KR100926489B1 - Novel Copolymer of [Poly3-hydroxyvutyrate-co-lactate] and Method for Preparing the Same - Google Patents

Abstract

The present invention relates to a novel 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)] and a preparation method thereof, and more particularly to lactate (lactate) lactyl-CoA (lactyl- CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA, the enzyme of phosphate butylase, phosphorance Novel copolymer consisting of monomers of lactate and 4-hydroxybutyrate using cells or plants having the butylase gene, butyrate kinase gene and polyhydroxyalkanoate (PHA) synthase gene Oxybutyrate-lactate copolymer) and novel 4-hydroxybutyrate-lactate copolymer.

The novel 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)] according to the present invention is a biodegradable polymer that can replace the use of conventional synthetic plastics and can also be used for medical purposes. Do.

Lactate, 4-hydroxybutyrate, copolymer

Description

Novel Copolymer of [Poly (3-hydroxyvutyrate-co-lactate)] and Method for Preparing the Same

Figure 1 is a schematic diagram showing a system of constant expression of the operon form in which PHA synthase and CP-PCT are expressed together.

Figure 2 shows a sequence map of the recombinant plasmid pPs619C1300-CPPCT comprising the PHA synthase gene and CP-PCT gene according to the present invention.

Figure 3 shows a sequence map of the recombinant plasmid pTacCpPctNCvEC comprising the PHA synthase gene and CP-PCT gene according to the present invention.

Figure 4 shows the sequence map of the recombinant plasmid pMCSPtbBuk containing the Ptb and Buk gene according to the present invention

Figure 5 shows the gas chromatogram results of analyzing the components of the copolymer biosynthesized by recombinant E. coli transformed with the pPs619C1300-CPPCT / pMCSPtbBuk plasmid.

Figure 6 shows the gas chromatogram results of analyzing the components of the copolymer biosynthesized by recombinant E. coli transformed with the pTacCpPctNCvEC / pMCSPtbBuk plasmid.

Field of invention

The present invention relates to a novel 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)] and a preparation method thereof, and more particularly to lactate (lactate) lactyl-CoA (lactyl- CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA, the enzyme of phosphate butylase, phosphorance Novel copolymer consisting of monomers of lactate and 4-hydroxybutyrate using cells or plants having the butylase gene, butyrate kinase gene and polyhydroxyalkanoate (PHA) synthase gene Oxybutyrate-lactate copolymer) and novel 4-hydroxybutyrate-lactate copolymer.

Background of the Invention

Polylactate (PLA), a polymer having lactate as a monomer, is a representative biodegradable polymer and has high applicability as a general purpose polymer or a medical polymer. Currently, PLA is produced by polymerizing lactate produced by microbial fermentation, but only low molecular weight (1000-5000 Daltons) PLA is produced by the direct polymerization of lactate. In order to synthesize 100,000 Daltons or more, there is a method of polymerizing PLA from a low molecular weight PLA obtained by direct polymerization of lactate to a PLA having a higher molecular weight using a chain coupling agent. The method for producing PLA having a molecular weight has a disadvantage in that the process is complicated due to the addition of an organic solvent or a coupling agent, and it is not easy to remove them. Currently commercially available high molecular weight PLA production process is a chemical synthesis method of converting lactate to lactide (lactide), and then synthesize the PLA through the ring-opening condensation reaction of the lactide ring.

On the other hand, PHAs are polyesters that microorganisms accumulate inside as energy or carbon source storage materials when there are excessive carbon sources and other nutrients such as phosphorus, nitrogen, magnesium, and oxygen are insufficient. PHA is regarded as a material to replace conventional synthetic plastics because it has properties similar to synthetic polymers derived from petroleum and shows complete biodegradability.

Conventionally known PHAs can be classified into short-chain-length PHAs (SCL-PHAs) and medium-chain-length PHAs (MCL-PHAs) with long carbon atoms. The gene of the enzyme that synthesizes PHA is Ralstonia It was isolated from eutropha , Pseudomonas, etc., and PHA composed of various kinds of monomers was synthesized through the recombinant microorganism transformed with the enzyme gene synthesizing the PHA (Qi et al ., FEMS Microbiol . Lett ., 157: 155, 1997; Qi et al ., FEMS Microbiol . Lett ., 167: 89, 1998; Langenbach et al ., FEMS Microbiol . Lett ., 150: 303, 1997; WO 01/55436; US 6,143,952; WO 98/54329; WO 99/61624).

In order to produce PHA in microorganisms, enzymes for converting metabolites of microorganisms to PHA monomers and PHA synthase synthesizing PHA polymers using PHA monomers are essential. PHA synthase synthesizes PHA using hydroxyacyl-CoA as a substrate, and Ralstonia is an enzyme that can provide hydroxyacyl-CoA, a substrate of PHA. α-ketothiolase (PhaA) derived from eutropha et al., acetoacetyl-CoA reductase (PhaB), 3-hydroxydecanoyl-ACP: CoA transferase derived from Pseudomonas (3- hydroxydecanoyl-ACP: CoA transferase: PhaG), Aeromonas caviae and Pseudomonas The (R) derived from a specific enol aeruginosa -CoA hydroxy latte rise [(R) -specific enoyl-CoA hydratase: PhaJ] (Fukui et al ., J. Bacteriol ., 180: 667, 1998; Tsuge et al ., FEMS Microbiol . Lett ., 184: 193, 2000), Escherichia coli and Pseudomonas 3-ketoacyl-ACP reductase (FabG) derived from aeruginosa et al. (Taguchi et. al ., FEMS Microbiol . Lett ., 176: 183, 1999; Ren et al ., J. Bacteriol ., 182: 2978, 2000; Park et al ., FEMS Microbiol . Lett ., 214: 217, 2002), Clostridium phosphotransbutylase (Ptb) gene derived from acetobutyricum , butyrate kinase (Buk; Liu and Steinbuchel, Appl) Environ Microbiol , 66: 739, 2000), Cat2 derived from Clostridium kluyveri (Hein et al . FEMS Microbiol . Lett ., 15: 411, 1997). Various enzymes have been synthesized using hydroxyalkanoates hydroxylated at various carbon positions (mostly 3, 4, 5, 6) using these enzymes.

