KR100823157B1 - - Method for Mass Production of Recombinant Adeno-associated Virus - Google Patents

Abstract

The present invention relates to a method for mass-producing AAV by transducing AAV gene carriers into suspension cells, specifically, (1) converting adherent cells into suspension cells; (2) transducing the adeno-associated virus (rAAV) expression vector to the suspension cultured cells prepared in step (1); (3) suspending the transduced cells in step (2); (4) lysing the cells cultured in step (3) to prepare a lysate; And (5) purifying the recombinant adeno-associated virus particles from the lysate of step (4). The method of the present invention can solve the difficulty of increasing the scale of production in the production of rAAV using conventional adherent culture cells, and can be usefully used in the rAAV production industry widely used for gene therapy.

Recombinant Adeno-associated Virus, rAAV, Mass Production Method

Description

Method for Mass Production of Recombinant Adeno-associated Virus             

1 is a photomicrograph of a cell showing a state in which HEK 293 cells (left), which are adherent culture cells, are converted to suspension culture cells (right).

Figure 2a is a cleavage map of the rAAV expression vector pTR-RFP expressing a red fluorescent protein (RFP), Figure 2b is a coagulation factor IX CDS including coagulation factor IX CDS FIG. 2C is a cleavage map of the rAAV expression vector pAAV-FIX-UTR including the CDS and untranslated region (UTR) of coagulation factor 9, and FIG. 2D is an anti-cancer peptide. It is a cleavage map of the rAAV expression vector pAAV-LK8 which expresses LK8, and FIG. 2E is a cleavage map of the rAAV expression vector pAAV-LK68 which expresses LK68.

Figure 3 shows the physical particle yield of GFP expressing recombinant adeno-associated virus (rAAV-GFP) when cotransduced by varying the amounts of pAAV-hrGFP vector and pDG helper plasmid in HEK 293 cells suspended in 6-well. (physical particles, PP) and the number of infectious particles (infectious particles, IP) quantitative comparison compared.

Figure 4a is a flow cytometry graph comparing the transduction efficiency according to the culture method when co-transduction of pAAV-hrGFP vector and pDG helper plasmid in HEK 293 cells attached or suspended culture in 6-well, Figure 4b is A graph comparing AAV production yield for cells.

5A is a flow cytometry graph showing transduction efficiency when each rAAV expression vector is transduced into cells by a scale-up transduction protocol based on cell number, and FIG. 5B is a diagram illustrating the expression vector based on the culture volume. Flow cytometry graph showing transduction efficiency when cells are transduced with a scale up transduction protocol.

6A is an ELISA assay showing the yield of AAV when each rAAV expression vector is transduced into cells with a scale-up transduction protocol based on cell number, and FIG. 6B shows the expression vector based on the culture volume. ELISA assay showing the yield of AAV when the cells were transduced by the scale-up transduction protocol.

7 is a result of ELISA analysis comparing AAV production yield according to culture scale-up when transducing by calcium-phosphate precipitation method to suspension culture of HEK 293T cells by applying a scale-up transduction protocol based on culture volume. .

Fig. 8A shows the double transduction of rAAV expression vector pAAV-hrGFP or pTR-UF6 and helper plasmid pDG and triple transduction of AAV expression vector pAAV-hrGFP or pTR-UF6 and helper plasmid pHelper and pAAV-RC. The physical particle number (PP) of rAAV was compared by ELISA analysis method, and FIG. 8B shows that the infectious particle number (IP) was compared by ICA (Infectious Center Assay) method in the above case. The result is. All experiments were performed 2 to 7 times and are shown as average and standard error.

9A is a graph showing purification of rAAV-GFP particles using iodixanol-concentration centrifugation and anion-exchange chromatography, and FIG. 9B is a Western blot analysis of the purified recombinant adeno-associated virus particles for each fraction. 9C is a photograph confirmed by silver staining analysis of the fraction.

10A is a chromatogram showing fractions 19-22 collected using cation-exchange resin CM Sepharose FF (primary chromatogram), and FIG. 10B is purified rAAV- using a column packed with POROS HE 50 resin. Chromatogram of BFP (secondary chromatogram), Figure 10c is a photograph confirmed by Western blot analysis of the obtained rAAV-BFP particles in secondary chromatography, Figure 10d is a silver stain analysis of the obtained rAAV-BFP particles This is a confirmed photo

11A is a chromatogram showing fractions 15 to 20 collected using cation-exchange resin CM Sepharose FF, FIG. 11B is a chromatogram of rAAV-BFP purified using a column packed with Source 15Q resin, FIG. 11c is a photograph confirming the obtained rAAV-BFP particles by Western blot analysis, Figure 11d is a photograph confirming the obtained rAAV-BFP particles by silver staining analysis.

The present invention relates to a method for mass production of recombinant adeno-associated virus, and more particularly, to a method for mass production of recombinant adeno-associated virus by transducing a vector for AAV expression in suspension cultured cells.

Adeno-associated virus (AAV) is a type of parvovirus, a non-pathogenic virus that does not cause a serious immune response, has a wide range of infected host cells, not only growing cells, but also growing cells. In addition to being infected with quiescent cells, they exist not only in the form of episomes in the host cell, but also because they have the ability to insert the genome of the virus into the chromosome of the host cell. Recently, attention has been paid to the possibility of using it as a vector for gene therapy. In particular, when the virus is infected with human cells, the genome of the virus tends to be inserted into a specific position on human chromosome 19, which is known as a region where no gene for a particular function is present. The possibility of activating proto-oncogenes by insertional mutagenesis is very low, which is more advantageous for gene therapy. In addition, recombinant adeno-associated viruses rarely occur in chromosomal insertion, and the reason is not yet clear.

Because of the above advantages, adeno-associated viruses have been considered to be used as gene vectors for introducing foreign genes for treatment into the subjects to be treated, and they can be used as important carriers for obtaining therapeutic effects in various diseases. It is reported to be highly probable (Russell, D. and Kay, MA, Blood , 94: 864-874, 1999; Ponnazhagan, S. et al ., Cancer Res ., 61: 6313-6321, 2001; Snyder, RO , J. Gene Med ., 1: 166-175, 1999; Chuah, MK, Collen, D. and Vanden Driessche, T., J. Gene Med ., 3: 3-20, 2001).

However, since AAV does not have its own self-replicating ability, it is not easy to efficiently produce recombinant AAV (rAAV) to the extent necessary for treatment. Because of these drawbacks, recombinant AAV has not been widely used since the early generation of gene therapy research, but as a result of steady research on the life history of viruses, helper virus-glass production systems (Xiao, X., Li, J. and Samulski) , RJ, J. Virol ., 72: 2224-2232, 1998; Grimm, D. et al ., Hum. Gene Ther ., 9: 2745-2760, 1998; Matsushita, T. et al. , Gene Ther. , 5: 938-945, 1998; Conway, JE et al. , Gene Ther ., 6: 986-993, 1999; Allen, Mol. Ther., 1: 88-95, 1999; Cao, L. et al ., J. Virol ., 74: 11456-11463, 2000), hybrid helper virus system (Zhang, H.-G. et al ., Gene Ther ., 8: 704-712, 2001; Urabe, M., Ding, C and Kotin, RM, Hum. Gene Ther ., 13: 1935-1943, 2002), or packaging cell lines transformed with the essential adenovirus and / or AAV gene (Gao, G.-P. et al ., Hum. Gene Ther ., 9: 2353-2362, 1998; Inoue, N. and Russell, DW, J. Virol ., 72: 7024-7031, 1998; Liu, XL, Clark, KR and Johnson, PR, Gene The r, 6: 293-299, 1999; Chadeuf, G. et al, J. Gene Med, 2:. 260-268, 2000; Liu, X. et al, Mol Ther, 2:..... 394- 403, 2000; Qiao, C. et al. , J. Virol ., 76: 13015-13027, 2002) have been devised for effective methods for rAAV production. Among the above methods, the most widely used method for producing rAAV is the rAAV expression vector encoding the object-gene and the AAV rep-cap gene expression vector (eg pAAV-RC) and the adenovirus required for infectious particle formation. A helper plasmid encompassing the expression vector of the gene of origin (e.g., pHelper) (a plasmid containing the AAV rep-cap gene and the adenovirus origin gene required for the formation of adeno-associated virus infectious particles, eg pDG). Is a method of double or triple transduction into a packaging cell line transformed with E1 gene of adenovirus, such as HEK 293 cells.

In most cases, transduction is usually performed in adherent cultures of packaging cell lines that can supplement the E1 gene of adenovirus, such as human embryonic kidney 293 cells (HEK 293) (Grimm, D , 2002, Methods , 28: 146-157; Zolotukhin, S. et al. , 2002, Methods , 28: 158-167). However, combining the results of previous studies, the amount of rAAV required to demonstrate therapeutic effects in animal studies is about 10 ¹³ particles, and at least 20 to as many as 5,000 HEKs based on a 15 cm 2 culture dish to produce this level of rAAV. Transduction for 293 culture dishes is required (Kay, MA et al ., Nat. Genet ., 24: 257-261, 2000; Chuah, MK, Collen, D. and Vanden Driessche, T., J. Gene Med. , 3: 3-20, 2001; Matsushita, T. et al ., Gene Ther ., 5: 938-945, 1998; Gao, G.-P. et al ., 1998, Hum. Gene Ther ., 9: 2353-2362; Zolotukhin, S. et al ., Gene Ther. , 6: 973-985, 1999; Chadeuf, G. et al ., J. Gene Med ., 2: 260-268, 2000; Drittanti, L. et al ., Gene Ther ., 7: 924-929, 2000; Drittanti, L. et al ., J. Gene Med ., 3: 59-71, 2001). Furthermore, in clinical trials involving humans, it is estimated that about 10 ¹³ to 10 ¹⁴ particles will be used in one clinical application, requiring a much larger number of culture dishes and transduction thereof (Grimm). , D. and Kleinschmidt, J. A. , Hum.Gener Ther ., 10: 2445-2450, 1999). Thus, effective mass production of rAAV is a very important technique for realizing gene therapy of various refractory diseases using AAV derived gene carriers.

