KR100925884B1 - Method for modifying the morphology of plants by controlling the level of BrSRS in cell - Google Patents

Abstract

The present invention relates to a method of changing the shape of plants by controlling the intracellular levels of BrSRS, more specifically, Chinese cabbage ( Brassica The present invention relates to a method for changing the shape of a plant using a BrSRS gene that affects plant size and growth development isolated from rapa ), and to a transformed plant having a changed shape. The present invention provides a method of changing the shape of a plant by regulating intracellular expression of the BrSRS gene. Therefore, the present invention is intended to modify the plant size, leaf shape, leaf color and seed size, in particular to make a small plant size for the purpose of ornamental or wave shape (leaf) or leaf shape curled up on the leaf shape It can be used to increase the horticultural value by increasing the quantity of seeds by increasing the size of the seed.

BrSRS, Chinese Cabbage, Transformant, Arabidopsis, Growth, Phenotype

Description

Method for modifying the morphology of plants by controlling the level of BrSRS in cell}

The present invention relates to a method of changing the shape of plants by controlling the intracellular levels of BrSRS, more specifically, Chinese cabbage ( Brassica The present invention relates to a method for changing the shape of a plant using a BrSRS gene that affects plant size and growth development isolated from rapa ), and to a transformed plant having a changed shape.

Plants are largely composed of roots, stems, leaves nutritional organs and flowers, seeds (seeds), fruit reproductive organs, they form a certain external structure (external structure), shape or color to form the plant.

This type of plant has been an important factor that determines the usefulness of the industrial, especially agricultural and horticultural aspects, so many studies have been made for a long time. Conventionally, various plants have been produced using breeding techniques, but recently, researches for producing useful plants by genetic engineering are being conducted, and this field is called 'plant molecular biodesign'. Call.

Genetic engineering of plants is mainly done on the leaves and colors of plants. This is because the most important role in determining the shape of the plant is the leaf and color of the plant, especially the color of the flower. Plant leaves have been studied for genes that control leaf length, width, or morphology. As a result, the ROT3 gene in Arabidopsis can regulate the activity of plant growth hormone called 'brasinosteroids'. It also has been shown that the AN gene also affects the width of the leaves by regulating the cytoskeleton, altering the skeleton of the cells. In addition to the length and width, research is being conducted to find and control genes that make the left and right sides of the leaf symmetrical, genes that have different top and bottom surfaces, and genes that determine flatness and convexity.

On the other hand, the study of designing the color of the plant is producing visible results more quickly, especially in the field of flowers has been much research. An example is the blue rose, which has been a long-time dream of a breeder. The blue rose is currently on the market by a team of Australian floridians, a subsidiary of Japan's Suntory Corporation, which has introduced a blue gene of blue pansy with violets to produce roses with a blue color. In addition, blue carnations are available on the market by introducing petunia blue jeans into carnations.

Therefore, the present inventors conducted a study to find a new factor that is involved in the morphology of the plant, and as a result, a new gene that reduces the overall size of the plant without affecting the seed formation and changes the leaf shape and the seed size in particular The present invention has been completed by developing a method of finding and using the same to change the shape of a plant.

Accordingly, it is an object of the present invention to provide a method of changing the shape of a plant by regulating the intracellular level of BrSRS.

In order to achieve the above object, the present invention provides a method of changing the shape of the plant by controlling the level () of the cells in the cells of BrSRS.

In order to achieve the another object of the present invention, the present invention provides a method for producing a plant having a changed form comprising the step of transforming the plant with the BrSRS gene.

In order to achieve another object of the present invention, the present invention provides a plant transformed to change the intracellular level of BrSRS.

Hereinafter, the present invention will be described in detail.

The present invention relates to a method of changing the shape of a plant by controlling the intracellular level of BrSRS.

The BrSRS of the present invention is a full-length polypeptide consisting of 346 amino acids or a modified form consisting of 223 amino acids and is involved in the formation of the shape of a plant's height, leaf, flower, seed and the like. More specifically, the overexpression of BrSRS of the present invention is to reduce the overall size of the plant, the size of the leaf, and the shape of the leaf to have a darker green while not affecting the seed formation and the like. In addition, it increases the seed size (length and width). The function of this BrSRS was first discovered by the inventors. BrSRS is preferably a polypeptide consisting of the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

On the other hand, the polypeptide may be a functional equivalent to the polypeptide having an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. The term 'functional equivalent' is at least 60%, preferably 70%, more preferably 80% or more of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 as a result of the addition, substitution, or deletion of amino acids. It refers to a polypeptide having substantially the same activity as BrSRS of the present invention as having the identity. Here, 'substantially homogeneous activity' refers to the determination of the shape of the plant, in particular the size of the plant as a whole, the size of the leaf, the leaf shape to be darker green as it is rolled inward, and the seed size (length And width). Such functional equivalents include amino acid sequence variants in which some of the amino acids of the amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2 are substituted, deleted or added. Substitutions of amino acids are preferably conservative substitutions. Examples of conservative substitutions of amino acids present in nature are as follows; Aliphatic amino acids (Gly, Ala, Pro), hydrophobic amino acids (Ile, Leu, Val), aromatic amino acids (Phe, Tyr, Trp), acidic amino acids (Asp, Glu), basic amino acids (His, Lys, Arg, Gln, Asn ) And sulfur-containing amino acids (Cys, Met). Deletion of amino acids is preferably located in portions not directly involved in the activity of BrSRS of the present invention. Also within the scope of these functional equivalents are polypeptide derivatives in which some chemical structures of the polypeptide have been modified while maintaining the basic backbone of BrSRS and its physiological activity. For example, fusion proteins made from fusions with other proteins such as GFP, while maintaining structural alterations and physiological activities to alter the stability, shelf life, volatility or solubility of the polypeptides of the present invention.

