CN115851837A

CN115851837A - Method for improving production of adeno-associated virus by baculovirus system and application

Info

Publication number: CN115851837A
Application number: CN202210087849.1A
Authority: CN
Inventors: 李华鹏; 陈君霖; 钟育健
Original assignee: Guangzhou Packgene Biotech Co ltd
Current assignee: Guangzhou Packgene Biotech Co ltd
Priority date: 2022-01-25
Filing date: 2022-01-25
Publication date: 2023-03-28
Also published as: WO2023143063A1

Abstract

Methods and uses for enhancing the production of adeno-associated virus by a baculovirus system are disclosed. The recombinant baculovirus vector comprises an AAV capsid protein gene expression box (Cap), an AAV Rep gene expression box (Rep) and an AD sequence (AD) of an adeno-associated virus Inverted Terminal Repeat (ITR), wherein the AD sequence of the ITR can be positioned behind the Rep gene expression box, or between the Rep gene expression box and the Cap gene expression box and behind the Cap gene expression box. The production levels of baculovirus and AAV in insect cells harboring recombinant baculovirus comprising Cap, rep and AD sequences are higher compared to controls comprising Cap and Rep but no AD sequences. The method is applied to preparing the recombinant adeno-associated virus, and has strong universality and high efficiency.

Description

Method for improving production of adeno-associated virus by baculovirus system and application

Technical Field

The present invention relates to baculovirus expression vectors, in particular baculovirus expression vectors with adeno-associated virus AD sequences. The invention also relates to application of the baculovirus expression vector in preparing recombinant adeno-associated virus.

Background

Adeno-associated virus (AAV) vectors are reliable tools for gene transfer in vitro and in vivo. The targeting property is good, the safety is high, the transduction capability is strong, and the gene targeting gene is widely used in a plurality of gene therapy clinical tests. Including familial lipoprotein lipase deficiency, hemophilia, ophthalmology and muscle and spinal cord genetic diseases, are reported in clinical research.

The difficulty of large-scale culture of adeno-associated virus, which results in expensive drug price, is one of the major obstacles limiting clinical application. Currently, the adeno-associated virus production system mainly comprises an HEK293 cell system, an insect cell baculovirus system and a herpes virus system. The HEK293 system package can be used for wall-mounted culture and suspension culture, and also comprises a two-plasmid or three-plasmid transfection mode. The production cycle is short, but the aspects related to plasmids, cells and the like are complex, so that large-scale culture is difficult to carry out in the actual production process, and the price is high. The herpes virus system produces adeno-associated virus, and the process may have allergic herpes virus, and the safety of the allergic herpes virus has certain potential risks. The insect cell baculovirus system has the advantages of high cell density, large-scale culture, high safety and the like, is considered to be one of the technical barrier breakthrough potential to overcome the difficulty of large scale culture of adeno-associated viruses. Optimization to improve the efficiency of baculovirus system-mediated production of adeno-associated virus is the key work of scientists.

The Inverted Terminal Repeat (ITR) of adeno-associated virus comprises 145 nucleotides and is divided into four components, namely A, B, C and D. Wherein 125 nucleotides in three parts of A-A ', B-B ', C-C ' formbase:Sub>A T-shaped palindromic hairpin structure, asbase:Sub>A viral DNA replication primer to initiate adeno-associated virus replication. The A sequence contains an RBE (REP binding element) structure and is a REP protein recognition binding site ¹ . B. The C sequence acts as a hairpin arm, once mutated or deleted, the AAV packageThe packing capacity is obviously reduced ² . The D sequence is independent of the T-type hairpin structure, and has long gene length for adeno-associated virus packaging gene, the ability of the virus to replicate DNA and infect is of critical importance ^3-4 . The AD sequence also contains a transcription initiation signal (A sequence 88to 95, sequence 126to 133) can initiate gene transcription as a promoter ⁵ . George Aslanidi et al, by homologous recombination of sequences (HR) with RBE elements by baculovirus, proposed immediate early trans-regulatory factor 1 (IE-1) induced binding of HR elements by baculovirus, the Rep and Cap gene expression is enhanced, and the accumulated Rep protein is combined with RBE elements, so that the accumulation of the Rep protein is further promoted ⁶ . The use of AD sequences however facilitates baculovirus packaging, and the effect of AD sequences on the efficiency of adeno-associated virus produced by the baculovirus system has not been reported.

