KR100834378B1 - Cytochrome p450 gene for strengthening apical dominance of plant - Google Patents

Cytochrome p450 gene for strengthening apical dominance of plant Download PDF

Info

Publication number
KR100834378B1
KR100834378B1 KR1020070005864A KR20070005864A KR100834378B1 KR 100834378 B1 KR100834378 B1 KR 100834378B1 KR 1020070005864 A KR1020070005864 A KR 1020070005864A KR 20070005864 A KR20070005864 A KR 20070005864A KR 100834378 B1 KR100834378 B1 KR 100834378B1
Authority
KR
South Korea
Prior art keywords
plant
gene
cytochrome
apical dominance
protein
Prior art date
Application number
KR1020070005864A
Other languages
Korean (ko)
Inventor
최상봉
김호방
Original Assignee
명지대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 명지대학교 산학협력단 filed Critical 명지대학교 산학협력단
Priority to KR1020070005864A priority Critical patent/KR100834378B1/en
Priority to PCT/KR2008/000250 priority patent/WO2008088161A1/en
Priority to CN2008800026324A priority patent/CN101583718B/en
Priority to US12/523,780 priority patent/US8153862B2/en
Application granted granted Critical
Publication of KR100834378B1 publication Critical patent/KR100834378B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

A method for strengthening apical dominance of a plant is provided to inhibit the growth of a secondary flower stalk and lateral branch of a plant using a cytochrome P450 gene. A method for strengthening apical dominance of a plant comprises a step of transforming a plant cell using a recombinant plant expression vector including a gene encoding a cytochrome P450 protein, which is used in order to strengthen the apical dominance of the plant and derived from Arabidopsis thaliana, and includes an amino acid sequence of SEQ ID : NO. 1 to over-express the gene, wherein the plant is a food crop selected from the group consisting of rice, rape, wheat, barley, corn, soybean, potato, red soybean, oat and African millet.

Description

식물의 정단 우성을 강화시키는 시토크롬 P450 유전자{Cytochrome P450 gene for strengthening apical dominance of plant}Cytochrome P450 gene for strengthening apical dominance of plant}

도 1은 애기장대의 상이한 조직에서 AtCYP78A7 발현의 RT-PCR 분석 결과를 보여준다.1 shows the results of RT-PCR analysis of AtCYP78A7 expression in different tissues of Arabidopsis.

도 2는 AtCYP78A7 발현의 GUS 조직화학적 분석 결과를 보여준다.2 shows the results of GUS histochemical analysis of AtCYP78A7 expression.

도 3은 발아 후 40일에 형질전환 아라비돕시스 식물의 표현형을 보여준다.3 shows the phenotype of the transformed Arabidopsis plant at 40 days after germination.

도 4는 발아 후 50일에 야생형 및 형질전환 식물 키의 비교를 보여준다.4 shows a comparison of wild type and transgenic plant heights 50 days after germination.

도 5는 아라비돕시스에서 AtCYP78A7 과발현은 종자 크기(A), 종자 무게(B) 및 12S 글로불린 및 2S 알부민과 같은 종자 저장 단백질의 함량(C)을 증가시킨다는 것을 보여준다.5 shows that AtCYP78A7 overexpression in Arabidopsis increases seed size (A), seed weight (B) and content of seed storage proteins (C) such as 12S globulin and 2S albumin.

도 6은 ABA에 반응하거나 저온/건조 스트레스 관련 유전자의 반정량적인 RT-PCR 결과를 보여준다.Figure 6 shows semi-quantitative RT-PCR results of ABA or cold / dry stress related genes.

도 7은 야생형 및 형질전환 아라비돕시스 사이의 건조 스트레스 반응의 비교를 보여준다. 숫자는 AtCYP78A7를 과발현하는 독립적인 형질전환 라인을 나타낸다. daws, 수분 스트레스 후 일수; darw, 재수분 후 일수.7 shows a comparison of dry stress response between wild type and transforming arabidopsis. Numbers indicate independent transformation lines overexpressing AtCYP78A7 . daws, days after moisture stress; darw, days after rehydration.

본 발명은 식물의 정단 우성을 강화시키는데 이용되는, 애기장대(Arabidopsis thaliana) 유래의 시토크롬 P450 단백질, 상기 단백질을 코딩하는 유전자, 상기 유전자를 포함하는 재조합 식물 발현 벡터, 상기 벡터를 이용하여 식물의 정단 우성을 강화시키는 방법, 상기 방법에 의해 제조된 정단 우성이 강화된 식물 및 상기 식물의 형질전환(transgenic) 종자에 관한 것이다.The present invention is a cytochrome P450 protein derived from Arabidopsis thaliana, a gene encoding the protein, a recombinant plant expression vector containing the gene, which is used to enhance apical dominance of a plant, and apical of the plant using the vector. A method for enhancing dominance, a plant enriched in apical dominance produced by the method, and a transgenic seed of the plant.

시토크롬 P450은 화학적으로 다른 다양한 종류의 기질에 대하여 효소학적 반응들, 즉, 내인성 및 이종성(xenobiotic) 기질에 대한 산화, 과산화 및 환원 대사를 촉매한다. 식물 P450은 식물 생산물, 예컨대 페닐프로파노이드, 알카로이드, 테르페노이드, 지질, 시아노제닉 글리코시드(cyanogenic glycosides) 및 글루코시놀레이트의 합성을 포함하는, 생화학적 경로에 참여한다(Chappel, Annu. Rev. Plant Physiol. Plant Mol. Biol. 198,49 : 311-343).Cytochrome P450 catalyzes enzymatic reactions to a variety of chemically different substrates, ie oxidation, peroxidation and reduction metabolism to endogenous and xenobiotic substrates. Plant P450 participates in biochemical pathways, including the synthesis of plant products such as phenylpropanoids, alkaloids, terpenoids, lipids, cyanogenic glycosides and glucosinolates (Chappel, Annu). Rev. Plant Physiol.Plant Mol.Biol. 198,49: 311-343).

시토크롬 P450은 또한 P450 헤미-티올레이트 단백질로 알려져 있으며, P450-함유 모노옥시게나제 시스템이라 일컫는 다중 인자 전자 전이 연쇄(multicomponent electron transfer chains)에서 최종 산화효소로 작용한다. 특이 촉매 반응으로는, 탈메틸화, 수산화, 에폭시화(epoxidation), N-산화, 설포옥시데이션, N-, S- 및 O-탈알킬화, 탈황산화, 탈아민화 및 아조(azo), 니트로 및 N-옥사이드 기의 환원이 있다.Cytochrome P450 is also known as P450 hemi-thiolate protein and acts as the final oxidase in multicomponent electron transfer chains called P450-containing monooxygenase system. Specific catalytic reactions include demethylation, hydroxylation, epoxidation, N-oxidation, sulfooxidation, N-, S- and O-dealkylation, desulfurization, deamination and azo, nitro and N -Reduction of oxide groups.

니코티아나 식물의 P450 효소의 다양한 역할은 페닐프로파노이드, 알카로이드, 테르페노이드, 지질, 시아노제닉 글리코시드, 글루코시놀레이트 및 그외 다른 화학적 본체에 대한 호스트와 같은 식물 대사산물의 다양성과 관련되어 있다. 최근 몇 년 동안, 일부 P450 효소가 식물 내 식물 대사 산물들의 구성에 영향을 미치는 것으로 확인되었다.The various roles of P450 enzymes in Nicotiana plants are related to the diversity of plant metabolites such as phenylpropanoids, alkaloids, terpenoids, lipids, cyanogenic glycosides, glucosinolates, and hosts to other chemical bodies. It is. In recent years, some P450 enzymes have been found to affect the composition of plant metabolites in plants.

상기와 같은 종래 기술을 바탕으로, 시토크롬 P450의 기능을 연구하던 중, 본 발명자들은 애기장대(Arabidopsis thaliana) 유래의 시토크롬 P450이 식물의 정단 우성을 강화시키는 것을 발견하고, 본 발명을 완성하게 되었다.Based on the prior art as described above, while studying the function of cytochrome P450, the present inventors have found that cytochrome P450 derived from Arabidopsis thaliana enhances apical dominance of plants, thereby completing the present invention.

본 발명의 목적은 식물의 정단 우성을 강화시키는 애기장대(Arabidopsis thaliana) 유래의 시토크롬 P450 단백질을 제공한다.It is an object of the present invention to provide cytochrome P450 protein from Arabidopsis thaliana which enhances apical dominance of plants.

또한, 본 발명의 목적은 상기 시토크롬 P450 단백질을 코딩하는 유전자를 제공한다.It is also an object of the present invention to provide a gene encoding the cytochrome P450 protein.

또한, 본 발명의 목적은 상기 유전자를 포함하는 재조합 식물 발현 벡터를 제공한다.It is also an object of the present invention to provide a recombinant plant expression vector comprising the gene.

