.,Haemophilus influenzae , Halobacterium gibbonsii, Halobacterium volcanii IncludingHalobacterium Microorganisms,Haloferax mediterranei, Hydroclathratus clathratus , Hydrogenomonas facilis , Hydrogenophaga flava , Hydrogenophaga pseudoflava , Hydrogenophaga taeniospiralis IncludingHydrogenophaga Microorganisms,Hyphomicrobium vulgareContainingHyphomicrobium Microorganisms,Ilyobacter delafieldii, Labrys monachus , Lamprocystis reseopersicina , Lampropedia hyalina , Legionella sp.,Leptothrix discophorus , Methylobacterium AM1,Methylobacterium extorquens IncludingMethylobacterium Microorganisms,Methylococcus thermophilus , Methlocystis parvus , Methylomonas methanica, Methylosinus sporium , Methylosinus trichosporium IncludingMethylosinus Microorganisms,Methylovibrio soehngenii , Micrococcus denitrificans , Micrococcus halodenitrificans IncludingMicrococcus Microorganisms,Mycobacterium album , Mycobacterium vacae IncludingMycobacterium Microorganisms,Nitrobacter agilis , Nitrobacter winogradskyi IncludingNitrobacter Microorganisms,Nocardia alba , Nocardia asteroides , Nocardia lucida , Nocardia rubra IncludingNocardia Microorganisms,Paracoccus dentrificans , Oscillatoria limosa , Penicillium cyclopium, Photobacterium mandapamensis , Photobacterium phosphoreum IncludingPhotobacterium Microorganisms,Physarum ploycephalumWowPseudomonas glathei , Pseudomonas indigofera, Pseudomonas lemonieri , Pseudomonas mallei , Pseudomonas marina , Pseudomonas mixta, Pseudomonas oleovorans , Pseudomonas oxalaticus , Pseudomonas pseudoalcaligenes , Pseudomonas aeruginosa , Pseudomonas alcaligenes , Pseudomonas asplenii , Pseudomonas butanovora, Pseudomonas cepacia , Pseudomonas coronafaciens , Pseudomonas dacunhae , Pseudomonas denitrificans , Pseudomonas diminuta , Pseudomonas echinoides , Pseudomonas fluorescens, Pseudomonas putida , Pseudomonas rubrilineas , Pseudomonas saccharophila , Pseudomonas stutzeri , Pseudomonas syringae , Pseudomonas thermophilus , Pseudomonas viridiflava IncludingPseudomonas Microorganisms,Ralstonia Microorganisms,Rhizobium hedysarum , Rhizobium lupini , Rhizobium meliloti , Rhizobium phaseoli , Rhizobium trifoli IncludingRhizobium Microorganisms,Rhodobacillus Microorganisms,Rhodobacter capsulatus , Rhodobacter sphaeroides IncludingRhodobacter Microorganisms,Rhodococcus rhodochrousContainingRhodococcusMicroorganisms,Rhodocyclus gelatinosus , Rhodocyclus tenuis IncludingRhodocyclus Microorganisms,Rhodomicrobium vannielii Wow Rhodopseudomonas acidophila , Rhodopseudomonas capsulata IncludingRhodopseudomonas Microorganisms,Rhodospirillum molischianum, Rhodospirillum rubrum IncludingRhodospirillum Microorganisms,Sphingomonas paucimobilis, Spilrillum itersomii , Spilrillum serpens IncludingSpilrillum Microorganisms,Spirulina jenneri, Spirulina maxima , Spirulina subsaksa IncludingSpirulina Microorganisms,Staphylococcus aureus , Staphylococcus epidermidis , Staphylococcus xylosus IncludingStaphylococcus Microorganisms,Stella humosa , Stella vacuolata IncludingStella Microorganisms,Streptomyces antibioticus , Streptomyces coelicolor IncludingStreptomyces Microorganisms,Syntrophomonas wolfei , Thermophilic cyanobacteria , Thermus thermophilus,Thiobacillus A2,Thiobacillus acidophilus , Thiobacillus versutus IncludingThiobacillus Microorganisms,Thiocapsa pfennigii IncludingThiocapsa Microorganisms,Thiocystis violacea,Vibrio parahaemolyticus,Xanthobacter autotrophicus , Xanthomonas maltophilia, Zoogloea ramigera IncludingZoogloea Genus microorganisms.

