KR102116733B1 - A composition for increasing the size of plant seeds, a method for increasing the size thereof - Google Patents

Abstract

The present invention relates to a composition for increasing the size of plant seeds, a method for increasing the size of plant seeds, a composition for increasing the initial germination rate of plant seeds and a method for increasing the initial germination rate of plant seeds, when the pPLAIIIα gene is overexpressed Since the size of plant seeds is increased and the initial germination rate is increased, it can be effectively used as a method of increasing plant productivity.

Description

A composition for increasing the size of plant seeds, a method for increasing the size thereof

The present invention relates to a composition for increasing the size of a plant seed, a method for increasing the size of a plant seed, a composition for increasing the initial germination rate of a plant seed, and a method for increasing the initial germination rate of a plant seed, more specifically the pPLAIIIα gene It is related to the increase in the size of plant seeds and the initial germination rate by overexpression of.

Lipases are a diverse group of hydrolases that break down acyl-lipids. Based on their preferred substrates in vitro, lipolytic enzymes are generally classified as triacylglycerol lipolytic enzymes, phospholipids, galactolipids, and the like.

However, many lipolytic enzymes can often act in vitro in various lipid classes and the determination of their physiological role is not trivial. Genomic analysis of Arabidopsis revealed that there are many genes that appear to be potentially involved in lipid degradation. Detoxifying the cellular function of many phytolipases is an important task.

Phospholipases (PLA) perform membrane remodeling in response to signal transduction, cell growth regulation, environmental stress and lipid metabolism by hydrolyzing the membrane. The PLA line is divided into two groups: low molecular weight PLA2 (PLA2α, β, γ and δ) and potato tuber (Solanum tuber) nodule storage protein patatin and homologous patatin related PLA (pPLAs). pPLA acts on phosphoric acid or galacto-glycerin lipids to release free fatty acids and solute lipids.

Patatin-related phospholipase A (pPLA) is a major lipid acyl hydrolase, which is divided into three groups. The pPLAIII group members (α, β, γ, δ) are distinguished from other PLAs because they lack the standard catalytic serine motif. Detailed studies of pPLAIIIβ and δ have been conducted, but the enzyme activity and cellular function of pPLAIIIα has not yet been investigated in Arabidopsis thaliana.

In Arabidopsis thaliana, 10 members of the pPLA lineage were grouped into three groups based on pPLAI, pPLAII (α, β, γ, δ, ε) and pPLAIII (α, β, γ, δ) gene structures and amino acid sequence similarity. . pPLAI and pPLAII are involved in pathogens, auxin signaling and plant responses to phosphate deficiency. The recently characterized pPLAIII lacks the standard catalytic serine-containing motif GXSXG, but they show lipolytic activity with broad substrate specificity.

It has been found in Arabidopsis that pPLAIIIδ is involved in the plant response to auxin. In addition, overexpression and knockout of rice OspPLAIIIα is known to have an effect opposite to the expression of the growth inhibitor SLENDER1 in the gibberellin signaling pathway.

Overexpression of pPLAIII showed a similar pattern of stunted growth with additional functions such as decreased cellulose content of pPLAIIIβ overexpression and increased seed oil of pPLAIII58E. The activation tagging of pPLAIIIβ also reduced longitudinal cell elongation and weakened development as observed in pPLAIIIβOE.

The recessive rice mutant dep3 lacking OspPLAIIIδ showed a compact, upright phenotype with short and broad epidermal cells. A comparative proteomic analysis of pPLAIII58E and WT was performed to understand how pPLAIII overexpression causes this change. One protein spot shifted in the OE line compared to WT. It was identified as microtubule-associated protein (MAP) 18.

However, considering the physiological functions between pPLAIIIβ, γ and δ, many molecular functions of pPLAIII have not been revealed. Moreover, the physiological phenotype and lipid profile of knockout mutants have not been reported for Arabidopsis pPLAIIIα.

Thus, the present inventors confirmed that the overexpression of the pPLAIIIα gene increases the size of plant seeds and also increases the initial germination rate.

Accordingly, an object of the present invention is to provide a composition for enhancing the size of plant seeds comprising a nucleic acid sequence encoding a pPLAIIIα (Patatin-related phospholipase A) protein or a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

Another object of the present invention is to provide a method of enhancing the size of a plant seed comprising a control step of increasing the expression of a nucleic acid sequence encoding a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

Another object of the present invention is to provide a composition for promoting the initial germination rate of plant seeds comprising a nucleic acid sequence encoding a pPLAIIIα protein or a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

Another object of the present invention is to provide a method for enhancing the initial germination rate of a plant seed comprising a control step of increasing the expression of a nucleic acid sequence encoding a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

Another object of the present invention relates to the use of the pPLAIIIα gene to increase seed size and to increase the initial germination rate of seeds.

The present invention relates to a composition for increasing the size of a plant seed, a method for increasing the size of a plant seed, a composition for increasing the initial germination rate of a plant seed, and a method for increasing the initial germination rate of a plant seed. When the pPLAIIIα (At2g39220) gene is overexpressed, the size of plant seeds increases and the initial germination rate is increased.