However, it has been reported that there is little reactivity of PHA synthase to hydroxylated hydroxyalkanoates at position 2 (Zhang et al. al ., Appl . Microbiol . Biotechnol ., 56: 131, 2001; Valentin and Steinbuchel, Appl. Microbiol. Biotechnol., 40: 699, 1994). To date in the PHA polymerase for raktil -CoA Although there have been reports of the reactivity of PHA synthase to lactyl-CoA through in vitro activity measurement, the reactivity of PHA synthase to lactyl-CoA is very weak (Zhang et al. al ., Appl . Microbiol. Biotechnol ., 56: 131, 2001; Valentin and Steinbuchel, Appl . Microbiol . Biotechnol ., 40: 699, 1994). That is, hydroxyalkanoates, such as 2-carbon-hydroxylated lactate, are not suitable for the substrate specificity of PHA synthase, so that PHA and its copolymers are produced naturally or using recombinant cells or plants. There is no example.

US Patent Publication No. 20040076982 discloses a method for synthesizing lactate in glucose, biosynthesizing lactate with lactyl-CoA, and biosynthesis of 4-hydroxybutyrate-CoA with lactyl-CoA, but not with lactyl- There is no disclosure in which a copolymer is prepared using CoA and 3-hydroxyalkanoate-CoA.

Accordingly, the present inventors have made intensive efforts to prepare high molecular weight 4-hydroxybutyrate-lactate copolymer [poly (3-hydroxyalkanoate-co-lactate)] using microorganisms. CoA), Clostridium , a gene for an enzyme that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. propionicum Derived propinyl-CoA transferase gene ( pct ), Clostridium 4-hydroxybutyrate-lactate by culturing recombinant E. coli transformed with a gene of phosphotransbutylase (Ptb) gene, butyrate kinase (Buk) and PHA synthase derived from acetobutyricum Copolymer [(poly (4-hydroxybutyrate-co-lactate)]] was confirmed that the present invention was completed.

It is an object of the present invention to provide a novel polymer, 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]].

Another object of the present invention is to provide a method for preparing the 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]].

In order to achieve the above object, the present invention provides a 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]] containing a lactate and 4-hydroxybutyrate as a repeating unit. .

The invention also converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. Culture or cultivate a cell or plant having the gene of the enzyme that converts to the phosphotransbutylase gene, the butyrate kinase gene, and the polyhydroxyalkanoate (PHA) synthase gene Provided is a method for preparing 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]), which is characterized by the above-mentioned.

In the present invention, the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to the cell or plant that does not have the gene. Synthesis of enzymes that convert to hydroxyalkanoyl-CoA, phosphotransbutylase gene, butyrate kinase gene, and polyhydroxyalkanoate (PHA) synthesis It may be characterized in that it is obtained by transformation with an enzyme gene.

In the present invention, the lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate (3-hydroxyalkanoate) 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA ) Is a propionyl-CoA transferase gene ( pct ) can be characterized in that, the phosphotransbutylase gene is derived from Clostridium acetobutyricum (Clostridium acetobutyricum) The butyrate kinase gene may be derived from Clostridium acetobutyricum.

In the present invention, the polyhydroxyalkanoate (PHA) synthase gene is Pseudomonas genus ( Pseudomonas sp . ) _{PhaC1 ps6 -19} derived from 6-19, wherein the polyhydroxyalkanoate (PHA) synthase gene is an amino acid of E130D, S325T and Q481M mutated in the amino acid sequence of SEQ ID NO: It may be characterized in that the gene encoding the sequence.

In the present invention, the cell may be characterized in that the microorganism, the microorganism may be characterized in that the E. coli.

In the present invention, the culture or cultivation may be characterized in that it is carried out in an environment containing 4-hydroxybutyrate (3-HP).

Cells or plants having the ability to produce the 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]) may be (i) lactate the cells or plants that do not have all of the genes. Phosphotransbutyl, an enzyme gene that converts lactyl-CoA and converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Obtained by transformation with the phosphotransbutylase gene, butyrate kinase gene and polyhydroxyalkanoate (PHA) synthase gene, or (ii) PHA synthase using lactyl-CoA as a substrate. Cells or plants with the gene of Lactate to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl -Enzyme to convert to CoA) A cell or plant having a gene of an enzyme that converts lactate to lactyl-CoA, or is obtained by transformation with a gene, a phosphotransbutylase gene and a butyrate kinase gene. Obtained by transformation with a phosphotransbutylase gene, a butyrate kinase gene and a polyhydroxyalkanoate (PHA) synthase gene, or (iv) a phosphotransbutylase Cells or plants bearing genes are converted to lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA CoA) enzyme, butyrate kinase gene and polyhydroxyalkanoate (P) converts lactate to lactyl-CoA and 3-hydroxy by obtaining a transformation with a PHA synthetase gene or (v) a cell or plant having a butyrate kinase gene. Genes of enzymes that convert 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA, phosphotransbutylase and polyhydroxyalkanoate: PHA) obtained by transformation with the synthase gene, or (vi) converting the genes and lactates of the PHA synthase using lactyl-CoA as a substrate to lactyl-CoA (lactyl-CoA) and 3-hydroxy Cells or plants having an enzyme gene that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA are phosphotransbutylase gene and butyrate kinase (but obtained by transformation with a yrate kinase gene, or (vii) converting lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalka Gene and butyrate kinase of PHA synthase using lactyl-CoA as a substrate for cells or plants having enzyme and phosphotransbutylase genes converting to 3-hydroxyalkanoyl-CoA kinase) genes, or (viii) genes and butyrates of enzymes that convert 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. Obtained by transforming a cell or plant having a butyrate kinase gene with a PHA synthase gene and a phosphotransbutylase gene, or (ix) lactyl-CoA as a substrate Cells or plants having the PHA synthase gene and the butyrate kinase gene are used to convert lactate to lactyl-CoA and 3-hydroxyalkanoate. Is obtained by the transformation of the enzyme to the 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) and the phosphotransbutylase gene, or (x) the gene of the PHA synthase and Cells or plants bearing the phosphotransbutylase gene were converted to lactate into lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalka. Obtained by transformation with a gene of enzyme converting to 3-hydroxyalkanoyl-CoA and butyrate kinase gene, or (xi) phosphotransbutylase Gene or lactate of PHA synthase using lactyl-CoA as a substrate is converted to lactyl-CoA (lactyl-CoA) and cells or plants carrying the gene and butyrate kinase gene. Obtained by transforming alkanoate (3-hydroxyalkanoate) with a gene of an enzyme that converts 3-hydroxyalkanoyl-CoA, or (xii) lactate to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA, a gene for enzymes, phosphotransbutylase ) Or a cell or plant having a gene and butyrate kinase gene is transformed with a gene of PHA synthase using lactyl-CoA as a substrate, or (xiii) phosphotransyl butylase (phosphotrans) Obtained by transforming a cell or plant having a butylase gene, a butyrate kinase gene and a polyhydroxyalkanoate (PHA) synthase gene with a gene of an enzyme that converts gene lactate to lactyl-CoA Or (xiv) convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Obtained by transforming a cell or plant having an enzyme gene, a butyrate kinase gene and a polyhydroxyalkanoate (PHA) synthase gene, with a gene phosphotransbutylase gene Or (xv) convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3- cells or plants carrying the enzyme gene, phosphotransbutylase and polyhydroxyalkanoate (PHA) synthase genes, which are converted to hydroxyalkanoyl-CoA), are transfected with a butyrate kinase gene. It may be characterized in that obtained by the conversion, but is not limited thereto.