In the present invention, lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate is converted to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA). Cells or plants having both the gene of the enzyme and the polyhydroxyalkanoate (PHA) synthase gene are cultured or cultivated in an environment containing 3-hydroxypropionate and lactate, and then 3-hydroxypropanol. Cells capable of preparing a cationate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)] and capable of biosynthesizing lactate and 3-hydroxypropionate from other carbon sources such as glucose or citric acid Alternatively, if the plant is not added separately, the copolymer can be prepared.

Transfection of a plant for producing a plant containing the gene of the converting enzyme of the present invention and the gene of the synthetase can be achieved by a conventional method using Agrobacterium, a viral vector or the like. For example, a microorganism of the genus Agrobacterium may be transformed with a recombinant vector containing a gene according to the present invention, and then the transformed Agrobacterium microorganism may be infected with tissues of a target plant to obtain a transfected plant. More specifically, (a) pre-culture the explant of the plant (preplant), and then transfected by co-culture with the transformed Agrobacterium; (b) culturing the transfected explants in a callus induction medium to obtain callus; And (c) cutting the obtained callus, and culturing it in shoot induction medium to form shoots, thereby producing a transfected plant.

In the present invention, the term "explant" refers to a slice of tissue cut out of a plant, and includes cotyledon or hypocotyl. The explants of the plant used in the method of the present invention may be cotyledons or hypocotyls, it is more preferable to use the cotyledons obtained by germinating in MS medium after disinfecting and washing the seeds of the plants.

Transfection target plants usable in the present invention include, but are not limited to, tobacco, tomatoes, peppers, beans, rice, corn, and the like. In addition, even if the plant used for transformation is a sexual propagation plant, it will be apparent to those skilled in the art that it can be repeatedly reproduced by tissue culture.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

Example  One: pct  Gene and PHA  Construction of Recombinant Plasmids Containing Genes

To prepare a 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)], recombinant plasmids pPs619C1300-CPPCT and pTacCpPctNCvEC containing the pct gene and the PHA gene were prepared.

(1) Preparation of pPs619C1300-CPPCT plasmid

The pct gene is Clostridium propionicum) propionyl -CoA transferase dehydratase (pronpionyl-CoA transferase derived from: was used as the CP-PCT) gene, PHA synthase gene is 6-10 Pseudomonas (Pseudomonas sp. 6-19) PHA synthase gene was used.

As shown in FIG. 1, a system for constitutive expression of operon in which PHA synthase and CP-PCT are expressed together was constructed. CP-PCT is known to be highly toxic to host microorganisms at the time of expression.In the IPTG expression system using tac or T7 promoters, which are widely used for recombinant protein expression, all recombinant microorganisms are killed at the same time as expression-inducing substances are added. do. For this reason, a constantly expressed system was used, which is weakly expressed but continuously expressed as the microorganism grows. CP-PCT gene is based on chromosomal DNA of Chostridium propionicum (DSMZ1682), pct Obtained by PCR using a primer having a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2 prepared based on the gene sequence (Selmer et al. , Eur J Biochem . , 269: 372, 2002).

SEQ ID NO: 5-ggaattcATGAGAAAGGTTCCCATTATTACCGCAGATGA

SEQ ID NO: 5-gctctagattaggacttcatttccttcagacccattaagccttctg

At this time, the Nde I restriction enzyme site originally present in the wild-type CP-PCT was removed using the SDM method for ease of cloning. In addition, overlapping PCR was performed using primers having the nucleotide sequences of SEQ ID NOs: 3 and 4 to add the Sbf I / Nde I recognition sites.