또한, 본 발명의 목적은 상기 벡터를 이용하여 식물의 정단 우성을 강화시키는 방법을 제공한다.It is also an object of the present invention to provide a method for enhancing apical dominance of a plant using the vector.

또한, 본 발명의 목적은 상기 방법에 의해 제조된 정단 우성이 강화된 식물 및 상기 식물의 형질전환(transgenic) 종자를 제공한다.It is also an object of the present invention to provide a plant with enhanced apical dominance produced by the method and transgenic seeds of the plant.

본 발명의 목적을 달성하기 위하여, 본 발명은 식물의 정단 우성을 강화시키는데 이용되는, 서열번호 1의 아미노산 서열을 가지는 애기장대(Arabidopsis thaliana) 유래의 시토크롬 P450 단백질을 제공한다.In order to achieve the object of the present invention, the present invention provides a cytochrome P450 protein derived from Arabidopsis thaliana having the amino acid sequence of SEQ ID NO: 1, which is used to enhance apical dominance of plants.

본 발명은 애기장대(Arabidopsis thaliana) 유래의 시토크롬 P450 단백질의 용도에 관한 것으로서, 구체적으로 상기 단백질은 식물의 정단 우성을 강화시키는데 이용될 수 있다. 정단 우성(apical dominance)은 식물체의 제일 꼭대기에서 생성된 호르몬에 의해 다른 가지의 생성이 억제되는 현상을 말한다.The present invention relates to the use of cytochrome P450 protein from Arabidopsis thaliana, specifically, the protein can be used to enhance apical dominance of plants. Apical dominance is a phenomenon in which the production of other branches is inhibited by hormones produced at the top of the plant.

본 발명의 일 구현예에 따른 시토크롬 P450 단백질에서, 상기 단백질은 서열번호 1의 아미노산 서열을 포함할 수 있다. 또한, 상기 서열의 변이체가 본 발명의 범위 내에 포함된다. 변이체는 아미노산 서열은 변화되지만, 서열번호 1의 아미노산 서열과 유사한 기능적 및 면역학적 특성을 갖는 아미노산 서열이다. 구체적으로, 시토크롬 P450 단백질은 서열번호 1의 아미노산 서열과 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 서열을 포함할 수 있다.In the cytochrome P450 protein according to an embodiment of the present invention, the protein may include the amino acid sequence of SEQ ID NO: 1. In addition, variants of such sequences are included within the scope of the present invention. Variants are amino acid sequences that vary in amino acid sequence but have functional and immunological properties similar to those of SEQ ID NO: 1. Specifically, the cytochrome P450 protein comprises a sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the amino acid sequence of SEQ ID NO: 1 can do.

본 발명은 또한, 식물의 정단 우성을 강화시키는데 이용되는, 서열번호 1의 아미노산 서열을 가지는 애기장대(Arabidopsis thaliana) 유래의 시토크롬 P450 단백질을 코딩하는 유전자(AtCYP78A7)를 제공한다. 바람직하게는 상기 유전자는 서열번호 2의 염기 서열을 가질 수 있다. 또한, 상기 서열의 변이체가 본 발명의 범위 내에 포함된다. 변이체는 염기 서열은 변화되지만, 서열번호 2의 염기 서열과 유사한 기능적 및 면역학적 특성을 갖는 염기 서열이다. 구체적으로, 시토크롬 P450 단백질을 코딩하는 유전자는 서열번호 2의 염기 서열과 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상 의 서열 상동성을 가지는 염기 서열을 포함할 수 있다.The present invention also provides a gene (AtCYP78A7) encoding a cytochrome P450 protein from Arabidopsis thaliana having the amino acid sequence of SEQ ID NO: 1, which is used to enhance apical dominance of plants. Preferably, the gene may have a nucleotide sequence of SEQ ID NO: 2. In addition, variants of such sequences are included within the scope of the present invention. Variants are base sequences that vary in base sequence but have similar functional and immunological properties as the base sequence of SEQ ID NO: 2. Specifically, the gene encoding the cytochrome P450 protein has at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the nucleotide sequence of SEQ ID NO: 2. It may include a base sequence having a.

폴리뉴클레오티드 및 폴리펩티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 및 폴리펩티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다. 상기 %는 동일한 핵산 염기 또는 아미노산 잔기가 두 서열 모두에 존재하는 위치의 수를 확인하여 정합 위치의 수를 산출하고, 그 정합 위치의 수를 비교 영역 내의 위치의 총 수로 나누고, 그 결과에 100을 곱하여 서열 상동성 %를 산출함으로써 계산된다. 비교를 위한 서열의 최적 배열은 공지된 연산방식의 컴퓨터에 의한 임플러먼테이션에 의해(예를 들면, GAP, BESTFIT, FASTA 및 TFAST in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, WI, or BlastN and BlastX available from the National Center for Biotechnology Information), 또는 검사에 의해 이루어질 수 있다. The "% sequence homology" for polynucleotides and polypeptides is determined by comparing two optimally arranged sequences with a comparison region, wherein a portion of the polynucleotide and polypeptide sequences in the comparison region are the reference sequences for the optimal alignment of the two sequences. It may include additions or deletions (ie gaps) compared to (not including additions or deletions). The% identifies the number of positions where identical nucleic acid bases or amino acid residues are present in both sequences, yielding the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison region, and subtracting 100 for the result. Calculated by multiplying to yield% sequence homology. Optimal alignment of sequences for comparison is by computerized implementation of known algorithms (e.g. GAP, BESTFIT, FASTA and TFAST in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science). Dr., Madison, WI, or BlastN and BlastX available from the National Center for Biotechnology Information), or by examination.

"실질적인 동일성" 또는 "실질적인 유사성"이란 용어는 폴리펩티드가 엄격한 조건하에서 표적 폴리펩티드와 혼성화될 수 있는 서열을 포함하는 것을 의미한다. 엄격한 조건은 2×SSC의 용액 및 65℃의 온도를 의미한다.The term "substantial identity" or "substantial similarity" means that the polypeptide includes sequences that can hybridize with the target polypeptide under stringent conditions. Stringent conditions mean a solution of 2 × SSC and a temperature of 65 ° C.

"실질적으로 유사한" 폴리펩티드는 동일하지 않은 잔기 위치가 보존적 아미노산 변화에 의해 상이할 수 있는 것을 제외하고는 상기 서열을 공유한다. 보존적 아미노산 치환은 유사한 측쇄를 갖는 잔기의 상호교환성을 의미한다. 예를 들면, 지방족 측쇄를 갖는 아미노산 군은 글리신, 알라닌, 발린, 류신 및 이소류신이며, 지방족 히드록실 측쇄를 갖는 아미노산 군은 세린 및 트레오닌이며, 아미드 함유 측쇄를 갖는 아미노산 군은 아스파라긴 및 글루타민이며, 방향족 측쇄를 갖는 아미노산 군은 페닐알라닌, 티로신 및 트립토판이며, 염기성 측쇄를 갖는 아미노산 군은 라이신, 아르기닌 및 히스티딘이며, 황 함유 측쇄를 갖는 아미노산 군은 시스테인 및 메티오닌이다.“Substantially similar” polypeptides share the sequence except that non-identical residue positions may differ by conservative amino acid changes. Conservative amino acid substitutions mean interchangeability of residues having similar side chains. For example, the amino acid group having aliphatic side chains is glycine, alanine, valine, leucine and isoleucine, the amino acid group having aliphatic hydroxyl side chains is serine and threonine, and the amino acid group having amide containing side chains is asparagine and glutamine, aromatic The amino acid groups with side chains are phenylalanine, tyrosine and tryptophan, the amino acid groups with basic side chains are lysine, arginine and histidine, and the amino acid groups with sulfur containing side chains are cysteine and methionine.