While a large number of mammalian cells can be grown in vitro by bond cultures, recombinant animal cell lines, such as Chinese hamster ovary (CHO) cells, are designed to grow in a suspension culture that is efficient for mass production of recombinant drugs. It is a common production technology that is currently grown and cultured in a mass suspension culture. The technique is a common method that can increase the capacity to bioreactors up to 10,000 L scale to produce various therapeutic recombinant proteins. Therefore, if a specific foreign gene can be efficiently transduced in suspension cultured cells, such a method will be the best method to produce rAAV in large capacity. To date, the recombinant adeno-associated viral expression vector of a HEK 293 cell line suspended in culture is based on the general idea that it is much more efficient to use adherent cultured cells to transduce mammalian cells by conventional follow-up. And few attempts to produce rAAV by cotransduction with helperplasmid or helper virus. However, the method can be attempted by considering several factors that can affect transduction efficiency, such as host cell lines, plasmid DNA and transfection reagents. First, looking at the host cell line, HEK 293 cell line is a cell line transformed with the E1 gene of the fifth serotype adenovirus, and has an excellent activity of complementarily inducing particle formation of recombinant adenovirus or rAAV from which the E1 gene has been removed. It is the most efficient and representative packaging cell line that is widely used. For the second factor, plasmid DNA for recombinant adeno-associated virus expression, as is well known, supercoil-type plasmid DNA is most suitable for efficient transduction, and is required to produce and purify this type of high quality plasmid DNA. As devices and methods are already commonplace, the choice of reliable, efficient and cost-effective transduction reagents is important for efficient transduction of large quantities in addition to factors such as host cell lines or plasmid DNA. Do. Unlike the previous two main factors, the transduction efficiency of adherent or suspension cultured cells can vary greatly depending on the selection of transfection reagent. DNA-calcium phosphate co-precipitation (CaPi) is the most common method of delivering DNA to mammalian cells and can be applied to high-volume systems, but is often reported to be less reproducible and limited in DNA binding capacity. , Best suited for large-scale transduction (Batard, P., Jordan, M. and Wurm, F., Gene , 270: 61-68, 2001; Jordan, M., Schallhorn, A. and Wurm, FM, Nucleic Acids Res ., 24: 596-601, 1996).

Polyethylenimine (PEI) is a cost-effective, non-lipid transduction reagent that is not only one of the most efficient transfection reagents in vitro , but also a variety of genes in vivo . (Kichler, A. et al ., J. Gene Med. , 3: 135-144, 2001; Boussif, O. et al. , Proc. Natl. Acad. Sci. USA. , 92: 7297-7301, 1995). Most of PEI's excellent gene transfer ability has been observed and reported in various cell lines cultured in adherent cultures, and there have been reports of inducing gene expression with high efficiency even when targeting 293 cells suspended in bioreactors (Schlaeger, E). -J. And Christensen, K., Cytotechnology , 30: 71-83, 1999). However, there are not many examples used to form rAAV particles which must be co-transduced with two or more plasmids to form recombinant virus particles having a three-dimensional structure (Drittanti, L. et al ., J. Gene Med , 3: 59-71, 2001), moreover, there have been no examples of rAAV particles generated by transduction into suspended cultured HEK 293 cells.

On the other hand, conventional methods for purifying recombinant adeno-virus particles include ultracentrifugation (Zolotukhin, S. et al ., Gene Ther. 6: 973-) using density differences of materials such as CsCl and iodixanol . 985, 1999), but this method is not suitable for mass production, and the low efficiency of pure separation of infectious viral vectors results in the use of ion exchange resins in the second step of purification or the heparan sulfate known as a potent receptor for AAV viruses. It may also be used in combination with purification methods using affinity resins that use affinity similar to proteoglycan receptors such as heparin and cellufine sulphate (Zolotukhin, S. et al. , Gene Ther., 6) . : 973-985, 1999; O'Riordan, CR et al. , J. Gene Med., 2: 444-454, 2000; Zolotukhin, S. et al. , Methods , 28: 158-167, 2002; Snyder, .... RO and Flotte, TR Curr Opin Biotechnol, 13: 418-423, 2002; Patent Registration No. No. 6,593,123). However, heparin-based affinity resins also have limitations in scale-up and, when used in clinical grade recombinant adeno-associated virus purification processes that require high purity, must ensure complete removal of affinity-derived material. It is difficult to use for industrial purposes. Therefore, it is necessary to establish an efficient process using a two-step ion exchange resin as a process for producing and purifying industrial recombinant adeno-associated viruses. Recently, in order to establish such a process, an attempt has been made to introduce a gel filtration method using a cation exchange resin and an anion exchange resin suitable for AAV vector purification step by step or using a molecular size difference as a second purification process (Drittanti, L. et al. , J. Gene Med., 3: 59-71, 2000; Brument, N. et al. , Mol. Ther., 6: 678-686, 2002; Blouin, V. et al. , J Gene Med., 6: S223-228, 2004).

In order to produce a large amount of rAAV, the present inventors convert susceptible culture cells, which are usually used for transduction, into suspension culture cells, thereby producing suspension culture cells that are easy to mass culture, and expressing recombinant adeno-associated virus in the cells. As a result of the introduction of the vector, the culture scale was gradually increased, followed by culturing, followed by purification by introducing a two-stage ion exchange resin purification method suitable for large-scale purification. The present invention was completed by confirming that the production yield is high.

An object of the present invention is to provide a method for mass production of recombinant adeno-associated virus by transducing a recombinant adeno-associated virus-forming vector into suspension culture cells.

Definition of Terms

AAV refers to adeno-associated virus, which encompasses recombinant adeno-associated viruses expressing foreign genes, but unless otherwise specified in this document, refers to wild type viruses. Refer. The adeno-associated virus is also referred to as adeno-associated virus or adeno-associated virus.

Recombinant adeno-associated virus (rAAV) refers to an adeno-associated virus capable of expressing the foreign gene by inserting a target foreign gene, and is a gene carrier used for gene therapy, and is also referred to as a recombinant AAV vector. It is referred to. Meanwhile, rAAV-GFP means GFP expressing recombinant adeno-associated virus generated from cells transduced with pAAV-hrGFP, which is an expression vector of GFP, and rAAV-BFP is transduced with pTR-UF6, an expression vector of BFP. BFP expressing recombinant adeno-associated virus produced from cells.

Recombinant adeno-associated viral expression vectors (abbreviated as rAAV expression vectors) in a narrow sense are foreign genes produced to express foreign genes in cells infected by recombinant adeno-associated viruses. Means an expression vector containing a gene, but in a broad sense includes any of the vectors required to transduce cells to form recombinant adeno-associated viruses, including the following AAV rep-cap gene expression vectors and helper plasmids or helper viruses it means. Unless otherwise specified in this document, recombinant adeno-associated virus expression vectors are used in the latter sense.

The AAV rep-cap gene expression vector represents an expression vector of a gene encoding an enzyme (rep) necessary for replication of the genome derived from the recombinant adeno-associated virus expression vector and an envelope protein (cap) for formation of adenovirus particles. By means of co-transduction with the recombinant adeno-associated virus expression vector, intracellular production of the recombinant adeno-associated virus is possible. Helper virus refers to a virus that helps to form infectious particles of adeno-associated viruses that cannot be replicated independently, and include adenoviruses, vaccinia virus and herpes simplex virus. Helper plasmid refers to a plasmid that acts as a function of the helper virus. On the other hand, the AAV rep-cap gene expression vector and helper plasmid may be implemented as a single vector, a representative example is pDG (DKFZ, Germany). Since the AAV rep-cap gene expression vector and the helper virus or helper plasmid can help to form an infectious rAAV particle by assisting an rAAV expression vector that cannot independently form an infectious adeno-associated virus particle, in this document, AAV Plasmids containing both the rep-cap gene and the adenovirus origin gene necessary for the formation of adeno-associated virus infectious particles (eg pDG), as well as the AAV rep-cap gene expression vector (eg pAAV-RC) And an expression vector (eg, pHelper) of an adenovirus-derived gene required for infectious particle formation are referred to as a helper plasmid, and the helper plasmid and helper virus are collectively referred to as a helper vector. Therefore, unless otherwise specified in the present document, helper plasmid is used to encompass both the AAV rep-cap gene expression vector and the expression vector of the adenovirus origin gene required for the formation of adeno-associated virus infectious particles.

Detailed description of the invention

In order to achieve the above object, the present invention provides a method for mass production of rAAV by transducing a recombinant adeno-associated virus (hereinafter, abbreviated as 'rAAV') expression vector into suspension culture cells.

Hereinafter, the present invention will be described in detail.

The present invention

(1) converting adherent cells into suspension cells;

(2) transducing the adeno-associated virus (rAAV) expression vector to the suspension cultured cells prepared in step (1);

(3) suspending the transduced cells in step (2);

(4) lysing the cells cultured in step (3) to prepare a lysate; And

(5) Provides a method for mass production of recombinant adeno-associated virus comprising purifying the recombinant adeno-associated virus particle from the lysate of step (4).

In step 1, the adherent culture cells to be converted into suspension culture is preferably selected from the group consisting of HEK 293 cells, HEK 293 T cells, 293E cells, HeLa cells and CHO cells. In a preferred embodiment of the present invention, HEK 293 cells, HEK 293 T cells, Naut cells were used, transduction efficiency and rAAV production yield when transduced rAAV expression vector by converting HEK 293T cells into suspension culture cells This was the most excellent. In addition, the conversion of adherent culture cells to suspension culture cells is preferably cultured in suspension by culturing the adherent culture cells in a hydrogel coated plate, thereby preventing the cells from adhering to the cell culture plate and spreading.