SEQ ID NO: 5-agg cct gca ggc gga taa caa ttt cac aca gg- 3

SEQ ID NO: 5-gcc cat atg tct aga tta gga ctt cat ttc c- 3

Pseudomonas sp. To isolate PHA synthase (phaC1 _{Ps6 -19} ) gene from 6-19 (KCTC11027BP), Pseudomonas sp. Primer having the nucleotide sequences of SEQ ID NOs: 5 and 6 based on phaC1 _Ps6-19 gene sequence (Song A-jin, Master's Thesis, Department of Chemical and Biomolecular Engineering, KAIST, 2004) production, and performing a PCR to obtain a phaC1 _Ps6 was _-19 gene, it exhibited a base sequence of the phaC1 _{Ps6 -19} gene is shown in SEQ ID NO: 7, exhibited an amino acid sequence calculated therefrom is shown in SEQ ID NO: 8.

SEQ ID NO: 5- GAG AGA CAA TCA AAT CAT GAG TAA CAA GAG TAA CG -3

SEQ ID NO 6: 5- CAC TCA TGC AAG CGT CAC CGT TCG TGC ACG TAC -3

By inserting the thus obtained phaC1 _{Ps6 -19} gene into a BstBI / SbfI recognition site of pBluescript II (Stratagene Co., USA) to prepare a recombinant vector pPs619C1. In order to make a phaC1 _{Ps6 -19} synthase gene fragment containing only one BstBI / SbfI recognition site at each end, the BstBI position, which is inherent in the BstBI / SbfI recognition region, was first removed without conversion of amino acids by SDM (site directed mutagenesis) method. In order to add a site, overlapping PCR was performed using primers having the nucleotide sequences of SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, and SEQ ID NOs: 13 and 14.

SEQ ID NO: 5- atg ccc gga gcc ggt tcg aa-3

SEQ ID NO: 10: 5- CGT TAC TCT TGT TAC TCA TGA TTT GAT TGT CTC TC-3

SEQ ID NO: 5- GAG AGA CAA TCA AAT CAT GAG TAA CAA GAG TAA CG-3

SEQ ID NO: 12 5-CAC TCA TGC AAG CGT CAC CGT TCG TGC ACG TAC-3

SEQ ID NO: 5- GTA CGT GCA CGA ACG GTG ACG CTT GCA TGA GTG-3

SEQ ID NO: 14 5- aac ggg agg gaa cct gca gg-3

Locate the amino acid sequence of the phaC1 _Ps6 SCL _-19 synthase through the array analysis (short-chain-length PHA) on amino acid position affects three-synthesizing activity (130, 325, 481), and then, SEQ ID NO: 15/16, SEQ ID NO: number by using the primers of SEQ ID NOS: 17/18 and 19/20, was produced in the pPs619C1300 containing the gene for the amino acid sequence of the phaC1 _Ps6 E130D, S325T and Q481M _-19 synthase encoding the mutant variants to SDM method ( Table 1).

phaC1 _Ps6-19 synthase variant Recombinant vector Nucleic Acid Substitution Amino acid substitutions primer pPs619C1300 GAA → GAT E130D SEQ ID NO: 15/16 AGC → ACC S325T SEQ ID NO: 17/18 CAG → ATG Q481M SEQ ID NO: 19/20

SEQ ID NO: 15 5- atc aac ctc atg acc gat gcg atg gcg ccg acc-3

SEQ ID NO 16: 5- ggt cgg cgc cat cgc atc ggt cat gag gtt gat- 3

SEQ ID NO: 17: 5- CTG ACC TTG CTG GTG ACC GTG CTT GAT ACC ACC- 3

SEQ ID NO: 18- 5-GGT GGT ATC AAG CAC GGT CAC CAG CAA GGT CAG- 3

SEQ ID NO: 19: 5- CGA GCA GCG GGC ATA TC A TGA GCA TCC TGA ACC CGC- 3

SEQ ID NO: 20 5-GCG GGT TCA GGA TGC TCA TGA TAT GCC CGC TGC TCG- 3

The prepared pPs619C1300 vector was digested with Sbf I / Nde I, and the pPs619C1300-CPPCT recombinant vector was prepared by inserting the cloned CP-PCT gene into the Sbf I / Nde I recognition site (FIG. 2).