폴리뉴클레오티드 서열의 실질적인 동일성은 폴리뉴클레오티드가 70% 이상의 서열 동일성, 바람직하게는 80% 이상, 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 동일성을 갖는 서열을 포함하는 것을 의미한다. 또 다른 의미는 두 분자가 엄격한 조건하에서 서로에게 특이적으로 혼성화하는 경우 뉴클레오티드 서열이 실질적으로 동일하다는 것이다. 엄격한 조건은 서열 의존성이며 다른 상황에서는 상이할 것이다. 일반적으로, 엄격한 조건은 정해진 이온 강도 및 pH에서 특정 서열에 대한 열 융점(Tm) 보다 약 10 ℃ 더 낮도록 선택된다. Tm은 표적 서열의 50%가 완전히 정합된 프로브에 혼성화되는 온도(정해진 이온 강도 및 pH 하에서)이다. 프로브의 길이 및 염기 조성 양자의 함수인, 혼성체의 Tm은 문헌(Sambrook, T. et al., (1989) Molecular Cloning - A Laboratory Manual (second edition), Volume 1-3, Cold Spring Harbor Laboratory, Cold Spring) 내의 정보를 이용하여 계산될 수 있다. 전형적으로, 서던 블롯 절차에 대한 엄격한 조건은 0.2XSSC로 65℃에서의 세척을 포함한다. 바람직한 올리고뉴클레오티드 프로브의 경우에, 세척 조건은 전형적으로 6XSSC에서 약 42℃이다.Substantial identity of the polynucleotide sequence means that the polynucleotide comprises a sequence having at least 70% sequence identity, preferably at least 80%, more preferably at least 90%, most preferably at least 95%. Another meaning is that the nucleotide sequences are substantially identical when the two molecules specifically hybridize to each other under stringent conditions. Stringent conditions are sequence dependent and will be different in other situations. In general, stringent conditions are selected to be about 10 ° C. below the thermal melting point (Tm) for a particular sequence at a given ionic strength and pH. Tm is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a fully matched probe. Hybrid Tm, a function of both the length and base composition of the probe, is described in Sambrook, T. et al., (1989) Molecular Cloning-A Laboratory Manual (second edition), Volume 1-3, Cold Spring Harbor Laboratory, Cold Spring) can be calculated using information. Typically, stringent conditions for the Southern blot procedure include washing at 65 ° C. with 0.2 × SSC. For preferred oligonucleotide probes, wash conditions are typically about 42 ° C. at 6 × SSC.

본 발명의 일 구현예에 따른 유전자에서, 시토크롬 P450 코딩 유전자는 서열 번호 3의 시토크롬 P450 코딩 유전자의 프로모터 서열을 추가로 포함할 수 있다. 상기 프로모터 서열에 GUS 유전자를 융합시켜 식물체 내에서 발현한 결과, 상기 유전자는 암발아/명발아 유식물의 자엽과 정단 분열조직, 꽃봉오리, 꽃, 측아 또는 발달 중인 배에서 강하게 발현되는 것을 알 수 있었다.In a gene according to an embodiment of the present invention, the cytochrome P450 coding gene may further comprise a promoter sequence of the cytochrome P450 coding gene of SEQ ID NO: 3. As a result of fusion of the GUS gene to the promoter sequence and expression in the plant, the gene was strongly expressed in the cotyledon and apical meristem of the germinating / mature germinal seedlings, buds, flowers, flanks or developing embryos. there was.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 유전자를 포함하는 재조합 식물 발현 벡터를 제공한다.In order to achieve another object of the present invention, the present invention provides a recombinant plant expression vector comprising the gene according to the present invention.

용어 "재조합"은 세포가 이종의 핵산을 복제하거나, 상기 핵산을 발현하거나 또는 펩티드, 이종의 펩티드 또는 이종의 핵산에 의해 암호된 단백질을 발현하는 세포를 지칭하는 것이다. 재조합 세포는 상기 세포의 천연 형태에서는 발견되지 않는 유전자 또는 유전자 절편을, 센스 또는 안티센스 형태 중 하나로 발현할 수 있다. 또한 재조합 세포는 천연 상태의 세포에서 발견되는 유전자를 발현할 수 있으며, 그러나 상기 유전자는 변형된 것으로써 인위적인 수단에 의해 세포 내 재도입된 것이다.The term “recombinant” refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, a heterologous peptide, or a heterologous nucleic acid. Recombinant cells can express genes or gene fragments that are not found in their natural form in either the sense or antisense form. Recombinant cells can also express genes found in natural cells, but the genes have been modified and reintroduced into cells by artificial means.

용어 "벡터"는 세포 내로 전달하는 DNA 단편(들), 핵산 분자를 지칭할 때 사용된다. 벡터는 DNA를 복제시키고, 숙주세포에서 독립적으로 재생산될 수 있다. 용어 "전달체"는 흔히 "벡터"와 호환하여 사용된다. 용어 "발현 벡터"는 목적한 코딩 서열과, 특정 숙주 생물에서 작동가능하게 연결된 코딩 서열을 발현하는데 필수적인 적정 핵산 서열을 포함하는 재조합 DNA 분자를 의미한다. 진핵세포에서 이용가능한 프로모터, 인핸서, 종결신호 및 폴리아데닐레이션 신호는 공지되어 있다.The term “vector” is used to refer to a DNA fragment (s), a nucleic acid molecule, that is delivered into a cell. Vectors can replicate DNA and be reproduced independently in host cells. The term "carrier" is often used interchangeably with "vector". The term “expression vector” refers to a recombinant DNA molecule comprising a coding sequence of interest and a suitable nucleic acid sequence necessary to express a coding sequence operably linked in a particular host organism. Promoters, enhancers, termination signals and polyadenylation signals available in eukaryotic cells are known.

식물 발현 벡터의 바람직한 예는 아그로박테리움 투머파시엔스와 같은 적당 한 숙주에 존재할 때 그 자체의 일부, 소위 T-영역을 식물 세포로 전이시킬 수 있는 Ti-플라스미드 벡터이다. 다른 유형의 Ti-플라스미드 벡터(EP 0 116 718 B1호 참조)는 현재 식물 세포, 또는 잡종 DNA를 식물의 게놈 내에 적당하게 삽입시키는 새로운 식물이 생산될 수 있는 원형질체로 잡종 DNA 서열을 전이시키는데 이용되고 있다. Ti-플라스미드 벡터의 특히 바람직한 형태는 EP 0 120 516 B1호 및 미국 특허 제4,940,838호에 청구된 바와 같은 소위 바이너리(binary) 벡터이다. 본 발명에 따른 DNA를 식물 숙주에 도입시키는데 이용될 수 있는 다른 적합한 벡터는 이중 가닥 식물 바이러스(예를 들면, CaMV) 및 단일 가닥 바이러스, 게미니 바이러스 등으로부터 유래될 수 있는 것과 같은 바이러스 벡터, 예를 들면 비완전성 식물 바이러스 벡터로부터 선택될 수 있다. 그러한 벡터의 사용은 특히 식물 숙주를 적당하게 형질전환하는 것이 어려울 때 유리할 수 있다.Preferred examples of plant expression vectors are Ti-plasmid vectors which, when present in a suitable host such as Agrobacterium tumerfaciens, can transfer a portion of themselves, the so-called T-region, to plant cells. Another type of Ti-plasmid vector (see EP 0 116 718 B1) is used to transfer hybrid DNA sequences to protoplasts from which current plant cells or new plants can be produced that properly insert hybrid DNA into the plant's genome. have. A particularly preferred form of the Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors, such as those which can be derived from double stranded plant viruses (eg CaMV) and single stranded viruses, gemini viruses, etc. For example, it may be selected from an incomplete plant viral vector. The use of such vectors can be advantageous especially when it is difficult to properly transform a plant host.

발현 벡터는 바람직하게는 하나 이상의 선택성 마커를 포함할 것이다. 상기 마커는 진핵세포 배양에 대해 디히드로폴레이트 환원효소 또는 네오마이신 내성을 포함한다. 가장 널리 이용되는 식물 형질전환 마커는 Tn5로부터 분리된 네오마이신 포스포트랜스퍼라아제 II(nptII) 유전자이며, 또 다른 마커 유전자는 항생제 하이그로마이신에 내성을 부여하는 하이그로마이신 포스포트랜스퍼라아제 유전자이다.The expression vector will preferably comprise one or more selectable markers. The marker includes dihydrofolate reductase or neomycin resistance to eukaryotic cell culture. The most widely used plant transformation marker is the neomycin phosphotransferase II (nptII) gene isolated from Tn5 and another marker gene is the hygromycin phosphotransferase gene that confers resistance to the antibiotic hygromycin. to be.

본 발명의 일 구현예에 따른 식물 발현 벡터에서, 프로모터는 CaMV 35S, 액틴, 유비퀴틴, pEMU, MAS 또는 히스톤 프로모터일 수 있으나, 이에 제한되지 않는다. "프로모터"란 용어는 구조 유전자로부터의 DNA 업스트림의 영역을 의미하며 전사를 개시하기 위하여 RNA 폴리머라아제가 결합하는 DNA 분자를 말한다. "식물 프로모터"는 식물 세포에서 전사를 개시할 수 있는 프로모터이다. "구성적(constitutive) 프로모터"는 대부분의 환경 조건 및 발달 상태 또는 세포 분화하에서 활성이 있는 프로모터이다. 형질전환체의 선택이 각종 단계에서 각종 조직에 의해서 이루어질 수 있기 때문에 구성적 프로모터가 본 발명에서 바람직할 수 있다. 따라서, 구성적 프로모터는 선택 가능성을 제한하지 않는다.In the plant expression vector according to an embodiment of the present invention, the promoter may be, but is not limited to, CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter. The term "promoter" refers to a region of DNA upstream from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of the transformants may be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.