Disclosure of Invention

In one aspect, provided herein is an isolated nucleic acid molecule comprising:

1) Adeno-associated virus (AAV) replication gene (Rep) expression cassettes and/or an AAV capsid protein gene (Cap) expression cassette; and

2) An AD sequence from an AAV Inverted Terminal Repeat (ITR) or a functional variant thereof.

In some embodiments, the AD sequence or functional variant thereof is located within or no more than 5kb from the Rep expression cassette.

In some embodiments, the AD sequence or functional variant thereof is located within or no more than 5kb from the Cap expression cassette.

In some embodiments, the nucleic acid molecule comprises: 1) The AD sequence or functional variant thereof is located within the Rep expression cassette and is no more than 5kb from the Cap expression cassette; 2) The AD sequence or functional variant thereof is located within the Cap expression cassette and is no more than 5kb from the Rep expression cassette; or 3) the AD sequence or functional variant thereof is located outside of the Rep expression cassette and the Cap expression cassette and is no more than 5kb from both the Rep expression cassette and the Cap expression cassette.

In some embodiments, the AD sequence or functional variant thereof is located within the Rep expression cassette and after a stop codon, and/or the AD sequence or functional variant thereof is located within the Cap expression cassette and after a stop codon.

In some embodiments, the Rep expression cassette and the Cap expression cassette are transcribed in different directions, and the AD sequence or functional variant thereof is located between the promoter of the Rep expression cassette and the promoter of the Cap expression cassette.

In some embodiments, the promoter of the Rep expression cassette and/or the Cap expression cassette is an insect cell promoter

In some embodiments, the promoters of said Rep expression cassette and said Cap expression cassette are independently selected from the group consisting of P10 and Polh promoters, respectively.

In some embodiments, the AD sequence comprises the nucleotide sequence set forth in SEQ ID NO: 56.

In some embodiments, the functional variant of the AD sequence comprises a nucleotide sequence that has at least 60%, 70%, 80%, or 90% sequence identity to the nucleotide sequence set forth in SEQ ID No. 56 and, when the nucleic acid molecule is introduced into a suitable host cell, is capable of increasing the amount of expression of the AAV replication gene (Rep) expression cassette and/or the AAV capsid protein gene (Cap) expression cassette in the host cell.

In some embodiments, the Rep expression cassette is used to transcribe and express Rep78/Rep68 and Rep52/Rep40 proteins.

In some embodiments, the Cap expression cassette is used to transcribe and express VP1 and VP2/VP3 proteins.

In some embodiments, the Rep expression cassette and/or the Cap expression cassette comprise an intron sequence comprising a promoter sequence.

In some embodiments, the intron sequence comprises the promoter that is a polh promoter.

In some embodiments, the intron sequence comprises the nucleotide sequence set forth in SEQ ID NO. 57 or a functional variant thereof.

In some embodiments, the intron sequence is positioned between Rep-encoding nucleotide sequences 530 and 531 in the Rep expression cassette to drive transcription of the Rep52/Rep40 subunit coding sequences.

In some embodiments, the intron sequences are positioned between Cap-encoding nucleotide sequences 25 and 26 in the Rep expression cassette to drive transcription of VP2 and VP3 subunit-encoding sequences.

In another aspect, provided herein is an expression vector comprising the nucleic acid molecule described above.

In some embodiments, the expression vector is a pfastbactmdial backbone.

In some embodiments, the expression vector is a baculovirus expression vector.

In some embodiments, the baculovirus vector is prepared by a Bac-to-BacTM baculovirus expression system.

In some embodiments, the expression vector further comprises an additional expression cassette.

In some embodiments, the additional expression cassette comprises, from 5 'to 3':

1) ITR of AAV;

2) A promoter;

3) A gene of interest operably linked to the promoter;

4) A polyadenylation signal; and

5) ITR of AAV.