In addition, the gene of PHA synthase using lactyl-CoA as a substrate may be characterized as phaC , pct It may be characterized in that it is transformed with a recombinant vector containing a gene and at the same time transformed with a vector containing phaC or phaC is inserted on a chromosome.

Various microorganisms are known as cells having the gene of the PHA synthase (KR 10-250830 B1). For example,Achromobacter sp.,Achromobacter xylosoxidans IncludingAchromobacter Microorganisms,Acidovorax delafieldii,Acidovax facilis,Acinetobacter sp.,Acinetobacter calcoaceticus,Acinetobacter lwoffii IncludingAcinetobacter Microorganisms,Actinomyces  sp.,Aeromonas caviae,Aeromonas hydrophila,Aeromonas salmonicida IncludingAeromonas Microorganisms,Alcaligenes aestus,Alcaligenes denitrificans,Alcaligenes eutrophus (Ralstonia eutrophaRenamed back toWautersia eutrophaRenamed to),Alcaligenes faecalis,Alcaligenes latus,Alcaligenes pacificus Alcaligenes paradoxus,Alcaligenes venestus IncludingAlcaligenes Microorganisms,Alteromonas macleodii,Amoebobacter roseu,Amoebobacter pendens IncludingAmoebobacter Microorganisms,Aphanocapa sp.,Aphanothece sp.Aquaspirillum autotrophicum,Azorhizobium caulinodans,Azospirillum sp.,Azospirillum brasilense,Azospirillum lipoferum IncludingAzospirillum Microorganisms,Azotobacter sp.,Azotobacter agilis,Azotobacter chroococcum,Azotobacter macrocytogenes,Azotobacter vinelandii IncludingAzotobacter Microorganisms,Bacillus anthracis, Bacillus cereus , Bacillus megaterium , Bacillus subtillus , Bacillus thuringiensis IncludingBacillus Microorganisms,Beggiatoa sp.,Beggiatoa alba IncludingBeggiatoa Microorganisms,Beijerinckia indicus , Beijerinckia mobilis IncludingBeijerinckia Microorganisms,Beneckia natrigens , Beneckea pelagia IncludingBeneckea Microorganisms,Bordetella pertussis , Bradyrhizobium japonicum, Caryophamon latum , Caulobacter bacteroides , Caulobacter crescentus IncludingCaulobacter Microorganisms,Chlororoflexus aurantiacus , Chlorogloea fritschiiIncludingChlororogloea Microorganisms,Chromatium minutissimum , Chromatium okenii , Chromatium tepidum IncludingChromatium Microorganisms,Chromobacterium violaceum IncludingChromobacterium Microorganisms,Clostridium botulinum, Clostridium sphenoides IncludingClostridium Microorganisms,Comamonas acidovorans , Comamonas testosteroni IncludingComamonas Microorganisms,Corynebacterium autotrophicum , Corynebacterium hydrocarboxydans IncludingCorynebacterium Microorganisms,Cyanobacteria,Derxia gummosaContainingDerxia Microorganisms,Desulfococcus multivorans , Desulfonema limicola , Desulfonema magnum IncludingDesulfonema Microorganisms,Desulfosacina variabilis , Desulfovibrio sapovorans, Ectothiorhodospira halochloris , Ectothiorhodospira mobilis , Ectothiorhodospira vacuolata IncludingEctothiorhodospira Microorganisms,Ferrobacillus ferroxidans , Flavobacterium sp.,Haemophilus influenzae , Halobacterium gibbonsii , Halobacterium volcanii IncludingHalobacterium Microorganisms,Haloferax mediterranei , Hydroclathratus clathratus , Hydrogenomonas facilis, Hydrogenophaga flava , Hydrogenophaga pseudoflava , Hydrogenophaga taeniospiralisIncludingHydrogenophaga Microorganisms,Hyphomicrobium vulgareContainingHyphomicrobium Microorganisms,Ilyobacter delafieldii , Labrys monachus , Lamprocystis reseopersicina , Lampropedia hyalina , Legionella sp.,Leptothrix discophorus, Methylobacterium AM1,Methylobacterium extorquens IncludingMethylobacterium Microorganisms,Methylococcus thermophilus , Methlocystis parvus , Methylomonas methanica , Methylosinus sporium , Methylosinus trichosporium IncludingMethylosinus Microorganisms,Methylovibrio soehngenii , Micrococcus denitrificans, Micrococcus halodenitrificans IncludingMicrococcus Microorganisms,Mycobacterium album , Mycobacterium vacae IncludingMycobacterium Microorganisms,Nitrobacter agilis , Nitrobacter winogradskyi IncludingNitrobacter Microorganisms,Nocardia alba , Nocardia asteroides , Nocardia lucida , Nocardia rubra IncludingNocardia Microorganisms,Paracoccus dentrificans , Oscillatoria limosa , Penicillium cyclopium , Photobacterium mandapamensis , Photobacterium phosphoreum IncludingPhotobacterium Microorganisms,Physarum ploycephalumWowPseudomonas glathei, Pseudomonas indigofera , Pseudomonas lemonieri , Pseudomonas mallei , Pseudomonas marina , Pseudomonas mixta , Pseudomonas oleovorans , Pseudomonas oxalaticus, Pseudomonas pseudoalcaligenes , Pseudomonas aeruginosa , Pseudomonas alcaligenes, Pseudomonas asplenii , Pseudomonas butanovora , Pseudomonas cepacia , Pseudomonas coronafaciens , Pseudomonas dacunhae , Pseudomonas denitrificans , Pseudomonas diminuta , Pseudomonas echinoides , Pseudomonas fluorescens , Pseudomonas putida , Pseudomonas rubrilineas , Pseudomonas saccharophila , Pseudomonas stutzeri , Pseudomonas syringae , Pseudomonas thermophilus , Pseudomonas viridiflava IncludingPseudomonas Microorganisms,Ralstonia Microorganisms,Rhizobium hedysarum , Rhizobium lupini , Rhizobium meliloti , Rhizobium phaseoli, Rhizobium trifoli  IncludingRhizobium Microorganisms,Rhodobacillus Microorganisms,Rhodobacter capsulatus , Rhodobacter sphaeroides IncludingRhodobacter Microorganisms,Rhodococcus rhodochrousContainingRhodococcus Microorganisms,Rhodocyclus gelatinosus , Rhodocyclus tenuis IncludingRhodocyclus Microorganisms,Rhodomicrobium vannielii Wow Rhodopseudomonas acidophila , Rhodopseudomonas capsulata IncludingRhodopseudomonas Microorganisms,Rhodospirillum molischianum , Rhodospirillum rubrum IncludingRhodospirillum Microorganisms,Sphingomonas paucimobilis , Spilrillum itersomii , Spilrillum serpens IncludingSpilrillum Microorganisms,Spirulina jenneri , Spirulina maxima , Spirulina subsaksa IncludingSpirulina Microorganisms,Staphylococcus aureus , Staphylococcus epidermidis , Staphylococcus xylosus IncludingStaphylococcus Microorganisms,Stella humosa , Stella vacuolata IncludingStella Microorganisms,Streptomyces antibioticus , Streptomyces coelicolor IncludingStreptomyces Microorganisms,Syntrophomonas wolfei , Thermophilic cyanobacteria , Thermus thermophilus,Thiobacillus A2,Thiobacillus acidophilus , Thiobacillus versutus IncludingThiobacillus Microorganisms,Thiocapsa pfennigii IncludingThiocapsaMicroorganisms,Thiocystis violacea,Vibrio parahaemolyticus,Xanthobacter autotrophicus , Xanthomonas maltophilia , Zoogloea ramigera IncludingZoogloea Genus microorganisms.

