KR100948777B1 - Novel Copolymer of [poly3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate] and Method for Preparing the Same - Google Patents

Abstract

The present invention relates to a novel 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)] and a preparation method thereof, and more particularly Is an enzyme that converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. A novel terpolymer consisting of monomers of lactate, 3-hydroxybutyrate and 3-hydroxyvalerate prepared using cells or plants having the gene of and the polyhydroxyalkanoate (PHA) synthase gene at the same time (3-hydroxybutyrate-3-hydroxyvallate-lactate terpolymer) and a novel 3-hydroxybutyrate-3-hydroxyvallate-lactate terpolymer.

The novel 3-hydroxybutyrate-3-hydroxyvalerate-lactate according to the present invention can replace the use of conventional synthetic plastics as biodegradable polymers and can also be used for medical purposes.

Lactate, 3-hydroxybalate, 3-hydroxybutyrate

Description

Novel Copolymer of [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)] and Method for Preparing the Same}

Figure 1 is a schematic diagram showing a system of constant expression of the operon form in which PHA synthase and CP-PCT are expressed together.

Figure 2 shows a sequence map of the recombinant plasmid pPs619C1300-CPPCT comprising the PHA synthase gene and CP-PCT gene according to the present invention.

Figure 3 shows a sequence map of the recombinant plasmid pTacCpPctNCvEC comprising the PHA synthase gene and CP-PCT gene according to the present invention.

4 is Ralstonia Representative map of recombinant plasmid pMCS104ReAB containing phaA and phaB genes of eutropha

Figure 5 shows the gas chromatogram results of analyzing the components of the terpolymer biosynthesized by recombinant Escherichia coli transformed with pPs619C1300-CPPCT or pPs619C1300-CPPCT / pMCS104ReAB plasmid.

Figure 6 shows the gas chromatogram results of analyzing the components of the terpolymer biosynthesized by recombinant E. coli transformed with pTacCpPctNCvEC or pTacCpPctNCvEC / pMCS104ReAB plasmid.

Field of invention

The present invention relates to a novel 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)] and a preparation method thereof, and more particularly Is an enzyme that converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. A novel terpolymer consisting of a monomer of lactate, 3-hydroxy valerate, and 3-hydroxybutyrate prepared using a cell or a plant having both the gene and the polyhydroxyalkanoate (PHA) synthase gene at the same time. (3-hydroxybutyrate-3-hydroxyvallate-lactate terpolymer) and a novel 3-hydroxybutyrate-3-hydroxyvallate-lactate terpolymer.

Background of the Invention

Polylactate (PLA), a polymer having lactate as a monomer, is a representative biodegradable polymer and has high applicability as a general purpose polymer or a medical polymer. Currently, PLA is produced by polymerizing lactate produced by microbial fermentation, but only low molecular weight (1000-5000 Daltons) PLA is produced by the direct polymerization of lactate. In order to synthesize 100,000 Daltons or more, there is a method of polymerizing PLA from a low molecular weight PLA obtained by direct polymerization of lactate to a PLA having a higher molecular weight using a chain coupling agent. The method for producing PLA having a molecular weight has a disadvantage in that the process is complicated due to the addition of an organic solvent or a coupling agent, and it is not easy to remove them. Currently commercially available high molecular weight PLA production process is a chemical synthesis method of converting lactate to lactide (lactide), and then synthesize the PLA through the ring-opening condensation reaction of the lactide ring.

On the other hand, PHAs are polyesters that microorganisms accumulate inside as energy or carbon source storage materials when there are excessive carbon sources and other nutrients such as phosphorus, nitrogen, magnesium, and oxygen are insufficient. PHA is regarded as a material to replace conventional synthetic plastics because it has properties similar to synthetic polymers derived from petroleum and shows complete biodegradability.

Conventionally known PHAs can be classified into short-chain-length PHAs (SCL-PHAs) and medium-chain-length PHAs (MCL-PHAs) with long carbon atoms. The gene of the enzyme that synthesizes PHA is Ralstonia It was isolated from eutropha , Pseudomonas, etc., and PHA composed of various kinds of monomers was synthesized through the recombinant microorganism transformed with the enzyme gene synthesizing the PHA (Qi et al ., FEMS Microbiol . Lett ., 157: 155, 1997; Qi et al ., FEMS Microbiol . Lett ., 167: 89, 1998; Langenbach et al ., FEMS Microbiol . Lett ., 150: 303, 1997; WO 01/55436; US 6,143,952; WO 98/54329; WO 99/61624).

In order to produce PHA in microorganisms, enzymes for converting metabolites of microorganisms to PHA monomers and PHA synthase synthesizing PHA polymers using PHA monomers are essential. PHA synthase synthesizes PHA using hydroxyacyl-CoA as a substrate, and Ralstonia is an enzyme that can provide hydroxyacyl-CoA, a substrate of PHA. α-ketothiolase (PhaA) derived from eutropha et al., acetoacetyl-CoA reductase (PhaB), 3-hydroxydecanoyl-ACP: CoA transferase derived from Pseudomonas (3- hydroxydecanoyl-ACP: CoA transferase: PhaG), Aeromonas caviae and Pseudomonas The (R) derived from a specific enol aeruginosa -CoA hydroxy latte rise [(R) -specific enoyl-CoA hydratase: PhaJ] (Fukui et al ., J. Bacteriol ., 180: 667, 1998; Tsuge et al ., FEMS Microbiol. Lett ., 184: 193, 2000), Escherichia coli and Pseudomonas 3-ketoacyl-ACP reductase (FabG) derived from aeruginosa et al. is known (Taguchi et. al ., FEMS Microbiol. Lett ., 176: 183, 1999; Ren et al ., J. Bacteriol ., 182: 2978, 2000; Park et al ., FEMS Microbiol. Lett ., 214: 217, 2002). Various enzymes have been synthesized using hydroxyalkanoates hydroxylated at various carbon positions (mostly 3, 4, 5, 6) using these enzymes.

However, it has been reported that there is little reactivity of PHA synthase to hydroxylated hydroxyalkanoates at position 2 (Zhang et al. al ., Appl . Microbiol . Biotechnol ., 56: 131, 2001; Valentin and Steinbuchel, Appl. Microbiol. Biotechnol., 40: 699, 1994). To date in the PHA polymerase for raktil -CoA Although there have been reports of the reactivity of PHA synthase to lactyl-CoA through in vitro activity measurement, the reactivity of PHA synthase to lactyl-CoA is very weak (Zhang et al. al ., Appl . Microbiol . Biotechnol ., 56: 131, 2001; Valentin and Steinbuchel, Appl . Microbiol. Biotechnol ., 40: 699, 1994). That is, hydroxyalkanoates, such as 2-carbon-hydroxylated lactate, are not suitable for the substrate specificity of PHA synthase, so that PHA and its terpolymers can be produced naturally or using recombinant cells or plants. There is no example.