Preferably the functional equivalent may be BrSRS present in known Chinese cabbage BAC clone (Genbank Accession No. AC189558). Genbank Accession No. AC189558 is a fragment of cabbage chromosome consisting of a total of 153,065 nucleotide sequences, BrSRS present in it consists of 1041 bases and consists of two exons (exon 1 and exon 2) and one intron. Exon 1 of BrSRS (655 bases) corresponds to sequences 82,373 to 81,097 of base AC189558 (reverse sequence) and exon 2 (386 bases) of sequence 82,373 to 81,719 of base AC189558 (reverse sequence) Corresponding. In the present invention, SEQ ID NO: 5 is represented by Genbank Accession No. The base sequence derived from Chinese cabbage chromosomal DNA consisting of exons 1 and exons 2 of AC189558 is SEQ ID NO: 4, which is the sequence of the polypeptide derived from SEQ ID NO: 5.

In the present invention, the form of the plant represents the external structure or shape of the plant, and represents the shape of each of the plant tissues or organs such as leaves, stems, roots, and flowers, and the overall shape of the plant. In the present invention, according to the intracellular level of BrSRS of SEQ ID NO: 1 or SEQ ID NO: 2 mainly reduce the overall size of the plant, the size of the leaf, and the leaf shape is darker green while rolling inward Increasing the seed size (length and width), the change in the shape of the plant in the present invention mainly indicates the change in the shape and color of the leaves, the overall size, the size of the seed.

The 'intracellular level' refers to the amount present in the cell, which can be adjusted by various methods known to those skilled in the art. For example, but not limited to, intracellular levels can be regulated through regulation at the transcriptional stage or regulation at the post-transcriptional stage. Modulation at the transcriptional stage is a method for enhancing expression of genes known to those skilled in the art, for example, by linking a promoter to a gene encoding the BrSRS of SEQ ID NO: 1, the BrSRS of SEQ ID NO: 2, or a functional equivalent thereof. Expression control method for producing a recombinant expression vector to enhance the expression of the gene or to enhance the expression of the gene around the gene encoding BrSRS of SEQ ID NO: 1, BrSRS of SEQ ID NO: 2 or functional equivalents thereof It may be carried out by a method of inserting a sequence or the like.

The term 'promoter' refers to a DNA sequence that regulates the expression of a nucleic acid sequence operably linked in a particular host cell. 'Operably linked' means that one nucleic acid fragment is combined with another nucleic acid fragment. Its function or expression is affected by other nucleic acid fragments. In addition, it may further comprise any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation. The promoter may be a promoter (constitutive promoter) to induce the expression of the gene of interest at all times at all times or a promoter (inducible promoter) to induce the expression of the gene of interest at a specific position, time, for example, SV40 promoter , CMV promoter, CAG promoter (Hitoshi Niwa et al., Gene, 108: 193-199, 1991; Monahan et al., Gene Therapy , 7: 24-30, 2000 ) , CaMV 35S promoter (Odell et al ., Nature 313: 810-812, 1985), Rsyn7 promoter (US Patent Application Serial No. 08 / 991,601), rice actin promoter (McElroy et. al ., Plant Cell 2: 163-171, 1990), ubiquitin promoter (Christensen et al ., Plant Mol. Biol. 12: 619-632, 1989) and ALS promoters (US Patent Application No. 08 / 409,297). In addition, U.S. Patents 5,608,149; The promoters disclosed in 5,608,144 5,604,121 5,569,597 5,466,785, 5,399,680 5,268,463, 5,608,142, and the like can all be used.

Modulation at the post-transcriptional stage is a method for enhancing protein expression known to those skilled in the art, for example, to enhance the stability of mRNA transcribed into a gene encoding the BrSRS of SEQ ID NO: 1 or SEQ ID NO: 2, It can be carried out by a method of enhancing the stability of the protein or polypeptide or by a method of enhancing the activity of the protein or polypeptide.

Preferably in the present invention, adjusting the intracellular level of the polypeptide of SEQ ID NO: 1 or SEQ ID NO: 2 may be carried out by a method of increasing the expression of the polynucleotide encoding the polypeptide. Such increasing methods may be methods known to those skilled in the art, respectively. For example, a recombinant expression vector may be prepared by linking a polynucleotide encoding a polypeptide of SEQ ID NO: 1 or SEQ ID NO: 2 to the promoter or an equivalent thereof. Can enhance expression. At this time, the polynucleotide may preferably have a nucleotide sequence represented by SEQ ID NO: 3, the recombinant expression vector may be pBrSRS (see Figure 1).

As used herein, the term "recombinant expression vector" refers to a gene construct that is capable of expressing a target protein or target RNA in a host cell and includes essential regulatory elements operably linked to express the gene insert. Vectors of the invention include, but are not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, viral vectors, and the like. Suitable expression vectors include signal sequences or leader sequences for membrane targeting or secretion in addition to expression control sequences such as promoters, operators, initiation codons, termination codons, polyadenylation signals, and enhancers (promoters), and are prepared according to the purpose. Can be. The expression vector also includes a selection marker for selecting a host cell containing the vector and, in the case of a replicable expression vector, a replication origin.

Plant in the present invention is a plant that can be changed in shape by the BrSRS of the present invention, but is not limited to, Arabidopsis, Chinese cabbage, cabbage, mustard, rape (rapeseed), radish, Homu ( Brassica napobrassica), turnip (Brassica rapa / Brassica campestris), tree, kale, cauliflower, broccoli, horseradish, wasabi Stork pole herbs, kkotdaji, sanggat (Brassica juncea ), brassica napus ), Brassica oleracea ( Brassica oleracea , Kohlrabi caulorapa), Brassica Pim other Calabria (Brassica fimbriata), Brassica rubo (Brassica ruvo), Brassica septi kepseu (Brassica septi - ceps ), black mustard ( Brassica nigra ), Cochlearia Officinalis officinalis ), Mustard ( Armoracia lapathifolia ), Descurainia pinnata , and Aubrieta deltoidea .

In addition, the present invention provides a method for producing a plant having a changed form, comprising the step of transforming the plant with a polynucleotide encoding BrSRS.

At this time, the regulation of BrSRS and intracellular levels is as described above, the preparation of the polynucleotide for transformation can be carried out by methods known to those skilled in the art, as described above.