(2) Construction of pTacCpPctNCvEC Plasmid

pTac99A (Park and Lee, J. Bacteriol. 185, 5391-5397, 2003) pTrc99A (Pharmacia Biotech) obtained by cutting a gene fragment containing a Tac promoter and transcription terminator obtained by cleaving a vector with Ssp I , Sweden) to create a pTaclac vector. Chromatium The phaEC of C. vinosum was amplified using primers of SEQ ID NO: 21 and SEQ ID NO: 22 using vinosum (DSMZ180) chromosome as a template.

SEQ ID NO: 21 ggaaatc cat ATGACGATGTTCTCGCTCATGGCG

SEQ ID NO: 22 ggaaatc catatg atc cag ggc cac tat ctc caa ctg

PTaclac vector was digested with Nde I and then amplified phaEC gene to prepare pTaclacNCvEC. In addition, the pct gene obtained by sequentially cutting pPs619C1300-CPPCT with EcoRI / XbaI was inserted into pTaclacNCvEC cut with EcoRI / XbaI to prepare pTacCpPctNCvEC (FIG. 3).

Example  2: 3- Hydroxypropionate - Lactate  Preparation of Copolymer

Example 1 a pct gene and the recombinant plasmid pPs619C1300-CPPCT and pTacCpPctNCvEC containing PHA produced by each gene was transformed into E. coli Top 10 (Invitrogen), E.coli Top10 / pPs619C1300-CPPCT and E. coli Top10 / pTacCpPctNCvEC was obtained.

The two kinds of transformants are cultured in two steps as follows. 3-hydroxypropionate-lactate copolymer was obtained. First, 100 mL of LB medium (Bacto ^TM Triptone (BD) 10 containing 100 mg / L of ampicillin, respectively, was used for transforming recombinant E. coli E. coli Top10 / pPs619C1300-CPPCT and E. coli Top10 / pTacCpPctNCvEC. After incubation for 24 hours in g / L, Bacto ^TM yeast extract (BD) 5 g / L; NaCl (amresco) 10 g / L), the cells were recovered by centrifugation for 15 minutes at 4 ℃, 1000g.

In the case of E. coli Top10 / pTacCpPctNCvEC, when the absorbance at ₆₀₀ nm (OD ₆₀₀ ) reached about 0.6, IPTG was added to 1 mM.

The recovered cells were transferred to MR medium containing 2 g / L of 3-hydroxypropionate (3-HP) and 100 mg / L of ampicillin (10 g of Glucose per 1 L, 6.67 g of KH ₂ PO ₄ , (NH ₄ ) ₂ HPO ₄ 4 g, MgSO ₄ .7H ₂ O 0.8 g, citric acid 0.8 g and trace metal solution 5 mL; composition of trace metal solution: 5 mL HM 5 mL per 1 L, FeSO ₄ 7H ₂ O 10 g, CaCl ₂ 2 g, ZnSO ₄ · 7H ₂ O 2.2 g, MnSO ₄ 4H ₂ O 0.5 g, CuSO ₄ · 5H ₂ O 1 g, (NH ₄ ) ₆ Mo ₇ O ₂ 4H ₂ O 0.1 g , And Na ₂ B ₄ O ₂ .10H ₂ O (0.02 g) for 3 days.

The culture solution was centrifuged at 4 ° C. and 1000 g for 15 minutes to recover the cells, washed four times with a sufficient amount of distilled water, and dried at 80 ° C. for 12 hours. After quantifying the cells completely removed moisture was reacted with methanol under sulfuric acid catalyst using chloroform as a solvent at 100 ℃. This was mixed by adding distilled water equal to half the volume of chloroform at room temperature and allowed to stand until it was separated into two layers. The chloroform layer in which the monomers of the methylated polymer were dissolved in two layers was taken and analyzed by gas chromatography. As an internal standard, benzoate was used.

As shown in FIGS. 4 and 5, in both E. coli Top10 / pPs619C1300-CPPCT and E. coli Top10 / pTacCpPctNCvEC cells, methyl-3-hydroxypropionate and methyl -Lactate (methyl-lactate) was detected it was confirmed that a novel [Poly (3-hydroxypropionate-co-lactate)] copolymer was produced by recombinant E. coli.