Accordingly, the present inventors have made intensive efforts to prepare high molecular weight 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer using microorganisms. As a result, the lactate is converted into lactyl-CoA (lactyl-CoA). Clostridium , the gene for enzymes that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA propionicum 3-hydroxybutyrate-3-hydroxyvallate-lock by culturing recombinant E. coli transformed with the derived propinyl-CoA transferase gene ( pct ) and PHA synthase gene It was confirmed that the tate terpolymer was produced and the present invention was completed.

It is an object of the present invention to provide a novel polymer, 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)].

Another object of the present invention is to provide a method for preparing the 3-hydroxybutyrate-3-hydroxy valerate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)].

In order to achieve the above object, the present invention is a 3-hydroxybutyrate-3-hydroxy valerate-lactate terpolymer containing lactate, 3-hydroxy valerate and 3-hydroxybutyrate as repeating units [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)].

The invention also converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. 3-hydroxybutyrate-3-hydroxyvallate-lac, characterized by culturing or cultivating a cell or plant having both an enzyme gene and a polyhydroxyalkanoate (PHA) synthase gene converting to Provided is a method for preparing a tate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)].

In the present invention, the lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate (3-hydroxyalkanoate) 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA The gene of the enzyme that converts to) may be characterized in that the propionyl-CoA transferase gene ( pct ). In addition, the gene of the enzyme that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA is Ralstonia. α-ketothiolase (PhaA) derived from eutropha and the like, and acetoacetyl-CoA reductase (acetoacetyl-CoA reductase: PhaB).

In the present invention, the culture or cultivation may be characterized in that it is carried out in an environment containing 3-hydroxy valerate (3-HV) and 3-hydroxybutyrate (3-HB).

The invention also converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. Enzyme, polyhydroxyalkanoate (PHA) synthase gene, and 3-hydroxyalkanoate, 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer, characterized in that the culture or cultivation of cells or plants having the gene of the enzyme to be converted to [poly (3-hydroxybutyrate-co-3-hydroxyvalerate -co-lactate)] is provided.

In the present invention, the polyhydroxyalkanoate (PHA) synthase gene is Pseudomonas sp. It may be characterized in that the phaC1 _{ps6 -19} derived from 6-19, wherein the polyhydroxyalkanoate (PHA) synthase gene is an amino acid sequence of E130D, S325T and Q481M mutated in the amino acid sequence of SEQ ID NO: 7 It may be characterized in that the gene coding for.

In the present invention, the enzyme for converting the 3-hydroxyalkanoate (3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) is α-keto thiolase (PhaA) or aceto It may be characterized in that the acetyl-CoA reductase (acetoacetyl-CoA reductase (PhaB)).

In the present invention, the culture or cultivation may be characterized in that it is carried out in an environment containing glucose and propionic acid or valeric acid.

In the present invention, the cell may be characterized in that the microorganism, the microorganism may be characterized in that the E. coli.

In the present invention, the lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate (3-hydroxyalkanoate) 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA A cell or plant having both the gene of the enzyme and polyhydroxyalkanoate (PHA) synthase gene converting to (i) lactylated cells or plants not having both of these genes. The gene of the enzyme converting -CoA (lactyl-CoA) and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (lactoyl-CoA) and the substrate of lactyl-CoA Or (ii) cells or plants having a PHA synthase gene using lactyl-CoA as a substrate, or lactate of lactyl-CoA (lactyl-CoA). ) And 3-hydroxyalkanoate noate) is obtained by transformation with a gene of an enzyme that converts 3-hydroxyalkanoyl-CoA, or (iii) lactate with lactyl-CoA (lactyl-CoA). Cells or plants having an enzyme gene which converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA, using lactyl-CoA as a substrate. It may be characterized in that it is obtained by transformation with a gene of PHA synthase, but is not limited thereto.

In the present invention, the lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate (3-hydroxyalkanoate) 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA Polyhydroxyalkanoate (PHA) synthase gene 3-hydroxyalkanoate (3-hydroxyalkanoate) to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) Cells or plants simultaneously carrying the gene of the enzyme converting to (i) convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxy PHA synthase gene using lactyl-CoA as a substrate and 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) as a substrate for cells or plants with an enzyme converting to alkanoyl-CoA (3-hydroxyalkanoyl-CoA) Obtained by transfection with the gene of the enzyme converting to CoA), or (ii) lactyl-C Cells or plants with a PHA synthase gene using oA as a substrate convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxy. Obtained by transformation with a gene of an enzyme converting to hydroxyalkanoyl-CoA and a gene of an enzyme converting to 3-hydroxyalkanoyl-CoA (iii) Cells or plants with an enzyme gene that converts to 3-hydroxyalkanoyl-CoA (lacto) to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkano Obtained by transforming the gene of enzyme converting 3-hydroxyalkanoate into 3-hydroxyalkanoyl-CoA and the gene of PHA synthase using lactyl-CoA as a substrate; iv) converting lactate to lactyl-CoA and 3-hydroxyalkano 3-cell or plant having the gene of the enzyme which converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA and the gene of PHA synthase using lactyl-CoA as a substrate. Obtained by transformation with a gene of an enzyme converting to hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA), or (v) Gene of an enzyme converting to 3-hydroxyalkanoyl-CoA And converting lactate to lactyl-CoA and converting 3-hydroxyalkanoate to cells or plants having a gene of PHA synthase using lactyl-CoA as a substrate. Obtained by transformation with a gene of an enzyme that converts to 3-hydroxyalkanoyl-CoA (vi), or (vi) an enzyme that converts into 3-hydroxyalkanoyl-CoA Gene and lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate (3-hydr Cells or plants with the gene of the enzyme that converts oxyalkanoate to 3-hydroxyalkanoyl-CoA are used as genes of PHA synthase using lactate as lactyl-CoA as a substrate. Characterized in that obtained by transformation, but is not limited thereto.

The cell or plant according to the invention is pct It may be characterized in that it is transformed with a recombinant vector containing a gene and at the same time transformed with a vector containing phaC or phaC is inserted on a chromosome. In addition, the gene of PHA synthase using lactyl-CoA as a substrate may be characterized as phaC , pct It may be characterized in that it is transformed with a recombinant vector containing a gene and at the same time transformed with a vector containing phaC or phaC is inserted on a chromosome.