터미네이터는 노팔린 신타아제(NOS) 또는 벼 α-아밀라아제 RAmy1 A 터미네이터일 수 있으나, 이에 제한되지 않는다. 터미네이터의 필요성에 관하여, 그러한 영역이 식물 세포에서의 전사의 확실성 및 효율을 증가시키는 것으로 일반적으로 알고 있다. 그러므로, 터미네이터의 사용은 본 발명의 내용에서 매우 바람직하다.Terminators may be, but are not limited to, nopaline synthase (NOS) or rice α-amylase RAmy1 A terminator. With regard to the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators is highly desirable in the context of the present invention.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 재조합 식물 발현 벡터로 식물 세포를 형질전환하여 시토크롬 P450 유전자를 과발현하는 단계를 포함하는 식물의 정단 우성을 강화시키는 방법을 제공한다. 바람직하게는 상기 식물은 벼, 유채, 밀, 보리, 옥수수, 대두, 감자, 밀, 팥, 귀리 및 수수로 이루어진 군에서 선택된 식량작물류일 수 있으나, 이에 제한되지 않는다.In order to achieve another object of the present invention, the present invention provides a method for enhancing the apical dominance of a plant comprising the step of transforming plant cells with a recombinant plant expression vector according to the present invention overexpressing the cytochrome P450 gene. . Preferably, the plant may be food crops selected from the group consisting of rice, rapeseed, wheat, barley, corn, soybean, potato, wheat, red beans, oats, and sorghum, but not limited thereto.

"식물 조직"은 분화된 또는 미분화된 식물의 조직, 예를 들면 이에 한정되진 않으나, 뿌리, 줄기, 잎, 꽃가루, 종자, 암 조직 및 배양에 이용되는 다양한 형태의 세포들, 즉 단일 세포, 원형질체(protoplast), 싹 및 캘러스 조직을 포함한다. 식물 조직은 인 플란타(in planta)이거나 기관 배양, 조직 배양 또는 세포 배양 상태일 수 있다."Plant tissue" refers to the tissues of differentiated or undifferentiated plants, such as, but not limited to, roots, stems, leaves, pollen, seeds, cancer tissues and various types of cells used in culture, ie single cells, protoplasts. (protoplast), shoots and callus tissue. The plant tissue may be in planta or in an organ culture, tissue culture or cell culture.

"식물 세포"는 인 플란타 식물 세포를 포함하며, 배양 상태의 식물 세포 및 원형질체를 포함한다."Plant cells" include in-planta plant cells and include plant cells and protoplasts in culture.

식물의 형질전환은 DNA를 식물에 전이시키는 임의의 방법을 의미한다. 그러한 형질전환 방법은 반드시 재생 및(또는) 조직 배양 기간을 가질 필요는 없다. 식물 종의 형질전환은 이제는 쌍자엽 식물뿐만 아니라 단자엽 식물 양자를 포함한 식물 종에 대해 일반적이다. 원칙적으로, 임의의 형질전환 방법은 본 발명에 따른 잡종 DNA를 적당한 선조 세포로 도입시키는데 이용될 수 있다. 방법은 원형질체에 대한 칼슘/폴리에틸렌 글리콜 방법(Krens, F.A. et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), 원형질체의 전기천공법(Shillito R.D. et al., 1985 Bio/Technol. 3, 1099-1102), 식물 요소로의 현미주사법(Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185), 각종 식물 요소의 (DNA 또는 RNA-코팅된) 입자 충격법(Klein T.M. et al., 1987, Nature 327, 70), 식물의 침윤 또는 성숙 화분 또는 소포자의 형질전환에 의한 아그로박테리움 투머파시엔스 매개된 유전자 전이에서 (비완전성) 바이러스에 의한 감염(EP 0 301 316호) 등으로부터 적당하게 선택될 수 있다. 본 발명에 따른 바람직한 방법은 아그로박테리움 매개된 DNA 전달을 포함한다. 특히 바람직한 것은 EP A 120 516호 및 미국 특허 제4,940,838호에 기재된 바와 같은 소위 바이너리 벡터 기술을 이용하는 것이다.Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have a period of regeneration and / or tissue culture. Transformation of plant species is now common for plant species, including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce hybrid DNA according to the invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185 ), (DNA or RNA-coated) particle bombardment of various plant elements (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumulopasis by plant infiltration or transformation of mature pollen or vesicles And infection with (incomplete) virus (EP 0 301 316) in en mediated gene transfer. Preferred methods according to the invention include Agrobacterium mediated DNA delivery. Especially preferred is the use of the so-called binary vector technology as described in EP A 120 516 and US Pat. No. 4,940,838.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명에 따른 방법에 의해 제조된 정단 우성이 강화된 식물을 제공한다. 본 발명의 방법에 의해 식 물 세포를 형질전환시켜, 시토크롬 P450 유전자를 과발현시키면 상기 식물의 정단 우성은 강화되는 것이다. 바람직하게는 상기 식물은 벼, 유채, 밀, 보리, 옥수수, 대두, 감자, 밀, 팥, 귀리 및 수수로 이루어진 군에서 선택된 식량작물류일 수 있으나, 이에 제한되지 않는다.In order to achieve another object of the present invention, the present invention provides a plant with enhanced apical dominance produced by the method according to the present invention. Plant cells are transformed by the method of the present invention and overexpression of the cytochrome P450 gene enhances the apical dominance of the plant. Preferably, the plant may be food crops selected from the group consisting of rice, rapeseed, wheat, barley, corn, soybean, potato, wheat, red beans, oats, and sorghum, but not limited thereto.

본 발명의 또 다른 목적을 달성하기 위하여, 본 발명은 본 발명의 재조합 벡터로 형질전환된 식물의 형질전환(transgenic) 종자를 제공한다. 바람직하게는 상기 식물은 벼, 유채, 밀, 보리, 옥수수, 대두, 감자, 밀, 팥, 귀리 및 수수로 이루어진 군에서 선택된 식량작물류일 수 있으나, 이에 제한되지 않는다.In order to achieve another object of the present invention, the present invention provides a transgenic seed of a plant transformed with the recombinant vector of the present invention. Preferably, the plant may be food crops selected from the group consisting of rice, rapeseed, wheat, barley, corn, soybean, potato, wheat, red beans, oats, and sorghum, but not limited thereto.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것이므로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.Hereinafter, the present invention will be described in more detail with reference to Examples. Since these examples are only for illustrating the present invention, the scope of the present invention is not to be construed as being limited by these examples.

실시예Example

재료 및 방법Materials and methods

식물 재료 및 성장 조건Plant material and growing conditions

애기장대(Arabidopsis thaliana) 생태형 Ws-2를 형질전환용 야생형으로서 이용하였다. 종자를 표면 살균하고, 2일 동안 4℃에서 차게한 후, 16시간-명 (22-24℃)/8시간-암 (18-20℃) 광주기하에 1% 수크로스(KOH를 이용하여 pH 5.8)로 보충된 1x Murashige and Skoog 염(Murashige T, Skoog F (1962) Physiol Plant 15: 473- 497)을 포함하는 0.8% 한천-고형화된 배지 상에서 발아 및 성장시켰다. 토양에서 자란 식물을 또한 동일한 광주기하에 키웠다. Arabidopsis thaliana ) Ecotype Ws-2 was used as a wild type for transformation. Seeds were surface sterilized, chilled at 4 ° C. for 2 days, and then pH adjusted using 1% sucrose (KOH) under 16 hour-light (22-24 ° C.) / 8 hour-dark (18-20 ° C.) photoperiod. 5.8) and germinated and grown on 0.8% agar-solidified medium containing 1 × Murashige and Skoog salts (Murashige T, Skoog F (1962) Physiol Plant 15: 473-497). Plants grown in the soil were also grown under the same photoperiod.