In some embodiments, the promoter in the additional expression cassette is a mammalian cell promoter.

In some embodiments, the gene of interest comprises a protein or RNA coding sequence.

In another aspect, provided herein is a host cell comprising the above-described nucleic acid molecule or expression vector.

In some embodiments, the nucleic acid molecule is integrated in the genome of the host cell.

In some embodiments, the host cell is an insect cell.

In some embodiments, the host cell is an insect cell SF9, SF21, or high five.

In another aspect, provided herein is a baculovirus expression vector combination comprising

1) A first baculovirus expression vector comprising the nucleic acid molecule described above, wherein the nucleic acid molecule comprises said Rep expression cassette and said Cap expression cassette; and

2) A second baculovirus expression vector comprising a gene of interest expression cassette and ITRs of AAV flanking said gene of interest expression cassette.

1) A first baculovirus expression vector comprising the nucleic acid molecule described above, wherein the nucleic acid molecule comprises the Rep expression cassette and does not comprise the Cap expression cassette;

2) A second baculovirus expression vector comprising the nucleic acid molecule described above, wherein the nucleic acid molecule comprises the Cap expression cassette and does not comprise the Rep expression cassette;

3) A third baculovirus expression vector comprising a gene of interest expression cassette and ITRs of AAV flanking said gene of interest expression cassette.

On the other hand, in the case of a liquid, provided herein are host cells comprising the above-described combinations of baculovirus expression vectors.

In another aspect, provided herein is a host cell comprising

1) The above-described nucleic acid molecule integrated into the genome of the host cell; and

2) An expression vector comprising a gene expression cassette of interest and ITRs of AAV flanking the gene expression cassette of interest.

In another aspect, provided herein are methods of producing rAAV, comprising

1) Culturing insect cells comprising the above baculovirus expression vector combination in a culture medium;

2) Recovering the rAAV from the culture medium and/or the insect cell.

In another aspect, provided herein is a method of producing a rAAV in an insect cell, comprising:

1) Co-infecting said host cell with a first baculovirus and a second baculovirus, wherein said first baculovirus comprises the nucleic acid molecule described above, wherein the nucleic acid molecule comprises said Rep expression cassette and said Cap expression cassette; the second baculovirus comprises a target gene expression cassette and ITRs of AAV positioned at two sides of the target gene expression cassette;

2) Culturing the insect cell in a culture medium; and

3) Recovering the rAAV from the culture medium and/or the insect cell.

1) Co-infecting said host cell with a first baculovirus, a second baculovirus and a third baculovirus, wherein said first baculovirus comprises the nucleic acid molecule described above, wherein the nucleic acid molecule comprises said Rep expression cassette and does not comprise said Cap expression cassette; a second baculovirus comprises the nucleic acid molecule described above, wherein the nucleic acid molecule comprises the Cap expression cassette and does not comprise the Rep expression cassette; the third baculovirus comprises a target gene expression cassette and ITRs of AAV positioned at two sides of the target gene expression cassette;

2) Culturing the insect cell in a culture medium; and

3) Recovering the rAAV from the culture medium and/or the insect cell.

In another aspect, provided herein is a method of producing AAV in an insect cell, comprising:

1) Integrating the nucleic acid molecule into the genome of said insect line, wherein the nucleic acid molecule comprises said Rep expression cassette and said Cap expression cassette;

2) Infecting the insect cells with a baculovirus vector comprising a gene expression cassette of interest and ITRs of AAV flanking the gene expression cassette of interest;

3) Culturing the insect cell in a culture medium; and

4) Recovering the rAAV from the culture medium and/or the insect cell.

In some embodiments, the serotype of the AAV or rAAV described above is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.

Provided herein are methods for increasing the production of adeno-associated virus by a baculovirus system, by combining the AD sequences with different positions of Rep and Cap, significantly increasing the titer of baculovirus, and the efficiency of baculovirus production of adeno-associated virus. The generation times of the baculovirus in the actual production process are reduced, the defects of poor genetic stability and the like caused by long library building time and high generation number of a baculovirus seed library are overcome, and the period of producing the adeno-associated virus by a baculovirus system is shortened.