Various microorganisms are known as cells having the gene of the PHA synthase (KR 10-250830 B1). For example, Achromobacter sp., Achromobacter Acidovorax microorganisms of the genus Achromobacter , including xylosoxidans delafieldii , Acidovax facilis , Acinetobacter sp., Acinetobacter calcoaceticus , Acinetobacter Microorganisms of the genus Acinetobacter , including lwoffii , Actinomyces sp., Aeromonas caviae , Aeromonas hydrophila , Aeromonas Aeromonas , including salmonicida Microorganisms, Alcaligenes aestus , Alcaligenes denitrificans , Alcaligenes eutrophus After renaming to Ralstonia eutropha renamed eutropha ), Alcaligenes faecalis , Alcaligenes latus , Alcaligenes pacificus Alcaligenes paradoxus , Alcaligenes Microorganisms of the genus Alcaligenes , including venestus, etc. Alteromonas macleodii , Amoebobacter roseu , Amoebobacter The Amoebobacter in microorganisms that contain such pendens, Aphanocapa sp., Aphanothece sp. Aquaspirillum autotrophicum , Azorhizobium caulinodans, Azospirillum sp., Azospirillum The Azospirillum spp, which include brasilense, Azospirillum lipoferum, Azotobacter sp. , Azotobacter agilis , Azotobacter chroococcum , Azotobacter macrocytogenes , Azotobacter Bacillus , microorganisms of the genus Azotobacter , including vinelandii, etc. anthracis , Bacillus cereus , Bacillus megaterium , Bacillus subtillus, Bacillus Bacillus spp. microorganisms, including thuringiensis , Beggiatoa sp., Beggiatoa Beggiatoa genus microorganisms including alba , Beijerinckia indicus , Beijerinckia Microorganisms of the genus Beijerinckia , including mobilis , Beneckia natrigens , Beneckea Microorganisms of the genus Beneckea , including pelagia, etc., Bordetella pertussis , Bradyrhizobium japonicum , Caryophamon latum , Caulobacter bacteroides, Caulobacter Caulobacter spp. including crescentus , Chloroflexus aurantiacus, Chlorogloea fritschii Microorganisms of the genus Chlorogloea , including Chromatium minutissimum, Chromatium okenii , Chromatium Chromatium containing tepidum etc Microorganisms, Chromobacterium violaceum Chromobacterium spp. Including, Clostridium botulinum, Clostridium Clostridium microorganisms, including sphenoides , Comamonas acidovorans, Comamonas Microorganisms of the genus Comamonas , including testosteroni , Corynebacterium autotrophicum, Corynebacterium Corynebacterium spp. including hydrocarboxydans , Cyanobacteria , Derxia Derxia with gummosa Genus Microorganisms, Desulfococcus multivorans , Desulfonema limicola , Desulfonema magnum Microorganisms of the genus Desulfonema , including Desulfosacina variabilis , Desulfovibrio sapovorans , Ectothiorhodospira halochloris , Ectothiorhodospira mobilis , Ectothiorhodospira Microorganisms of the genus Ectothiorhodospira , including vacuolata , Ferrobacillus ferroxidans , Flavobacterium sp., Haemophilus influenzae , Halobacterium gibbonsii, Halobacterium The Halobacterium spp, including the volcanii etc., Haloferax mediterranei, Hydroclathratus clathratus , Hydrogenomonas facilis , Hydrogenophaga flava , Hydrogenophaga pseudoflava , Hydrogenophaga taeniospiralis Microorganisms of the genus Hydrogenophaga, etc., Hyphomicrobium The Hyphomicrobium in microorganisms including vulgare, Ilyobacter delafieldii, Labrys monachus , Lamprocystis reseopersicina , Lampropedia hyalina, Legionella sp., Leptothrix discophorus , Methylobacterium AM1, Methylobacterium The Methylobacterium in microorganisms that contain such extorquens, Methylococcus thermophilus , Methlocystis parvus , Methylomonas methanica, Methylosinus sporium , Methylosinus The Methylosinus in microorganisms that contain such trichosporium, Methylovibrio soehngenii , Micrococcus denitrificans , Micrococcus Mycobacterium microorganisms of the genus Micrococcus , including halodenitrificans album , Mycobacterium vacae Mycobacterium spp. Including Nitrobacter agilis , Nitrobacter Nitrobacter genus microorganisms, including winogradskyi , Nocardia alba , Nocardia asteroides , Nocardia lucida , Nocardia rubra Microorganisms of the genus Nocardia , including the paracoccus dentrificans , Oscillatoria limosa , Penicillium cyclopium, Photobacterium mandapamensis , Photobacterium microbes in the Photobacterium containing the phosphoreum etc., Physarum ploycephalum and Pseudomonas glathei, Pseudomonas indigofera, Pseudomonas lemonieri , Pseudomonas mallei , Pseudomonas marina , Pseudomonas mixta, Pseudomonas oleovorans , Pseudomonas oxalaticus , Pseudomonas pseudoalcaligenes , Pseudomonas aeruginosa , Pseudomonas alcaligenes , Pseudomonas asplenii , Pseudomonas butanovora, Pseudomonas cepacia , Pseudomonas coronafaciens , Pseudomonas dacunhae , Pseudomonas denitrificans , Pseudomonas diminuta , Pseudomonas echinoides , Pseudomonas fluorescens, Pseudomonas putida , Pseudomonas rubrilineas , Pseudomonas saccharophila , Pseudomonas stutzeri , Pseudomonas syringae , Pseudomonas thermophilus , Pseudomonas microorganisms of the genus Pseudomonas , including viridiflava , microorganisms of the genus Ralstonia , Rhizobium hedysarum , Rhizobium lupini , Rhizobium meliloti , Rhizobium phaseoli , Rhizobium trifoli Microorganisms of the genus Rhizobium , microorganisms of the genus Rhodobacillus , Rhodobacter microorganisms of the genus Rhodobacter , including capsulatus , Rhodobacter sphaeroides , and Rhodococcus The microorganism of the genus Rhodococcus containing a rhodochrous, Rhodocyclus gelatinosus , Rhodocyclus Rhodocyclus microorganisms, including tenuis , Rhodomicrobium vannielii with Rhodopseudomonas Microorganisms of the genus Rhodopseudomonas , including acidophila , Rhodopseudomonas capsulata , Rhodospirillum molischianum, Rhodospirillum Microorganisms of the genus Rhodospirillum , including rubrum , Sphingomonas paucimobilis, Spirillum itersomii , Spirillum Spirillum spp . including serpens , Spirulina jenneri, Spirulina maxima , Spirulina Spirulina spp ., including subsaksa, etc. Staphylococcus aureus , Staphylococcus The Staphylococcus spp, including a epidermidis, Staphylococcus xylosus etc., Stella Stella spp., Streptomyces , including humosa , Stella vacuolata antibioticus , Streptomyces Microorganisms of the genus Streptomyces , including coelicolor, etc., Syntrophomonas wolfei , Thermophilic cyanobacteria , Thermus thermophilus , Thiobacillus A2, Thiobacillus acidophilus , Thiobacillus Thiobacillus , including versutus Microorganisms, Thiocapsa Thiocapsa including pfennigii et al Microorganisms, Thiocystis violacea , Vibrio parahaemolyticus , Xanthobacter autotrophicus , Xanthomonas maltophilia, Zoogloea There is such Zoogloea in microorganisms that contain such ramigera.