In step 2, transduction of the rAAV expression vector is not particularly limited thereto, but DNA-calcium phosphate co-precipitation (CaPi), lipofection, electrophoresis or polyethyleneimine (polyethylenimine, PEI) It is preferable to carry out by a method using), and more preferably to a method using PEI for more stable scale-up. Transduction of rAAV expression vectors may be performed using a conventional recombinant vector transduction method, but PEI is used as a transduction agent to increase transduction efficiency and mixed with the rAAV expression vector DNA in an appropriate ratio. Use it. PEI is a cost-effective non-lipid transformation reagent that can efficiently deliver large amounts of genes into cells.

In addition, the transduction is preferably carried out by transducing the rAAV expression vector and the helper plasmid or helper virus at the same time. In one embodiment of the present invention, the helper plasmid is composed of a combination of an AAV rep-cap gene expression vector and an expression vector of an adenovirus origin gene required for the formation of an infectious recombinant adeno-associated virus particle, and in another embodiment of the present invention, The two vectors are implemented in one plasmid. In a preferred embodiment of the present invention, pAAV-hrGFP (Stratagene, USA), pAAV-RFP, pTR-UF6 or pTR-RFP was used as the rAAV expression vector, and pAAV-RC (Stratagene) as the AAV rep-cap gene expression vector. , USA), and pHelper (Stratagene, USA) was used as an expression vector of adenovirus-derived genes required for infectious recombinant adeno-associated virus particle formation. Meanwhile, pDG (DKFZ, Germany) was used as a vector implementing the AAV rep-cap gene expression vector and the helper plasmid into one plasmid (see Example 3).

In step 3, the suspension culture of the transduced cells is preferably cultured at a culture scale of 0.1 to 1,000 L, and may be cultured to 0.1 L or less, but the purpose of the present invention is to mass produce rAAV. It is preferable to incubate in the culture scale range. Suspension culture on this scale consists of a large-scale culture vessel capable of cultivating at a time with a large capacity, and cultivating using a general bioreactor capable of maintaining an appropriate oxygen concentration, CO 2 concentration, pH range, rotation speed, and temperature at all times. desirable.

Step 4 may be performed using a conventional cell lysis buffer.

Purifying the recombinant adeno-associated virus particles of step 5 is preferably performed by chromatography using an ion exchange resin, and is performed by two-step chromatography using a combination of a cation exchange resin and an anion exchange resin. More preferred. At this time, the ion exchange resin is not particularly limited, but is preferably a resin of carboxymethyl, methylsulfonate or quaternary ammonium. In addition, the two-step chromatography is performed by treating the recombinant adeno-associated virus crude extract fraction obtained by treatment with cation exchange resin with an anion exchange resin, or cation the recombinant adeno-associated virus crude extract fraction obtained by treatment with an anion exchange resin. It is preferably carried out by treating with an exchange resin. Alternatively, the crude extract fraction obtained by treating the lysate first with a cation exchange resin can be purified by two step chromatography treating with an affinity resin. At this time, the affinity resin is not particularly limited thereto, but preferably includes a binding agent for AAV such as an antibody specific for AAV or a receptor for AAV.

The present inventors were able to obtain HEK 293 cells suspended in culture in a stable form by culturing HEK 293 cells, which are adherent culture cells, in a hydrogel coated plate (see FIG. 1), and the suspension cultured cells, HEK 293T cells, and Naut cells. PAAV-hrGFP (Stratagene, USA), pAAV-RFP, pTR-UF6, or pTR-RFP, which are rAAV expression vectors, as a helper plasmid, pAAV-RC (Stratagene, USA), which is an AAV rep-cap gene expression vector, and infectious recombinant adeno- Together with pHelper (Stratagene, USA), the expression vector of the adenovirus-derived genes required for the formation of accessory viral particles, or the expression vector of the adenovirus-derived genes required for the formation of the AAV rep-cap gene expression vector and infectious recombinant adeno-associated virus particles. Cotransduction was performed with pDG (DKFZ, Germany) implemented as one vector. As a result of measuring the transduction efficiency and the adeno-associated virus production yield of the transduced cells, it was confirmed that the transduction efficiency was almost similar to or superior to that of the transduced cells (see FIG. 4A). In addition, as a result of measuring the adeno-associated virus production yield in the transduced cells, it was confirmed that both the physical particle number and the DNase I-resistant particle number is much superior to the adherent culture cells (see FIG. 4B).

Culture scale up protocol based on cell number and culture volume up protocol based on culture volume were performed to ensure transduction efficiency and adeno-associated virus production yield were maintained even when culture size was increased. As a result of transduction in a 125 ml Erlenmyer flask, all of the above protocols showed transduction efficiency as before the culture scale-up (see FIGS. 5A and 5B), and the rAAV production yield was similarly maintained (FIG. 6a and 6b). The culture scale was gradually increased to 1 L spinner flask suspension culture and 2 L bioreactor suspension culture to measure the transduction efficiency and rAAV production yield of rAAV expression vectors. In addition, it was confirmed that the effective virus production yield is also effective in the actual gene therapy (see Table 1 and Table 2).

In this case, a method of combining ultracentrifugation and ion-exchange resin purification using iodixanol as a method for large-scale purification of the produced rAAV particles (FIGS. 9A and 9B). And 9c), a method of combining an ion exchange resin purification method and a method of using adeno-associated virus affinity resin (see FIGS. 10A, 10B, 10C, and 10D) to confirm a conventional purification method. An efficient two stage ion exchange resin purification method was established (see FIGS. 11A, 11B, 11C and 11D).

Therefore, the method of the present invention is characterized by using a transduction method of rAAV expression vectors using suspension culture cells without using the transduction method of rAAV expression vectors using conventionally used adherent culture cells. In order to increase the rAAV production, the culture scale was increased, and in the case of adherent culture cells, the rAAV was produced and purified in a large amount through only one bioreactor, overcoming the difficulty of continuously increasing the number of culture plates. It is a great feature to be an excellent way to do this.

Hereinafter, the present invention will be described in detail by way of examples.

However, the following examples are merely to illustrate the invention, but the content of the present invention is not limited to the following examples.

Example 1 Cell Culture and Obtaining Virus

HeRC 32 cells (Chadeuf, G., et al., J. Gene Med. 2: 260-268, 2000), human embryonic kidney 293 cells (hereinafter referred to as 'HEK 293', Microbix Biosystems, Canada), 293T cells (CRL-11268; ATCC, USA) and Naut cells (Microbix Biosystems, Canada) were treated with 10% (v / v) fetal calf serum (Dulbecco's Modified Eagles Medium) medium (Life Technologies, USA). FBS, Biowhittaker, USA) was used to incubate in a condition that the air containing 5% CO ₂ was supplied at 37 ℃. Wild-type adenovirus type 5 (Ad5 wt; VR-5, ATCC, USA) was cultured with HEK 293 cells, obtained by CsCl concentration gradient method, and fractionated through normal virus purification (Snyder, O., Xiao) , X. and Samulski, RJ, Current protocols in human genetics.Unit 12.1 Vectors for gene therapy, John Wiley & Sons, New York, USA, 1996).

Example 2 Conversion of HEK 293 Cells to Suspension Cultured Cells

HEK 293 cells (passage numbers 25-40) cultured in 75 cm ² culture flasks were detached from the flasks and then 3 × 10 ⁵ cells / ml in a hydrogel-coated disposable 6-well cell culture plate (Corning, USA). Inoculated at concentration. When cultured in a hydrogel-coated culture plate, it is possible to prevent the cells from attaching and spreading. A medium prepared by adding 2% (v / v) fetal bovine serum, dextran sulfate (25 mg / L) and 0.1% (w / v) Pluronic F68 to DME medium was used for suspension culture. . Cell culture was incubated under the conditions that the air containing 5% CO ₂ at 37 ℃ supplied.

As a result, the subculture was stably suspended after subculture for one month. These secondary cultured cells proliferated at a maximum doubling time of 26 hours similar to adherent cultures, and by dividing at a 1: 3 ratio, the continuous secondary culture was maintained in a stable suspension culture (FIG. 1).