Drawings

Fig. 1 shows a map of an expression vector containing AD sequences designed in example 1, which comprises the AD sequences, rep expression cassettes and Cap expression cassettes in 5 'to 3' order.

Fig. 2 shows a map of an expression vector containing AD sequences designed in example 2, which comprises the Rep expression cassette, AD sequences and Cap expression cassette in 5 'to 3' order.

Fig. 3 shows a map of an expression vector containing AD sequences designed in example 3, which comprises the Rep expression cassette, the Cap expression cassette, and the AD sequences in 5 'to 3' order.

FIG. 4 shows the effect of different combinations of AD sequences, rep expression cassettes, and Cap expression cassette positions on baculovirus packaging titers in example 4.

FIG. 5 shows the effect of different combinations of AD sequences, rep expression cassettes and Cap expression cassette positions on the yield of adeno-associated virus produced by baculovirus in example 5.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

"and/or" means that either or both of the preceding and following elements are present. For example, "X and/or Y" should be understood to mean "X", "Y" or "X and Y".

As used herein, the terms "nucleic acid molecule," "nucleic acid," and "polynucleotide" are used interchangeably to refer to a polymer of nucleotides. Such nucleotide polymers may contain natural and/or non-natural nucleotides and include, but are not limited to, DNA, RNA, and PNA. "nucleic acid sequence" refers to a linear sequence of nucleotides contained in a nucleic acid molecule or polynucleotide. An "isolated nucleic acid molecule" refers to a nucleic acid molecule that is free from its natural environment in which it is found (e.g., the intracellular environment), substantially free of one or more substances with which it is normally associated in nature, e.g., proteins, nucleic acids, lipids, carbohydrates, cell membranes, etc., or that is artificially prepared (e.g., synthesized).

An "adeno-associated virus (AAV)" is a non-enveloped icosahedral capsid virus of the parvoviridae family, comprising a single-stranded DNA viral genome. The parvoviridae family includes the dependoviruses, which include AAV, which rely on the presence of helper viruses, such as adenovirus, for their replication. Due to its relatively simple structure, ability to infect a variety of cells (including quiescent and dividing cells) without integration into the host genome, and its relatively mild immunogenic characteristics, AAV has been demonstrated to be useful as a biological tool. Also contemplated herein are AAV-based expression vectors, including recombinant AAV (rAAV) bearing the gene of interest for therapeutic purposes.

The wild-type AAV viral genome is a linear, single-stranded DNA (ssDNA) molecule, about 5,000 nucleotides (nt) in length. Inverted Terminal Repeats (ITRs) typically terminate the viral genome at the 5 'and 3' ends, providing an origin of replication for the viral genome. AAV viral genomes typically include two ITR sequences. These ITRs have a characteristic T-hairpin structure. The double-stranded hairpin structure includes a variety of functions, including but not limited to serving as an origin of DNA replication by serving as a primer for the endogenous DNA polymerase complex of the host virus replicating cell.

The wild-type AAV viral genome further comprises nucleotide sequences of two open reading frames, one being four non-structural Rep proteins (Rep 78, rep68, rep52, rep40, encoded by the Rep gene) and the other being three capsid or structural proteins (VP 1, VP2, VP3, encoded by the capsid gene or the Cap gene). The Rep proteins are important for replication and packaging, while the capsid proteins assemble to form the protein coat of the AAV or the AAV capsid. Alternating splicing and alternating start codons and promoters result in the production of four different Rep proteins from a single open reading frame, and three capsid proteins from a single open reading frame.

The term "viral capsid protein" or "capsid protein" as used in reference to AAV refers to a protein of AAV that is capable of self-assembly to produce AAV particles, also known as the coat protein or VP protein. It consists of three subunits, VP1, VP2 and VP3, which are usually expressed from a single nucleic acid molecule and interact together to form an icosahedral symmetric capsid.

The term "serotype" as used in reference to an AAV is intended to refer to the difference in the capsid proteins of the AAV that are serologically distinct from other AAV serotypes. The serological uniqueness is determined by the reactivity of an antibody with one AAV and the lack of cross-reactivity with other or another AAV. This cross-reactivity difference is typically due to differences in capsid protein sequences/epitopes (e.g., due to differences in VP1, VP2, and/or VP3 sequences of AAV serotypes).