In the present invention, lactate is converted to lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate is converted to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA). Cells or plants having both the gene of the enzyme and the polyhydroxyalkanoate (PHA) synthase gene are cultured or cultivated in an environment containing 3-hydroxyvalerate, lactate and 3-hydroxybutyrate. 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)] can be prepared and other carbon sources such as glucose or citric acid If the cells or plants capable of biosynthesis of lactate, 3-hydroxy valerate and 3-hydroxybutyrate from the copolymer can be prepared without additional addition.

Transfection of a plant for producing a plant containing the gene of the converting enzyme of the present invention and the gene of the synthetase can be achieved by a conventional method using Agrobacterium, a viral vector, or the like. For example, a microorganism of the genus Agrobacterium may be transformed with a recombinant vector containing a gene according to the present invention, and then the transformed Agrobacterium microorganism may be infected with tissues of a target plant to obtain a transfected plant. More specifically, (a) pre-culture the explant of the plant (preplant), and then transfected by co-culture with the transformed Agrobacterium; (b) culturing the transfected explants in a callus induction medium to obtain callus; And (c) cutting the obtained callus, and culturing it in shoot induction medium to form shoots, thereby producing a transfected plant.

In the present invention, the term "explant" refers to a slice of tissue cut out of a plant, and includes cotyledon or hypocotyl. The explants of the plant used in the method of the present invention may be cotyledons or hypocotyls, it is more preferable to use the cotyledons obtained by germinating in MS medium after disinfecting and washing the seeds of the plants.

Transfection target plants usable in the present invention include, but are not limited to, tobacco, tomatoes, peppers, beans, rice, corn, and the like. In addition, even if the plant used for transformation is a sexually propagating plant, it will be apparent to those skilled in the art that it can be repeatedly reproduced by tissue culture or the like.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

Example  One: pct  Gene and PHA  Construction of Recombinant Plasmids Containing Genes

Recombinant plasmid pPs619C1300 containing pct and PHA genes for the production of 3-hydroxybutyrate-3-hydroxyvalaterate-lactate copolymers [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)] -CPPCT and pTacCpPctNCvEC were constructed.

(1) Preparation of pPs619C1300-CPPCT plasmid

The pct gene is Clostridium propionicum) propionyl -CoA transferase dehydratase (pronpionyl-CoA transferase derived from: was used as the CP-PCT) gene, PHA synthase gene is 6-10 Pseudomonas (Pseudomonas sp. 6-19) PHA synthase gene was used.

As shown in FIG. 1, a system for constitutive expression of operon in which PHA synthase and CP-PCT are expressed together was constructed. CP-PCT is known to be highly toxic to host microorganisms at the time of expression.In the IPTG expression system using tac or T7 promoters, which are widely used for recombinant protein expression, all recombinant microorganisms are killed at the same time as expression-inducing substances are added. do. For this reason, a constantly expressed system was used, which is weakly expressed but continuously expressed as the microorganism grows. CP-PCT gene is Chostridium propionicum Chromosomal DNA of (DSMZ1682) as a template, pct Gene sequence (Selmer et al . , Eur J Biochem. , 269: 372, 2002) was obtained by PCR using a primer having a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2.

SEQ ID NO: 5-ggaattcATGAGAAAGGTTCCCATTATTACCGCAGATGA

SEQ ID NO: 5-gctctagattaggacttcatttccttcagacccattaagccttctg

At this time, the Nde I restriction enzyme site originally present in the wild-type CP-PCT was removed using the SDM method for ease of cloning. In addition, overlapping PCR was performed using primers having the nucleotide sequences of SEQ ID NOs: 3 and 4 to add the Sbf I / Nde I recognition sites.

SEQ ID NO: 5-agg cct gca ggc gga taa caa ttt cac aca gg- 3

SEQ ID NO: 5-gcc cat atg tct aga tta gga ctt cat ttc c- 3

Pseudomonas sp. To isolate PHA synthase (phaC1 _{Ps6 -19} ) gene from 6-19 (KCTC11027BP), Pseudomonas sp. Extracting the total DNA of 6-19 and, phaC1 _{Ps6 -19} gene sequence to prepare a (transmission aejin, Master's Thesis, Department of Chemical and Biomolecular Engineering, KAIST, 2004) SEQ ID NO primer having the base sequence of the 5 and 6 based on the , by performing a PCR to yield the phaC1 _{Ps6 -19} gene, exhibited a base sequence of the phaC1 _{Ps6 -19} gene is shown in SEQ ID NO: 7, exhibited an amino acid sequence calculated therefrom is shown in SEQ ID NO: 8.

SEQ ID NO: 5- GAG AGA CAA TCA AAT CAT GAG TAA CAA GAG TAA CG -3

SEQ ID NO 6: 5- CAC TCA TGC AAG CGT CAC CGT TCG TGC ACG TAC -3

By inserting the thus obtained phaC1 _{Ps6 -19} gene into a BstBI / SbfI recognition site of pBluescript II (Stratagene Co., USA) to prepare a recombinant vector pPs619C1. In order to make a phaC1 _{Ps6 -19} synthase gene fragment containing only one BstBI / SbfI recognition site at each end, the BstBI position, which is inherent in the BstBI / SbfI recognition region, was first removed without conversion of amino acids by SDM (site directed mutagenesis) method. In order to add a site, overlapping PCR was performed using primers having the nucleotide sequences of SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, and SEQ ID NOs: 13 and 14.