Example 3 Transduction and rAAV Production Yield in 6-well Plate Suspension Cultures

Example 3-1 Preparation of Transduction Plasmid

pAAV-hrGFP (Stratagene, USA), pAAV-LacZ (Stratagene, USA) and pTR-UF6 (University of Florida, USA) were used as rAAV expression vectors. At this time, the pTR-UF6 is an expression vector of blue fluorescent protein (BFP) with blue fluorescence, which is a kind of mutated green fluorescent protein (GFP). As the helper plasmid, the expression vector of the adenovirus-derived gene required for the formation of pAAV-RC (Stratagene, USA) and the infectious recombinant adeno-associated virus particles as the AAV rep-cap gene expression vector in the case of triple transduction is pHelper (Stratagene, USA). In the case of double transduction, pDG (DKFZ, Germany) in which the AAV rep-cap gene expression vector and the expression vector of the adenovirus-derived gene required for the formation of infectious recombinant adeno-associated virus particles was formed into one vector Used. The pTR-UF6 plasmid was cleaved with Not I and blunt-ended using the Klenow enzyme to prepare a linearized pTR plasmid and to limit the pDsRed 1-1 (Clontech, USA) vector to the plasmid. DNA fragments containing red fluorescent protein (RFP) genes obtained by cleavage with the enzymes Bam H I and Not I and smoothed with the Klenow enzyme were inserted to prepare a vector containing the RFP gene, which was then prepared as 'pTR-RFP'. '(FIG. 2A). In addition, the plasmid pDsRed 1-1 was digested with Not I, blunted with Klenow enzyme, and then digested with Bam H I, and the DNA fragment containing the RFP gene was digested with Hin d II and Bam HI, pCMV-MCS. (Stratagene, USA) was inserted into the plasmid to prepare a recombinant vector and named it 'pCMV-RFP'. In addition, the RFP gene fragment obtained by cleaving the pCMV-RFP vector with Not I was inserted into a linearized pAAV plasmid to prepare an AAV plasmid expressing the RFP gene, which was named 'pAAV-RFP'. At this time, the pAAV plasmid was prepared by cutting the pAAV-LacZ plasmid with Not I to remove the LacZ gene. The pAAV-RFP plasmid prepared above was transformed into E. coli DH5α or Oneshot ^® TOP10 cells (Invitrogen, USA). The transformed cells were harvested and cultured with transformant colonies formed by spreading them on LB-agar plates containing 100 μg / ml ampicillin, followed by plasmid extraction using a plasmid extraction kit (Qiagen Plasmid Midi Kit, Qiagen, Germany). DNA was extracted. The extracted DNA was selected by Not I restriction enzyme cleavage analysis, and by sequencing a part of the inserted gene, it was confirmed whether or not the transformants in which the gene was finally inserted were properly selected. Sequencing was performed using the ABI PRISM Big Dye ^™ ready reaction terminator cycle sequencing kit, followed by manufacturer's instructions (Applied Biosystems, USA) in the ABI PRISM 310 genetic analyzer by end fluorescence staining method. Analyzed.

Recombinant adeno-associated virus vectors pAAV-FIX and pAAV-FIX-UTR for coagulation factor IX were constructed by the following method: First, homogeneous using an RNA extraction kit (Pharmacia, USA) 1.2 mg of total RNA was extracted from 1 g of human liver tissue homogenized with a homogenizer (Kyung Hee Medical Center). The single stranded cDNA was synthesized using M-MuLV reverse transcriptase and oligo deoxy-thymine primer (oligo-dT23 Primer, New England Biolabs, USA) as a template. DNA fragment (hereinafter referred to as 'FIX fragment') containing the CDS (coding sequence, SEQ ID NO: 1) of the coagulation factor IX (FIX) gene (Genbank accession No. M11309) using the single-stranded cDNA as a template Primer set (FIX F: 5′-catgcggccgc atgcagcgcgtgaacatg- 3 ′ (SEQ ID NO: 2), FIX R: 5′-gcgtcgact ttaagtgagctttgttttttcc −3 ′ (SEQ ID NO: 3) and CDS and the human hemagglutination factor 9 Primer set for DNA fragments containing untranslated region (UTR) of the cDNA of the gene (hereinafter referred to as 'FIX-UTR fragment', SEQ ID NO: 4) [FIX-UTR F: 5'-ctagcggccgc accactttcacaatctgc- PCR was performed using 3 ′ (SEQ ID NO: 5), FIX-UTR R: 5′-gtgtcgac aaaaagcaatgatcatagaatg- 3 ′ (SEQ ID NO: 6)]. In this case, the underlined portions in the nucleotide sequences 2 and 3 mean a sequence corresponding to the CDS portion in the cDNA of the human coagulation factor 9 gene, and the underlined portions in the nucleotide sequences 5 and 6 represent the human blood coagulation factor 9 It refers to the sequence corresponding to the UTR portion of the cDNA of the gene. The FIX and FIX-UTR fragments synthesized as a result of the PCR reaction and the vector pTR-UF6 (University of Florida, USA) were respectively digested with restriction enzyme Not I- Sal I, subjected to electrophoresis, and DNA extracted from agarose gel. It was. The cleaved vector and FIX fragment or FIX-UTR fragment were mixed at a molar ratio of 1: 3, respectively, and then ligated using T4 DNA ligase (Roche, USA), respectively. E. coli DH5? Transformed with the ligated recombinant vector, transformed colonies formed by smearing on LB agar plates containing ampicillin were harvested and cultured, and then plasmid extraction kit (Qiagen Plasmid Midi Kit, Qiagen). , Germany), to extract plasmid DNA. The extracted DNA was further cut into Not I and Sal I to confirm that the FIX and FIX-UTR fragments were correctly inserted. The purified plasmids were named 'pAAV-FIX' and 'pAAV-FIX-UTR', respectively (FIGS. 2B and 2C).

Meanwhile, pAAV-LK8 (FIG. 2D), which is an rAAV expression vector containing a gene encoding SEQ ID NO: 7 (Kringle 8) of human apolipoprotein (a), and Kringle 68 (LK68) of the protein PAAV-LK68 (FIG. 2E), which is an rAAV expression vector containing a gene encoding (SEQ ID NO: 8), was the same as that described in Korean Patent Application No. 2004-0001695.

Example 3-2 Optimization of Plasmid Amount for Transduction

rAAV was produced through a double transduction method, wherein the pAAV-hrGFP, pAAV-RFP, pTR-UF6, and pTR-RFP prepared above were used as the rAAV expression vectors, and pDG (DKFZ, a helper plasmid, respectively) was used as the remaining plasmids. , Germany). PEI (MW 25,000, Polysciences, USA) was used as a transduction reagent, and the transduction method using PEI was performed according to Bosif et al . (Boussif, O. et al ., Proc. Natl. Acad. Sci. USA. , 92: 7297-7301, 1995). Culture scale-up via the suspension culture method of the transduced cells was carried out using a 6-well tissue culture plate, a 125 ml Erlenmeyer flask, a 1 L spinner flask and a 2 L bioreactor scale. It was performed in the order of. Specifically, the cells were cultured in a hydrogel coated plate (Corning 3471, Corning, USA) to prevent adhesion and diffusion of the cells to the culture surface at the 6-well tissue culture plate scale. Cells were obtained by centrifugation at 1,000 rpm for 5 minutes just before transduction. Plasmid DNA containing the rAAV expression vector and pDG at the same molar concentration was added by 0.3, 1.0, 3.0, 6.0, 9.0 and 12.0 μg, respectively, to determine the amount of the appropriate plasmid that was transduced and showed the optimal expression yield. In the transduction experiment for confirming the introduction efficiency, 6 µg of the plasmid was diluted in 1 ml of 150 mM sodium chloride aqueous solution, and then mixed with 66 µl of 10 µM PEI solution (Polysciences, USA) so as to have a ratio of 6 PEI nitrogen per DNA monophosphate. . The DNA-PEI mixture was mixed with the cell suspension and the mixture was added to each well of the culture plate. Physical virus particles (hereinafter, abbreviated as 'PP') among the produced viruses obtained as a result of transduction were quantified by ELISA analysis according to the method shown in the figure (Grimm, D. et al ., Gene Ther . , 6: 1322-1330, 1999), Infectious virus particles (abbreviated as 'IP') were quantified according to the method of Snyder et al. (Infectious count assay (ICA)) (Snyder, O., Xiao, X. and Samulski, RJ, Current protocols in human genetics.Unit 12.1 Vectors for gene therapy, John Wiley & Sons, New York, USA., 1996). Specifically, 48 hours after the culture by transduction, samples were collected from the suspension culture and centrifuged at 1,000 rpm for 5 minutes to obtain cells. The obtained cells were suspended in lysate (50 mM HEPES, 150 mM NaCl, pH 7.6) and then subjected to basic freeze-thaw methods (Snyder, O., Xiao, X. and Samulski, RJ, Current protocols in human genetics.Unit Crude lysate was prepared by dissolving through 12.1 Vectors for gene therapy, John Wiley & Sons, New York, USA., 1996). PP of rAAV in the crude extract or purified fractions thereof was quantified by ELISA method (PRATV; Progen, Heidelberg, Germany) (Grimm, D. et al ., Gene Ther ., 6: 1322-1330, 1999).

IP specifically, rep and cap genes (Chadeuf, G. et al, J. Gene Med, 2:.. 260-268, 2000) the complement (complement) cells, HeRC32 cell 24 to 5 × 10 ⁴ dogs Inoculate each well of the well plate and incubate overnight, then step-by-step the wild type adenovirus type 5 (Ad5 wt) and crude rAAV extract or purified fraction of 20 MOI (Multiplicity of infection) so that the final culture solution is 0.2 ml. Infected simultaneously with samples diluted 10-fold. This was incubated at 37 ° C. for one hour, followed by replacement with DMEM medium containing 10% fetal bovine serum (Biowhittaker, UK). After 36 hours of incubation at 37 ° C. with air supplied with 5% CO 2, cells were obtained and resuspended in PBS buffer containing trypsin, consisting of a 47-mm diameter manifold (Millipore, USA). In a negative pressure-induced filter, the nylon membrane treated with the positive charge was adsorbed using capillary action. The nylon membrane to which the sample was adsorbed was used as a probe and each DNA template labeled with ³² P using a primer-It II ^® random primer labeling kit (Stratagene, USA) for gene encoding GFP, RFP or BFP. Hybridized. hrGFP templates were prepared by cleaving the pAAV-hrGFP plasmid with Eco R I and Xho I. All DNA templates were purified using a gel gel extraction kit (Jetsorb gel extraction kit, Genomed, Germany). At this time, [α- ³² P] -dCTP (NEN, USA) was used to label the probes. The hybridized nylon membrane is then exposed to a biological imager (phosphorimager, BAS 1000, Fujifilm, Tokyo, Japan) or x-ray film (Kodak, Rochester, NY, USA), resulting in each sample being counted by counting the spots that appear on the nylon membrane. Infectious virus particles containing were quantified.