아라비돕시스에서In Arabidopsis AtCYP78A7AtCYP78A7 의 구성적 발현Constitutive expression of

AtCYP78A7의 코딩 영역을 포함하는 게놈 단편을 주형으로서 아라비돕시스 게놈 DNA를 이용하여 프라이머 쌍으로 Pwo 중합효소 (Roche, Mannheim, Germany)에 의해 증폭하였다. PCR 산물의 용이한 클로닝을 위해, KpnI 및 XbaI에 대한 제한효소 자리를 프라이머 내로 도입하였다: 78A7KpF, 5'-GGGGTACCCATCAACCCAAAATAATGGAGTTGATG-3'(서열번호 4); 78A7XbR, 5'-GCTCTAGACATTCTGCAATTCATACCTCTCGACAA-3'(서열번호 5). PCR 산물을 pUC19 벡터의 SmaI 자리 내로 클로닝하였다. PCR 산물의 완전한 뉴클레오티드 서열을 결정하여 PCR 에러를 검사하였다. PCR 산물의 KpnI/XbaI 단편을 CaMV 35S 프로모터 및 pART7의 ocs3' 사이에 서브클로닝하였다 (Gleave AP (1992) Plant Mol Biol 20: 1203-1207). pART7 유래의 과발현 카세트를 포함하는 NotI 단편을 바이너리 벡터인 pART27 내로 서브클로닝하였다 (Gleave AP (1992) Plant Mol Biol 20: 1203-1207). pART27 내의 과발현 카세트를 전기천공에 의해 아그로박테리움 GV3101 내로 형질전환하고, 플로랄 딥(floral dip) 방법을 이용하여 생태형 Ws-2 식물 내로 도입하였다 (Clough SJ, Bent AF (1998) Plant J 16: 735-743). 형질전환 식물을 카나마이신 (40 ㎍/mL)을 포함하는 MS 플레이트에서 선발하였다.Genomic fragments comprising the coding region of AtCYP78A7 were amplified by Pwo polymerase (Roche, Mannheim, Germany) with primer pairs using Arabidopsis genomic DNA as a template. For ease of cloning of the PCR product, restriction enzyme Kpn a seat for the I and Xba I were introduced into the primers: 78A7KpF, 5'-GG GGTACC CATCAACCCAAAATA ATG GAGTTGATG-3 '( SEQ ID NO: 4); 78A7XbR, 5'-GC TCTAGA CATTCTGCAATTCATACCTCTCGACAA-3 '(SEQ ID NO: 5). PCR products were cloned into the Sma I site of the pUC19 vector. PCR errors were examined by determining the complete nucleotide sequence of the PCR product. The Kpn I / Xba I fragment of the PCR product was subcloned between the CaMV 35S promoter and pART7 the ocs3 '(Gleave AP (1992) Plant Mol Biol 20: 1203-1207). Not I fragments containing an overexpression cassette derived from pART7 were subcloned into the binary vector pART27 (Gleave AP (1992) Plant Mol Biol 20: 1203-1207). Overexpressing cassettes in pART27 were transformed into Agrobacterium GV3101 by electroporation and introduced into ecological Ws-2 plants using a floral dip method (Clough SJ, Bent AF (1998) Plant J 16: 735-743). Transgenic plants were selected on MS plates containing kanamycin (40 μg / mL).

프로모터 구축물의 생성 및 GUS 염색 절차Generation of promoter constructs and GUS staining procedure

AtCYP78A7의 프로모터 영역을 포함하는 게놈 단편 (길이가 약 2.5 kb)을 SalI/BamHI으로 절단된 BAC 클론 (MYH9)으로부터 수득하였다. 상기 프로모터 단편은 GUS 유전자와 번역 융합을 하기 위해 상기 유전자의 부분적인 ORF를 포함하였다. SalI/BamHI 단편을 pBI101 바이너리 벡터 내로 서브클로닝하였다. 상기 프로모터 구축물을 전기천공에 의해 Agrobacterium GV3101 내로 형질전환하고, 플로랄 딥(floral dip) 방법을 이용하여 생태형 Ws-2 식물 내로 도입하였다 (Clough SJ, Bent AF (1998) Plant J 16: 735-743). 형질전환 식물을 카나마이신 (40 ㎍/mL)을 포함하는 MS 플레이트에서 선발하였다. 프로모터 구축물을 포함하는 동형접합 형질전환 라인을 T3 세대로부터 선발하였다. 식물 및 식물 조직을 Stomp의 방법에 따라 GUS 염색을 하였다(Stomp A-M (1992) In S.R. Gallagher ed, GUS protocols: Using the GUS gene as a reporter of gene expression, Academic Press, San Diego, CA, pp. 103-113). GUS 염색된 조직을 에탄올 시리즈를 통해 탈수하였다.Genomic fragments (approximately 2.5 kb in length) comprising the promoter region of AtCYP78A7 were obtained from BAC clones (MYH9) digested with Sal I / Bam HI. The promoter fragment contained a partial ORF of the gene for translational fusion with the GUS gene. Sal I / Bam HI fragments were subcloned into pBI101 binary vector. The promoter constructs were transformed into Agrobacterium GV3101 by electroporation and introduced into ecological Ws-2 plants using a floral dip method (Clough SJ, Bent AF (1998) Plant J). 16: 735-743). Transgenic plants were selected on MS plates containing kanamycin (40 μg / mL). Homozygous transformation lines containing promoter constructs were selected from the T3 generation. Plants and plant tissues were GUS stained according to Stomp's method (Stomp AM (1992) In SR Gallagher ed, GUS protocols: Using the GUS gene as a reporter of gene expression, Academic Press, San Diego, CA, pp. 103-113). GUS stained tissue was dehydrated through a series of ethanol.

역전사Reverse transcription -중합효소 연쇄반응Polymerase chain reaction

식물 조직으로부터 전체 RNA를 TRIzol 시약 (Invitrogen, Carlsbad, CA)을 이용하여 정제하였다. 전체 RNA (5 ㎍)를 MMLV-역전사효소(Invitrogen)를 이용하여 제1 가닥 cDNA 합성에 이용하였다. PCR 증폭 조건은 하기와 같다: 96℃, 5분 초기변성에 이은 94℃/15초, 55℃/30초, 및 72℃/1분의 27 사이클 후, 72℃에서 5분 동안 최종 연장. 튜불린-2를 코딩하는 전사체를 양성 대조군으로서 증폭하였다. RT-PCR에 대한 프라이머 서열은 하기 표 1에 요약하였다.Total RNA from plant tissues was purified using TRIzol reagent (Invitrogen, Carlsbad, CA). Total RNA (5 μg) was used for first strand cDNA synthesis using MMLV-reverse transcriptase (Invitrogen). PCR amplification conditions were as follows: 96 ° C., 5 min initial denaturation followed by 94 ° C./15 sec, 55 ° C./30 sec, and 27 cycles of 72 ° C./1 min, followed by a final extension at 72 ° C. for 5 minutes. Transcripts encoding tubulin-2 were amplified as positive controls. Primer sequences for RT-PCR are summarized in Table 1 below.

RT-PCR에 이용된 프라이머 서열Primer Sequences Used for RT-PCR Atg 코드Atg code 유전자 산물Gene products PCR 프라이머 (5'→3')PCR primers (5 '→ 3') 정방향Forward direction 역방향Reverse At5g09970At5g09970 AtCYP78A7AtCYP78A7 GGTACGACGGTTCGAGTGGGGTCAGGA(서열번호 6)GGTACGACGGTTCGAGTGGGGTCAGGA (SEQ ID NO: 6) CATTACTCCATTTAGATTTTAGACCCACAA(서열번호 7)CATTACTCCATTTAGATTTTAGACCCACAA (SEQ ID NO: 7) At3g02480At3g02480 저온 유도된 단백질 kin1Low temperature induced protein kin1 ATAAAATTCAAAGTGTAAGCAAAAC (서열번호 8)ATAAAATTCAAAGTGTAAGCAAAAC (SEQ ID NO: 8) ATTAATTAGAAAAGAAGTCCAAGGT(서열번호 9)ATTAATTAGAAAAGAAGTCCAAGGT (SEQ ID NO: 9) At5g62490At5g62490 ABA-반응성 단백질 (HVA22b)ABA-reactive protein (HVA22b) ATCACGAAGACTAATAAAACAAAGT (서열번호 10)ATCACGAAGACTAATAAAACAAAGT (SEQ ID NO: 10) AACAAATTAACACTTAGGAAAATTG(서열번호 11)AACAAATTAACACTTAGGAAAATTG (SEQ ID NO: 11) At2g42530At2g42530 저온-반응성 단백질/저온 조절된 단백질 (cor15b)Cold-reactive protein / cold regulated protein (cor15b) AAACAAAAGACTACATTGTTGAGA (서열번호 12)AAACAAAAGACTACATTGTTGAGA (SEQ ID NO: 12) TACGTATTTAAAATGTGCTAGTGAG(서열번호 13)TACGTATTTAAAATGTGCTAGTGAG (SEQ ID NO: 13) At3g50970At3g50970 dehydrin xero2 (XERO2)dehydrin xero2 (XERO2) AAAAGGTATAGCAGAAAAGATTAAA (서열번호 14)AAAAGGTATAGCAGAAAAGATTAAA (SEQ ID NO: 14) CATCATATTATTACACCACACAAAT(서열번호 15)CATCATATTATTACACCACACAAAT (SEQ ID NO: 15) At5g61380At5g61380 ABI3-상호작용 단백질 1 (AIP1)ABI3-Interacting Protein 1 (AIP1) AAGAAGATTAGGTATGTGAATAGGA (서열번호 16)AAGAAGATTAGGTATGTGAATAGGA (SEQ ID NO: 16) AACATCTTCTGTTGTTTGATAAGAT(서열번호 17)AACATCTTCTGTTGTTTGATAAGAT (SEQ ID NO: 17) At5g25610At5g25610 탈수 유도된 단백질 RD22Dehydration Induced Protein RD22 AAAAGTTAGTGGAGAGGAGAAGTAT (서열번호 18)AAAAGTTAGTGGAGAGGAGAAGTAT (SEQ ID NO: 18) AGATCTATCTAGTAGCTGAACCACA(서열번호 19)AGATCTATCTAGTAGCTGAACCACA (SEQ ID NO: 19) At5g52310At5g52310 탈수 유도된 단백질 RD29ADehydration Induced Protein RD29A ATTCTGTTGAAGAGGCTCCAAAATC (서열번호 20)ATTCTGTTGAAGAGGCTCCAAAATC (SEQ ID NO: 20) AATACATCAAAGACGTCAAACAAAACA(서열번호 21)AATACATCAAAGACGTCAAACAAAACA (SEQ ID NO: 21) At1g52400At1g52400 AtBG1 (β-글루코시다제 1)AtBG1 (β-glucosidase 1) TTATATCCAAAGGCATCTCTTGAGT (서열번호 22)TTATATCCAAAGGCATCTCTTGAGT (SEQ ID NO: 22) AAACGATCCATAGAACACACAAACT(서열번호 23)AAACGATCCATAGAACACACAAACT (SEQ ID NO: 23) 튜불린-2Tubulin-2 GAGCCTTACAACGCTACTCTGTCTGTC(서열번호 24)GAGCCTTACAACGCTACTCTGTCTGTC (SEQ ID NO: 24) ACACCAGACATAGTAGCAGAAATCAAG(서열번호 25)ACACCAGACATAGTAGCAGAAATCAAG (SEQ ID NO: 25)