SEQ ID NO: 5- atg ccc gga gcc ggt tcg aa-3

SEQ ID NO: 10: 5- CGT TAC TCT TGT TAC TCA TGA TTT GAT TGT CTC TC-3

SEQ ID NO: 5- GAG AGA CAA TCA AAT CAT GAG TAA CAA GAG TAA CG-3

SEQ ID NO: 12 5-CAC TCA TGC AAG CGT CAC CGT TCG TGC ACG TAC-3

SEQ ID NO: 5- GTA CGT GCA CGA ACG GTG ACG CTT GCA TGA GTG-3

SEQ ID NO: 14 5- aac ggg agg gaa cct gca gg-3

Locate the amino acid sequence of the phaC1 _Ps6 SCL _-19 synthase through the array analysis (short-chain-length PHA) on amino acid position affects three-synthesizing activity (130, 325, 481), and then, SEQ ID NO: 15/16, SEQ ID NO: number by using the primers of SEQ ID NOS: 17/18 and 19/20, was produced in the pPs619C1300 containing the gene for the amino acid sequence of the phaC1 _Ps6 E130D, S325T and Q481M _-19 synthase encoding the mutant variants to SDM method ( Table 1).

phaC1 _Ps6-19 synthase variant Recombinant vector Nucleic Acid Substitution Amino acid substitutions primer pPs619C1300 GAA → GAT E130D SEQ ID NO: 15/16 AGC → ACC S325T SEQ ID NO: 17/18 CAG → ATG Q481M SEQ ID NO: 19/20

SEQ ID NO: 15 5- atc aac ctc atg acc gat gcg atg gcg ccg acc-3

SEQ ID NO 16: 5- ggt cgg cgc cat cgc atc ggt cat gag gtt gat- 3

SEQ ID NO: 17: 5- CTG ACC TTG CTG GTG ACC GTG CTT GAT ACC ACC- 3

SEQ ID NO: 18- 5-GGT GGT ATC AAG CAC GGT CAC CAG CAA GGT CAG- 3

SEQ ID NO: 19: 5- CGA GCA GCG GGC ATA TC A TGA GCA TCC TGA ACC CGC- 3

SEQ ID NO: 20 5-GCG GGT TCA GGA TGC TCA TGA TAT GCC CGC TGC TCG- 3

The prepared pPs619C1300 vector was digested with Sbf I / Nde I, and the pPs619C1300-CPPCT recombinant vector was prepared by inserting the cloned CP-PCT gene into the Sbf I / Nde I recognition site (FIG. 2).

(2) Construction of pTacCpPctNCvEC Plasmid

was inserted pTac99A (Park and Lee, J. Bacteriol . 185, 5391-5397, 2003) a pTrc99A (Pharmacia Biotech, Sweden) cutting a gene fragment containing the Tac promoter and Transcription terminator obtained by cutting the vector with Ssp I with SspI pTaclac vector was constructed. Chromatium The phaEC of C. vinosum was amplified using the primers of SEQ ID NOs: 21 and 22 with vinosum chromosome (DSMZ180) as a main chain.

SEQ ID NO: 21 ggaaatc cat ATGACGATGTTCTCGCTCATGGCG

SEQ ID NO: 22 ggaaatc catatg atc cag ggc cac tat ctc caa ctg

The amplified phaEC gene was inserted after cleaving the pTaclac vector with Nde I (pTaclacNCvEC). Further, pTacCpPctNCvEC was completed by inserting the pct gene obtained by sequentially cutting pPs619C1300-CPPCT into EcoRI / XbaI into pTaclacNCvEC cut with EcoRI / XbaI.

(2) production of pMCS104ReAB

A plasmid pMCS104ReAB was prepared to provide α-ketothiolase (PhaA), acetoacetyl-CoA reductase (PhaB) derived from R. eutropha (Pak Si-jae, PhD thesis, Department of Chemical and Biomolecular Engineering , KAIST, 2003). pSYL105 (Lee et al . Biotechnol . Bioeng . 44: 1337, 1994) p10499A (Park et. al ., FEMS Microbiol . Lett ., 214: 217, 2002) to prepare p10499PhaAB. The p10499PhaAB plasmid was digested with SspI to obtain a gene fragment containing 104 promoter and phaAB gene, and then inserted into pBBR1MCS plasmid digested with EcoRV to prepare pMCS104ReAB plasmid.

Example  2: 3- Hydroxybutyrate -3- Hydroxy valerate - Lactate  Preparation of Copolymer

Recombinant plasmids pPs619C1300-CPPCT and pTacCpPctNCvEC containing the pct and PHA genes prepared in Example 1 were transformed into E. coli Top 10 (Invitrogen), respectively, to E. coli Top10 / pPs619C1300-CPPCT and E. coli Top10 / pTacCpPctNCvEC was obtained.

The two kinds of transformants are cultured in two steps as follows. 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer was obtained. First, 100 mL of LB medium (Bacto ^TM Triptone (BD) 10 containing 100 mg / L of ampicillin, respectively, was used for transforming recombinant E. coli E. coli Top10 / pPs619C1300-CPPCT and E. coli Top10 / pTacCpPctNCvEC. After incubation for 24 hours in g / L, Bacto ^TM yeast extract (BD) 5 g / L; NaCl (amresco) 10 g / L), the cells were recovered by centrifugation for 15 minutes at 4 ℃, 1000g.

In the case of E. coli Top10 / pTacCpPctNCvEC, when the absorbance at ₆₀₀ nm (OD ₆₀₀ ) reached about 0.6, IPTG was added to 1 mM.

The recovered cells were MR medium containing 1 g / L 3-hydroxy valerate (3-HV), 1 g / L 3-hydroxybutyrate (3-HB) and 100 mg / L ampicillin. (10 g Glucose per 1 L, 6.67 g KH ₂ PO ₄ , (NH ₄ ) ₂ HPO ₄ 4 g, MgSO ₄ 7H ₂ O 0.8 g, 0.8 g citric acid and 5 mL trace metal solution; Composition of trace metal solution: 1 5M HCl 5 mL, FeSO ₄ per _{L · 7H 2 O 10 g,} CaCl 2 2 g, ZnSO 4 · 7H 2 O 2.2 g, MnSO 4 · 4H 2 O 0.5 g, CuSO 4 · 5H 2 O 1 g, ( 0.1 g of NH ₄ ) ₆ Mo ₇ O ₂ .4H ₂ O, and 0.02 g of Na ₂ B ₄ O ₂ .10H ₂ O) were anaerobicly cultured for 3 days.