As a result of transduction by varying the amount of plasmid to 0.3, 1, 3, 6, 9 and 12 μg per well, the virus production yield was 1 × 10 ⁸ to 8 × 10 ⁹ PP or 3 × 10 ⁴ to 3 × 10 ⁷ There were many variations in the IP range, and the most appropriate amount of plasmid per well could be determined to be 6 μg (FIG. 3). Therefore, it was decided to scale up based on cell concentration, medium volume, and optimal plasmid amount in 6-well plates. That is, the amount of plasmid per cell of each well was applied to convert the amount of plasmid required for the subsequent large-scale transduction.

<Example 3-3> rAAV expression vector transduction efficiency

Transduction of HEK 293 cells suspended and cultured in 6-well tissue culture plates and HEK 293 cells cultured in 6-well tissue culture plates was performed to compare the efficiency of transduction into suspension cultured cells with that of conventional adherent cells. rAAV was produced through a double transduction method, wherein pAAV-hrGFP (Stratagene, USA) was used as the rAAV expression vector and pDG (DKFZ, Germany), a helper plasmid, was used as the remaining plasmid. In the case of transduction into suspension culture cells, 6 μg of the expression vector and the helper plasmid showing the optimal production yield in Example 3-2 were transduced by the method of Example 3-2 using linear PEI. At this time, the experimental group which was transduced into adherent cells without suspension culture as a control group was included. For suspension culture, a hydrogel coated 6-well plate was used, and for adherent culture, HEK 293 cells that were not adapted to suspension culture were cultured in 6-well plates for general tissue culture.

To measure transduction efficiency after transduction, fluorescent cells were detected using a flow cytometer (Fluorescence-Activated Cell Sorter, FACScalibur, Beckton & Dickinson, USA) tuned with an argon ion laser.

As a result, DNA-PEI mixtures containing pAAV-hrGFP and pDG plasmids in the same molar concentration were transduced into the subculture cells and normal adherent cells, respectively. In order to confirm whether the suspension culture method attempted in the present invention affects the transduction, cells were obtained 48 hours after transduction into the two cultured cells, injected into a flow cytometer, and the fluorescent cells were counted. Transduction efficiency of pAAV-hrGFP, determined by percentage of the total cell population of the fluorescent cell population, was 96% for the suspension culture-like method and 82% for the attachment culture method (FIG. 4A). . In conclusion, the method of the present invention is very efficient, regardless of the culture method of the transduction method, unlike the conventional method is limited to adherent culture cells, and thus does not affect the transduction efficiency for the suspension cultured cells. It can be seen that transduction into suspension cultured cells is safe.

<Example 3-4> rAAV production yield analysis

In the above, it was confirmed that the transduction efficiency into the suspension cultured cells is good. Therefore, the high transduction efficiency was intended to determine whether the effect of the rAAV production yield. Specifically, 48 hours after the transduction and culture, samples were collected from the suspension culture and centrifuged at 1,000 rpm for 5 minutes to obtain cells. The obtained cells were suspended in lysis solution (50 mM HEPES, 150 mM NaCl, pH 7.6) followed by basic freeze-thaw methods (Snyder, O., Xiao, X. and Samulski, RJ, Current protocols in human genetics.Unit 12.1 Crude lysate was prepared by dissolving through Vectors for gene therapy, John Wiley & Sons, New York, USA., 1996). PP of rAAV in crude extract or purified fractions thereof was quantified by ELISA method (PRATV; Progen, Heidelberg, Germany) (Grimm, D. et al ., Gene Ther ., 6: 1322-1330, 1999).

As a result of AAV-ELISA analysis, HEK 293 cells in suspension culture produced 2.59 ± 1.84 × 10 ⁹ PP of GFP expressing recombinant adeno-associated virus (hereinafter abbreviated as 'rAAV-GFP') for each well. Excellent when compared with the corresponding rAAV production yield in adherent culture (attachment HEK 293 cells: 1.57 ± 0.94 × 10 ⁹ PP) (FIG. 4B). These results show that rAAV can be produced as efficiently as in transduction in HEK 293 cells adhered and cultured by a helper virus transduction method in suspension cultured HEK 293 cells.

Example 4 Transduction and rAAV Production Efficiency in a 125 ml Erlenmeyer Flask Suspension Culture

Example 4-1 Transduction Efficiency

In a 125 ml Erlenmeyer flask suspension culture scale, 5 × 10 ⁶ HEK 293 cells were obtained by centrifugation at 1,000 rpm for 5 minutes, and then resuspended in 10 ml of fresh culture and inoculated into each flask before transduction. The total amount of DNA used for transduction was determined according to the ratio between the amount of DNA and the number of cells or the ratio of the amount of DNA and the volume of culture determined at the 6-well culture scale, based on cell number and culture volume, respectively. Defined as a volume-based scale up protocol and comparing transduction efficiencies in bulk suspension cultures. First, in the scale-up protocol based on cell number, the amount of total DNA used for transduction was determined according to the ratio of DNA amount and cell number, based on the efficient ratio obtained on the 6-well plate culture scale. For transduction, one of the AAV expression vectors pAAV-hrGFP, pAAV-RFP, pTR-UF6 and pTR-RFP and pDG as a helper plasmid were used. 100 μg of the plasmid containing the same amount of AAV expression vector and helper plasmid was diluted in 5 mL of 150 mM sodium chloride aqueous solution, and 329 μl of 10 μM PEI solution (Polysciences, USA) so that the ratio of PEI nitrogen per phosphate of DNA was 6. Mixed with. The scale-up protocol based on the culture volume is a method in which the ratio between the amount of DNA and the amount of medium is an important factor in determining the amount of DNA required for scale-up transduction. As a reference. In the above method, 30 µg of a plasmid containing the same amount of rAAV expression vector and helper plasmid was diluted in 1.5 ml of 150 mM sodium chloride aqueous solution, and the diluted solution was mixed with 98.72 µl of 10 µM PEI solution. The DNA-PEI mixture was mixed vigorously for 10 seconds and then reacted at room temperature for 10 minutes. Thereafter, the reaction solution was diluted in 10 ml of culture medium and placed in a 125 ml Erlenmeyer flask. The culture was incubated at 37 ° C. for 6 hours under the condition that air was supplied containing 5% CO 2. After transduction for 6 hours, the culture was replaced with fresh medium and cultured for 48 hours.

Cells were obtained by transducing the cells by the respective scale-up methods 48 hours after culturing. A portion of the obtained cells were injected into a flow cytometer to measure transduction efficiency and the rest was used to measure rAAV titers.

As a result of measuring the transduction efficiency, transduction efficiency of 75% or more and 99% was shown in both the scale-up protocol based on the cell number and the scale-up protocol based on the culture volume (FIG. 5A). However, in the case of pTR-RFP, when the scale-up protocol based on the cell number was used, the transduction efficiency was about 82%, but the scale-up protocol based on the culture volume was reduced to 54% (FIG. 5B). . In addition to the distinct protocol differences, the gene expression product may have influenced the results, as the introduced RFP gene may not have been humanized and caused toxicity in HEK 293 cells. In any case, the transduction efficiency of 54% itself was sufficient to induce rAAV particle formation with very high transduction efficiency.

Example 4-2 yield of rAAV

The transduction efficiency was measured in Example 4-1, and the yield of rAAV produced in the cells using the remaining cells was performed in the same manner as in Example 3-2.

As a result, in the scale-up protocol based on the cell number, the yield of rAAV was found to be 4.9-8.4 x 10 ⁹ PP rAAV / ml per culture (FIG. 6A). Therefore, the total rAAV yield from 10 ml culture was found to be 4.9-8.4 x 10 ¹⁰ PP. In addition, when the scale-up protocol based on the culture volume, the production yield of rAAV was found to be 3.8-7.7 × 10 ⁹ PP rAAV / ml per culture (FIG. 6B). Therefore, it was found that the total rAAV yield obtained from the 10 ml culture was 3.8-7.7 x 10 ¹⁰ PP. The results showed a reduction of 8-40% and 24-49%, respectively, from the yield of PP obtained when using the scale up protocol based on cell number, but required by the scale up protocol based on cell number. Using only 30% of the amount of DNA that can be reached is a high efficiency.

Through the above advantages, it can be seen that the protocol based on the culture volume is a substantially effective protocol in terms of minimizing the amount of DNA required for subsequent scale-up. Moreover, the production yield of pTR-RFP-derived RFP expressing rAAV, which was reduced when transduced using the scale-up protocol based on the culture volume, showed the highest result compared to the production yield of other rAAV. To support them. In conclusion, the scale-up protocol based on culture volume is as efficient as the scale-up protocol based on cell number in producing rAAV, leading to titers of 10 ¹² to 10 ¹³ PP per liter in suspension culture.

Example 4-3 Comparison of Calcium Phosphate Precipitation and Transduction Using PEI

To compare the yield of rAAV production by calcium phosphate precipitation and transduction using PEI, transduction was performed on HEK 293 cells suspended in Erlenmeyer flask culture by calcium phosphate precipitation. At this time, transduction was performed using the same method as the protocol based on the culture volume of Example 4-1, and the CaPi method was described by Chen, CA and Okayama H. Biotechniques, 6: 632-638. , 1988). However, in Example 4-1, HEK 293 cells were used, but CaPi transduction was performed by suspension culture of HEK 293T cells, which have been reported to have higher production yields. In this case, pAAV-hrGFP, pAAV-RFP, pTR-UF6, pAAV-LacZ or pTR-RFP were used as rAAV expression vectors and pDG, a helper plasmid, was used as the remaining plasmid.

As a result, the yield of physical particles was found to be 3.4 ~ 4.5 × 10 ⁹ PP / ㎖ concentration without significant variation depending on the type of vector plasmid (Fig. 7). Therefore, the total yield of rAAV from 10 ml culture was found to be 3.4 to 4.5 × 10 ¹⁰ PP. This is a CaPi transduction method, considering that the production yield of transduction using PEI and scale-up protocol based on culture volume is about 3.8 to 7.7 × 10 ⁹ PP / ml as shown in Example 4-2. In addition, when HEK 293T is used, a production yield similar to that of PEI can be obtained.