The present inventors characterized the overexpression mutation of Arabidopsis thaliana in order to reveal the function of pPLAIIIα, thus confirming that the seed size increases and the initial germination rate is enhanced.

Hereinafter, the present invention will be described in more detail.

One aspect of the present invention is a composition for enhancing the size of plant seeds comprising a nucleic acid sequence encoding a pPLAIIIα (Patatin-related phospholipase A) protein or a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

The nucleic acid sequence may be a nucleic acid sequence represented by SEQ ID NO: 2.

Another aspect of the present invention is a method for enhancing the size of a plant seed comprising a control step of increasing the expression of a nucleic acid sequence encoding a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

The nucleic acid sequence may be a nucleic acid sequence represented by SEQ ID NO: 2.

The control step may be performed by transforming a plant with a recombinant vector containing a nucleic acid sequence encoding a pPLAIIIα protein.

The term "vector" means a means for expressing a gene of interest in a host cell. Refers to DNA fragment (s), nucleic acid molecules that are delivered into cells, can replicate DNA, and can be independently reproduced in host cells.

"Expression vector" means a plasmid, virus or other mediator known in the art into which a nucleotide sequence encoding a target protein can be inserted or introduced. The sequence encoding the protein may be operably linked to an expression control sequence, and the operably linked base sequence and expression control sequence may be contained in one expression vector including a selection marker and a replication origin. Can be included. The term “operably linked” may be a gene and expression control sequence linked in a manner that enables gene expression when an appropriate molecule is coupled to the expression control sequence. “Expression control sequence” means a DNA sequence that regulates the expression of a polynucleotide sequence operably linked in a specific host cell. Such regulatory sequences include a promoter for conducting transcription, any operator sequence for regulating transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation.

Known vectors include pBI121, pBIG, pOCA18, pJJ1881, pGreen and pCAMBIA. Without being limited thereto, the recombinant vector is preferably a recombinant expression vector.

A preferred example of a plant expression vector is a Ti-plasmid vector capable of transferring part of itself, the so-called T-region, to plant cells when present in a suitable host such as Agrobacterium tumerfaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences into plant cells, or protoplasts, into which new plants can be produced that properly insert hybrid DNA into the genome of the plant. have. A particularly preferred form of Ti-plasmid vector is the so-called binary vector as claimed in EP 0 120 516 B1 and US Pat. No. 4,940,838.

Other suitable vectors that can be used to introduce the DNA according to the invention into a plant host are viral vectors, such as those that can be derived from double-stranded plant viruses (e.g. CaMV) and single-stranded viruses, gemini viruses, etc. For example, it can be selected from incomplete plant viral vectors. The use of such vectors can be advantageous, particularly when it is difficult to properly transform plant hosts. The expression vector will preferably include one or more selectable markers. The marker is a nucleic acid sequence having a property that can be selected by a chemical method, and all genes capable of distinguishing transformed cells from non-transformed cells correspond to this. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotic resistance genes such as Kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, etc. , But is not limited thereto.

In one embodiment of the present invention, the promoter of the plant expression vector may be a CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but is not limited thereto. The term "promoter" refers to the region of the DNA upstream from the structural gene and refers to a DNA molecule to which RNA polymerase binds to initiate transcription. "Plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental status or cell differentiation. Constitutive promoters may be preferred in the present invention because selection of transformants can be made by various tissues at various stages. Thus, constitutive promoters do not limit the possibility of selection. In addition, the vector can use a conventional terminator, for example, nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, agrobacterium tumefaciens There is a terminator of the Pine (Octopine) gene, but is not limited thereto. With regard to the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of terminators can be very desirable in the context of the present invention.

Plant transformation refers to any method of transferring DNA to a plant. Such transformation methods do not necessarily have periods of regeneration and / or tissue culture. Transformation of plant species is now common for plant species including both dicotyledonous plants as well as monocotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the invention into suitable progenitor cells. Calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation method (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185) , Agrobacterium tumerfaciens by (DNA or RNA-coated) particle impact method of various plant elements (Klein TM et al., 1987, Nature 327, 70), infiltration of plants or transformation of mature pollen or vesicles It may be suitably selected from infection with (incomplete) virus (EP 0 301 316) in mediated gene transfer. A preferred method according to the invention comprises Agrobacterium mediated DNA delivery.

The "plant cell" used for transformation of a plant may be any form of cultured cells, cultured tissue, cultured organs or whole plants, preferably cultured cells, cultured tissue or cultured organs, and more preferably cultured cells.

"Plant tissue" is a tissue of a differentiated or undifferentiated plant, such as, but not limited to, roots, stems, leaves, pollen, seeds, various types of cells used for cancer tissue and culture, ie single cells, protoplasts (protoplast), shoots and callus tissue. The plant tissue may be in planta or organ culture, tissue culture or cell culture.