Transformation of plants with BrSRS gene in the present invention can be carried out by transformation techniques known to those skilled in the art. Preferably, transformation method using Agrobacterium, microprojectile bombardment, electroporation, PEG-mediated fusion, microinjection, liposome mediation (liposome) mediated method, In planta transformation, Vacuum infiltration method, floral meristem dipping method, Agrobacteria spraying method. More preferably, a transformation method using Agrobacterium can be used. At this time, the polynucleotide may be in the form of a recombinant expression vector operably linked to a promoter, for example, operably linked to a promoter to be expressed in the transformed plant.

In an embodiment of the present invention, the cabbage specific gene is isolated and cloned from the cDNA gene bank prepared from the cabbage bud, and compared with the information contained in the NCBI database, the short internode related similar functional domain (domain). Similar to the gene with) was named BrSRS ( Brassica rapa Short internode related sequence).

In another embodiment of the present invention to prepare a recombinant expression vector comprising the BrSRS gene, Agrobacterium tumefaciens GV3101 ( Agrobacterium tumefaciens GV3101) to transform the Arabidopsis.

In another embodiment of the present invention it was confirmed whether the transformed Arabidopsis transformed and whether the gene expression by PCR, Southern blot and Northern blot. As a result, the BrSRS gene was well introduced into the transformed Arabidopsis and was stably expressed.

In another embodiment of the present invention cultivated transformed Arabidopsis was analyzed for phenotype by growth stage. As a result, the transformed Arabidopsis had a smaller overall plant size than the wild type, the leaf tip curled inwards, and a darker green color, and the seed size was larger than the non-transformant. Could.

In another embodiment of the present invention, a transgenic cabbage, into which the BrSRS gene was introduced, was produced and analyzed for its phenotype. As a result, the transgenic cabbages into which the BrSRS gene was introduced were smaller in size and smaller in leaf size than the wild type, similar to Arabidopsis transformants. Leaf shape also showed more intense waves and darker green than non-transformants.

Thus, the present invention provides a method of changing the shape of a plant by controlling the intracellular levels of BrSRS protein, which makes the plant small, especially when it is desired to modify plant size, leaf shape, leaf color and seed size. It is used for the purpose of ornamental shape, to increase the horticultural value by introducing the wave shape on the leaf shape or the leaf shape curled up, or to increase the yield by increasing the seed size. Could be.

Below. The present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

< Example  1>

BrSRS  gene Cloning  And analysis

The cabbage specific gene was isolated and cloned from the cDNA gene bank prepared from the cabbage bud. Chinese cabbage cDNA gene bank isolated RNA from the bud tissue of about 4-6 mm in size using Trizol solution (Invitrogen, USA). Extraction of mRNA from the isolated RNA was performed using a commercial kit (PolyATract kit, Promega, USA) and cDNA was synthesized using reverse transcriptase. The synthesized cDNA was cloned into the pBluescript SK (-) phagemid vector, and the whole process of the gene bank production such as cDNA synthesis, cDNA cloning, and introduction into Escherichia coli was carried out using a commercial kit (ZAP-cDNA Synthesis). kit, Stratagene, USA).

The cDNA gene bank prepared in this manner was named KBFL, and E. coli containing each cDNA was cultured in a solid selection medium to which antibiotic ampicillin was added to secure an independent clone. Escherichia coli grown on selection medium had a plasmid vector cloned with Chinese cabbage cDNA, and randomly selected approximately 10,000 E. coli were cultured in LB liquid medium and extracted plasmid DNA containing cDNA. The nucleotide sequences of these plasmid DNAs were analyzed using ABI 3730XL autobase sequencer, and the gene sequences were compared with those of genes registered in the NCBI database.

The BLAST program, which is provided on the Web, is used to compare the information contained in the NCBI database. It is similar to a gene having a short internode related similar functional domain, which is similar to BrSRS ( Brassica). rapa Short internode related sequence.

As a result of determining the nucleotide sequence of the cloned gene, it was confirmed that the Chinese cabbage gene was 100% identical to the nucleotide sequence of the Chinese cabbage BAC clone (Genebank ID AC189558), and the nucleotide sequence of the cDNA gene was set to SEQ ID NO: 3. A typical cDNA (or mRNA) sequence consists of a 5-terminal UTR sequence, a sequence of coding base sequences from the ATG start codon designating the first peptide of the protein to a TAA (or TGA) sequence that is a stop codon, and a 3-terminal UTR sequence. The poly (A) sequence, which is composed of parts and is a specific structure of mRNA, exists at the 3-terminal part. However, specifically, the cDNA sequence of SEQ ID NO: 3 is the 5-UTR sequence (number 1 to 48 of SEQ ID NO: 3), the exon 1 coding base sequence containing the ATG start codon (numbers 49 to 703 of SEQ ID NO: 3) 655 bases to base), intron sequence (235 bases from 704 to 938 of SEQ ID NO: 3), and exon 2 (terminus 3 to 324 bases from 939 to 1324) containing the stop codon ), A 3-terminal UTR sequence (2325 bases from 1325 through 1536 of SEQ ID NO: 3), and a poly (A) sequence consisting of 19 bases A (bases 1537 through 1555 of SEQ ID NO: 3) It turned out to be a structure. The entire region except for poly (A) in the structure and nucleotide sequence of cDNA represented by SEQ ID NO: 3 is exactly 100% identical to the BAC clone, the Chinese cabbage chromosome (AC189558). It is considered that the intron existing between two exon regions is not removed and remains in the form of mRNA (proven by the presence of poly (A)). RT-PCR analysis on the actual cabbage confirmed that the mRNA structure corresponding to SEQ ID NO: 3 and the mRNA structure from which the intron portion was removed from SEQ ID NO: 3 existed simultaneously. Therefore, it is inferred that two proteins that control the gene function are composed of 346 polypeptides and 223 polypeptides that are made after the two types of mRNA are completely transcribed.