Example 4-4 Comparison with Triple Transduction Method

To confirm the effect of the helper plasmid system on rAAV production, the helper plasmid pDG (DKFZ, Germany) was used together with the rAAV expression vector pAAV-hrGFP (Stratagene, USA) or pTR-UF6 (University of Florida, USA). As a double transduction method and the rAAV expression vector and the helper plasmid, the AAV rep-cap gene expression vector is an expression vector of adenovirus-derived genes necessary for the formation of pAAV-RC (Stratagene, USA) and infectious recombinant adeno-associated virus particles. Compared the triple transduction method using pHelper (Stratagene, USA). PP of the produced virus was measured by the ELISA assay of Example 2, and IP was measured by the method of Example 3-2.

As a result of the dual transduction method, rAAV-GFP per cell culture was produced at a concentration of 7.2 ± 0.3 × 10 ⁹ PP / ml, and BFP expressing recombinant adeno-associated virus (hereinafter abbreviated as 'rAAV-BFP') Produced at a concentration of 5.7 ± 4.0 × 10 ⁹ PP / mL (FIG. 8A). In addition, as a result of using the triple transduction method, rAAV-GFP was produced at a concentration of 4.5 ± 0.3 × 10 ⁹ PP / ml, and rAAV-BFP was produced at a concentration of 6.7 ± 0.7 × 10 ⁹ PP / ml. For infectious virus particle counts, double transduction produced rAAV-GFP per cell culture at a concentration of 4.8 ± 1.4 × 10 ⁷ IP / ml and rAAV-BFP at a 2.6 ± 0.3 × 10 ⁸ IP / ml concentration. On the other hand, rAAV-GFP was produced at 2.1 ± 0.2 × 10 ⁷ IP / ml per cell culture, and rAAV-BFP was produced at 1.8 ± 0.3 × 10 ⁸ IP / ml per cell culture (Fig. 8b). ). When the vector plasmid was pAAV-hrGFP or pTR-UF6, the productivity of infectious virus particles was found to be 40-130% higher than that of the double transduction method. In addition, although the productivity of infectious virus particles varies greatly depending on the type of vector plasmid cotransduced, it can be seen that the productivity of physical particles is not significantly different. Overall, it was found that the HEK 293 cells in suspension culture can produce high titer rAAV even by using the double transduction method or the triple transduction method.

Example 5 Transduction and rAAV Production Yield in 1 L Spinner Flask Suspension Cultures

Mass cultivation was carried out on a 1 L spinner flask scale and transduction was performed to confirm the possibility of subsequent scale up. At the spinner flask scale, the same culture procedure was followed as for the Erlenmeyer flask scale, but the amount of plasmid, PEI and sodium chloride was used in the scale up protocol based on the culture volume.

As a result, the overall rAAV production was 0.2-1.3 × 10 ¹³ PP and 0.1-1.6 × in 1 L scale transduction following co-transduction of rAAV expression vector and helper plasmid into HEK 293 cells, Naut cells and HEK 293T cells. 10 to ¹¹ IP. More specifically, in six individual cultures followed by transduction experiments, HEK 293T cells with an average number of 6.8 ± 2.3 × 10 ⁸ cells were transduced to average 6.7 ± 4.1 × 10 ¹² PP and 7.1 ± 6.9 × 10 ^10. IP was produced and the mean specific productivity was 9,589 ± 3,136 PP and 116 ± 121 IP per cell. In addition, the average PP: IP ratio in the crude extract was 287 ± 215. Physical rAAV particle production specific productivity measured using three sub-clone ELISAs of the HEK 293 cell line used in the present invention showed a similar tendency, but 293 T cells had an infectious rAAV particle count of the remaining HEK 293 cell line and Naut. About 5-6 times higher than the cells (HEK 293T: 15.9 ± 0.5 × 10 ¹⁰ IP, HEK 293 cells and Naut cells: 2.7 ± 1.2 × 10 ¹⁰ IP, Table 1). This result was due to the difference in specific productivity according to the packaging cell line (261 ± 90 IP / 293 T cell line, compared to 44 ± 28 IP / HEK 293 and Naut cells). HEK 293T cell line is a cell line produced by transforming HEK 293 cell line with large T (large T) antigen gene of SV 40 virus, based on the report that the protein produced by this gene will help rAAV particle formation. (Ogston, P. et al., J. Virol. 74: 3494-3504, 2000), The high rAAV non-productivity of the HEK 293T cell line can be objectively justified, and this cell line can be used efficiently for suspension culture transduction. I could see that.

Comparison of rAAV Production Yields According to rAAV Expression Vectors, Helperplasmids, and Cell Lines in 1-L Suspension Cultures rAAV expression vector Helper plasmid Cell line Culture volume (ml) Cell number (× 10 ⁸ ) PP ^* (× 10 ¹²⁾ IP ^† (× 10 ¹⁰ ) PP / IP PP / cell IP / cell pAAV-hrGFP pDG HEK 293 1000 10.8 12.6 2.11 596 11667 20 pAAV-LacZ pDG Naut 1010 6.93 6.54 3.29 199 8676 44 pTR-UF6 pDG HEK 293 995 4.98 3.47 1.4 249 11412 28 pTR-UF6 pDG HEK 293 1015 5.08 4.24 4.15 102 7474 82 Average 293 / Naut 6.95 6.71 2.74 287 9807 44 pTR-UF6 pDG HEK 293T 1004 5.02 2.47 16.3 15 4920 324 pTR-UF6 pDG HEK 293T 790 7.90 10.59 15.56 68 13385 197 Average HEK 293T 6.46 3.3 15.93 42 9153 261 Overall average 969 6.79 6.65 7.14 205 9589 116

PP of rAAV in (*) in Table 1 was quantified by PRATV ELISA (Progen, Heidelberg, Germany), and rAAV in (†) was quantified by ICA method.

Example 6 Transduction and rAAV Production Yield in 200 mL Spinner Flask Suspension Cultures

In order to confirm the possibility of subsequent scale-up, a large-scale culture was performed in a 200 mL spinner flask scale, and pAAV-LK8 (Korean Patent Application No. 10-2004-0001695) and pAAV-LK68 (Korean Patent Application) were used as rAAV expression vectors, respectively. 10-2004-0001695), pAAV-LacZ (Stratagene, USA), pTR-UF6 (University of Florida, USA), pAAV-hFIX and pAAV-hFIX-UTR and transduction using pDG with helper plasmid It was. At the spinner flask scale, the same culture procedure was followed as for the Erlenmeyer flask scale, but the amount of plasmid, PEI and sodium chloride was used in the scale-up protocol based on the culture volume.

As a result, pAAV-LK8 (Korean Patent Application No. 2004-0001695), pAAV-LK68 (Korean Patent Application No. 2004-0001695), pAAV-LacZ (Stratagene, USA), pTR-UF6 (University of Florida, USA) 6 different rAAV expression vectors, pAAV-hFIX, pAAV-hFIX-UTR, and 200 mL scale transduction following co-transduction of helper plasmid pDG into HEK 293T cells, the overall rAAV production was 1-7 × 10. ¹² PP and 1 to 8 × 10 ¹⁰ IP. More specifically, in 14 individual cultures followed by transduction experiments, HEK 293T cells with an average number of 1.5 ± 0.5 × 10 ⁸ cells were transduced to average 2.9 ± 2.6 × 10 ¹² PP and 4.3 ± 2.6 × 10 ^10. IP was produced and mean specific productivity was 19,538 ± 6,719 PP and 282 ± 152 IP per cell. Also, the average PP: IP ratio in crude extract was 86 ± 46. In this example, transfection was attempted when the number of cells was 1 × 10 ⁸ or 2 × 10 ⁸ , but the rAAV particle specific productivity showed a similar tendency, but when the number of cells was twice as large as 1 × 10 ⁸ , the rAAV virus Yield yield was high proportionally (Table 2).

Comparison of rAAV Production Yields According to Transduction of Various rAAV Expression Vectors in 200 ml Suspension Cultures rAAV expression vector Cell number (× 10 ⁸ ) PP ^* (× 10 ¹² ) IP ^† (× 10 ¹⁰⁾ PP / IP PP / cell IP / cell pAAV-LK8 1.0 2.15 1.36 158 22,020 140 pAAV-LK68 " 1.97 3.80 52 20,280 390 pAAV-LacZ " 2.11 2.05 103 21,640 210 pTR-UF6 " 1.90 6.40 30 19,440 656 pAAV-LK8 2.0 3.71 4.22 88 18,529 211 pAAV-LK68 " 2.13 2.80 76 10,654 140 pAAV-LacZ " 2.57 8.40 31 12,865 420 pTR-UF6 " 3.27 6.06 54 16,332 303 pAAV-hFIX 1.0 1.30 1.59 82 13,334 163 pAAV-hFIX-UTR " 1.85 1.01 183 18,948 104 pAAV-hFIX 2.0 5.38 5.40 100 27,600 277 pAAV-hFIX-UTR " 6.94 8.39 83 35,558 430 Overall average 1.5 2.86 4.26 86.4 19,538 282 Standard Deviation 0.52 1.55 2.59 46.3 6,719 152

The data shown in the table above are the results of transduction using HEK 293T cells as the packaging cells and helper plasmid pDG, and pAAV-LK8 and pAAV-LK68 are described in Korean Patent Application No. 2004-0001695, filed by the present applicant. RAAV expression vectors. The patent application document is incorporated herein by reference. In the table, the PP of rAAV at (*) was quantified by PRATV ELISA (Progen, Heidelberg, Germany), and the IP of rAAV at (†) was quantified by ICA method.