단백질 추출 및 SDS-PAGEProtein Extraction and SDS-PAGE

500개의 성숙한 건조 종자를 막자 및 사발을 이용하여 400 ul의 추출 버퍼 [125 mM Tris-HCl (pH 8.8), 1% SDS, 10% 글리세롤, 50 mM 소듐 설파이트]를 이용하여 균질화하였다. 원심분리 후에, 5 ul의 각각의 추출액을 SDS-PAGE에 이용하였다 (Laemmli UK (1970) Nature 227: 680-685). 단백질 함량을 표준으로서 BSA를 이용하여 Bio-Rad 단백질 분석 키트를 이용하여 측정하였다.500 mature dry seeds were homogenized with 400 ul of extraction buffer [125 mM Tris-HCl (pH 8.8), 1% SDS, 10% glycerol, 50 mM sodium sulfite] using a mortar and bowl. After centrifugation, 5 ul of each extract was used for SDS-PAGE (Laemmli UK (1970) Nature 227: 680-685). Protein content was measured using the Bio-Rad Protein Assay Kit using BSA as a standard.

탈수 처리Dewatering treatment

5주된 야생형 및 형질전환 아라비돕시스 식물을 건조 스트레스 처리에 이용하였다. 토양에서 키운 식물을 물에 12시간 동안 침지시키고, 과량의 물을 제거한 후, 18일 동안 관개(irrigation)를 보류함으로써 탈수 스트레스를 가하였다. 상기 식물이 탈수 스트레스로부터 회복될 수 있는지를 검사하기 위해, 식물을 18일 동안 탈수 스트레스 후에 다시 물을 주었다.Five week wild-type and transgenic Arabidopsis plants were used for dry stress treatment. Plants grown in the soil were immersed in water for 12 hours, excess water was removed, and dewatering stress was applied by withholding irrigation for 18 days. To check if the plant can recover from dehydration stress, the plant is watered again after dehydration stress for 18 days.

RNA 추출 및 RNA extraction and 마이크로어레이Microarray 혼성화Hybridization

전체 RNA를 TRIzol 시약 (Invitrogen)을 이용하여 12일된 모종으로부터 분리하였다. 분리된 전체 RNA를 RNeasy 식물 미니 키트 (Qiagen, Germany)를 이용하여 추가로 정제하였다. cDNA를 Superscript II 역전사효소 (Invitrogen)를 이용하여 시료당 15㎍의 전체 RNA로부터 제조하고, Cy3 및 Cy5로 표지된 마이크로어레이 프로브를 제조자의 지시(Genisphere, Montvale, NJ)에 따라 Genisphere 3DNA Array 900 DNA 표지 키트를 이용하여 cDNA로부터 제조하였다. 상기 cDNA 프로브는 Qiagen-Operon Arabidopsis Genome Array Ready Oligo Set (AROS) Version 3.0 (http://www.ag.arizona.edu/microarray/)를 이용하여 아리조나 대학교에서 프린팅된 29,000-element 아라비돕시스 올리고뉴클레오티드 마이크로어레이에 혼성화하였다. 간단하게, 혼성화를 하기 2단계 절차에 따라 수행하였다: 1) 슬라이드 상에 스팟팅된 올리고먼에 대한 cDNA 혼성화, 2) 제1 가닥 합성 동안 cDNA에 혼입된 포획 서열을 통한 cDNA에 대한 3-DNA 형광 덴드리머의 혼성화. 모든 cDNA 및 형광 염료 혼성화를 제조자가 공급한 SDS-기재 혼성화 버퍼를 이용하여 35 ul의 부피에서 수행하였다. cDNA 혼성화를 60℃에서 18시간 동안 MAUI Hybridization System 및 MAUI Mixer AO Hybridization Chamber Lids (BioMicro Systems, Salt Lake City)에서 수행하였다. 이어서 슬라이드를 절차에 따라 세정하고, 10분 동안 원심분리에 의해 풍건하였다. 0.5 mM DTT를 첫번째 두번의 세정 용액에 첨가하여 플루오로크롬이 산화되는 것을 방지한 것을 제외하고는, 3-DNA 혼성화를 전술한 바와 같이 4시간 동안 55℃에서 수행하였다. 1일 교환 슬라이드를 포함하는 4개의 사본 슬라이드를 각 실험에 대해 생성하여 염료 형광 편차를 제거하였다. 형질전환 아라비돕시스 라인 #19 및 #38에 대해 각각 3개 및 2개 슬라이드를 이용하였다.Total RNA was isolated from 12 day old seedlings using TRIzol reagent (Invitrogen). The isolated total RNA was further purified using RNeasy Plant Mini Kit (Qiagen, Germany). cDNA was prepared from 15 μg of total RNA per sample using Superscript II reverse transcriptase (Invitrogen), and Cy3 and Cy5 labeled microarray probes were prepared according to the manufacturer's instructions (Genisphere, Montvale, NJ) for Genisphere 3DNA Array 900 DNA. Prepared from cDNA using a label kit. The cDNA probe was a 29,000-element Arabidopsis oligonucleotide microarray printed at the University of Arizona using Qiagen-Operon Arabidopsis Genome Array Ready Oligo Set (AROS) Version 3.0 (http://www.ag.arizona.edu/microarray/). Hybridized to. Briefly, hybridization was performed according to the following two step procedure: 1) cDNA hybridization for oligoman spotted on slides, 2) 3-DNA for cDNA via capture sequences incorporated into cDNA during first strand synthesis Hybridization of Fluorescent Dendrimers. All cDNA and fluorescent dye hybridizations were performed at a volume of 35 ul using SDS-based hybridization buffer supplied by the manufacturer. cDNA hybridization was performed at 60 ° C. for 18 hours in MAUI Hybridization System and MAUI Mixer AO Hybridization Chamber Lids (BioMicro Systems, Salt Lake City). The slides were then washed according to the procedure and air dried by centrifugation for 10 minutes. 3-DNA hybridization was performed at 55 ° C. for 4 hours as described above, except 0.5 mM DTT was added to the first two wash solutions to prevent fluorochrome from oxidizing. Four copy slides containing a daily exchange slide were generated for each experiment to remove dye fluorescence deviations. Three and two slides were used for transforming Arabidopsis lines # 19 and # 38, respectively.