In the present invention, the enzyme for converting 4-hydroxybutyrate to 4-hydroxybutyryl-CoA is Clostridium The Cat2 gene from kluyveri can be used, and the Cat2 gene can achieve the same effect as using the Ptb and buk genes.

In the present invention, lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate is converted to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA). Cells or plants having the same enzyme gene, phosphobutylbutylase gene, phosphobutylbutylase gene, butyrate kinase gene and polyhydroxyalkanoate (PHA) synthase gene simultaneously are 4-hydroxybutyrate and The 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]] can be prepared by culturing or cultivating in an environment including lactate, and using lac from other carbon sources such as glucose or citric acid. Cells or plants capable of biosynthesizing tate and 4-hydroxybutyrate can be prepared without the addition of the copolymer.

Transfection of a plant for producing a plant containing the gene of the converting enzyme of the present invention and the gene of the synthetase can be achieved by a conventional method using Agrobacterium, a viral vector, or the like. For example, a microorganism of the genus Agrobacterium may be transformed with a recombinant vector containing a gene according to the present invention, and then the transformed Agrobacterium microorganism may be infected with tissues of a target plant to obtain a transfected plant. More specifically, (a) pre-culture the explant of the plant (preplant), and then transfected by co-culture with the transformed Agrobacterium; (b) culturing the transfected explants in a callus induction medium to obtain callus; And (c) cutting the obtained callus, and culturing it in shoot induction medium to form shoots, thereby producing a transfected plant.

In the present invention, the term "explant" refers to a slice of tissue cut out of a plant, and includes cotyledon or hypocotyl. The explants of the plant used in the method of the present invention may be cotyledons or hypocotyls, it is more preferable to use the cotyledons obtained by germinating in MS medium after disinfecting and washing the seeds of the plants.

Transfection target plants usable in the present invention include, but are not limited to, tobacco, tomatoes, peppers, beans, rice, corn, and the like. In addition, even if the plant used for transformation is a sexually propagating plant, it will be apparent to those skilled in the art that it can be repeatedly reproduced by tissue culture or the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

Example  One: pct  Gene and PHA  Construction of Recombinant Plasmids Containing Genes

To prepare 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]], recombinant plasmids pPs619C1300-CPPCT and pTacCpPctNCvEC containing the pct and PHA genes were prepared.

(1) Preparation of pPs619C1300-CPPCT plasmid

The pct gene is Clostridium propionicum) propionyl -CoA transferase dehydratase (pronpionyl-CoA transferase derived from: was used as the CP-PCT) gene, PHA synthase gene is 6-10 Pseudomonas (Pseudomonas sp. 6-19) PHA synthase gene was used.

As shown in FIG. 1, a system for constitutive expression of operon in which PHA synthase and CP-PCT are expressed together was constructed. CP-PCT is known to be highly toxic to host microorganisms at the time of expression.In the IPTG expression system using tac or T7 promoters, which are widely used for recombinant protein expression, all recombinant microorganisms are killed at the same time as expression-inducing substances are added. do. For this reason, a constantly expressed system was used, which is weakly expressed but continuously expressed as the microorganism grows. CP-PCT gene is Chostridium template of chromosomal DNA of propionicum (DSM1682), pct Gene sequence (Selmer et al . , Eur J Biochem . , 269: 372, 2002) was obtained by PCR using a primer having a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2.

SEQ ID NO: 5-ggaattcATGAGAAAGGTTCCCATTATTACCGCAGATGA

SEQ ID NO: 5-gctctagattaggacttcatttccttcagacccattaagccttctg

At this time, the Nde I restriction enzyme site originally present in the wild-type CP-PCT was removed using the SDM method for ease of cloning. In addition, overlapping PCR was performed using primers having the nucleotide sequences of SEQ ID NOs: 3 and 4 to add the Sbf I / Nde I recognition sites.

SEQ ID NO: 5-agg cct gca ggc gga taa caa ttt cac aca gg- 3

SEQ ID NO: 5-gcc cat atg tct aga tta gga ctt cat ttc c- 3

Pseudomonas sp . ) 6-19 (KCTC11027BP) Pseudomonas species (Pseudomonas to isolate derived PHA synthase (phaC1 _{Ps6 -19)} gene sp . ) Extracting the total DNA of 6-19 and, phaC1 _{Ps6 -19} gene sequence to prepare a (transmission aejin, Master's Thesis, Department of Chemical and Biomolecular Engineering, KAIST, 2004) SEQ ID NO primer having the base sequence of the 5 and 6 based on the , by performing a PCR to yield the phaC1 _{Ps6 -19} gene, exhibited a base sequence of the phaC1 _{Ps6 -19} gene is shown in SEQ ID NO: 7, exhibited an amino acid sequence calculated therefrom is shown in SEQ ID NO: 8.