Example 7 Transduction and rAAV Production Yield in 2 L Bioreactor Suspension Cultures

On a 2 L bioreactor scale, from a 3 to 7 L spinner flask culture incubated with rotation of the cell culture stirrer (Techne, UK) at a rate of 50 rpm at 37 ° C. under air supplied with 5% CO 2. After the cell inoculum was prepared, it was inoculated in a spin filter bioreactor (Spinferm bioreactor, Braun Biotechnology International, Germany) on a 3.5 or 7 L culture scale and cultured to a concentration of 3 × 10 ⁵ cells / ml. The culture was incubated while injecting air at a rate of 0.1 L / min to the headspace while mixing well using a marine impeller at a speed of 70 rpm. Dissolved oxygen tension (DO) was automatically adjusted to maintain 30-50% of the saturated oxygen concentration at atmospheric pressure using pure oxygen, and an aqueous 7.5% (w / v) sodium bicarbonate solution as needed. Was used to maintain the pH of the culture to 6.9 or more. Transduction was performed two days after inoculation, when the cell concentration reached a concentration of 5-6 × 10 ⁵ cells / ml. Plasmids to be used for transduction were prepared according to the scale-up protocol based on the culture volume and transduced directly in a bioreactor ( in situ ). pAAV-hrGFP and pDG helper plasmids were transduced with HEK 293 cell line and pTR-UF6 and pDG helper plasmids were transduced with HEK 293T cell line. Cultures were incubated for 48 hours after transduction, and culture samples were taken daily to analyze cell concentrations, fluorescence protein expressing cells, and titers of virus particles produced. After 48 hours of incubation, whole cells were obtained and stored at -70 ° C until the purification step was performed, and freeze-thaw methods from some samples (Snyder, O., Xiao, X. and Samulski, RJ, Current protocols in human The crude extracts were prepared using Genes.Unit 12.1 Vectors for gene therapy, John Wiley & Sons, New York, USA, 1996) and used for further purification and analysis of rAAV.

In all seven experiments, an average of 7.2 ± 1.5 × 10 ⁹ HEK 293 cells produced rAAV-GFP at 5.3 ± 0.9 × 10 ¹² PP and 2.3 ± 0.3 × 10 ¹⁰ IP concentrations. Then, on average 1.0 ± 0.4 × 10 ⁹ HEK 293T cells, rAAV-BFP particles were produced with 1.0 ± 0.3 × 10 ¹³ PP and 3.5 ± 1.6 × 10 ¹¹ IP, wherein the specific productivity of the rAAV-BFP particles per cell The average was 9,600 ± 3,129 PP and 345 ± 154 IP, and the average PP: IP ratio in the crude extract remained as low as 37 ± 19 (Table 3). The ratio indicates that a substantial portion of the virus particles produced are infectious particles, which indicates that highly infectious particles are produced by the production method of the present invention even in the crude extract without purification. Exceptionally, in Run GT05 of Table 3, the rAAV yield was about 3 to 5 times lower than the average, especially the IP yield was much lower. The transduction in the Run GT05 was performed one day after inoculation of the cells, and the inventors observed that the cell growth after transduction was drastically reduced, and this influenced the decrease in virus yield. Therefore, it was concluded that after the start of cell culture, the culture was maintained until the cells reached the maximum growth phase and transduced was suitable for improving rAAV productivity. In addition, overall bioreactor studies showed that HEK 293T cells were able to produce rAAV with a much higher infectious titer than HEK 293 cells, although the culture and transduction methods were different.

Comparison of rAAV Production Yields According to Transduction of Each rAAV Expression Vector in 2 L Bioreactor Suspension Cultures Run ^* rAAV expression vector Helper Plasmid Cell line Cell number (× 10 ⁸ ) PP ^† (× 10 ¹² ) IP ^‡ (× 10 ¹⁰ ) PP / IP PP / cell IP / cell GT02 pAAV-hrGFP pDG HEK 293 61.5 5.91 2.04 290 961 3 GT03 pAAV-hrGFP pDG HEK 293 83 4.66 2.52 185 561 3 Average 72.25 5.29 2.28 238 761 3 GT04 ^§ pTR-UF6 pDG HEK 293T 9.7 10.91 31.3 35 11257 321 GT05 pTR-UF6 pDG HEK 293T 9.75 6.09 9.27 66 6246 95 GT06 pTR-UF6 pDG HEK 293T 9.85 6.9 48 14 7005 487 GT07 pTR-UF6 pDG HEK 293T 9.85 9.65 36.6 37 9601 372 GT08 pTR-UF6 pDG HEK 293T 10.58 14.7 47.8 31 13894 452 Average 9.95 9.65 34.56 37 9600 345

In Table 3 (*), the culture volume is 2435 ± 21 ml for GT02 and GT03, 2038 ± 226 ml for GT05 to GT08, 3500 ml for GT04, and PP of rAAV in (†) PRATV ELISA (Progen, Germany) was quantified, the rAAV's IP in (‡) was quantified by the ICA method, and the results from the 3.5 L scale in (§) were normalized to the 2 L scale.

Example 8 Purification and Identification of rAAV

Example 8-1 Purification of rAAV

rAAV contained in crude extracts of cells transduced with rAAV expression vectors and helper plasmids was purified by iodixanol-gradient ultracentrifugation (Zolotukhin, S. et al. , Gene Ther . , 6: 973-985, 1999). Half of the crude extract containing rAAV 9.66 × 10 ¹¹ PP or 1.2 × 10 9 IP obtained from transduction in 1 L spinner flask culture was used for the purification of rAAV.

As a result, it was possible to purify the rAAV in the fraction of the 40% Iodixanol concentration gradient position, after obtaining the fraction, using anion exchange column chromatography (Biologic Duo-Flow Workstation system, Biorad, USA) as follows Purification: first dilute 20 ml of the iodixanol fraction containing rAAV in Buffer A (20 mM Tris, 15 mM NaCl, pH 8.5) at a ratio of 1: 1, then buffer A at a flow rate of 3-5 ml / The mixture was loaded into a 5 ml volume of HiTrap Q Sepharose ™ FF, Amersham Pharmacia, Sweden, equilibrated by injection into minutes. Elution of rAAV particles was performed using Buffer A with NaCl injected such that the concentration of NaCl was increased in a linear gradient in the range of 15-500 mM concentration (FIG. 9A).

The chromatography showed three peaks in fractions 33-38, which were found to contain rAAV particles.

Example 8-2 Confirmation of Purified rAAV

Western blot analysis and silver staining analysis were performed to confirm that the rAAV purified in Example 8-1 is actually rAAV.

Example 8-2-1 Western blot analysis

Western blot analysis methods were performed as follows: Transduced crude extracts or purified fractions were separated by SDS-PAGE on 4-20% Tris-glycine gel (Invitrogen, USA), and the electrophoresis gels were separated by PVDF membrane ( BioRad, USA) for the electrical delivery and adsorption. Polyclonal rabbit anti-AAV2 capsid antibodies (Progen, Germany) were used as primary antibodies to detect AAV2 capsid proteins. Signals induced by the secondary antibody anti-rabbit HRP-binding antibody (KPL, USA) were detected using a chemiluminescent substrate (SuperSignal® West Pico chemiluminescent substrate, Pierce, USA) (FIG. 9B).

As shown in FIG. 9B, in 33-38 fractions eluted using Buffer A with 0.22-0.26 M NaCl via Western blot analysis performed with anti-AAV rabbit polyclonal antibody (Progen, Germany), Three capsid proteins of AAV were identified, VP-1, VP-2 and VP-3.

<Example 8-2-2> Silver staining analysis

In order to confirm that the rAAV was purified with high purity according to the purification method of Example 8-1, silver staining analysis of fractions found to contain rAAV by Western blot analysis was performed as follows: 5 minutes of each fraction 1 was taken into a concentrated filtration device (CentriPLUS YM-100, Millipore, USA), concentrated by centrifugation at 3000 rpm for 30 minutes in a small centrifuge (Eppendorf, Germany), and each virus sample was concentrated in 5 × sample buffer. Diluted to a final volume of 20 μl, heated for 5 minutes and then loaded onto 4-12% Tris-glycine gel (Invitrogen, USA). The loaded samples were electrophoresed at 120 V for 3 hours and visualized using a SilverQuest silver staining kit (Invitrogen, USA) (FIG. 9C).

As shown in Fig. 9c, in fractions 33 and 34, only three characteristic AAV-specific bands appeared in the same position as the Western blot analysis of Example 8-2-1, so that only the pure rAAV was purified and obtained. It can be seen that the fraction. These fractions were identified to have rAAV 4.1 × 10 ¹¹ PP or 3.8 × 10 ⁹ IP, indicating that the overall recovery of rAAV was 43% and 32% for each PP and IP.

Example 9 Purification of rAAV Using Two-Step Chromatography

Example 9-1 Two-Step Chromatography Using Cation Exchange Resin and Affinity Resin

For the purification of higher purity rAAV, two steps of chromatography were carried out as follows: First, a 1.7 ml volume CM Sepharose FF column (Amersham Pharmacia, Uppsala, Sweden), a cation-exchange resin column, was subjected to Buffer A ( 50 mM acetic acid, 15 mM NaCl, pH 5.0), and from Run GT08 in Table 3 above, 3 ml / of total crude extract 1/12 containing rAAV 1.2 × 10 ¹² PP or 4.0 × 10 ¹⁰ IP. The equilibrated CM Sepharose FF column was loaded at a flow rate of minutes. Purification of the rAAV particles was carried out using Buffer A containing NaCl, in which the concentration of NaCl was increased in a linear gradient in the range of 15 to 500 mM, whereby fractions of 1.5 mL each could be obtained (FIG. 10A). ). Fractions containing rAAV were confirmed by performing Western blot analysis in the same manner as in Example 8-2-1.