The method for selecting the transformed host cell can be easily carried out according to a method well known in the art using a phenotype expressed by a selection label. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

Another aspect of the present invention is a composition for promoting the initial germination rate of a plant seed comprising a pPLAIIIα protein or a nucleic acid sequence encoding a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

The nucleic acid sequence may be a nucleic acid sequence represented by SEQ ID NO: 2.

Another aspect of the present invention is a method for enhancing the initial germination rate of plant seeds comprising a control step of increasing expression of a nucleic acid sequence encoding a pPLAIIIα protein consisting of the amino acid sequence represented by SEQ ID NO: 1.

The nucleic acid sequence may be a nucleic acid sequence represented by SEQ ID NO: 2.

The control step may be performed by transforming a plant with a recombinant vector containing a nucleic acid sequence encoding a pPLAIIIα protein.

The present invention relates to a composition for increasing the size of plant seeds, a method for increasing the size of plant seeds, a composition for increasing the initial germination rate of plant seeds and a method for increasing the initial germination rate of plant seeds, when the pPLAIIIα gene is overexpressed Since the size of plant seeds is increased and the initial germination rate is increased, it can be effectively used as a method of increasing plant productivity.

1A is a schematic diagram showing the conserved pPLAIIIα motif unique to Arabidopsis thaliana and spatial and temporal gene expression.
1B is a schematic diagram showing the over-expression line of pPLAIIIα under the control of the 35S promoter with YFP fusion at the T-DNA insertion site and C-terminus of the pplalllα mutation.
1C is a photograph showing RT-PCR results of pPLAIIIα expression in WT and pplaIIIa knockout lines.
Figure 1d is a photograph showing the intracellular location of pPLAIIIα-YFP (top) and pPLAIIIα-mRFP (bottom).
1E is a graph showing the pPLAIIIα gene transcription level of the pplalllα mutant and pPLAIIIα overexpression line.
Figure 2a is a photograph showing the comparison of the organ size of flowers in the Col-0 and pPLAIIIα overexpression lines.
Figure 2b is a photograph showing the structure of the flower organ and pollen in Col-0.
Figure 2c is a picture showing the structure of the organs and pollen of flowers in the pPLAIIIα overexpression line.
Figure 2d is a photograph comparing the root lengths of seedling cultivation 4 and 9 days in the pplalllα mutant and pPLAIIIα overexpression lines.
Figure 2e is a photograph comparing the embryonic length of 4 and 9 days of seedling cultivation in the pplalllα mutant and pPLAIIIα overexpression line.
2f is a graph comparing the length of petiole of the pplalllα mutant and pPLAIIIα overexpression lines grown for 3 weeks.
Figure 2g is a photograph showing the stem cell elongation in the pPLAIIIα overexpression line and the resulting stem area.
2H is a photograph comparing the size of seeds in the pplalllα mutant and pPLAIIIα overexpression lines.
2i is a graph comparing the size of seeds in the pplalllα mutant and pPLAIIIα overexpression lines.
2J is a graph comparing the weight of seeds in the pplalllα mutant and pPLAIIIα overexpression lines.
2K is a graph comparing the number of seeds per silique in the pplalllα mutant and pPLAIIIα overexpression lines.
3A is a graph comparing germination rates in the pplalllα mutant and pPLAIIIα overexpression lines.
3B is a graph comparing germination rates in culture conditions including GA ₃ 1 uM in the pplalllα mutant and pPLAIIIα overexpression lines.
Figure 3c is a graph comparing the ABA content in the pplalllα mutant and pPLAIIIα overexpression line.
Figure 3d is a graph showing the gene expression pattern of gibberellin oxidase (GA2ox1, GA2ox2, GA3ox1 and GA20ox1) in pplalllα mutant and pPLAIIIα overexpression line seeds grown for 20 hours.

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.

Example 1: Confirmation of knockout and overexpression lines of pPLAIIIα in Arabidopsis thaliana

Amino acid sequences were analyzed to predict and confirm conserved domains or active sites using an online program (www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi). Multiple sequence alignments were performed using the BioEdit program (version 7.1.9). A phylogenetic tree was generated by the neighbor participation method using the MEGA6 (version 6.06) program.

As can be seen in FIG. 1A, like all pPLAIII (At2g06925) proteins, pPLAIIIα was deficient in serine (S) of the S-D presumed dioxide because S present in the standard GxSxG motif was replaced by G.

However, the second residue of the estimated catalytic S-D chromosome, aspartate (D), was present in the DGG motif. It was also noted that the phosphate or anionic binding element DSGGXXG was not completely conserved in the pPLAIIIα protein, because the second glycine (G) was replaced by serine (S).

pPLAIIIα (patatin-related PLAs; At2g39220) is expressed as a single gene encoding a protein of 499 amino acids with a pI of 6.24 predicted using ProtParam and a molecular weight of 54495.06 kDa.

The amino acid sequence of pPLAIIIα and the nucleic acid sequence encoding the same are shown in Table 1 below.