As described and demonstrated in detail above, the present invention has the effect of providing a novel 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)], lactating lactate Genes and polyhydroxyalkanos of enzymes that convert to -CoA (lactyl-CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) Preparation of 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)] characterized by culturing or cultivating cells or plants having the polyhydroxyalkanoate (PHA) synthase gene at the same time It has the effect of providing a method. The novel 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-co-lactate)] according to the present invention is a biodegradable polymer that can replace the use of conventional synthetic plastics and is also suitable for medical use. It is possible.

As described above in detail specific parts of the present invention, it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents. Simple modifications and variations of the present invention can be readily used by those skilled in the art, and all such variations or modifications can be considered to be included within the scope of the present invention.

<110> LG CHEM, LTD          Korea Advanced Institute of Science and Technology <120> Novel Copolymer of [Poly (3-hydroxypropionate-co-lactate)] and          Method for Preparing the Same <130> P06-B230 <160> 22 <170> KopatentIn 1.71 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ggaattcatg agaaaggttc ccattattac cgcagatga 39 <210> 2 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gctctagatt aggacttcat ttccttcaga cccattaagc cttctg 46 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aggcctgcag gcggataaca atttcacaca gg 32 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gcccatatgt ctagattagg acttcatttc c 31 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 7 <211> 1677 <212> DNA Pseudomonas sp. 6-19 (KCTC11027BP) <400> 7 atgagtaaca agagtaacga tgagttgaag tatcaagcct ctgaaaacac cttggggctt 60 aatcctgtcg ttgggctgcg tggaaaggat ctactggctt ctgctcgaat ggtgcttagg 120 caggccatca agcaaccggt gcacagcgtc aaacatgtcg cgcactttgg tcttgaactc 180 aagaacgtac tgctgggtaa atccgggctg caaccgacca gcgatgaccg tcgcttcgcc 240 gatccggcct ggagccagaa cccgctctat aaacgttatt tgcaaaccta cctggcgtgg 300 cgcaaggaac tccacgactg gatcgatgaa agtaacctcg cccccaagga tgtggcgcgt 360 gggcacttcg tgatcaacct catgaccgaa gcgatggcgc cgaccaacac cgcggccaac 420 ccggcggcag tcaaacgctt ttttgaaacc ggtggcaaaa gcctgctcga cggcctctcg 480 cacctggcca aggatctggt acacaacggc ggcatgccga gccaggtcaa catgggtgca 540 ttcgaggtcg gcaagagcct gggcgtgacc gaaggcgcgg tggtgtttcg caacgatgtg 600 ctggaactga tccagtacaa gccgaccacc gagcaggtat acgaacgccc gctgctggtg 660 gtgccgccgc agatcaacaa gttctacgtt ttcgacctga gcccggacaa gagcctggcg 720 cggttctgcc tgcgcaacaa cgtgcaaacg ttcatcgtca gctggcgaaa tcccaccaag 780 gaacagcgag agtggggcct gtcgacctac atcgaagccc tcaaggaagc ggttgacgtc 840 gttaccgcga tcaccggcag caaagacgtg aacatgctcg gggcctgctc cggcggcatc 900 acttgcactg cgctgctggg ccattacgcg gcgattggcg aaaacaaggt caacgccctg 960 accttgctgg tgagcgtgct tgataccacc ctcgacagcg acgtcgccct gttcgtcaat 1020 gaacagaccc ttgaagccgc caagcgccac tcgtaccagg ccggcgtact ggaaggccgc 1080 gacatggcga aggtcttcgc ctggatgcgc cccaacgatc tgatctggaa ctactgggtc 1140 aacaattacc tgctaggcaa cgaaccgccg gtgttcgaca tcctgttctg gaacaacgac 1200 accacacggt tgcccgcggc gttccacggc gacctgatcg aactgttcaa aaataaccca 1260 ctgattcgcc cgaatgcact ggaagtgtgc ggcaccccca tcgacctcaa gcaggtgacg 1320 gccgacatct tttccctggc cggcaccaac gaccacatca ccccgtggaa gtcctgctac 1380 aagtcggcgc aactgtttgg cggcaacgtt gaattcgtgc tgtcgagcag cgggcatatc 1440 cagagcatcc tgaacccgcc gggcaatccg aaatcgcgct acatgaccag caccgaagtg 1500 gcggaaaatg ccgatgaatg gcaagcgaat gccaccaagc atacagattc ctggtggctg 1560 cactggcagg cctggcaggc ccaacgctcg ggcgagctga aaaagtcccc gacaaaactg 1620 ggcagcaagg cgtatccggc aggtgaagcg gcgccaggca cgtacgtgca cgaacgg 1677 <210> 8 <211> 559 <212> PRT Pseudomonas sp. 6-19 (KCTC11027BP) <400> 8 Met Ser Asn Lys Ser Asn Asp Glu Leu Lys Tyr Gln Ala Ser Glu