The polypeptide sequence of BrSRS described in SEQ ID NO: 1 is a normal structure consisting of 346 polypeptides translated from 1,041 bases except for the intron region from the ATG start codon to TAA stop codon for protein synthesis in the nucleotide sequence of SEQ ID NO: 3 Protein sequence. SEQ ID NO: 2 is the sequence consisting of 223 polypeptides maintained from the ATG start codon (49 th base) for the protein synthesis in SEQ ID NO: 3 to the 718 th TAA stop codon. This gene has an ORF consisting of 223 amino acid sequences (669 nucleotide sequences), which alters the normal gene consisting of two exons and one intron identified by homologous chromosomal sequences (identified by BAC DNA sequences). It was judged as a premature stop mutant gene.

RT-PCR analysis of Chinese cabbage confirmed that the above-described mutant BrSRS gene was normally expressed, and that the gene of normal structure was also expressed, and is thought to be involved in expression regulation in the mutual transcription or translation stage (result not shown). ).

< Example  2>

Gateway system ( Gateway system Transformation vector and Arabidopsis transformant production using

<2-1> Production of vector for plant transformation using gateway system

Specific sequences (attB sequences) required for insertion of the gene into the final carrier (pB2GW7) were obtained by PCR. The length of the sequence to be additionally inserted into the gene for site-specific recombination is 29 bp, so that only part of this sequence (12 bp) is overhanged on the gene specific sequence (GSP) to increase the efficiency of PCR. First PCR was performed. The first PCR was 95 ° C. 2 min using SEQ ID NO: 6 (KR1B1: AAAAAGCAGGCTTGCAGGAATTCGGCACGAGG) and SEQ ID NO: 7 (KSXhoB2: AGAAAGCTGGGTACCGGGCCCCCCCTCGAG); 10 times at 94 ° C for 30 seconds, 60 ° C for 30 seconds, and 68 ° C for 1 minute; And 68 ° C. for 10 minutes. Take 1/10 of the PCR reaction solution, and again use attB1 (ACAAGTTTGTACAAAAAAGCAGGCT, SEQ ID NO: 8) and attB2 (ACCCAGCTTTCTTGTACAAAGTGGT, SEQ ID NO: 9) having the full recombinant sequence as a primer at 95 ° C for 2 minutes; 94 ° C for 30 seconds, 45 ° C. 30 seconds, 5 times at 68 ° C. per minute; 94 ° C. 30 sec, 55 ° C. 30 sec, 68 ° C. 25 min; And a second PCR under conditions of 68 ° C. for 10 minutes. The amplified PCR product was used after purification. Therefore, the PCR product had all attB sequences and was used for the production of a transformation vector. The gateway system can be largely divided into BP and LR reactions. The PCR product of the BrSRS gene containing the attB sequence was first subjected to a BP reaction with a pDNOR vector (invitrogen) to produce an intermediate vector. The desired final transformation vector was obtained (see FIG. 1).

In order to introduce the produced vector into the Arabidopsis, Agrobacterium tumefaciens GV3101 was repeatedly frozen / thawed 2-3 times, and then transformed by heat shock at 37 ° C. It was then incubated in YEP medium. Among the colonies formed, transformed colonies were used for Arabidopsis transformation. Agrobacterium tumefaciens GV3101 transformed above was named as Agrobacterium GV3101: pBrSRS, and was deposited with the Korean Agricultural Microbial Resources Center under accession number KACC 95068P.

<2-2> Arabidopsis transformant preparation

Transformed Agrobacterium was inoculated in LB medium containing 50 mg / l of specinomycin, 50 mg / l of rifampicin, 25 mg / l of gentamycin and 3-4 at 28 ° C. Incubate for about one day. The fully grown Agrobacterium was precipitated by centrifugation and suspended well in 18 ml of a 5% sucrose solution. 2 ml of Tween-20 (2500 ppm) was added to the suspension and mixed well. The Agrobacterium suspension was well sprayed on Arabidopsis flowers, placed in a 25 ° C dew chamber (RH 100%) for 24 hours and then transferred to the growth chamber. After 3-4 days, the transformation was repeated, and the seed was harvested in the growth room by repeating the same process.

< Example  3>

In Arabidopsis transformants BrSRS  Genetic analysis

<3-1> PCR Introduction of genes by

Harvested Arabidopsis seeds were mixed with 0.1% agarose in an appropriate amount, and evenly sown in pots with horticultural soil (mixed at the ratio of horticultural clay partner 5: horticultural clay TKS 2). After one week of sowing, sprouted sprouts were first sprayed with 0.3% Basta herbicide, and after 3-5 days, 0.3% Basta was further treated with secondary. After about a week, only the transformed genes survived. The surviving transformants were transplanted again and grown on growth maintained at 23 ° C. for 18 hours light, 6 hours dark.

Genomic DNA was isolated from Arabidopsis plants selected by the Chinese cabbage BrSRS gene and selected as herbicides according to the manufacturer's instructions using a commercially available kit (DNeasy Plant Kit, Qiagene). PCR (94 DEG C. 5 min.) Using 500 ng of isolated genomic DNA as a template and using a primer of SEQ ID NO: 10 (KSR1B1: 5 'AAAAAGCAGGCTTGCAGGAATTCGGCACGAGG 3') and a primer of SEQ ID NO: 11 (KSxhoB2: 5 'AGAAAGCTGGGTACCGGGCCCCCCCTCGAGA 3'); 30 cycles of ℃ 30 seconds, 50-52 ℃ 30 seconds, 72 ℃ 1 minute; 72 ℃ 10 minutes) was performed to confirm the introduction of the gene into the plant

As a result, as shown in FIG. 2A, PCR products were well amplified in T2 plants (9-1, 9-2, and 9-3) of the Transformant No. 9 line, indicating that the cabbage BrSRS gene was introduced.