Sequence number designation order One Amino acid sequence of pPLAIIIα MLTTMQRVHNKPIDSIGGFKHLVKQSNGGDGGVTATDMQEPSIETDKLSYEIFSILESKFLFGYDDDLKLMESRSRDPSPEQETASPAMVEALNGVVPGTVKNQRGKVCVLSIDSGGMRGIIPGKALAYLEHALKSKSGDPNARIADYFDVASGSGIGGIFTAMLFASSDGNRPIFKAEDTWRFLAMKGKSFYNKSPPGILNRVMKTGSGGSGGSGSKLEKAMKESFEELTLKDTLKPVLIPCYDLTSSAPFLFSRADALETDGYDFKLWEVCRATWAEPGVFEPVEMRSVDGKTRCVAVDGGLAMSNPTAAAITHVLHNKQEFPFVRGVEDLLVLSLGTGQLVDVKYDCDKVMKWKAKHWARPAVRISADGAADTVDQAVSMAFGQCRRSNYVRIQANGSSFGPCKPNIDTDASPSNVNMLVGVAEEMLKQKNAESVLFGGKKINEESNYEKLDWLAGELVLEHQRRSCRIAPTVAFKQSGDRRVDQQTIFKDIDCMF 2 Nucleic acid sequence encoding the amino acid sequence of pPLAIIIα CACACCTCAAAATTCTCAAATTCTTGTCAGTTCAATAAAACAATTTCCTTGAATTATTGTCAGACACTTAAAAGATTTGTATGCATGTAACTGCTGGTCCCGTATTAATATTTATTGCTTCATTCCTTATTACTAAGCAACAAAAGTCACGCGTGAGATATAAAAGAAGATCCTTTGCAGTTTCTCTGTTCTTGCTCCTTCTTCTTCATCTCCCTTTATTGATACTGTCTGAGTAATAATAAAAATTCACTCTTTTTGTCTTCTCAAGACAGATTTCAAAATAGAAATCATTCTCCTTTTTTCTTTTTGAAAATTTCGAGTGATTTAAGGAGGGAAAATAAAGACAGAAACAAGAACAAAAGCATCGTTTGCGAATAAGACTTCTCGTACTCTGTTTTCTTTTCTCGTGTTCTTATGACAGATTTATAAAAAAGATTAGGTTTTTGTCTTGTCTTGGCGATAATGCCTAGAGAGTGTTTTAAAGATTTGATTTAAATACTCTTTTATGTTAACTACGATGCAAAGAGTACACAACAAACCGATTGATTCTATCGGAGGTTTTAAGCATTTGGTAAAACAGAGTAACGGCGGTGACGGTGGAGTGACGGCGACGGATATGCAAGAACCGAGCATCGAGACTGATAAGCTTAGCTACGAGATTTTCTCTATTCTCGAAAGCAAGTTTCTTTTCGGGTATGATGATGACCTGAAGCTTATGGAATCAAGAAGCAGAGACCCGAGTCCAGAGCAAGAAACGGCATCACCGGCGATGGTGGAAGCTTTAAACGGCGTTGTTCCGGGTACAGTTAAGAACCAGAGAGGTAAAGTTTGTGTTTTGAGTATCGATAGTGGTGGAATGAGAGGGATTATACCTGGAAAAGCTTTGGCTTATCTGGAACATGCTCTGAAATCGAAATCGGGTGACCCGAATGCTCGAATCGCTGATTACTTCGACGTAGCTTCCGGTTCCGGTATCGGTGGGATTTTCACGGCGATGCTT TTTGCGTCGAGCGATGGTAACCGTCCGATCTTCAAAGCGGAAGACACGTGGCGGTTTTTAGCTATGAAAGGTAAAAGCTTTTACAACAAATCACCACCGGGGATACTAAACAGGGTTATGAAAACCGGGTCGGGTGGTTCGGGTGGGTCAGGTTCGAAGCTTGAGAAAGCGATGAAGGAGTCTTTCGAAGAGCTTACGCTTAAGGATACGCTTAAACCGGTTTTGATTCCTTGTTACGACCTCACGAGCTCTGCACCGTTCTTGTTCTCACGTGCTGATGCGTTGGAAACGGACGGTTATGATTTTAAGCTGTGGGAAGTTTGTAGAGCTACTTGGGCTGAGCCAGGAGTGTTTGAGCCGGTGGAGATGAGATCAGTTGATGGTAAGACACGGTGTGTAGCTGTTGATGGTGGTTTAGCAATGAGTAATCCAACGGCTGCAGCGATTACTCATGTGTTGCATAATAAGCAAGAGTTTCCTTTTGTTAGAGGTGTTGAGGATTTGCTTGTGTTGTCACTTGGTACGGGACAGTTGGTTGATGTTAAGTATGATTGTGATAAGGTTATGAAGTGGAAGGCTAAGCATTGGGCTCGACCTGCGGTTCGGATTTCTGCTGATGGAGCAGCTGATACTGTGGATCAGGCTGTTTCCATGGCGTTTGGTCAGTGTAGGAGGAGTAACTACGTCCGTATTCAGGCGAATGGATCAAGCTTTGGTCCGTGCAAACCAAACATAGACACAGATGCGAGTCCAAGCAATGTGAATATGCTTGTGGGAGTAGCAGAGGAGATGCTGAAGCAGAAGAATGCAGAGTCTGTTCTGTTTGGTGGTAAGAAAATCAATGAAGAAAGCAATTATGAGAAGCTGGATTGGTTAGCCGGTGAACTAGTGCTAGAACACCAGAGGAGGAGTTGTAGAATCGCTCCCACTGTAGCGTTCAAGCAATCCGGCGACAGAAGAGTCGATCAACAGACCATTTTCAAGGATATTGATTGTATGT TTTGAATATTTTTAAATTGTATAGATTTGTGTTTAAGTCCAGAAGAAAGCAACATTATATTCGAATTAGGCTTTTTATTAAATCTTAAAGATATGTGTAATTTTTGTTTTACTGAATTGTTATTTTCTATTGACTCTAAAAGAGCTTCGTCAACAAAATTTTGGAATGCAGAGAGCGTC