The second chromatography step was then carried out as follows: Fractions containing rAAV eluted from the first column were collected by Centriplus YM-100 centrifugal filter (Millipore, USA) and centrifuged (Union 32R, Hanil). , Korea) were centrifuged at 4 ° C. for 20 minutes at 2,000 rpm. Concentrated samples were diluted 1: 1 in Buffer A and 3 ml / in a 1.7 ml volume of POROS ^® 50 HE column (Applied Biosystems, USA) equilibrated with 12 mM PBS-MK buffer (pH 7.4). Load at flow rate of minutes. rAAV was eluted by injecting NaCl with a linear concentration gradient of 0 to 50 mM, through which 1.5 mL fractions of each could be obtained (FIG. 10B). Whether rAAV was contained in the separated fractions was confirmed by Western blot analysis using the same method as in Example 8-2-1, and the fractions were analyzed using the same method as in Example 8-2-2. Purification purity was confirmed by silver staining (FIGS. 10C and 10D).

As shown in FIG. 10C, Western blot analysis using anti-AAV rabbit polyclonal antibody (Progen, Germany) was able to detect the three capsid proteins VP1, VP2 and VP3 of AAV in fractions 26-29. In addition, as shown in FIG. 10D, only three characteristic AAV-specific bands appeared in fractions 25 to 30 through silver-stained gel electrophoresis, confirming that the fractions are pure rAAV only purified-obtained fractions. Could. These fractions were found to contain rAAV 3.4 × 10 ¹¹ PP or 1.3 × 10 ¹⁰ IP, indicating that the overall recovery of rAAV was 35% and 40% for each PP and IP.

Example 9-2 Purification of rAAV by Cation Exchange Chromatography followed by Two Step Chromatography of Anion Exchange Chromatography

The present inventors performed the purification step using the cation exchange chromatography and the anion exchange chromatography sequentially in order to produce higher purity rAAV. That is, cation and anion exchange chromatography were used in order to adjust pH and salt concentration, remove impurities and produce pure rAAV. At this time, all chromatography was performed using a biological workstation (Biologic Workstaion, Bio-Rad, USA) FPLC device.

Example 9-2-1 Pretreatment Step of Sample

The 293T cells obtained in Example 7 were subjected to basic freeze-thaw methods (Snyder, O., Xiao, X. and Samulski, RJ, Current protocols in human genetics.Unit 12.1 Vectors for gene therapy, John Wiley & Sons, New York) , USA, 1996) to prepare a crude extract (crude lysate). Benzonase (Novagen, USA) was added to the crude extract at a final concentration of 50 U / ml and reacted at 37 ° C. for 30 minutes, centrifuged at 4,000 g for 20 minutes, and a supernatant containing rAAV was obtained to obtain 0.22 μm. Filtration with PVDF syringe filter (MILLEX-GV, Millipore, USA).

Example 9-2-2 Cation Chromatography Step

Fill the empty column (2.6 mm x 20 mm, resin volume 10 ml) with CM Sepharose FF (Amersham Bioscience, Sweden), a weak carboxymethyl cation exchange resin, to pH 5 containing 15 mM NaCl. Equilibrate with 50 mM acetic acid equilibration buffer. The rAAV crude extract obtained in Example 9-2-1 was diluted with 2 times equilibrium buffer solution and injected into the equilibrated column, and then the equilibration buffer solution containing 120 mM NaCl was washed with 5 times column volume. The equilibration buffer solution and the elution buffer solution containing 1 M NaCl were mixed under linear concentration conditions (120 mM to 1 M section, flow rate 7 ml / min) to elute with a 25-fold column volume to obtain an eluate containing rAAV. 11a). RAAV isolated in each fraction was confirmed by Western blot analysis.

Example 9-2-3 Anion Chromatography Step

The rAAV crude purified fractions obtained by the cation exchange chromatography were collected and purified by anion exchange chromatography as follows: Strong anion exchange resin having a tetravalent ammonium as an anion exchange resin column. Phosphorus Source 15Q (Amersham Biosciences) was used. The resin was filled into an empty column (2.6 mm × 10 mm, resin volume 5 ml) and equilibrated with 20 mM Tris-HCl / 2 mM MgCl 2/1 mM CaCl 2 equilibration buffer at pH 8.0 with 15 mM NaCl. Then, the crude liquid obtained by the cation chromatography was concentrated using a CentriPLUS YM-100 concentrator (Millipore, USA), diluted with 4 times equilibration buffer, injected into a column, and the equilibration buffer was added to 15 Washed with column column volume. Subsequently, the equilibration buffer solution and the elution buffer solution containing 1 M NaCl were mixed under linear concentration conditions (15 mM to 1 M section, flow rate 5 ml / min), eluted to a 35-fold column volume, and containing pure rAAV. Were obtained (FIG. 11B). It was confirmed by Western blot analysis whether rAAV contained in the separated fractions, and the fractions were silver stained to confirm the purification purity (FIGS. 11C and 11D).

As shown in FIGS. 11C and 11D, three capsid proteins VP1, VP2 and VP3 of AAV could be detected in fractions 13-17, and the silver-stained gel electrophoresis revealed three characteristic AAV specifics in the fraction. As only the band appeared, it could be confirmed that the fractions were purified-obtained fractions only pure rAAV. Meanwhile, the final yield quantified by ELISA and ICA analysis was 32%.

Therefore, the experiments were able to produce up to 10 ¹³ rAAV particles from the rAAV expression vector through a simple transduction process in suspension culture, in particular, it was confirmed that can produce up to 10 ¹¹ infectious particles even in 2 L scale culture. It was. Through these results, a large amount of rAAV can be produced by suspending culture using a large-scale bioreactor, followed by transduction, and it can be seen that the rAAV production method using suspension culture cells of the present invention is a very useful method.

As described above, the present invention relates to a method for mass production of rAAV by transducing the transduced cells with a large-scale bioreactor by transducing the rAAV expression vector to the suspension cultured cells. The method of the present invention can solve the difficulty of increasing the scale of production in the production of rAAV using conventional adherent culture cells, and can be usefully used in the rAAV production industry widely used for gene therapy.

Attach sequence list electronic file  

Claims (19)

(1) converting adherent cells selected from the group consisting of HEK 293 cells, HEK 293 T cells, 293E cells, CHO cells, Naut cells and HeLa cells to suspension culture cells; (2) transducing the adeno-associated virus (rAAV) expression vector and the helper vector simultaneously using polyethyleneimine (PEI) to the suspension cultured cells prepared in step (1); (3) suspending the transduced cells in step (2); (4) lysing the cells cultured in step (3) to prepare a lysate; And (5) A method for mass production of recombinant adeno-associated virus, comprising purifying the recombinant adeno-associated virus particles from the lysate of step (4) by chromatography using an ion exchange resin. delete The method of claim 1, wherein step (1) is performed by culturing the cells in a hydrogel coated culture plate. delete delete delete The method of claim 1, wherein the helper vector is a helper plasmid or helper virus. 8. The method of claim 7, wherein the helper plasmid is pDG or a combination of pAAV-RC and pHelper. 8. The method of claim 7, wherein the helper virus is adenovirus, vaccinia virus or herpes simplex virus (HSV). 2. The pAAV-FIX of SEQ ID NO: 2B or SEQ ID NO: 2B according to claim 1, wherein the recombinant adeno-associated virus expression vector of step (2) comprises the coding region of human coagulation factor IX as set forth in SEQ ID NO: 1. A method for mass production of recombinant adeno-associated virus, characterized in that it is pAAV-FIX-UTR of FIG. 2C comprising a non-translated and coding region of human coagulation factor 9 described in 4. The pAAV of FIG. 2D according to claim 1, wherein the recombinant adeno-associated virus expression vector of step (2) comprises a gene encoding Kringle 8 (LK8) of human apolipoprotein (a) as set forth in SEQ ID NO: 7 Mass-producing recombinant adeno-associated virus, characterized in that it is pAAV-LK68 of FIG. 2E which contains a gene encoding Kringle 68 (LK68) of human apolipoprotein (a) described by -LK8 or SEQ ID NO: 8 Way. 2. The method of claim 1, wherein the suspension culture of step (3) is carried out in a bioreactor having a culture size of 0.1 to 1,000 L. The method of mass production of recombinant adeno-associated virus according to claim 1, wherein step (5) is performed by chromatography using an ion exchange resin. The method of claim 1, wherein step (5) is performed by two-step chromatography using a combination of a cation exchange resin and an anion exchange resin. 15. The method for mass production of recombinant adeno-associated virus according to claim 14, wherein the two-step chromatography is performed by treating the recombinant adeno-associated virus crude extract fraction obtained by treatment with a cation exchange resin with an anion exchange resin. . 15. The method of mass production of recombinant adeno-associated virus according to claim 14, wherein the two-step chromatography is performed by treating the recombinant adeno-associated virus crude extract fraction obtained by treatment with an anion exchange resin with a cation exchange resin. . 15. The method of claim 14, wherein the ion exchange resin is selected from the group consisting of carboxy methyl, methylsulfonate and quaternary ammonium. The method of claim 1, wherein in step (5) the recombinant adeno-associated virus particles are purified by two-step chromatography in which the recombinant adeno-associated virus crude extract fraction obtained by treating the cation exchange resin is treated with an affinity resin. A method for mass production of recombinant adeno-associated viruses, characterized in. 19. The recombinant adeno-associated virus as claimed in claim 18, wherein the affinity resin comprises an adeno-associated virus binding material selected from the group consisting of antibodies specific for adeno-associated virus or adeno-associated virus receptors. How to Produce Amount.

Images