SEQ ID NO: 5- GAG AGA CAA TCA AAT CAT GAG TAA CAA GAG TAA CG -3

SEQ ID NO 6: 5- CAC TCA TGC AAG CGT CAC CGT TCG TGC ACG TAC -3

By inserting the thus obtained phaC1 _{Ps6 -19} gene into a BstBI / SbfI recognition site of pBluescript II (Stratagene Co., USA) to prepare a recombinant vector pPs619C1. In order to make a phaC1 _{Ps6 -19} synthase gene fragment containing only one BstBI / SbfI recognition site at each end, the BstBI position, which is inherent in the BstBI / SbfI recognition region, was first removed without conversion of amino acids by SDM (site directed mutagenesis) method. In order to add a site, overlapping PCR was performed using primers having the nucleotide sequences of SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, and SEQ ID NOs: 13 and 14.

SEQ ID NO: 5- atg ccc gga gcc ggt tcg aa-3

SEQ ID NO: 10: 5- CGT TAC TCT TGT TAC TCA TGA TTT GAT TGT CTC TC-3

SEQ ID NO: 5- GAG AGA CAA TCA AAT CAT GAG TAA CAA GAG TAA CG-3

SEQ ID NO: 12 5-CAC TCA TGC AAG CGT CAC CGT TCG TGC ACG TAC-3

SEQ ID NO: 5- GTA CGT GCA CGA ACG GTG ACG CTT GCA TGA GTG-3

SEQ ID NO: 14 5- aac ggg agg gaa cct gca gg-3

Locate the amino acid sequence of the phaC1 _Ps6 SCL _-19 synthase through the array analysis (short-chain-length PHA) on amino acid position affects three-synthesizing activity (130, 325, 481), and then, SEQ ID NO: 15/16, SEQ ID NO: No. 17/18 was prepared and using the primers of SEQ ID NOS: 19/20, pPs619C1300 containing the gene for the amino acid sequence of the phaC1 _Ps6 E130D, S325T and Q481M _-19 synthase encoding the variants are changed as SDM method (Table 1).

phaC1 _{Ps6 -19} synthase variant Recombinant vector Nucleic Acid Substitution Amino acid substitutions primer pPs619C1300 GAA → GAT E130D SEQ ID NO: 15/16 AGC → ACC S325T SEQ ID NO: 17/18 CAG → ATG Q481M SEQ ID NO: 19/20

SEQ ID NO: 15 5- atc aac ctc atg acc gat gcg atg gcg ccg acc-3

SEQ ID NO 16: 5- ggt cgg cgc cat cgc atc ggt cat gag gtt gat- 3

SEQ ID NO: 17: 5- CTG ACC TTG CTG GTG ACC GTG CTT GAT ACC ACC- 3

SEQ ID NO: 18- 5-GGT GGT ATC AAG CAC GGT CAC CAG CAA GGT CAG- 3

SEQ ID NO: 19: 5- CGA GCA GCG GGC ATA TC A TGA GCA TCC TGA ACC CGC- 3

SEQ ID NO: 20 5-GCG GGT TCA GGA TGC TCA TGA TAT GCC CGC TGC TCG- 3

The prepared pPs619C1300 vector was digested with Sbf I / Nde I, and the pPs619C1300-CPPCT recombinant vector was prepared by inserting the cloned CP-PCT gene into the Sbf I / Nde I recognition site (FIG. 2).

(2) Construction of pTacCpPctNCvEC Plasmid

pTac99A (Park and Lee, J. Bacteriol . 185, 5391-5397, 2003) a pTrc99A (Pharmacia Biotech, Sweden) cutting a gene fragment, including the Tac promoter and the transcriptional terminator is obtained by cutting the vector with Ssp I restriction enzyme SspI PTaclac vector was prepared. Chromatium The phaEC gene was amplified using the primers of SEQ ID NOs: 21 and 22 using vinosum (DSMZ180) chromosomal DNA as a template.

SEQ ID NO: 21 ggaaatc cat ATGACGATGTTCTCGCTCATGGCG

SEQ ID NO: 22 ggaaatc catatg atc cag ggc cac tat ctc caa ctg

The amplified phaEC gene was inserted into the Nde I cleavage site of the prepared pTaclac vector to prepare pTaclacNCvEC.

In addition, the pct gene obtained by sequentially cutting pPs619C1300-CPPCT with EcoRI / XbaI was inserted into pTaclacNCvEC cut with EcoRI / XbaI to prepare pTacCpPctNCvEC (FIG. 3).

(3) Preparation of pMCSPtbBuk plasmid

The ptb and buk genes are Clostridium acetobutyricum acetobutyricum ) The strain consists of one operon. ptb / buk by the gene using the primers of SEQ ID NO: 23 and SEQ ID NO: 24 Clostridium acetonitrile butyronitrile rikum (Clostridium acetobutyricum (ATCC824) amplified from the chromosomal DNA.

SEQ ID NO: 23 GGCAGAGAG ACAATCAAAT C ATGATTAAGAGTTTTAATG

SEQ ID NO: 24 ggaattc catatg tta ttt gta ttc ctt agc ttt ttc ttc tcc

In addition, PCR was performed using pC1300-CPPCT as a template using primers of SEQ ID NO: 25 and SEQ ID NO: 26 to amplify the gene of the SbfI recognition portion of pC1300-CPPCT.

SEQ ID NO: 25 GGGCAGATGT GCCGGCAGAC

SEQ ID NO: 26 gat ttg att gtc tct ctg ccg

Using overlapping PCR using primers of SEQ ID NO: 24, 25 using the gene fragment obtained using the primers of SEQ ID NO: 23 and 24 and the gene fragment obtained using the primers of SEQ ID NO: 25 and 25 as templates Finally, ptb / buk gene fragment with SbfI / NdeI recognition site was obtained. The resulting ptb / buk gene fragment was digested with SbfI / NdeI and inserted into pC1300-CPPCT digested with the same enzyme to prepare a pPtbBuk plasmid. The pPtbBuk plasmid was digested with XmaI / XhoI to obtain a gene fragment containing a promoter of the R. eutropha PHA biosynthesis gene and the ptb / buk gene, and the obtained gene was inserted into pBBR1MCS (NCCB 3433) plasmid digested with XmaI / XhoI. pMCSPtbBuk plasmid was constructed (FIG. 4).