In order to study the function of Arabidopsis pPLAIIIα, a homozygous T-DNA insertion mutation was isolated for pPLAIIIα. In the present invention, the Columbia Ecotype of Arabidopsis thaliana (Col-0) was used as a model wild type plant. Was used. The knockout pPLAIIIα mutant (SALI830G12) was purchased from Arabidopsis stock center (www.arabidopsis.org/).

Specifically, immediately before the washing step, total RNA was extracted from the frozen sample with an RNeasy plant mini kit (Qiagen, USA) containing DNase I degrading enzyme (digestion). RNA concentration was measured using a Nano-MD UV-Vis spectrophotometer (Scinco, Seoul, Korea). To synthesize the first strand cDNA, 3 mg of total RNA was reverse transcribed using reverse transcriptase (RevertAid Reverse transcriptase, Thermo Fisher Scientific, USA). SYBR® Premix EX Taq? Quantitative PCR was performed using 100 ng of cDNA in a 25 uL reaction volume using (Takara, Shiga, Japan).

30 cycles at 95 ° C, 5 seconds at 95 ° C, 10 seconds at 58 ° C, 20 seconds at 72 ° C, and 45 cycles were used as recommended by the manufacturer. Fluorescence was detected at the end of each cycle. Amplification, detection and data analysis were performed in a real-time PCR system (Thermal Cycle Dice, Takara, Shiga, Japan). To determine the relative fold-difference of template abundance for each sample, the Ct value for each gene was normalized using the Ct value for β-actin (At5g09810) and using the formula 2- △ Ct It was calculated for the calibrator.

As can be seen in Figure 1c, it was confirmed that the transcription factor for pPLAIIIα was not detected by RT-PCR, and thus a knockout mutant.

In addition, the full-length genomic DNA sequence of Arabidopsis pPLAIIIα was overexpressed in Arabidopsis thaliana under the control of a 35S promoter with a yellow fluorescence protein (YFP) or monomeric red fluorescent protein (mRFP) tag at the C-terminus. .

Specifically, in order to characterize patatin-related phospholipase A (pPLAIIIα) and visualize intracellular localization patterns, pPLAIIIα under the control of the cauliflower mosaic virus (CaMV) 35S promoter The whole genome sequence of was expressed. A modified pCAMBIA1390 vector (present from E. Blancaflor) containing the CaMV 35S promoter, YFP, and / or mRFP was used for these constructs. The pPLAIIIα genomic fragment was amplified as follows using primers with SalI and AvrII sites:

Sequence number designation order 3 Forward primer for pPLAIIIα genome fragment amplification TCGTCGACATGTTAACTACGATGCAA 4 Reverse primer for pPLAIIIα genome fragment amplification GGCCTAGGAACATAATCAATATC

The enzyme digestion PCR product was cloned into a vector Pro35s: YFP / mRFP, such as pPLAIIIα-YFP and / or mRFP fusion protein (Pro35s: pPLAIIIα-YFP / mRFP). All transformants were identified by nucleotide sequencing using Agrobacterium tumefaciens C58C1 (pMP90) and transformed into Arabidopsis thaliana. The transformant insertion was confirmed by confocal microscopy or PCR analysis of the transformant.

1/2 MS medium containing 1% sucrose, 0.5 g / L MES (2- [N-morpholino] ethane sulfonic acid), KOH at pH 5.7 and 0.8% agarose (Duchefa Biochemie, The Netherlands ). Seeds that had been cold-treated for 2 days germinated in 23 hours of 16 hours of light / 8 hours of dark conditions. Transformants were selected from hygromycin-containing plates (50 ug / mL). When the seed coat was opened, the seed germination was counted and cold-treated for 2 days, followed by continuous light emission in 1/2 MS medium to cause radiation.

Fluorescence emitted from reporter proteins and organelle markers was observed by a confocal laser scanning microscope (LSM 510 META, Carl Zeiss, Jena, Germany). YFP and mRFP were detected using a set of 514 /> 530 and 543 / 560-615 nm excitation / emission filters, respectively. Fluorescent images were digitized with the Zeiss LSM image browser.