In addition, pPs619C1300-CPPCT or pTacCpPctNCvEC were transformed with pMCS104ReAB to E. coli Top 10 (Invitrogen), respectively, to obtain E. coli Top10 / pPs619C1300-CPPCT / pMCS104ReAB and E. coli Top10 / pTacCpPctNCvEC / pMCS104Re.

The two kinds of transformants are cultured in two steps as follows. 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer was obtained. First, the transformed recombinant E. coli E. coli Top10 / pPs619C1300-CPPCT / pMCS104ReAB and E. coli Top10 / pTacCpPctNCvEC / pMCS104ReAB are each contained 100 mg / L of ampicillin and 30 mg / L of chloramphenicol (Chloramphenicol). Incubated in 100 mL LB medium (10 g / L Bacto ^TM Triptone (BD), 5 g / L Bacto ^TM yeast extract (BD); 10 g / L NaCl (amresco)) at 4 ° C. and 1000 g. Cells were recovered by centrifugation for 15 minutes.

In the case of E. coli Top10 / pTacCpPctNCvEC / pMCS104ReAB, IPTG was added to 1 mM when the absorbance at ₆₀₀ nm (OD ₆₀₀ ) reached about 0.6.

The recovered cells were transferred to MR medium containing 2 g / L propionic acid or 2 g / L valeric acid, 100 mg / L ampicillin and 30 mg / L chloramphenicol. 10 g of Glucose per 1 L, 6.67 g of KH ₂ PO ₄ , (NH ₄ ) ₂ HPO ₄ 4 g, MgSO ₄ .7H ₂ O 0.8 g, 0.8 g citric acid and 5 mL of trace metal solution; composition of trace metal solution: 1 L 5 mL HMCl 5 mL, FeSO ₄ 7H ₂ O 10 g, CaCl ₂ 2 g, ZnSO ₄ 7H ₂ O 2.2 g, MnSO ₄ 4H ₂ O 0.5 g, CuSO ₄ 5H ₂ O 1 g, (NH ₄ ) ₆ Mo ₇ O ₂ .4H ₂ O 0.1 g, and Na ₂ B ₄ O ₂ .10H ₂ O 0.02 g) were anaerobicly cultured for 3 days.

The culture solution was centrifuged at 4 ° C. and 1000 g for 15 minutes to recover the cells, washed four times with a sufficient amount of distilled water, and dried at 80 ° C. for 12 hours. After quantifying the cells completely removed moisture was reacted with methanol under sulfuric acid catalyst using chloroform as a solvent at 100 ℃. This was mixed by adding distilled water equal to half the volume of chloroform at room temperature and allowed to stand until it was separated into two layers. The chloroform layer in which the monomers of the methylated polymer were dissolved in two layers was taken and analyzed by gas chromatography. As an internal standard, benzoate was used.

As shown in FIG. 5 and FIG. 6, in both E. coli Top10 / pPs619C1300-CPPCT, E. coli Top10 / pTacCpPctNCvEC, Top10 / pPs619C1300-CPPCT / pMCS104ReAB and E. coli Top10 / pTacCpPctNCvEC / pMCS104ReAB 3-hydroxybutyrate, methyl-3-hydroxyvalerate and methyl-lactate are detected and 3-hydroxybutyrate by recombinant E. coli It was confirmed that -3-hydroxyvalate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)] was produced.

As described and demonstrated in detail above, the present invention provides a novel 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)]. Effective, converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA 3-hydroxybutyrate-3-hydroxyvallate-lactate, characterized by culturing or culturing cells or plants having both the gene of the converting enzyme and the polyhydroxyalkanoate (PHA) synthase gene It is effective to provide a method for preparing a terpolymer (poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)). The novel 3-hydroxybutyrate-3-hydroxyvallate-lactate terpolymer [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)] according to the present invention is the use of conventional synthetic plastics as a biodegradable polymer. It can replace and can be used for medical purposes.

As described above in detail specific parts of the present invention, it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Thus, the substantial scope of the present invention will be defined by the appended claims and their equivalents. Simple modifications and variations of the present invention can be readily used by those skilled in the art, and all such modifications or changes can be seen to be included in the scope of the present invention.