Asn   1 5 10 15 Thr Leu Gly Leu Asn Pro Val Val Gly Leu Arg Gly Lys Asp Leu Leu              20 25 30 Ala Ser Ala Arg Met Val Leu Arg Gln Ala Ile Lys Gln Pro Val His          35 40 45 Ser Val Lys His Val Ala His Phe Gly Leu Glu Leu Lys Asn Val Leu      50 55 60 Leu Gly Lys Ser Gly Leu Gln Pro Thr Ser Asp Asp Arg Arg Phe Ala  65 70 75 80 Asp Pro Ala Trp Ser Gln Asn Pro Leu Tyr Lys Arg Tyr Leu Gln Thr                  85 90 95 Tyr Leu Ala Trp Arg Lys Glu Leu His Asp Trp Ile Asp Glu Ser Asn             100 105 110 Leu Ala Pro Lys Asp Val Ala Arg Gly His Phe Val Ile Asn Leu Met         115 120 125 Thr Glu Ala Met Ala Pro Thr Asn Thr Ala Ala Asn Pro Ala Ala Val     130 135 140 Lys Arg Phe Phe Glu Thr Gly Gly Lys Ser Leu Leu Asp Gly Leu Ser 145 150 155 160 His Leu Ala Lys Asp Leu Val His Asn Gly Gly Met Pro Ser Gln Val                 165 170 175 Asn Met Gly Ala Phe Glu Val Gly Lys Ser Leu Gly Val Thr Glu Gly             180 185 190 Ala Val Val Phe Arg Asn Asp Val Leu Glu Leu Ile Gln Tyr Lys Pro         195 200 205 Thr Thr Glu Gln Val Tyr Glu Arg Pro Leu Leu Val Val Pro Pro Gln     210 215 220 Ile Asn Lys Phe Tyr Val Phe Asp Leu Ser Pro Asp Lys Ser Leu Ala 225 230 235 240 Arg Phe Cys Leu Arg Asn Asn Val Gln Thr Phe Ile Val Ser Trp Arg                 245 250 255 Asn Pro Thr Lys Glu Gln Arg Glu Trp Gly Leu Ser Thr Tyr Ile Glu             260 265 270 Ala Leu Lys Glu Ala Val Asp Val Val Thr Ala Ile Thr Gly Ser Lys         275 280 285 Asp Val Asn Met Leu Gly Ala Cys Ser Gly Gly Ile Thr Cys Thr Ala     290 295 300 Leu Leu Gly His Tyr Ala Ala Ile Gly Glu Asn Lys Val Asn Ala Leu 305 310 315 320 Thr Leu Leu Val Ser Val Leu Asp Thr Thr Leu Asp Ser Asp Val Ala                 325 330 335 Leu Phe Val Asn Glu Gln Thr Leu Glu Ala Ala Lys Arg His Ser Tyr             340 345 350 Gln Ala Gly Val Leu Glu Gly Arg Asp Met Ala Lys Val Phe Ala Trp         355 360 365 Met Arg Pro Asn Asp Leu Ile Trp Asn Tyr Trp Val Asn Asn Tyr Leu     370 375 380 Leu Gly Asn Glu Pro Pro Val Phe Asp Ile Leu Phe Trp Asn Asn Asp 385 390 395 400 Thr Thr Arg Leu Pro Ala Ala Phe His Gly Asp Leu Ile Glu Leu Phe                 405 410 415 Lys Asn Asn Pro Leu Ile Arg Pro Asn Ala Leu Glu Val Cys Gly Thr             420 425 430 Pro Ile Asp Leu Lys Gln Val Thr Ala Asp Ile Phe Ser Leu Ala Gly         435 440 445 Thr Asn Asp His Ile Thr Pro Trp Lys Ser Cys Tyr Lys Ser Ala Gln     450 455 460 Leu Phe Gly Gly Asn Val Glu Phe Val Leu Ser Ser Ser Gly His Ile 465 470 475 480 Gln Ser Ile Leu Asn Pro Pro Gly Asn Pro Lys Ser Arg Tyr Met Thr                 485 490 495 Ser Thr Glu Val Ala Glu Asn Ala Asp Glu Trp Gln Ala Asn Ala Thr             500 505 510 Lys His Thr Asp Ser Trp Trp Leu His Trp Gln Ala Trp Gln Ala Gln         515 520 525 Arg Ser Gly Glu Leu Lys Lys Ser Pro Thr Lys Leu Gly Ser Lys Ala     530 535 540 Tyr Pro Ala Gly Glu Ala Ala Pro Gly Thr Tyr Val His Glu Arg 545 550 555 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atgcccggag ccggttcgaa 20 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cgttactctt gttactcatg atttgattgt ctctc 35 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gtacgtgcac gaacggtgac gcttgcatga gtg 33 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aacgggaggg aacctgcagg 20 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 atcaacctca tgaccgatgc gatggcgccg acc 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ggtcggcgcc atcgcatcgg tcatgaggtt gat 33 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ctgaccttgc tggtgaccgt gcttgatacc acc 33 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ggtggtatca agcacggtca ccagcaaggt cag 33 <210> 19 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cgagcagcgg gcatatcatg agcatcctga acccgc 36 <210> 20 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gcgggttcag gatgctcatg atatgcccgc tgctcg 36 <210> 21 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ggaaatccat atgacgatgt tctcgctcat ggcg 34 <210> 22 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 ggaaatccat atgatccagg gccactatct ccaactg 37  