"recombinant AAV vector (rAAV)" refers to an AAV genome derived by removing portions of wild-type genes (e.g., rep and Cap genes) from the AAV genome using molecular biological methods, and replacing with a heterologous nucleic acid sequence (e.g., a coding sequence for a protein or RNA for therapeutic purposes). Typically, for rAAV vectors, one or both Inverted Terminal Repeat (ITR) sequences of the AAV genome are retained. In most cases, rAAV is replication-defective and lacks sequences encoding functional Rep and Cap proteins in its viral genome. These replication-defective AAV particles may lack most of the parental coding sequences and carry essentially only one or two AAV ITR sequences and the target nucleic acid for delivery to a cell, tissue, organ or organism.

The term "expression cassette" refers to a nucleic acid sequence that, under appropriate expression conditions (e.g., intracellular conditions), allows transcription of a coding sequence (e.g., a protein coding sequence or an RNA coding sequence) therein, and optionally further translation (e.g., the product is a protein). An expression cassette typically includes a transcriptional regulatory sequence (e.g., promoter, enhancer), a coding sequence operably linked to the transcriptional regulatory sequence, and a polyadenylation signal (or transcription termination signal), where the transcriptional regulatory sequence is typically located upstream of the coding sequence. In addition, the expression cassette will typically also include a 5 'untranslated region (5' -UTR) or a 3 'untranslated region (3' -UTR).

The term "promoter" or "promoter sequence" refers to a DNA sequence involved in the recognition and binding of DNA-dependent RNA polymerase and other proteins (trans-acting transcription factors) to initiate and control the transcription of one or more coding sequences. It is usually located upstream (i.e., 5' to) the transcription start site and includes some conserved sequences, such as the TATA box, etc. In some examples herein, some promoters are used to initiate transcription of the Rep expression cassette and the Cap expression cassette in insect cells. These include the P10 promoter or polh promoter (otherwise known as the PH promoter).

The term "enhancer" or "enhancer sequence" refers to a DNA sequence on an expression vector that enhances the transcriptional activity of a promoter. Enhancer transcription enhancing activity is generally non-directional (i.e., may be located upstream, downstream, or even within the gene encoding the protein of interest), and in some cases may function remotely (e.g., several Kb from the transcription start site).

The term "operably linked" refers to a linkage that has a functional relationship between polynucleotide elements. A nucleic acid or polynucleotide sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a transcriptional regulatory sequence, such as a promoter, enhancer, or other expression control element known in the art, will be operably linked to a coding sequence if it affects the transcription of the coding sequence.

The term "Polyadenylation signal" refers to a mechanism by which the transcription process is terminated and a poly-A tail is added to the 3' end of the mRNA that is produced by transcription. The tailing process is catalyzed by polyadenylate polymerase to form mature mRNA. Accordingly, the sequence on the expression cassette associated with this polyadenylation is referred to as the "polyadenylation signal sequence" or "PolyA signal region (PolyA signal)".

The term "Untranslated Region (UTR)" refers to a segment located on the mRNA at both ends of the coding Region that is not translated into protein. Wherein the segment of the mRNA located upstream of the coding region is referred to as the 5 'untranslated region (5' -UTR) and the segment located downstream of the coding region is referred to as the 3 'untranslated region (3' -UTR). The untranslated regions can regulate gene expression at the gene transcription and post-transcriptional translation levels, e.g., the 5 'untranslated region can affect the transcriptional efficiency, stability, and nuclear transport of the gene's mRNA, leading to altered protein expression levels; the 3' untranslated region mainly affects the stability and translation efficiency of mRNA. For convenience of explanation, a DNA fragment corresponding to the above-mentioned untranslated region in an expression vector or a gene sequence is also referred to as a 5 '-untranslated region (5' -UTR) or a 3 '-untranslated region (3' -UTR).