<110> LG CHEM, LTD          Korea Advanced Institute of Science and Technology <120> Novel Copolymer of          poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate) and          Method for Preparing the Same <130> P06-B257 <160> 22 <170> KopatentIn 1.71 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 1 ggaattcatg agaaaggttc ccattattac cgcagatga 39 <210> 2 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 gctctagatt aggacttcat ttccttcaga cccattaagc cttctg 46 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 aggcctgcag gcggataaca atttcacaca gg 32 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gcccatatgt ctagattagg acttcatttc c 31 <210> 5 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 6 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 7 <211> 1677 <212> DNA Pseudomonas sp. 6-19 (KCTC11027BP) <400> 7 atgagtaaca agagtaacga tgagttgaag tatcaagcct ctgaaaacac cttggggctt 60 aatcctgtcg ttgggctgcg tggaaaggat ctactggctt ctgctcgaat ggtgcttagg 120 caggccatca agcaaccggt gcacagcgtc aaacatgtcg cgcactttgg tcttgaactc 180 aagaacgtac tgctgggtaa atccgggctg caaccgacca gcgatgaccg tcgcttcgcc 240 gatccggcct ggagccagaa cccgctctat aaacgttatt tgcaaaccta cctggcgtgg 300 cgcaaggaac tccacgactg gatcgatgaa agtaacctcg cccccaagga tgtggcgcgt 360 gggcacttcg tgatcaacct catgaccgaa gcgatggcgc cgaccaacac cgcggccaac 420 ccggcggcag tcaaacgctt ttttgaaacc ggtggcaaaa gcctgctcga cggcctctcg 480 cacctggcca aggatctggt acacaacggc ggcatgccga gccaggtcaa catgggtgca 540 ttcgaggtcg gcaagagcct gggcgtgacc gaaggcgcgg tggtgtttcg caacgatgtg 600 ctggaactga tccagtacaa gccgaccacc gagcaggtat acgaacgccc gctgctggtg 660 gtgccgccgc agatcaacaa gttctacgtt ttcgacctga gcccggacaa gagcctggcg 720 cggttctgcc tgcgcaacaa cgtgcaaacg ttcatcgtca gctggcgaaa tcccaccaag 780 gaacagcgag agtggggcct gtcgacctac atcgaagccc tcaaggaagc ggttgacgtc 840 gttaccgcga tcaccggcag caaagacgtg aacatgctcg gggcctgctc cggcggcatc 900 acttgcactg cgctgctggg ccattacgcg gcgattggcg aaaacaaggt caacgccctg 960 accttgctgg tgagcgtgct tgataccacc ctcgacagcg acgtcgccct gttcgtcaat 1020 gaacagaccc ttgaagccgc caagcgccac tcgtaccagg ccggcgtact ggaaggccgc 1080 gacatggcga aggtcttcgc ctggatgcgc cccaacgatc tgatctggaa ctactgggtc 1140 aacaattacc tgctaggcaa cgaaccgccg gtgttcgaca tcctgttctg gaacaacgac 1200 accacacggt tgcccgcggc gttccacggc gacctgatcg aactgttcaa aaataaccca 1260 ctgattcgcc cgaatgcact ggaagtgtgc ggcaccccca tcgacctcaa gcaggtgacg 1320 gccgacatct tttccctggc cggcaccaac gaccacatca ccccgtggaa gtcctgctac 1380 aagtcggcgc aactgtttgg cggcaacgtt gaattcgtgc tgtcgagcag cgggcatatc 1440 cagagcatcc tgaacccgcc gggcaatccg aaatcgcgct acatgaccag caccgaagtg 1500 gcggaaaatg ccgatgaatg gcaagcgaat gccaccaagc atacagattc ctggtggctg 1560 cactggcagg cctggcaggc ccaacgctcg ggcgagctga aaaagtcccc gacaaaactg 1620 ggcagcaagg cgtatccggc aggtgaagcg gcgccaggca cgtacgtgca cgaacgg 1677 <210> 8 <211> 559 <212> PRT Pseudomonas sp. 6-19 (KCTC11027BP) <400> 8 Met Ser Asn Lys Ser Asn Asp Glu Leu Lys Tyr Gln Ala Ser Glu Asn   1 5 10 15 Thr Leu Gly Leu Asn Pro Val Val Gly Leu Arg Gly Lys Asp Leu Leu              20 25 30 Ala Ser Ala Arg Met Val Leu Arg Gln Ala Ile Lys Gln Pro Val His          35 40 45 Ser Val Lys His Val Ala His Phe Gly Leu Glu Leu Lys Asn Val Leu      50 55 60 Leu Gly Lys Ser Gly Leu Gln Pro Thr Ser Asp Asp Arg Arg Phe Ala  65 70 75 80 Asp Pro Ala Trp Ser Gln Asn Pro Leu Tyr Lys Arg Tyr Leu Gln Thr                  85 90 95 Tyr Leu Ala Trp Arg Lys Glu Leu His Asp Trp Ile Asp Glu Ser Asn             100 105 110 Leu Ala Pro Lys Asp Val Ala Arg Gly His Phe Val Ile Asn Leu Met         115 120 125 Thr Glu Ala Met Ala Pro Thr Asn Thr Ala Ala Asn Pro Ala Ala Val     130 135 140 Lys Arg Phe Phe Glu Thr Gly Gly Lys Ser Leu Leu Asp Gly Leu Ser 145 150 155 160 His Leu Ala Lys Asp Leu Val His Asn Gly Gly Met Pro Ser Gln Val                 165 170 175 Asn Met Gly Ala Phe Glu Val Gly Lys Ser Leu Gly Val Thr Glu Gly             180 185 190 Ala Val Val Phe Arg Asn Asp Val Leu Glu Leu Ile Gln Tyr Lys Pro         195 200 205 Thr Thr Glu Gln Val Tyr Glu Arg Pro Leu Leu Val Val Pro Pro Gln     210 215 220 Ile Asn Lys Phe Tyr Val Phe Asp Leu Ser Pro Asp Lys Ser Leu Ala 225 230 235 240 Arg Phe Cys Leu Arg Asn Asn Val Gln Thr Phe Ile Val Ser Trp Arg                 245 250 255 Asn Pro Thr Lys Glu Gln Arg Glu Trp Gly Leu Ser Thr Tyr Ile Glu             260 265 270 Ala Leu Lys Glu Ala Val Asp Val Val Thr Ala Ile Thr Gly Ser Lys         275 280 285 Asp Val Asn Met Leu Gly Ala Cys Ser Gly Gly Ile Thr Cys Thr Ala     290 295 300 Leu Leu Gly His Tyr Ala Ala Ile Gly Glu Asn Lys Val Asn Ala Leu 305 310 315 320 Thr Leu Leu Val Ser Val Leu Asp Thr Thr Leu Asp Ser Asp Val Ala                 325 330 335 Leu Phe Val Asn Glu Gln Thr Leu Glu Ala Ala Lys Arg His Ser Tyr             340 345 350 Gln Ala Gly Val Leu Glu Gly Arg Asp Met Ala Lys Val Phe Ala Trp         355 360 365 Met Arg Pro Asn Asp Leu Ile Trp Asn Tyr Trp Val Asn Asn Tyr Leu     370 375 380 Leu Gly Asn Glu Pro Pro Val Phe Asp Ile Leu Phe Trp Asn Asn Asp 385 390 395 400 Thr Thr Arg Leu Pro Ala Ala Phe His Gly Asp Leu Ile Glu Leu Phe                 405 410 415 Lys Asn Asn Pro Leu Ile Arg Pro Asn Ala Leu Glu Val Cys Gly Thr             420 425 430 Pro Ile Asp Leu Lys Gln Val Thr Ala Asp Ile Phe Ser Leu Ala Gly         435 440 445 Thr Asn Asp His Ile Thr Pro Trp Lys Ser Cys Tyr Lys Ser Ala Gln     450 455 460 Leu Phe Gly Gly Asn Val Glu Phe Val Leu Ser Ser Ser Gly His Ile 465 470 475 480 Gln Ser Ile Leu Asn Pro Pro Gly Asn Pro Lys Ser Arg Tyr Met Thr                 485 490 495 Ser Thr Glu Val Ala Glu Asn Ala Asp Glu Trp Gln Ala Asn Ala Thr             500 505 510 Lys His Thr Asp Ser Trp Trp Leu His Trp Gln Ala Trp Gln Ala Gln         515 520 525 Arg Ser Gly Glu Leu Lys Lys Ser Pro Thr Lys Leu Gly Ser Lys Ala     530 535 540 Tyr Pro Ala Gly Glu Ala Ala Pro Gly Thr Tyr Val His Glu Arg 545 550 555 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 9 atgcccggag ccggttcgaa 20 <210> 10 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 10 cgttactctt gttactcatg atttgattgt ctctc 35 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 11 gagagacaat caaatcatga gtaacaagag taacg 35 <210> 12 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 12 cactcatgca agcgtcaccg ttcgtgcacg tac 33 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 13 gtacgtgcac gaacggtgac gcttgcatga gtg 33 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 14 aacgggaggg aacctgcagg 20 <210> 15 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 15 atcaacctca tgaccgatgc gatggcgccg acc 33 <210> 16 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 16 ggtcggcgcc atcgcatcgg tcatgaggtt gat 33 <210> 17 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 17 ctgaccttgc tggtgaccgt gcttgatacc acc 33 <210> 18 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 18 ggtggtatca agcacggtca ccagcaaggt cag 33 <210> 19 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 19 cgagcagcgg gcatatcatg agcatcctga acccgc 36 <210> 20 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 20 gcgggttcag gatgctcatg atatgcccgc tgctcg 36 <210> 21 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 21 ggaaatccat atgacgatgt tctcgctcat ggcg 34 <210> 22 <211> 37 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 22 ggaaatccat atgatccagg gccactatct ccaactg 37  