스캐닝 및 Scanning and 데이타Data 분석 analysis

혼성화 후에, 상기 슬라이드를 GenePix 4000B (Axon Instruments, Union City, CA)를 이용하여 스캐닝하고, 스팟을 GenePix Pro 4.0 (Axon Instruments, Union City, CA, USA)을 이용하여 정량화하였다. 상기 스캐닝된 마이크로어레이 결과를 Acuity 분석 소프트웨어 3.0 (Axon Instruments, Union City, CA) 내로 도입하고, global LOWESS normalization (Yang YH, 등 (2002) Nucleic Acids Res 30:e15)을 이용하여 표준화하였다. 데이타 파일을 이어서 하기 필터를 만족하는 각 실험에 대해 생성하였다[(Sum of Medians>=100) AND (Flags>=0) AND (F635%Sat<3) AND (F532%Sat<3) AND (RgnR2(635/532)>0.6) AND (SNR635>3) AND (SNR532>3)]. 상기 필터는 GenePix에 의해 불량한 것으로 플래깅되거나(flagged) 100 미만의 중간 합을 갖거나 (매우 약함) 백그라운드의 것보다 적은 픽셀을 갖는 (진정한 스팟일 가능성이 낮음) 데이타 포인트를 제거한다. 이용한 슬라이드 중에서 75% 이상에 대해 상기 기준을 통과한 스팟을 분석하였다. 야생형 및 형질전환 라인의 비교를 위해, 각 데이타세트에서 상기 기준에 부합하는 스팟에 대한 비율의 중간 평균을 계산하였다. 생성된 2개의 데이타세트를 이어서 Acuity 소프트웨어에서 K-means 클러스터링 알고리즘을 이용하여 클러스터링하였다. 마이크로어레이 상의 클론에 대한 주석 및 유전자 존재(ontology) 기능을 웹사이트 The Arabidopsis Information Resource (TAIR, ftp://ftp.arabidopsis.org/home/tair/home/tair/)로부터 수집하고, Gene Ontology Consortium (www.geneontology.org)에 의해 제공된 카테고리에 따라 분류하였다.After hybridization, the slides were scanned using GenePix 4000B (Axon Instruments, Union City, CA) and spots were quantified using GenePix Pro 4.0 (Axon Instruments, Union City, CA, USA). The scanned microarray results were introduced into Acuity Analysis Software 3.0 (Axon Instruments, Union City, Calif.) And normalized using global LOWESS normalization (Yang YH, et al. (2002) Nucleic Acids Res 30: e15). A data file was then generated for each experiment satisfying the following filter [(Sum of Medians> = 100) AND (Flags> = 0) AND (F635% Sat <3) AND (F532% Sat <3) AND (RgnR2 (635/532)> 0.6) AND (SNR635> 3) AND (SNR532> 3)]. The filter removes data points that are flagged as poor by GenePix or have an intermediate sum less than 100 (very weak) or have fewer pixels (less likely to be true spots) than those in the background. Spots that passed the criteria were analyzed for at least 75% of the slides used. For comparison of wild type and transformation lines, the median mean of the ratios for the spots meeting the criteria in each dataset was calculated. The two datasets generated were then clustered using the K-means clustering algorithm in Acuity software. Annotation and gene ontology functions for clones on microarrays are collected from The Arabidopsis Information Resource (TAIR, ftp://ftp.arabidopsis.org/home/tair/home/tair/), and the Gene Ontology Consortium Classified according to the category provided by (www.geneontology.org).

실시예Example 1: RT- 1: RT- PCRPCR 분석을 통한 조직별 발현 양상 분석 Analysis of Expression Patterns by Tissue

RT-PCR 분석을 통해 조직별 발현 양상을 살펴본 결과, AtCYP78A7 유전자는 거의 모든 식물 조직에서 발현되나 꽃봉오리, 꽃, 열매 (silique) 및 유식물에서 강하게 발현되는 것을 확인하였다 (도 1).As a result of examining the expression patterns of tissues through RT-PCR analysis, it was confirmed that the AtCYP78A7 gene is expressed in almost all plant tissues but is strongly expressed in buds, flowers, fruits (silique) and seedlings (FIG. 1).

실시예Example 2: 프로모터::GUS를 이용한 발현 분석 2: Expression Analysis Using Promoter :: GUS

GUS 리포터 유전자를 이용한 조직별 발현 양상을 분석한 결과, AtCYP78A7 유전자는 암발아/명발아 유식물의 자엽과 정단 분열조직에서 강하게 발현되었고, 꽃봉오리, 꽃, 측아, 발달 중인 배 등에서도 강하게 발현되었다 (도 2).Analysis of tissue expression patterns using the GUS reporter gene revealed that the AtCYP78A7 gene was strongly expressed in cotyledon and apical meristem of cancer germination / mist seedlings, and also in buds, flowers, flanks, and developing embryos. (FIG. 2).

실시예Example 3:  3: AtCYP78A7AtCYP78A7 유전자를 과발현하는 애기장대 형질전환체 Arabidopsis transformants overexpress genes

1) 형질전환체 형태적 표현형1) Transformant Morphological Phenotype

과발현 형질전환체(35S:CYP78A7)의 경우, 야생형(Ws-2)에 비해 2차 꽃대와 측지의 생장이 억제되는 강한 정단 우성 현상을 보였다 (도 3).The overexpressing transformant (35S: CYP78A7) showed a strong apical dominant phenomenon in which the growth of secondary stalks and geodesics was suppressed compared to wild type (Ws-2) (FIG. 3).

또한, 과발현 형질전환체(35S:AtCYP78A7의 라인 #9, #19 및 #38)의 경우, 야생형(Ws-2)에 비해 식물체의 키가 야생형에 약 25% 증가하였다 (도 4).In addition, for overexpressing transformants (lines # 9, # 19 and # 38 of 35S: AtCYP78A7), the plant height was increased approximately 25% in wild type compared to wild type (Ws-2) (FIG. 4).

또한, 과발현 형질전환체의 경우, 야생형(Ws-2)에 비해 종자의 크기가 증가하였으며 (도 5의 A), 종자 무게는 야생형(Ws-2)에 비해 약 50% 정도 증가하였으며 (도 5의 B), 12S 글로불린 및 2S 알부민과 같은 종자 저장 단백질의 함량은 야생형(Ws-2)에 비해 또한 증가하였다 (도 5의 C). 종자 무게는 동일한 수의 야생형(Ws-2) 및 형질전환 종자(#9 및 #19)를 이용하여 측정하였다. 총 저장 단백질은 동일한 수의 야생형(Ws-2) 및 형질전환 종자(#9 및 #19)로부터 추출하였다.In addition, in the case of overexpressing transformants, the size of the seed was increased compared to the wild type (Ws-2) (FIG. 5A), and the seed weight was increased by about 50% compared to the wild type (Ws-2) (FIG. 5). The content of seed storage proteins such as B), 12S globulin and 2S albumin was also increased compared to wild type (Ws-2) (FIG. 5C). Seed weight was determined using the same number of wild type (Ws-2) and transformed seeds (# 9 and # 19). Total storage protein was extracted from the same number of wild type (Ws-2) and transformed seeds (# 9 and # 19).

2) 형질전환체에 대한 마이크로어레이2) Microarrays for Transformants

애기장대 전체 게놈 올리고 칩을 이용하여 마이크로어레이를 수행하였다. 12일간 키운 유식물체에서 전체 RNA를 분리하여 5회의 독립된 마이크로어레이를 수행한 결과, 12S와 2S 종자 저장 단백질, 식물 호르몬인 ABA에 반응하거나 저온/건조 스트레스에 반응하는 유전자들의 발현이 형질전환체에서 증가하였다 (표 2).Microarrays were performed using Arabidopsis whole genome oligo chips. Five separate microarrays of total RNA were isolated from seedlings grown for 12 days, resulting in the expression of genes that respond to 12S and 2S seed storage proteins, the plant hormone ABA, or to cold / dry stress. Increased (Table 2).

종자 저장 단백질, ABA에 반응하거나 저온/건조 스트레스 관련 단백질을 코딩하는 유전자가 AtCYP78A7을 과발현하는 형질전환 아라비돕시스에서 상향 조절되는 것을 보여주는 마이크로어레이 분석.Microarray analysis showing that the seed storage protein, a gene that responds to ABA or encodes a cold / dry stress related protein, is upregulated in transgenic Arabidopsis overexpressing AtCYP78A7 . 유전자 카테고리Gene category 유전자 코드Genetic code 유전자 산물Gene products 저장 단백질 유전자Storage protein genes At4g28520At4g28520 12S 종자 저장 단백질12S Seed Storage Protein At4g27150At4g27150 2S 종자 저장 단백질 22S Seed Storage Protein 2 At5g44120At5g44120 12S 종자 저장 단백질 (CRA1)12S Seed Storage Protein (CRA1) At4g27140At4g27140 2S 종자 저장 단백질 12S Seed Storage Protein 1 At4g27160At4g27160 2S 종자 저장 단백질 32S Seed Storage Protein 3 ABA에 반응하거나 저온/건조 스트레스 관련 유전자Genes that respond to ABA or are associated with cold / dry stress At3g02480At3g02480 저온 유도된 단백질 kin1Low temperature induced protein kin1 At5g62490At5g62490 ABA-반응성 단백질 (HVA22b)ABA-reactive protein (HVA22b) At2g42530At2g42530 저온 조절된 유전자 cor15bCold-regulated gene cor15b At4g19120At4g19120 탈수 스트레스에 대한 초기 반응성 단백질 (ERD3)Early Reactive Proteins for Dehydration Stress (ERD3) At2g26980At2g26980 CBL-상호작용 단백질 키나아제 3 (CIPK3)CBL-Interacting Protein Kinase 3 (CIPK3) At3g50970At3g50970 dehydrin xero2 (XERO2)/저온 유도 단백질 LTI30 (LTI30)dehydrin xero2 (XERO2) / cold induction protein LTI30 (LTI30) At1g56280At1g56280 건조 반응성 패밀리 단백질Dry reactive family proteins At1g52400At1g52400 글리코실 히드롤라제 패밀리 1 단백질/베타-글루코시다제 (AtBG1)Glycosyl Hydrolase Family 1 Protein / Beta-Glucosidase (AtBG1) At5g61380At5g61380 ABI3-상호작용 단백질 1 (AIP1)ABI3-Interacting Protein 1 (AIP1)

이들 유전자들이 형질전환체에서 발현이 증가했는지의 여부를 파악하기 위하여, 야생형(Ws-2)과 형질전환체(35S:AtCYP78A7의 라인 #9, #19 및 #38)로부터 RNA를 분리하여 RT-PCR을 수행한 결과, 형질전환체에서 모두 발현이 증가함을 확인하였다 (도 6).To determine whether these genes had increased expression in the transformants, RNA was isolated from wild-type (Ws-2) and transformants (lines # 9, # 19 and # 38 of 35S: AtCYP78A7). As a result of performing PCR, it was confirmed that expression was increased in all of the transformants (FIG. 6).