For further analysis, homozygous plants with a 3: 1 isolation ratio were selected from the plate containing hygromycin (50 ug / mL). Specifically, for each construct, 20 to 30 T1 independent lines were obtained, and the importance of the phenotype of the transgene was further analyzed among the selected lines.

As can be seen in Figure 1d, both C-terminal YFP and mRFP tagging showed that pPLAIIIα was confined to the plasma membrane of root cells.

As can be seen in Figure 1e, according to the results of quantification of the transcription level for pPLAIIIα in four independent homozygous overexpression lines, pPLAIIIα is very strong (about 600 times) in overexpression lines (OE) # 6, # 7 and # 13, # 8 showed moderate (6x) overexpression.

Example  2: pPLAIIIα  Plant size, pollen structure and seed size according to overexpression

The physiological function of Arabidopsis thaliana pplaIIIα was investigated by performing detailed phenotypic analysis of several organs in the overexpression and knockout lines for pPLAIIIα. Transversely expanded cell morphology with modified longitudinal cell elongation was previously reported by overexpression of pPLAIIIβ (At3g54950) and pPLAIIIδ (AT3G63200).

Data represent mean ± standard error (SE) of three independent replicates at P <0.05 (*) and P <0.01 (**), respectively. All surface images were taken with a low vacuum scanning electron microscope (JSM-IT300, JEOL Korea) at a working distance of 10.8 mm and 20.0 kV.

As can be seen in FIGS. 2A-2C, organs such as flowers, siliques and leaves were smaller in pPLAIIIα-OE. It was also found that the pollen structure changes in the overexpression line. Compared to Col-0, the pPLAIIIα-OE line with short and thick long carnivores reduced the organ size of the flower. Scale bars are shown in 0.2 mm (top), 2 mm (middle) and 5 mm (bottom).

In the overexpression lines shown in Figs. 2b and 2c, the flower organs with defects in the pollen structure appeared small. The scale bar is represented by 500 um (left), 100 um (top right) and 10 um (bottom right).

As can be seen in Figure 2d, the root length of the three strong pPLAIIIα-OE lines (# 6, # 7, # 13) in the OE line increases compared to the Col-0 control, while the root length of the pplaIIIa knockout mutant Showed a slight decrease.

As can be seen in Figures 2e and 2f, the hypocotyl and petiole lengths of the pplaIIIa mutant have two control groups (Col-0 and vector control) and the OE line indicates the related potential of the plant hormones auxin and gibberellin. . Scale bars are indicated in 1 mm.

As can be seen in Figure 2g, when pPLAIIIα was overexpressed, the longitudinal extension pattern from the stem cells was reduced. On the other hand, they extended transversely. The scale bar was represented by 500 um (top) and 100 um (bottom).

As can be seen in Figures 2h and 2i, interestingly, the exception to organ size reduction in the OE line was that the seed width and length increased when pPLAIIIα was overexpressed (n = 23).

As can be seen in Figure 2j, consistently, the seed weight increased by 23% in pPLAIIIα-OE and decreased by 10% in the pplaIIIα mutant, showing that pPLAIIIα is involved in seed development in WT plants (n = 10).

As can be seen in Figure 2k, in the highly overexpressed OE line, an increase in seed weight was evident at the expense of the long shell and the number of seeds per sugar (n = 10).

As a result, overexpression of pPLAIIIα decreased cell growth in seeds but increased seed size.

Example 3: Germination of seeds according to overexpression of pPLAIIIα

Seed germination rate and growth were observed in seed size and root length 4 to 9 days after the growth of pplaIII mutant was reduced. The seeds were incubated in 1/2 MS medium under dark conditions for 2 days at 4 ° C., and then transferred to a growth chamber under light.

Data represent mean ± standard error (SE) of three independent replicates at P <0.05 (*) and P <0.01 (**), respectively.

As can be seen in Figure 3a, the germination rate of the pplaIIIα mutant after 20 hours was reduced by 13% compared to the control and the OE line was increased by 16%. All knockout seeds completed germination by 30 hours, germination rate was not affected, but germination was delayed compared to WT (n = 48-56).

As can be seen in Figure 3b, the germination delay of the pplaIIIα mutant was slightly recovered by the treatment of GA ₃ . When cultured for 24 hours compared to 20 hours, the WT was 1.16 times, and the OE was 1.13 times, whereas the pplaIIIα mutant increased 1.28 times.

As can be seen in Figure 3c, the initial germination delay of knockout seeds may be due to an increase in the content of abscisic acid (ABA).

To test the role of bioactive gibberellin biosynthesis, four gibberellin (GA) oxidase genes were analyzed. GA20ox and GA3ox are enzymes that catalyze bioactive gibberellin biosynthesis, and GA2ox is involved in the conversion of bioactive gibberellin to an inactive form.

As can be seen in Figure 3d, the GA oxidase gene GA2ox1 (AT1G78440) increased 2 times in the pplaIIIα mutant, GA20ox1 (AT4G25420) increased GA2ox2 (AT1G30040) 0.7 times further and increased 1.3 times in the OE line. This indicates that germination delay may be caused by a low content of the active type GA in the pplaIIIa mutant, a low activity in the OE, and a low content of the relatively less active GA form.