Example  2: 4- Hydroxybutyrate - Lactate  Preparation of Copolymer

PPs619C1300-CPPCT or pTacCpPctNCvEC prepared in Example 1 were transformed with pMCSPtbBuk to E. coli Top 10 (Invitrogen), respectively, to obtain E. coli Top10 / pPs619C1300-CPPCT / pMCSPtbBuk and E. coli Top10 / pTacCpPcttbBc / BtBcBct / It was.

The two kinds of transformants are cultured in two steps as follows. 4-hydroxybutyrate-lactate copolymer was obtained. First, the transformed recombinant E. coli E. coli Top10 / pPs619C1300-CPPCT / pMCSPtbBuk and E. coli Top10 / pTacCpPctNCvEC / pMCSPtbBuk contain 100 mg / L of ampicillin and 30 mg / L of chloramphenicol (Chloramphenicol), respectively. Incubated in 100 mL LB medium (10 g / L Bacto ^TM Triptone (BD), 5 g / L Bacto ^TM yeast extract (BD); 10 g / L NaCl (amresco)) at 4 ° C. and 1000 g. Cells were recovered by centrifugation for 15 minutes.

In the case of E. coli Top10 / pTacCpPctNCvEC / pMCSPtbBuk, IPTG was added to 1 mM when the absorbance at ₆₀₀ nm (OD ₆₀₀ ) reached about 0.6.

Recovered cells were MR medium containing 2 g / L 4-hydroxybutyrate (4-HB), 100 mg / L ampicillin and 30 mg / L chloramphenicol (10 g of Glucose per 1 L, KH ₂ 6.67 g of PO ₄ , (NH ₄ ) ₂ HPO ₄ 4 g, MgSO ₄ .7H ₂ O 0.8 g, citric acid 0.8 g and trace metal solution 5 mL; composition of trace metal solution: 5 mL HM 5 mL per 1 L, FeSO _{4 · 7H 2 O 10 g,} CaCl 2 2 g, ZnSO 4 · 7H 2 O 2.2 g, MnSO 4 · 4H 2 O 0.5 g, CuSO 4 · 5H 2 O 1 g, (NH 4) 6 Mo 7 O 2 · 0.1 g of 4H ₂ O, and 0.02 g of Na ₂ B ₄ O ₂ .10H ₂ O) were anaerobicized for 3 days.

The culture solution was centrifuged at 4 ° C. and 1000 g for 15 minutes to recover the cells, washed four times with a sufficient amount of distilled water, and dried at 80 ° C. for 12 hours. After quantifying the cells completely removed moisture was reacted with methanol under sulfuric acid catalyst using chloroform as a solvent at 100 ℃. This was mixed by adding distilled water equal to half the volume of chloroform at room temperature and allowed to stand until it was separated into two layers. The chloroform layer in which the monomers of the methylated polymer were dissolved in two layers was taken and analyzed by gas chromatography. As an internal standard, benzoate was used.

As shown in FIG. 5 and FIG. 6, in both E. coli Top10 / pPs619C1300-CPPCT / pMCSPtbBuk and E. coli Top10 / pTacCpPctNCvEC / pMCSPtbBuk cells, methyl-4-hydroxybutyrate And methyl-lactate (methyl-lactate) was detected it was confirmed that the novel 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)) copolymer was produced by recombinant E. coli.

As described and demonstrated in detail above, the present invention has the effect of providing a novel 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)], lactate (lactate)- Enzyme of the enzyme which converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA, phosphobutyl butylase gene, to CoA (lactyl-CoA) 4-hydroxybutyrate-lactate, comprising culturing or cultivating a cell or plant simultaneously having a phosphotransbutylease gene, a butyrate kinase gene, and a polyhydroxyalkanoate (PHA) synthase gene It has the effect of providing a method for preparing a copolymer [(poly (4-hydroxybutyrate-co-lactate)].] The novel 4-hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-lactate)) yrate-co-lactate)] is a biodegradable polymer that can replace the use of conventional synthetic plastics and can also be used for medical purposes.

As described above in detail specific parts of the present invention, it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents. Simple modifications and variations of the present invention can be readily used by those skilled in the art, and all such variations or modifications can be considered to be included within the scope of the present invention.