3) 형질전환체의 수분 스트레스 저항성3) Water Stress Resistance of Transformant

마이크로어레이 결과를 바탕으로 형질전환체의 수분 스트레스 저항성 여부를 조사하였다. 야생형의 경우 수분 스트레스 처리 12 일째 시들기 시작한 후 18일째 완전히 죽는 것을 볼 수 있었다. 반면, 형질전환체(35S:AtCYP78A7의 라인 #9, #19 및 #38)의 경우, 수분 스트레스 처리 18일 후에야 시들기 시작함을 볼 수 있었고, 다시 수분을 공급하면 수분 스트레스로부터 완전히 회복되는 것을 볼 수 있었으나, 야생형의 경우 복구되지 않았다 (도 7).Based on the results of the microarray, the transformants were examined for water stress resistance. The wild type died completely on day 18 after wilting on day 12 of water stress treatment. On the other hand, for the transformants (lines # 9, # 19 and # 38 of 35S: AtCYP78A7), it could be seen that it started to wither only 18 days after the water stress treatment, and the water supply again completely recovered from the water stress. However, wild type did not recover (FIG. 7).

본 발명에 따르면, 식물의 2차 꽃대와 측지의 생장이 억제되는 정단 우성을 강화시킬 수 있다.According to the present invention, it is possible to enhance the apical dominance in which the growth of the secondary peduncle and the geodes of the plant is suppressed.

서열목록 전자파일 첨부 Attach sequence list electronic file  

Claims (12)

삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 삭제delete 식물의 정단 우성 강화에 이용되는, 서열번호 1의 아미노산 서열을 가지는 애기장대(Arabidopsis thaliana) 유래의 시토크롬 P450 단백질을 코딩하는 유전자를 포함하는 재조합 식물 발현 벡터로 식물 세포를 형질전환하여 상기 유전자를 과발현하는 단계를 포함하는 식물의 정단 우성을 강화시키는 방법.Plant cells are transformed with a recombinant plant expression vector comprising a gene encoding a cytochrome P450 protein derived from Arabidopsis thaliana having the amino acid sequence of SEQ ID NO: 1, which is used for enhancing apical dominance of the plant, and overexpresses the gene. A method of enhancing the apical dominance of a plant comprising the step of. 제8항에 있어서, 상기 식물은 벼, 유채, 밀, 보리, 옥수수, 대두, 감자, 밀, 팥, 귀리 및 수수로 이루어진 군에서 선택된 식량작물인 것을 특징으로 하는 방법.9. The method of claim 8, wherein the plant is a food crop selected from the group consisting of rice, rapeseed, wheat, barley, corn, soybeans, potatoes, wheat, red beans, oats, and sorghum. 제8항의 방법에 의해 제조된 정단 우성이 강화된 식물.A plant with enhanced apical dominance produced by the method of claim 8. 제10항에 있어서, 상기 식물은 벼, 유채, 밀, 보리, 옥수수, 대두, 감자, 밀, 팥, 귀리 및 수수로 이루어진 군에서 선택된 식량작물인 것을 특징으로 하는 식물.The plant of claim 10, wherein the plant is a food crop selected from the group consisting of rice, rapeseed, wheat, barley, corn, soybean, potato, wheat, red beans, oats, and sorghum. 제10항 또는 제11항에 따른 식물의 형질전환(transgenic) 종자.Transgenic seed of a plant according to claim 10.
KR1020070005864A 2007-01-19 2007-01-19 Cytochrome p450 gene for strengthening apical dominance of plant KR100834378B1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
KR1020070005864A KR100834378B1 (en) 2007-01-19 2007-01-19 Cytochrome p450 gene for strengthening apical dominance of plant
PCT/KR2008/000250 WO2008088161A1 (en) 2007-01-19 2008-01-15 Cytochrome p450 gene for increasing seed size or water stress resistance of plant
CN2008800026324A CN101583718B (en) 2007-01-19 2008-01-15 Cytochrome p450 gene for increasing seed size or water stress resistance of plant
US12/523,780 US8153862B2 (en) 2007-01-19 2008-01-15 Cytochrome P450 gene for increasing seed size or water stress resistance of plant

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020070005864A KR100834378B1 (en) 2007-01-19 2007-01-19 Cytochrome p450 gene for strengthening apical dominance of plant

Publications (1)

Publication Number Publication Date
KR100834378B1 true KR100834378B1 (en) 2008-06-02

Family

ID=39769763

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020070005864A KR100834378B1 (en) 2007-01-19 2007-01-19 Cytochrome p450 gene for strengthening apical dominance of plant

Country Status (1)

Country Link
KR (1) KR100834378B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101544768B1 (en) 2013-09-13 2015-08-17 한국생명공학연구원 AtCYP78A7-specific monoclonal antibody and hybridoma cell producing the monoclonal antibody

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20000076045A (en) * 1997-03-07 2000-12-26 로얄 베터리너리 앤드 어그리컬쳐 유니버서티 Cytochrome P450 monooxygenases

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20000076045A (en) * 1997-03-07 2000-12-26 로얄 베터리너리 앤드 어그리컬쳐 유니버서티 Cytochrome P450 monooxygenases

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101544768B1 (en) 2013-09-13 2015-08-17 한국생명공학연구원 AtCYP78A7-specific monoclonal antibody and hybridoma cell producing the monoclonal antibody

Similar Documents

Publication Publication Date Title
US20210054396A1 (en) Polynucleotides and polypeptides involved in plant fiber development and methods of using same
Blee et al. A lignin-specific peroxidase in tobacco whose antisense suppression leads to vascular tissue modification
US8395021B2 (en) Highly active soybean promoter from the SUBI-3 polyubiquitin gene and uses thereof
Plesse et al. Effects of the polyubiquitin gene Ubi. U4 leader intron and first ubiquitin monomer on reporter gene expression in Nicotiana tabacum
JP2014500706A (en) Adult leaf specific promoter
KR100794395B1 (en) Cytochrome p450 gene for increasing seed size of plant
US7208652B2 (en) Constitutive photomorphogenesis 1 (COP1) nucleic acid sequence from Zea mays and its use thereof
KR100834380B1 (en) Cytochrome p450 gene for increasing water stress resistnace of plant
KR102065491B1 (en) A root hair-specific promoter from Oryza sativa Os11g41640 gene and uses thereof
KR101210308B1 (en) Root hair-specific expression promoter from Oryza sativa EXPB5 gene and uses thereof
KR100834378B1 (en) Cytochrome p450 gene for strengthening apical dominance of plant
US8153862B2 (en) Cytochrome P450 gene for increasing seed size or water stress resistance of plant
JP2009240248A (en) Function-converting method of nac transcription factor family
EP1177299B1 (en) Auxin transport proteins
JP5472089B2 (en) DNA involved in regulation of gene expression in photosynthetic tissues
EP2324117B1 (en) Increasing cell wall deposition and biomass in plants
KR101210306B1 (en) Root hair-specific expression promoter from Hordeum vulgare EXPB1 gene and uses thereof
KR101306678B1 (en) Promoter of gene specifically expressed in early flower stage in rice and uses thereof
KR102065490B1 (en) A root hair-specific promoter from Oryza sativa Os07g39940 gene and uses thereof
KR102173875B1 (en) Composition for enhancing herbicide resistance of plants and method for enhancing herbicide resistance of plants using the same
US7179957B1 (en) Method for altering nitrogen or oil content of seeds by down regulating AGL11 expression or activity
KR102353488B1 (en) A lignification related gene and an use thereof
KR102065493B1 (en) A root hair-specific promoter from Oryza sativa Os03g42100 gene and uses thereof
KR102116733B1 (en) A composition for increasing the size of plant seeds, a method for increasing the size thereof
KR102027542B1 (en) SAGL1 promoter sensing humidity from Arabidopsis thaliana and uses thereof

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20130527

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20140526

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20150526

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20160527

Year of fee payment: 9

FPAY Annual fee payment

Payment date: 20170526

Year of fee payment: 10

LAPS Lapse due to unpaid annual fee