<110> Industry-University Cooperation Foundation Chonnam University <120> A composition for increasing the size of plant seeds, a method          for increasing the size thereof, a composition for promoting the          initial germination speed of plant seeds, and a method for          promoting the same <130> PN180325 <160> 4 <170> KopatentIn 2.0 <210> 1 <211> 499 <212> PRT <213> Arabidopsis thaliana <400> 1 Met Leu Thr Thr Met Gln Arg Val His Asn Lys Pro Ile Asp Ser Ile   1 5 10 15 Gly Gly Phe Lys His Leu Val Lys Gln Ser Asn Gly Gly Asp Gly Gly              20 25 30 Val Thr Ala Thr Asp Met Gln Glu Pro Ser Ile Glu Thr Asp Lys Leu          35 40 45 Ser Tyr Glu Ile Phe Ser Ile Leu Glu Ser Lys Phe Leu Phe Gly Tyr      50 55 60 Asp Asp Asp Leu Lys Leu Met Glu Ser Arg Ser Arg Asp Pro Ser Pro  65 70 75 80 Glu Gln Glu Thr Ala Ser Pro Ala Met Val Glu Ala Leu Asn Gly Val                  85 90 95 Val Pro Gly Thr Val Lys Asn Gln Arg Gly Lys Val Cys Val Leu Ser             100 105 110 Ile Asp Ser Gly Gly Met Arg Gly Ile Ile Pro Gly Lys Ala Leu Ala         115 120 125 Tyr Leu Glu His Ala Leu Lys Ser Lys Ser Gly Asp Pro Asn Ala Arg     130 135 140 Ile Ala Asp Tyr Phe Asp Val Ala Ser Gly Ser Gly Ile Gly Gly Ile 145 150 155 160 Phe Thr Ala Met Leu Phe Ala Ser Ser Asp Gly Asn Arg Pro Ile Phe                 165 170 175 Lys Ala Glu Asp Thr Trp Arg Phe Leu Ala Met Lys Gly Lys Ser Phe             180 185 190 Tyr Asn Lys Ser Pro Pro Gly Ile Leu Asn Arg Val Met Lys Thr Gly         195 200 205 Ser Gly Gly Ser Gly Gly Ser Gly Ser Lys Leu Glu Lys Ala Met Lys     210 215 220 Glu Ser Phe Glu Glu Leu Thr Leu Lys Asp Thr Leu Lys Pro Val Leu 225 230 235 240 Ile Pro Cys Tyr Asp Leu Thr Ser Ser Ala Pro Phe Leu Phe Ser Arg                 245 250 255 Ala Asp Ala Leu Glu Thr Asp Gly Tyr Asp Phe Lys Leu Trp Glu Val             260 265 270 Cys Arg Ala Thr Trp Ala Glu Pro Gly Val Phe Glu Pro Val Glu Met         275 280 285 Arg Ser Val Asp Gly Lys Thr Arg Cys Val Ala Val Asp Gly Gly Leu     290 295 300 Ala Met Ser Asn Pro Thr Ala Ala Ala Ile Thr His Val Leu His Asn 305 310 315 320 Lys Gln Glu Phe Pro Phe Val Arg Gly Val Glu Asp Leu Leu Val Leu                 325 330 335 Ser Leu Gly Thr Gly Gln Leu Val Asp Val Lys Tyr Asp Cys Asp Lys             340 345 350 Val Met Lys Trp Lys Ala Lys His Trp Ala Arg Pro Ala Val Arg Ile         355 360 365 Ser Ala Asp Gly Ala Ala Asp Thr Val Asp Gln Ala Val Ser Met Ala     370 375 380 Phe Gly Gln Cys Arg Arg Ser Asn Tyr Val Arg Ile Gln Ala Asn Gly 385 390 395 400 Ser Ser Phe Gly Pro Cys Lys Pro Asn Ile Asp Thr Asp Ala Ser Pro                 405 410 415 Ser Asn Val Asn Met Leu Val Gly Val Ala Glu Glu Met Leu Lys Gln             420 425 430 Lys Asn Ala Glu Ser Val Leu Phe Gly Gly Lys Lys Ile Asn Glu Glu         435 440 445 Ser Asn Tyr Glu Lys Leu Asp Trp Leu Ala Gly Glu Leu Val Leu Glu     450 455 460 His Gln Arg Arg Ser Cys Arg Ile Ala Pro Thr Val Ala Phe Lys Gln 465 470 475 480 Ser Gly Asp Arg Arg Val Asp Gln Gln Thr Ile Phe Lys Asp Ile Asp                 485 490 495 Cys Met Phe             <210> 2 <211> 2179 <212> DNA <213> Arabidopsis thaliana <400> 2 cacacctcaa aattctcaaa ttcttgtcag ttcaataaaa caatttcctt gaattattgt 60 cagacactta aaagatttgt atgcatgtaa ctgctggtcc cgtattaata tttattgctt 120 cattccttat tactaagcaa caaaagtcac gcgtgagata taaaagaaga tcctttgcag 180 tttctctgtt cttgctcctt cttcttcatc tccctttatt gatactgtct gagtaataat 240 aaaaattcac tctttttgtc ttctcaagac agatttcaaa atagaaatca