<3-2> Southern On the blot  Gene introduction confirmation

In order to determine the copy number of the cabbage BrSRS gene introduced into the plant genome, Southern blot was performed as follows. 500-700 ng of genomic DNA isolated from selected Arabidopsis transformant leaves were digested with restriction enzyme HindIII and then developed by electrophoresis on 1% agarose gel. This was transferred to a Hybond ⁺ nylon membrane (Amersham, USA) by alkaline transfer method using 0.4N NaOH. Membrane with genomic DNA was hybridized at 65 ° C. using a cabbage BrSRS cDNA labeled with ³² P as a probe. After the hybridization reaction, the cells were washed for 10 minutes at 2X SSC, 0.1% SDS, 20 minutes at 1X SSC, 20% at 0.1% SDS, 20 minutes at 0.1X SSC, 0.1% SDS, and developed on an x-ray film to confirm gene introduction. It was.

As a result, as shown in Fig. 2B, only one band appeared, indicating that one copy of the gene was introduced into each transformant (T2 plant of line 9). In addition, these results showed that the cabbage BrSRS gene was stably inserted into the Arabidopsis genome.

<3-3> Northern Blot  Gene expression analysis

In order to determine whether the introduction of the Chinese cabbage BrSRS gene is confirmed in the transformant Northern blot was performed as follows. Verwoerd et al. (1989, Nucleic acid research 17: 2362) were isolated from the leaves of each independent transformant of T1 generation (No. 15, 13, 7, 9), and the total RNA was transferred to a 1% agarose gel. After developing by electrophoresis, it was transferred to a Hybond ⁺ nylon membrane in the same manner as in Example <3-2>. It was hybridized, washed and photosensitive as in the method of Example <3-2>.

As a result, as shown in Figure 3, it was found that the Chinese Cabbage BrSRS gene is well expressed in the transformants (15, 13, 9) showing the characteristic phenotype.

< Example  4>

BrSRS Phenotypic analysis of growth-induced Arabidopsis transformants

Seeds of transformant T2 showing phenotypic characteristics are mixed with 0.1% agarose in an appropriate amount and seeded evenly in pots with horticultural soil (mixed at the ratio of horticultural clay partner 5: horticultural clay TKS 2). Arabidopsis growth was cultivated under light control and temperature control at 23 ° C. in 18 h light and 6 h dark, and plant growth was observed at 2, 3 and 5 weeks after seed germination.

As a result, as shown in Figure 4, two weeks after germination, the total size of the plant was small compared to the non-transforming Colombian Arabidopsis, and the leaf tip was curled inward. After 3 weeks, the size of the plant was smaller than that of the control and maintained the same leaf shape. After 5 weeks, the total size of the plant was smaller than the control and the leaf shape was the same as the first. Flowering time was similar to control.

As shown in Figure 5, the Arabidopsis and non-transformers introduced BrSRS gene showed the most distinctive features in the leaf form. As shown in FIG. 5, the transformant was smaller and thinner than the leaves of the non-transformant, and the leaf tip was rolled inward to show a darker green color. Flowers were also smaller overall than nontransformants. The size of the pods was not significantly different from the non-transformants. Seeds were larger in size compared to non-transformants, which were 16% larger than non-transformed seeds (see Table 1 below).

Nontransformers and  Seed Size Comparison of Transformants Plant Seed length (mm) Seed width (mm) Nontransformer control-1 0.45 ± 0.01 0.29 ± 0.01 control-2 0.49 ± 0.02 0.31 ± 0.01 Transformant B41-9 0.52 ± 0.02 0.37 ± 0.02 B41-15 0.58 ± 0.02 0.36 ± 0.01

< Example  5>

BrSRS Chinese cabbage transformants introduced

<5-1> Chinese cabbage transformant preparation

Chinese cabbage transformation was co-cultured for 2 days after inoculation of Agrobacterium tumefaciens GV3101 transformed with BrSRS gene prepared in Example <2-1> to embryonic embryos germinated for 5-6 days in the cabin. . The transformants were prepared by organically rooting from shoots re-differentiated in a medium containing 4 mg / l of herbicide phosphinothricin (ppt).

As a result, 13 Transformants could be prepared.

<5-2> Confirmation of BrSRS gene introduction

Separation of DNA from the cabbage transformants to determine whether or not the cabbage transformant is the primer of SEQ ID NO: 12 (KSR1B1: 5 'AAAAAGCAGGCTTGCAGGAATTCGGCACGAGG 3') and the primer of SEQ ID NO: 13 (KSxhoB2: 5 'AGAAAGCTGGGTACCGGGCCCCCCCTCGAG 3) Except for using '), the BrSRS gene was introduced into the cabbage transformant as in Example <3-1>.

As a result, as shown in Figure 6, the PCR product was amplified in the transformant was found that the BrSRS gene was introduced into the cabbage transformant.

<5-3> Chinese cabbage transformant phenotype characteristics

The transformants were transplanted into soil mixed in the ratio of horticultural clay partner 5: horticultural clay TKS 2 and cultivated in glass greenhouse to observe phenotypic characteristics such as plant growth and leaf shape, and low temperature treatment for flowering (4 ℃). After 40 days of treatment, the morphological characteristics after the addition were observed.

As a result, as shown in Figure 7, when comparing the transformant and the non-transformant introduced BrSRS gene, the size of the cabbage transformant overall dwarf and leaf size was similar to the Arabidopsis transformant. Leaf shape also showed a severe wave and dark green compared to the non-transformant (Fig. 7A). In addition, the flowering plants also showed dwarfity and blossomed flowers in a short state without elongation compared to non-transformants (FIG. 7B). These results suggest that the expression of BrSRS gene may affect organ development and morphological features such as plant size, leaf shape, and leaf color.

As described above, the present invention provides a method of changing the shape of the plant by controlling the intracellular levels of BrSRS protein. Therefore, the present invention is intended to modify the plant size, leaf shape, leaf color and seed size, in particular to make a small plant size for the purpose of ornamental or wave shape (leaf) or leaf shape curled up on the leaf shape It can be used to increase horticultural value by increasing horticultural value, or to increase yields by increasing seed size.

Figure 1 shows a schematic diagram of the pBrSRS vector of the present invention (Bar ^R : Bar resistance gene, P35S: CaMV 35S promoter, T35S: CaMV 35S terminator)

Figure 2 confirms the introduction of BrSRS gene in Arabidopsis transformants by PCR (A) and Southern blot (B).