<110> LG CHEM, LTD          Korea Advanced Institute of Science and Technology <120> Novel Copolymer of [Poly (3-hydroxyvutyrate-co-lactate)] and          Method for Preparing The Same <130> P06-B251 <160> 26 <170> KopatentIn 1.71 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ggaattcatg agaaaggttc ccattattac cgcagatga 39 <210> 2 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gctctagatt aggacttcat ttccttcaga cccattaagc cttctg 46 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aggcctgcag gcggataaca atttcacaca gg 32 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gcccatatgt ctagattagg acttcatttc c 31 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 7 <211> 1677 <212> DNA Pseudomonas sp. 6-19 (KCTC11027BP) <400> 7 atgagtaaca agagtaacga tgagttgaag tatcaagcct ctgaaaacac cttggggctt 60 aatcctgtcg ttgggctgcg tggaaaggat ctactggctt ctgctcgaat ggtgcttagg 120 caggccatca agcaaccggt gcacagcgtc aaacatgtcg cgcactttgg tcttgaactc 180 aagaacgtac tgctgggtaa atccgggctg caaccgacca gcgatgaccg tcgcttcgcc 240 gatccggcct ggagccagaa cccgctctat aaacgttatt tgcaaaccta cctggcgtgg 300 cgcaaggaac tccacgactg gatcgatgaa agtaacctcg cccccaagga tgtggcgcgt 360 gggcacttcg tgatcaacct catgaccgaa gcgatggcgc cgaccaacac cgcggccaac 420 ccggcggcag tcaaacgctt ttttgaaacc ggtggcaaaa gcctgctcga cggcctctcg 480 cacctggcca aggatctggt acacaacggc ggcatgccga gccaggtcaa catgggtgca 540 ttcgaggtcg gcaagagcct gggcgtgacc gaaggcgcgg tggtgtttcg caacgatgtg 600 ctggaactga tccagtacaa gccgaccacc gagcaggtat acgaacgccc gctgctggtg 660 gtgccgccgc agatcaacaa gttctacgtt ttcgacctga gcccggacaa gagcctggcg 720 cggttctgcc tgcgcaacaa cgtgcaaacg ttcatcgtca gctggcgaaa tcccaccaag 780 gaacagcgag agtggggcct gtcgacctac atcgaagccc tcaaggaagc ggttgacgtc 840 gttaccgcga tcaccggcag caaagacgtg aacatgctcg gggcctgctc cggcggcatc 900 acttgcactg cgctgctggg ccattacgcg gcgattggcg aaaacaaggt caacgccctg 960 accttgctgg tgagcgtgct tgataccacc ctcgacagcg acgtcgccct gttcgtcaat 1020 gaacagaccc ttgaagccgc caagcgccac tcgtaccagg ccggcgtact ggaaggccgc 1080 gacatggcga aggtcttcgc ctggatgcgc cccaacgatc tgatctggaa ctactgggtc 1140 aacaattacc tgctaggcaa cgaaccgccg gtgttcgaca tcctgttctg gaacaacgac 1200 accacacggt tgcccgcggc gttccacggc gacctgatcg aactgttcaa aaataaccca 1260 ctgattcgcc cgaatgcact ggaagtgtgc ggcaccccca tcgacctcaa gcaggtgacg 1320 gccgacatct tttccctggc cggcaccaac gaccacatca ccccgtggaa gtcctgctac 1380 aagtcggcgc aactgtttgg cggcaacgtt gaattcgtgc tgtcgagcag cgggcatatc 1440 cagagcatcc tgaacccgcc gggcaatccg aaatcgcgct acatgaccag caccgaagtg 1500 gcggaaaatg ccgatgaatg gcaagcgaat gccaccaagc atacagattc ctggtggctg 1560 cactggcagg cctggcaggc ccaacgctcg ggcgagctga aaaagtcccc gacaaaactg 1620 ggcagcaagg cgtatccggc aggtgaagcg gcgccaggca cgtacgtgca cgaacgg 1677 <210> 8 <211> 559 <212> PRT Pseudomonas sp. 6-19 (KCTC11027BP) <400> 8 Met Ser Asn Lys Ser Asn Asp Glu Leu Lys Tyr Gln Ala Ser Glu Asn   1 5 10 15 Thr Leu Gly Leu Asn Pro Val Val Gly Leu Arg Gly Lys Asp Leu Leu              20 25 30 Ala Ser Ala Arg Met Val Leu Arg Gln Ala Ile Lys Gln Pro Val His          35 40 45 Ser Val Lys His Val Ala His Phe Gly Leu Glu Leu Lys Asn Val Leu      50 55 60 Leu Gly Lys Ser Gly Leu Gln Pro Thr Ser Asp Asp Arg Arg Phe Ala  65 70 75 80 Asp Pro Ala Trp Ser Gln Asn Pro Leu Tyr Lys Arg Tyr Leu Gln Thr                  85 90 95 Tyr Leu Ala Trp Arg Lys Glu Leu His Asp Trp Ile Asp Glu Ser Asn             100 105 110 Leu Ala Pro Lys Asp Val Ala Arg Gly His Phe Val Ile Asn Leu Met         115 120 125 Thr Glu Ala Met Ala Pro Thr Asn Thr Ala Ala Asn Pro Ala Ala Val     130 135 140 Lys Arg Phe Phe Glu Thr Gly Gly Lys Ser Leu Leu Asp Gly Leu Ser 145 150 155 160 His Leu Ala Lys Asp Leu Val His Asn Gly Gly Met Pro Ser Gln Val                 165 170 175 Asn Met Gly Ala Phe Glu Val Gly Lys Ser Leu Gly Val Thr Glu Gly             180 185 190 Ala Val Val Phe Arg Asn Asp Val Leu Glu Leu Ile Gln Tyr Lys Pro         195 200 205 Thr Thr Glu Gln Val Tyr Glu Arg Pro Leu Leu Val Val Pro Pro Gln     210 215 220 Ile Asn Lys Phe Tyr Val Phe Asp Leu Ser Pro Asp Lys Ser Leu Ala 225 230 235 240 Arg Phe Cys Leu Arg Asn Asn Val Gln Thr Phe Ile Val Ser Trp Arg                 245 250 255 Asn Pro Thr Lys Glu Gln Arg Glu Trp Gly Leu Ser Thr Tyr Ile Glu             260 265 270 Ala Leu Lys Glu Ala Val Asp Val Val Thr Ala Ile Thr Gly Ser Lys         275 280 285 Asp Val Asn Met Leu Gly Ala Cys Ser Gly Gly Ile Thr Cys Thr Ala     290 295 300 Leu Leu Gly His Tyr Ala Ala Ile Gly Glu Asn Lys Val Asn Ala Leu 305 310 315 320 Thr Leu Leu Val Ser Val Leu Asp Thr Thr Leu Asp Ser Asp Val Ala                 325 330 335 Leu Phe Val Asn Glu Gln Thr Leu Glu Ala Ala Lys Arg His Ser Tyr             340 345 350 Gln Ala Gly Val Leu Glu Gly Arg Asp Met Ala Lys Val Phe Ala Trp         355 360 365 Met Arg Pro Asn Asp Leu Ile Trp Asn Tyr Trp Val Asn Asn Tyr Leu     370 375 380 Leu Gly Asn Glu Pro Pro Val Phe Asp Ile Leu Phe Trp Asn Asn Asp 385 390 395 400 Thr Thr Arg Leu Pro Ala Ala Phe His Gly Asp Leu Ile Glu Leu Phe                 405 410 415 Lys Asn Asn Pro Leu Ile Arg Pro Asn Ala Leu Glu Val Cys Gly Thr             420 425 430 Pro Ile Asp Leu Lys Gln Val Thr Ala Asp Ile Phe Ser Leu Ala Gly         435 440 445 Thr Asn Asp His Ile Thr Pro Trp Lys Ser Cys Tyr Lys Ser Ala Gln     450 455 460 Leu Phe Gly Gly Asn Val Glu Phe Val Leu Ser Ser Ser Gly His Ile 465 470 475 480 Gln Ser Ile Leu Asn Pro Pro Gly Asn Pro Lys Ser Arg Tyr Met Thr                 485 490 495 Ser Thr Glu Val Ala Glu Asn Ala Asp Glu Trp Gln Ala Asn Ala Thr             500 505 510 Lys His Thr Asp Ser Trp Trp Leu His Trp Gln Ala Trp Gln Ala Gln         515 520 525 Arg Ser Gly Glu Leu Lys Lys Ser Pro Thr Lys Leu Gly Ser Lys Ala     530 535 540 Tyr Pro Ala Gly Glu Ala Ala Pro Gly Thr Tyr Val His Glu Arg 545 550 555 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atgcccggag ccggttcgaa 20 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cgttactctt gttactcatg atttgattgt ctctc 35 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gtacgtgcac gaacggtgac gcttgcatga gtg 33 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aacgggaggg aacctgcagg 20 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 atcaacctca tgaccgatgc gatggcgccg acc 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ggtcggcgcc atcgcatcgg tcatgaggtt gat 33 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ctgaccttgc tggtgaccgt gcttgatacc acc 33 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ggtggtatca agcacggtca ccagcaaggt cag 33 <210> 19 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cgagcagcgg gcatatcatg agcatcctga acccgc 36 <210> 20 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gcgggttcag gatgctcatg atatgcccgc tgctcg 36 <210> 21 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ggaaatccat atgacgatgt tctcgctcat ggcg 34 <210> 22 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 ggaaatccat atgatccagg gccactatct ccaactg 37 <210> 23 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 23 ggcagagaga caatcaaatc atgattaaga gttttaatg 39 <210> 24 <211> 43 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 24 ggaattccat atgttatttg tattccttag ctttttcttc tcc 43 <210> 25 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 25 gggcagatgt gccggcagac 20 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 26 gatttgattg tctctctgcc g 21  