ttctcctttt 300 ttctttttga aaatttcgag tgatttaagg agggaaaata aagacagaaa caagaacaaa 360 agcatcgttt gcgaataaga cttctcgtac tctgttttct tttctcgtgt tcttatgaca 420 gatttataaa aaagattagg tttttgtctt gtcttggcga taatgcctag agagtgtttt 480 aaagatttga tttaaatact cttttatgtt aactacgatg caaagagtac acaacaaacc 540 gattgattct atcggaggtt ttaagcattt ggtaaaacag agtaacggcg gtgacggtgg 600 agtgacggcg acggatatgc aagaaccgag catcgagact gataagctta gctacgagat 660 tttctctatt ctcgaaagca agtttctttt cgggtatgat gatgacctga agcttatgga 720 atcaagaagc agagacccga gtccagagca agaaacggca tcaccggcga tggtggaagc 780 tttaaacggc gttgttccgg gtacagttaa gaaccagaga ggtaaagttt gtgttttgag 840 tatcgatagt ggtggaatga gagggattat acctggaaaa gctttggctt atctggaaca 900 tgctctgaaa tcgaaatcgg gtgacccgaa tgctcgaatc gctgattact tcgacgtagc 960 ttccggttcc ggtatcggtg ggattttcac ggcgatgctt tttgcgtcga gcgatggtaa 1020 ccgtccgatc ttcaaagcgg aagacacgtg gcggttttta gctatgaaag gtaaaagctt 1080 ttacaacaaa tcaccaccgg ggatactaaa cagggttatg aaaaccgggt cgggtggttc 1140 gggtgggtca ggttcgaagc ttgagaaagc gatgaaggag tctttcgaag agcttacgct 1200 taaggatacg cttaaaccgg ttttgattcc ttgttacgac ctcacgagct ctgcaccgtt 1260 cttgttctca cgtgctgatg cgttggaaac ggacggttat gattttaagc tgtgggaagt 1320 ttgtagagct acttgggctg agccaggagt gtttgagccg gtggagatga gatcagttga 1380 tggtaagaca cggtgtgtag ctgttgatgg tggtttagca atgagtaatc caacggctgc 1440 agcgattact catgtgttgc ataataagca agagtttcct tttgttagag gtgttgagga 1500 tttgcttgtg ttgtcacttg gtacgggaca gttggttgat gttaagtatg attgtgataa 1560 ggttatgaag tggaaggcta agcattgggc tcgacctgcg gttcggattt ctgctgatgg 1620 agcagctgat actgtggatc aggctgtttc catggcgttt ggtcagtgta ggaggagtaa 1680 ctacgtccgt attcaggcga atggatcaag ctttggtccg tgcaaaccaa acatagacac 1740 agatgcgagt ccaagcaatg tgaatatgct tgtgggagta gcagaggaga tgctgaagca 1800 gaagaatgca gagtctgttc tgtttggtgg taagaaaatc aatgaagaaa gcaattatga 1860 gaagctggat tggttagccg gtgaactagt gctagaacac cagaggagga gttgtagaat 1920 cgctcccact gtagcgttca agcaatccgg cgacagaaga gtcgatcaac agaccatttt 1980 caaggatatt gattgtatgt tttgaatatt tttaaattgt atagatttgt gtttaagtcc 2040 agaagaaagc aacattatat tcgaattagg ctttttatta aatcttaaag atatgtgtaa 2100 tttttgtttt actgaattgt tattttctat tgactctaaa agagcttcgt caacaaaatt 2160 ttggaatgca gagagcgtc 2179 <210> 3 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 3 tcgtcgacat gttaactacg atgcaa 26 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Artificial sequences <400> 4 ggcctaggaa cataatcaat atc 23

Claims (10)

A composition for enhancing the size of a plant seed comprising a pPLAIIIα (Patatin-related phospholipase A) protein consisting of the amino acid sequence represented by SEQ ID NO: 1 or a nucleic acid sequence encoding a pPLAIIIα protein. According to claim 1, wherein the nucleic acid sequence is a nucleic acid sequence represented by SEQ ID NO: 2, the composition for enhancing the size of plant seeds. A method for enhancing the size of a plant seed comprising a control step of increasing expression of a nucleic acid sequence encoding a pPLAIIIα (Patatin-related phospholipase A) protein consisting of the amino acid sequence represented by SEQ ID NO: 1. The method of claim 3, wherein the nucleic acid sequence is a nucleic acid sequence represented by SEQ ID NO: 2. The method of claim 4, wherein the adjusting step is performed by transforming a plant with a recombinant vector comprising a nucleic acid sequence encoding a pPLAIIIα protein. delete delete delete delete delete

Images