Figure 3 confirms the expression of BrSRS gene in Arabidopsis transformants by Northern blot (Nt: wild type, 15, 13, 9: each independent transformant of the T1 generation showing the phenotype, 7: shows the phenotype. Do not transform)

Figure 4 confirms the phenotype of growth stage of Arabidopsis transformants.

Figure 5 confirms the phenotype of the leaves (A), flowers (B), pods (C), seeds (D) in Arabidopsis transformants.

Figure 6 shows the introduction of BrSRS gene in Chinese cabbage transformants by PCR.

Fig. 7 shows the phenotype of Chinese cabbage transformants, which are the plant form (A) before flowering and the plant form (B) after flowering.

<110> Republic of Korea <120> Method for modifying the morphology of plants by controlling the          level of BrSRS in cell <130> NP07-0137 <160> 13 <170> KopatentIn 1.71 <210> 1 <211> 346 <212> PRT <213> Brassica rapa <400> 1 Met Ala Gly Leu Phe Tyr Leu Gly Gly Arg Glu Asn Asn Lys Gln Asp   1 5 10 15 His His His Gln Asp Lys Asp His Asn Glu Asp Arg Ser Asn Asn Tyr              20 25 30 Leu His Leu Tyr Lys Asp Glu Ile Tyr Asn Asn Asn Lys Gly Phe Glu          35 40 45 Ile Trp Pro Pro Gln Tyr Phe Gln Gln Gln Gln Glu Gln Gln Asn His      50 55 60 Val Ala Pro Pro Thr Asn Phe Tyr Ser Phe Gly Met Val Pro Ser Gly  65 70 75 80 Ser Ser His Asn Asn Asn Arg Ser Ser Asn Arg Ser Leu Tyr Phe Asn                  85 90 95 Val Val Ser Asp His Glu Pro Val Arg Ser Ser Thr Gly Arg Phe Thr             100 105 110 Val Thr Arg Gln Gly Ser Met Asn Cys Gln Asp Cys Gly Asn Gln Ala         115 120 125 Lys Lys Asp Cys Pro His Met Arg Cys Arg Thr Cys Cys Lys Ser Arg     130 135 140 Gly Phe Asp Cys Gln Thr His Val Lys Ser Thr Trp Val Pro Ala Ala 145 150 155 160 Lys Arg Arg Glu Arg Gln Ala Gln Leu Ala Gly Leu Pro Thr Lys Arg                 165 170 175 Ser Arg Glu Ala Ser Ser Gly Gly Gly Asp Asp Asp Asp Glu Arg Glu             180 185 190 Gly Asp Glu Asn Gly Ala Gln Gly Gly Gly Gly Gly Ser Ala Leu Ala         195 200 205 Cys Ile Arg Val Val Asn Ala Ser Ser Ser Gly Phe Glu Ser Ser His     210 215 220 Leu Pro Pro Glu Leu Ser Leu Pro Ala Val Phe Arg Cys Met Arg Val 225 230 235 240 Ser Ser Ile Asp Asp Glu Asp Glu Glu Tyr Ala Tyr Gln Thr Ala Val                 245 250 255 Asn Ile Gly Gly His Val Phe Lys Gly Ile Leu Tyr Asp Gln Gly Pro             260 265 270 Ser Asp Asp His Arg Tyr Ser Ser Ser Pro Ala Ala Ile Ala Ala Glu         275 280 285 Thr Ser Gln His His Leu Asn Leu Leu Ala Ser Ala Ser Ser Val Ala     290 295 300 Thr Thr Thr Gly Val Thr Ala Ser Asn Ile Asn Asn Ala Ser Ile Asp 305 310 315 320 Pro Ser Ser Val Tyr Thr Ala Ala Pro Ile Asn Ser Phe Val Thr Ala                 325 330 335 Ala Thr Ser Phe Phe Ala Ser Pro Arg Ser             340 345 <210> 2 <211> 223 <212> PRT <213> Brassica rapa <400> 2 Met Ala Gly Leu Phe Tyr Leu Gly Gly Arg Glu Asn Asn Lys Gln Asp   1 5 10 15 His His His Gln Asp Lys Asp His Asn Glu Asp Arg Ser Asn Asn Tyr              20 25 30 Leu His Leu Tyr Lys Asp Glu Ile Tyr Asn Asn Asn Lys Gly Phe Glu          35 40 45 Ile Trp Pro Pro Gln Tyr Phe Gln Gln Gln Gln Glu Gln Gln Asn His      50 55 60 Val Ala Pro Pro Thr Asn Phe Tyr Ser Phe Gly Met Val Pro Ser Gly  65 70 75 80 Ser Ser His Asn Asn Asn Arg Ser Ser Asn Arg Ser Leu Tyr Phe Asn                  85 90 95 Val Val Ser Asp His Glu Pro Val Arg Ser Ser Thr Gly Arg Phe Thr             100 105 110 Val Thr Arg Gln Gly Ser Met Asn Cys Gln Asp Cys Gly Asn Gln Ala         115 120 125 Lys Lys Asp Cys Pro His Met Arg Cys Arg Thr Cys Cys Lys Ser Arg     130 135 140 Gly Phe Asp Cys Gln Thr His Val Lys Ser Thr Trp Val Pro Ala Ala 145 150 155 160 Lys Arg Arg Glu Arg Gln Ala Gln Leu Ala Gly Leu Pro Thr Lys Arg                 165 170 175 Ser Arg Glu Ala Ser Ser Gly Gly Gly Asp Asp Asp Asp Glu Arg Glu             180 185 190 Gly Asp Glu Asn Gly Ala Gln Gly Gly Gly Gly Gly Ser Ala Leu Ala         195 200 205 Cys Ile Arg Val Val Asn Ala Ser Ser Ser Gly Ile Phe Ser Phe     210 215 220 <210> 3 <211> 1555 <212> DNA <213> Brassica rapa <400> 3 aggcttgcag gaattcggca cgagggtttg tgattggaag tagaagaaat ggctggattg 60 ttctatctag gaggtagaga aaacaacaaa caagatcatc atcatcaaga caaggatcat 120 aatgaagaca ggagcaacaa ttatcttcat ctatataaag acgagatcta caacaacaac 180 aagggttttg agatctggcc acctcaatat tttcagcaac aacaagaaca acaaaaccac 240 gtcgctcctc ctacaaattt ctactctttt ggtatggttc caagtggtag cagccataac 300 aataaccgga gtagtaatcg gagtttgtat ttcaacgtcg tctccgacca tgagccggtg 360 agatcctcca cgggaaggtt tacggtaacc aggcaaggaa gcatgaattg ccaagactgt 420 gggaatcaag ccaagaaaga ttgtcctcat atgagatgcc gtacttgttg caagagccga 480 gggtttgatt gtcaaaccca cgtgaagagt acgtgggtcc ctgctgctaa acgccgtgag 540 agacaggctc agttagctgg tttgccaact aagcggagca gagaggctag ctctggcggt 600 ggtgatgatg atgatgagag agagggcgat gaaaatggag ctcaaggcgg tggtggtgga 660 tcagctcttg cttgcatccg tgtagtcaat gctagctctt caggtatttt tagtttttaa 720 ttaactaacc taatttatcg gtacctttag tggaacatta actttgtgag atcataagaa 780 gatgtaattt tgattgttta gtcaaatatc atttgagtgt gaatgaagtt tttctttaca 840 agtatttggt ttcataactt ttattcgatt atatgaactt tatattaaaa tatgtgttat 900 gtttggattt atagtaattt tcatttttat tgaattaggg tttgagagta gtcacttacc 960 accggagtta agtttacccg cggttttccg gtgtatgaga gtcagctcaa ttgatgatga 1020 agacgaagag tatgcatatc aaacggctgt gaacatcgga ggtcacgtgt tcaaaggcat 1080 tctctacgac caaggtccgt cagatgatca ccgttacagc tcaagccctg ccgccatagc 1140 cgcagaaacc tctcaacacc atcttaatct cttggcctca gcctcttcag tcgccactac 1200 aaccggcgtg acagcgagca gtattaataa cgcatcaatt gacccttctt