Claims (25)

4-hydroxybutyrate-lactate copolymers containing lactate and 4-hydroxybutyrate as repeating units [(poly (4-hydroxybutyrate-co-lactate)]. Of enzymes that convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Cultivating or cultivating cells or plants having the gene, the phosphotransbutylase gene, the butyrate kinase gene and the polyhydroxyalkanoate (PHA) synthase gene at the same time -Hydroxybutyrate-lactate copolymer [(poly (4-hydroxybutyrate-co-lactate)]]. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate that does not have all of the genes. , A phosphotransbutylase gene, a butyrate kinase gene, and a polyhydroxyalkanoate of an enzyme that converts to 3-hydroxyalkanoyl-CoA : PHA) Method characterized in that it is obtained by transformation with a synthase gene. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA (lactyl-CoA) and converts the cell or plant having a gene of PHA synthase using lactyl-CoA as a substrate. Enzyme converting 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA, phosphotransbutylase gene and butyrate kinase gene Characterized in that it is obtained by transformation. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Cells or plants having an enzyme gene that converts to 3-hydroxyalkanoyl-CoA) are phosphotransbutylase gene, butyrate kinase gene and polyhydroxyalkanoate (PHA) synthase gene Characterized in that it is obtained by transformation. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to a cell or plant having a phosphotransbutylase gene. Genes of enzymes that convert (3-hydroxyalkanoate) to 3-hydroxyalkanoyl-CoA, butyrate kinase gene and polyhydroxyalkanoate (PHA) synthase gene Characterized in that it is obtained by transformation. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and converts the cell or plant having a butyrate kinase gene to 3-hydroxyalkanoate (3). -hydroxyalkanoate) is a gene for enzymes that convert 3-hydroxyalkanoyl-CoA, phosphotransbutylase and polyhydroxyalkanoate (PHA) synthase genes. Characterized in that it is obtained by transformation. The method of claim 2, wherein the cell or plant converts the gene and lactate of PHA synthase using lactyl-CoA as a substrate to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate ( A cell or plant having an enzyme gene that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA is converted into a phosphotransbutylase gene and a butyrate kinase gene. Characterized in that obtained by transformation. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Cells or plants having an enzyme and a phosphotransbutylase gene that convert to 3-hydroxyalkanoyl-CoA) are genes of PHA synthase and butyrate kinase gene using lactyl-CoA as a substrate. Characterized in that obtained by transformation. The gene or butyrate kinase of the enzyme according to claim 2, wherein the cell or plant converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. The cell or plant having a kinase gene is obtained by transforming the gene of PHA synthase and the phosphotransbutylase gene. According to claim 2, wherein the cell or plant cells or plants having a gene of PHA synthase and butyrate kinase gene using lactyl-CoA as a substrate to lactate (lactate) lactyl-CoA (lactyl- CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (enzyme gene and phosphotransbutylase gene) Characterized in that obtained by transformation. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and converts the cell or plant having a gene of PHA synthase and a phosphotransbutylase gene to 3- It is obtained by transforming the hydroxyalkanoate (3-hydroxyalkanoate) with the enzyme and butyrate kinase gene of the enzyme that converts to 3-hydroxyalkanoyl-CoA (CoA) How to. The gene or lactate of PHA synthase using lactyl-CoA as a substrate of cells or plants having a phosphotransbutylase gene and a butyrate kinase gene. is an enzyme that converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. Characterized in that it is obtained by transformation. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA 3-hydroxyalkanoyl-CoA) gene, a phosphotransbutylase gene and a butyrate kinase gene or cell having a plant as a substrate of PHA synthase using lactyl-CoA as a substrate Characterized in that obtained by transformation. According to claim 2, wherein the cell or plant is a cell or plant having a phosphotransbutylase gene, butyrate kinase gene and polyhydroxyalkanoate (PHA) synthase gene The method is characterized in that it is obtained by transforming the gene lactate with the gene of the enzyme that converts to lactyl-CoA. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Gene or phosphotransbutylase is used to convert cells or plants having an enzyme gene that converts to 3-hydroxyalkanoyl-CoA, butyrate kinase gene, and polyhydroxyalkanoate (PHA) synthase gene. Characterized in that it is obtained by transformation with a gene. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Genes of enzymes that convert to 3-hydroxyalkanoyl-CoA, phosphotransbutylase and polyhydroxyalkanoate (PHA) synthase genes, but not genes butyrate kinase Characterized in that it is obtained by transformation. The method of claim 2, wherein the lactate is converted to lactyl-CoA and 3-hydroxyalkanoate is converted into 3-hydroxyalkanoyl-CoA. The gene of the enzyme converting to CoA) is propionyl-CoA transferase gene ( pct ). The method of claim 2, wherein the phosphotransbutylase gene is derived from Clostridium acetobutyricum . The method of claim 2, wherein the butyrate kinase gene is Clostridium acetobutyricum acetobutyricum ). The method of claim 2, wherein the polyhydroxyalkanoate (PHA) synthase gene is phaC1 _{ps6 -19} from Pseudomonas sp. 6-19. The method of claim 2, wherein the polyhydroxyalkanoate (PHA) synthase gene is a gene encoding an amino acid sequence of which E130D, S325T and Q481M are mutated in the amino acid sequence of SEQ ID NO. 7. The method of claim 2, wherein the cell is a microorganism. The method of claim 23, wherein the microorganism is Escherichia coli. The method of claim 2, wherein the culturing or cultivation is performed in an environment containing 4-hydroxybutyrate (4-HB).

Images