Claims (11)

3-hydroxypropionate-lactate copolymers containing lactate and 3-hydroxypropionate as repeat units [poly (3-hydroxypropionate-co-lactate)]. Of enzymes that convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA A 3-hydroxypropionate-lactate copolymer [poly (3-hydroxypropionate-) characterized by culturing or cultivating a cell or plant having a gene and a polyhydroxyalkanoate (PHA) synthase gene at the same time. co-lactate)]. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate that does not have both genes. It is obtained by transforming the gene of the enzyme to convert to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) and the gene of PHA synthase using lactyl-CoA as a substrate. The method according to claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxy to a cell or plant having a gene of PHA synthase using lactyl-CoA as a substrate. And a method obtained by transforming alkanoate (3-hydroxyalkanoate) with a gene of an enzyme that converts 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA). The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3). -hydroxyalkanoyl-CoA) is obtained by transforming a cell or plant having the gene of the enzyme converting with a gene of PHA synthase using lactyl-CoA as a substrate. The method of claim 2, wherein the lactate is converted to lactyl-CoA and 3-hydroxyalkanoate is converted into 3-hydroxyalkanoyl-CoA. The gene of the enzyme converting to CoA) is propionyl-CoA transferase gene ( pct ). The method of claim 2, wherein the polyhydroxyalkanoate (PHA) synthase gene is phaC1 _{ps6 -19} from Pseudomonas sp. 6-19. The method of claim 2, wherein the polyhydroxyalkanoate (PHA) synthase gene is a gene encoding an amino acid sequence of which E130D, S325T and Q481M are mutated in the amino acid sequence of SEQ ID NO. 7. The method of claim 2, wherein the cell is a microorganism. 10. The method of claim 9, wherein the microorganism is Escherichia coli. The method of claim 2, wherein the culturing or cultivation is performed in an environment containing 3-hydroxypropionate (3-HP).

Images