cggtttacac 1260 tgcagcaccg atcaactctt ttgtcacggc cgctacatcc ttctttgcat ctcctaggtc 1320 ttaagattta aatgttatgt ttttaaaacg tttgttatta ctcttataat tatcagagga 1380 ctaccagtac caaaaattat tatttcgata gttttgttgt tgtcggacaa tgcggtaact 1440 ttcgtaccta gctagggttt gcgagagtac tgattaacat gcacatcgta cgttttctag 1500 agataaatga tcgattatta tatattttct tttgagaaaa aaaaaaaaaa aaaaa 1555 <210> 4 <211> 346 <212> PRT <213> Brassica rapa <400> 4 Met Ala Gly Leu Phe Tyr Leu Gly Gly Arg Glu Asn Asn Lys Gln Asp   1 5 10 15 His His His Gln Asp Lys Asp His Asn Glu Asp Arg Ser Asn Asn Tyr              20 25 30 Leu His Leu Tyr Lys Asp Glu Ile Tyr Asn Asn Asn Lys Gly Phe Glu          35 40 45 Ile Trp Pro Pro Gln Tyr Phe Gln Gln Gln Gln Glu Gln Gln Asn His      50 55 60 Val Ala Pro Pro Thr Asn Phe Tyr Ser Phe Gly Met Val Pro Ser Gly  65 70 75 80 Ser Ser His Asn Asn Asn Arg Ser Ser Asn Arg Ser Leu Tyr Phe Asn                  85 90 95 Val Val Ser Asp His Glu Pro Val Arg Ser Ser Thr Gly Arg Phe Thr             100 105 110 Val Thr Arg Gln Gly Ser Met Asn Cys Gln Asp Cys Gly Asn Gln Ala         115 120 125 Lys Lys Asp Cys Pro His Met Arg Cys Arg Thr Cys Cys Lys Ser Arg     130 135 140 Gly Phe Asp Cys Gln Thr His Val Lys Ser Thr Trp Val Pro Ala Ala 145 150 155 160 Lys Arg Arg Glu Arg Gln Ala Gln Leu Ala Gly Leu Pro Thr Lys Arg                 165 170 175 Ser Arg Glu Ala Ser Ser Gly Gly Gly Asp Asp Asp Asp Glu Arg Glu             180 185 190 Gly Asp Glu Asn Gly Ala Gln Gly Gly Gly Gly Gly Ser Ala Leu Ala         195 200 205 Cys Ile Arg Val Val Asn Ala Ser Ser Ser Gly Phe Glu Ser Ser His     210 215 220 Leu Pro Pro Glu Leu Ser Leu Pro Ala Val Phe Arg Cys Met Arg Val 225 230 235 240 Ser Ser Ile Asp Asp Glu Asp Glu Glu Tyr Ala Tyr Gln Thr Ala Val                 245 250 255 Asn Ile Gly Gly His Val Phe Lys Gly Ile Leu Tyr Asp Gln Gly Pro             260 265 270 Ser Asp Asp His Arg Tyr Ser Ser Ser Pro Ala Ala Ile Ala Ala Glu         275 280 285 Thr Ser Gln His His Leu Asn Leu Leu Ala Ser Ala Ser Ser Val Ala     290 295 300 Thr Thr Thr Gly Val Thr Ala Ser Asn Ile Asn Asn Ala Ser Ile Asp 305 310 315 320 Pro Ser Ser Val Tyr Thr Ala Ala Pro Ile Asn Ser Phe Val Thr Ala                 325 330 335 Ala Thr Ser Phe Phe Ala Ser Pro Arg Ser             340 345 <210> 5 <211> 1788 <212> DNA <213> Brassica rapa <220> <221> 5'UTR <222> (-300) .. (-1) <220> <221> exon <222> (1) .. (655) <220> <221> intron (222) (656) .. (891) <220> <221> exon (222) (892) .. (1277) <220> <221> 3'UTR (222) (1278) .. (1488) <400> 5 caaatgtctt aaatgatttg aacagaagca ataaaccttg gcggcgtttg cagcagtttc -241 ttaaatttcc ttaccatcat tactctctca tccgctccca gtttcactgc tcctttcaaa -181 tacctaacac atcttcaagt ctagaaatta atgagctagg gagcaaaaga aaaagaagaa -121 ggtaaactcg aatccccaaa aataatttat ttcacaaacc cctaacatag tctcaaatat -61 tctctctctt tttctctctc tcttttccgt ggcgtgtgtt tgtgattgga agtagaagaa -1 atggctggat tgttctatct aggaggtaga gaaaacaaca aacaagatca tcatcatcaa 60 gacaaggatc ataatgaaga caggagcaac aattatcttc atctatataa agacgagatc 120 tacaacaaca acaagggttt tgagatctgg ccacctcaat attttcagca acaacaagaa 180 caacaaaacc acgtcgctcc tcctacaaat ttctactctt ttggtatggt tccaagtggt 240 agcagccata acaataaccg gagtagtaat cggagtttgt atttcaacgt cgtctccgac 300 catgagccgg tgagatcctc cacgggaagg tttacggtaa ccaggcaagg aagcatgaat 360 tgccaagact gtgggaatca agccaagaaa gattgtcctc atatgagatg ccgtacttgt 420 tgcaagagcc gagggtttga ttgtcaaacc cacgtgaaga gtacgtgggt ccctgctgct 480 aaacgccgtg agagacaggc tcagttagct ggtttgccaa ctaagcggag cagagaggct 540 agctctggcg gtggtgatga tgatgatgag agagagggcg atgaaaatgg agctcaaggc 600 ggtggtggtg gatcagctct tgcttgcatc cgtgtagtca atgctagctc ttcaggtatt 660 tttagttttt aattaactaa cctaatttat cggtaccttt agtggaacat taactttgtg 720 agatcataag aagatgtaat tttgattgtt tagtcaaata tcatttgagt gtgaatgaag 780 ttttttcttt acaagtattt ggtttcataa cttttattcg attatatgaa ctttatatta 840 aaatatgtgt tatgtttgga tttatagtaa ttttcatttt tattgaatta gggtttgaga 900 gtagtcactt accaccggag ttaagtttac ccgcggtttt ccggtgtatg agagtcagct 960 caattgatga tgaagacgaa gagtatgcat atcaaacggc tgtgaacatc ggaggtcacg 1020 tgttcaaagg cattctctac gaccaaggtc cgtcagatga tcaccgttac agctcaagcc 1080 ctgccgccat agccgcagaa acctctcaac accatcttaa tctcttggcc tcagcctctt 1140 cagtcgccac tacaaccggc gtgacagcga gcaatattaa taacgcatca attgaccctt 1200 cttcggttta cactgcagca ccgatcaact cttttgtcac ggccgctaca tccttctttg 1260 catctcctag gtcttaagat ttaaatgtta tgtttttaaa acgtttgtta ttactcttat 1320 aattatcaga ggactaccag taccaaaaat tattatttcg atagttttgt tgttgtcgga 1380 caatgcggta actttcgtac ctagctaggg tttgcgagag tactgattaa catgcacatc 1440 gtacgttttc tagagataaa tgatcgatta ttatatattt tcttctga 1488 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KR1B1 <400> 6 aaaaagcagg cttgcaggaa ttcggcacga gg 32 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> KSXhoB2 <400> 7 agaaagctgg gtaccgggcc ccccctcgag 30 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attB1 <400> 8 acaagtttgt acaaaaaagc aggct 25 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> attB2 <400> 9 acccagcttt cttgtacaaa gtggt 25 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KSR1B1 <400> 10 aaaaagcagg cttgcaggaa ttcggcacga gg 32 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> KSxhoB2 <400> 11 agaaagctgg gtaccgggcc ccccctcgag 30 <210> 12 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> KSR1B1 <400> 12 aaaaagcagg cttgcaggaa ttcggcacga gg 32 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> KSxhoB2 <400> 13 agaaagctgg gtaccgggcc ccccctcgag 30  