Claims (25)

3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer containing lactate, 3-hydroxybutyrate and 3-hydroxyvalerate as repeat units [poly (3-hydroxybutyrate-co-3-hydroxyvalerate -co-lactate)]. Of enzymes that convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA 3-hydroxybutyrate-3-hydroxyvallate-lactate terpolymer, characterized in that the culture or cultivation of cells or plants having the gene and the polyhydroxyalkanoate (PHA) synthase gene simultaneously [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate)]. The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate that does not have both genes. It is obtained by transforming the gene of the enzyme to convert to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) and the gene of PHA synthase using lactyl-CoA as a substrate. The method according to claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxy to a cell or plant having a gene of PHA synthase using lactyl-CoA as a substrate. And a method obtained by transforming alkanoate (3-hydroxyalkanoate) with a gene of an enzyme that converts 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA). The method of claim 2, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3). -hydroxyalkanoyl-CoA) is obtained by transforming a cell or plant having the gene of the enzyme converting with a gene of PHA synthase using lactyl-CoA as a substrate. The method of claim 2, wherein the lactate is converted to lactyl-CoA and 3-hydroxyalkanoate is converted into 3-hydroxyalkanoyl-CoA. The gene of the enzyme converting to CoA) is propionyl-CoA transferase gene ( pct ). The method of claim 2, wherein the polyhydroxyalkanoate (PHA) synthase gene is phaC1 _{ps6 -19} from Pseudomonas sp. 6-19. The method of claim 2, wherein the polyhydroxyalkanoate (PHA) synthase gene is a gene encoding an amino acid sequence of which E130D, S325T and Q481M are mutated in the amino acid sequence of SEQ ID NO. 7. The method of claim 2, wherein the cell is a microorganism. 8. The method of claim 7, wherein the microorganism is Escherichia coli. The method of claim 2, wherein the culturing or cultivation is performed in an environment containing 3-hydroxybutyrate (3-HB) and 3-hydroxyvalerate (3-HV). Of enzymes that convert lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Gene, polyhydroxyalkanoate (PHA) synthase gene, and enzymes that convert 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA) 3-hydroxybutyrate-3-hydroxyvalerate-lactate terpolymer, characterized in that culture or cultivation of cells or plants having the gene simultaneously [poly (3-hydroxybutyrate-co-3-hydroxyvalerate-co-lactate) ] Manufacturing method. The method of claim 12, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3). Enzymes that convert cells or plants with genes of enzymes that convert to -hydroxyalkanoyl-CoA) into genes of PHA synthase that use lactyl-CoA as substrate and 3-hydroxyalkanoyl-CoA Method characterized in that it is obtained by transformation with a gene of. 13. The method of claim 12, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxy to a cell or plant having a gene of PHA synthase using lactyl-CoA as a substrate. Enzyme that converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA and enzyme to convert 3-hydroxyalkanoyl-CoA Method characterized in that it is obtained by transformation with a gene of. The method of claim 12, wherein the cell or plant has a cell or plant having a gene of an enzyme that converts to 3-hydroxyalkanoyl-CoA (lactate) to lactate (Lactyl-CoA) ) And PHA synthetase using lactyl-CoA as a substrate and gene of enzyme converting 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA Method characterized in that it is obtained by transformation with a gene of. The method of claim 12, wherein the cell or plant converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA (3). An enzyme that converts a cell or plant having a gene of an enzyme that converts -hydroxyalkanoyl-CoA) and a gene of a PHA synthase that uses lactyl-CoA as a substrate to 3-hydroxyalkanoyl-CoA (3-hydroxyalkanoyl-CoA). Method characterized in that it is obtained by transformation with a gene of. 13. The cell or plant according to claim 12, wherein the cell or plant has a gene of an enzyme converting to 3-hydroxyalkanoyl-CoA and a gene of PHA synthase using lactyl-CoA as a substrate. Is an enzyme that converts lactate to lactyl-CoA and 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA. Method characterized in that it is obtained by transformation with a gene of. 13. The cell or plant of claim 12, wherein the cell or plant is converted to 3-hydroxyalkanoyl-CoA and the gene of the enzyme and lactyl-CoA (lactyl-CoA) and 3-hydroxyalkanoate. PHA synthetase using lactate and lactyl-CoA as substrates for cells or plants with genes of enzymes that convert (3-hydroxyalkanoate) to 3-hydroxyalkanoyl-CoA Method characterized in that it is obtained by transformation with a gene of. The method of claim 12, wherein the lactate is converted to lactyl-CoA and 3-hydroxyalkanoate is converted to 3-hydroxyalkanoyl-CoA. The gene of the enzyme converting to CoA) is propionyl-CoA transferase gene ( pct ). The method of claim 12, wherein the polyhydroxyalkanoate (PHA) synthase gene is Pseudomonas sp. _{PhaC1 ps6 -19} derived from 6-19. The method according to claim 12, wherein the polyhydroxyalkanoate (PHA) synthase gene is a gene encoding an amino acid sequence of which E130D, S325T and Q481M are mutated in the amino acid sequence of SEQ ID NO. The enzyme of claim 12, wherein the enzyme converts 3-hydroxyalkanoate to 3-hydroxyalkanoyl-CoA or α-ketothiolase (PhaA). Acetoacetyl-CoA reductase (PhaB). The method of claim 12, wherein the cell is a microorganism. The method of claim 23, wherein the microorganism is Escherichia coli. The method of claim 12, wherein the culturing or cultivation is performed in an environment containing glucose and propionic acid or valeric acid.

Images