Claims (8)

A method of changing the morphology of a plant by controlling the intracellular level of a polypeptide having an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. The method of claim 1, wherein said regulating said intracellular levels increases expression of a polynucleotide encoding said polypeptide. The method of claim 2, wherein the polynucleotide has a nucleotide sequence represented by SEQ ID NO: 3. The method of claim 1, wherein the plant is Arabidopsis, Chinese cabbage, cabbage, mustard, rape (rapeseed), radish, Homu ( Brassica) napobrassica ), turnip ( Brassica rapa / Brassica campestris ), tricale, cauliflower, broccoli, wasabi, horseradish, pole sprouts, flower pods, brassica juncea , brassica napus , brassica oleracea , brassica caulorapa , Brassica fimbriata , Brassica ruvo , Brassica septi-ceps , Black mustard ( Brassica nigra ), Cochlearia officinalis , Mustard A method of changing the shape of a plant, characterized in that it is selected from a pizza plant consisting of Armoracia lapathifolia , Descurainia pinnata , and Aubrieta deltoidea . A method for producing a plant with a changed form, comprising the step of transforming the plant with a polynucleotide encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. The method according to claim 5, wherein the polynucleotide has a nucleotide sequence represented by SEQ ID NO: 3. A plant produced by the method of claim 5 or 6. The method according to claim 7, wherein the plants are Arabidopsis, Chinese cabbage, cabbage, mustard, rape (rapeseed), radish, brass radish ( Brassica napabrassica ), turnip ( Brassica rapa / Brassica campestris ), tricale , cauliflower, broccoli, wasabi, Horseradish, Pole Sprout, Flower Pot, Brassica juncea , Brassica napus , Brassica oleracea , Brassica caulorapa , Brassica fimbriata , Brassica Brassica ruvo , Brassica septi-ceps , Black mustard ( Brassica nigra ), Cochlearia officinalis , Mustard ( Armoracia lapathifolia ), Descurainia pinnata ( Descurainia pinnata) ), A plant characterized by being selected from a pizza plant consisting of Aubrieta deltoidea .

Images