The term "expression vector" refers to a nucleic acid molecule that contains various expression elements for expressing a protein of interest or an RNA of interest in a host cell. For expression vectors used to express a protein of interest in eukaryotic cells, these expression elements typically include promoters, enhancers, polyadenylation signal sequences, and the like. For ease of amplification in E.coli, the expression vector will typically also include an E.coli replicon sequence. In addition, the expression vector may further include an antibiotic resistance gene or a selection marker gene for selection (e.g., ampicillin resistance gene (AmpR), thymidine kinase gene (TK), kanamycin resistance gene (KanR), neomycin resistance gene (NeoR), etc.) and a Multiple Cloning Site (MCS) for insertion of a gene of interest. In some embodiments of the invention, the expression vector is a baculovirus expression vector or a rAAV expression vector.

Baculovirus is a double-stranded DNA virus that specifically infects arthropods, and Autographa californica nuclear polyhedrosis virus (AcMNPV) is a model species of baculovirus. Since Smith GE expressed human interferon-beta gene in insect cell by baculovirus for the first time in 1983, baculovirus expression vector has been widely used in scientific research and production due to its advantages of low cost, high yield, various post-translational modification systems, etc. When the baculovirus genome is used as an expression vector, the target gene can be placed under the control of a baculovirus overexpression promoter, so that the target gene is overexpressed at the end of infection. When baculovirus infects insect cells, two proteins can be overexpressed in the very late stages of infection: polyhedrin and p10 protein. They are not essential for replication of the virus in cultured cells in vitro, so that the promoters of both genes can be used to drive expression of the gene of interest, allowing high levels of production of the desired protein at the end of infection. In general, when baculovirus genomes are used as expression vectors, unnecessary sequences in the genomes may be removed in order to accommodate more foreign genes or increase the expression amount of target proteins. Advantages of baculovirus expression vectors include: the genetic background of the virus is clear; the gene capacity is large, and a large target gene can be borne; the biological safety is good, and the human body cannot be infected under the natural condition; glycosylation modification can be performed on the expressed protein, and the like. The baculovirus is an excellent protein expression vector, and is especially suitable for large-scale production of active proteins of enzymes, medicaments and the like in bioengineering.

The term "AD sequence" refers to the a and D sequences of an ITR from AAV that are linked to each other. In one embodiment, the AD sequence is set forth in SEQ ID NO 56.

SEQ ID NO:56：gcctcagtgagcgagcgagcgcgcagagagggagtggccaactccatcactaggggttcct。

A "functional variant" of an AD sequence is one that substantially retains the ability of the AD sequence to facilitate the production of baculoviral vectors and rAAV but differs in nucleotide sequence from the sequence shown in SEQ ID NO: 56. In some embodiments, the functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotide substitutions, additions or deletions relative to the sequence shown in SEQ ID No. 56. In other embodiments, the functional variant has at least 60%, e.g., at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with respect to the sequence set forth in SEQ ID NO. 56. In some embodiments, the functional variant retains at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or even 100% of the function of the sequence shown in SEQ ID No. 56 with respect to the retention into a baculovirus vector and/or production of rAAV. Preferably, the functional variant retains at least 80%, 90% or even 100% of the function of the sequence shown in SEQ ID NO 56 with respect to the sequence shown in SEQ ID NO 56 in terms of retention in the baculovirus vector and/or production of rAAV. Those skilled in the art can obtain such functional variants by performing various substitutions, additions or deletions of the sequence shown in SEQ ID NO:56 and verifying the function of the obtained sequence.

In reference to the position of an AD sequence (or a functional variant thereof), "no more than 5kb from the expression cassette" means that the distance, expressed in number of nucleotides, between the terminal nucleotide of the AD sequence (or a functional variant thereof) and the terminal nucleotide of the expression cassette in the same nucleic acid molecule (linear or circular molecule) is no more than 5000 nucleotides, such as no more than 4000 nucleotides, no more than 3000 nucleotides, no more than 2000 nucleotides, or even no more than 1000 nucleotides. In some embodiments, the AD sequence (or functional variant thereof) is no more than 5kb from the nucleotides at the proximal ends of the expression cassette. When the AD sequence or functional variant thereof is inside the expression cassette, the distance between them is considered to be 0 nucleotides.

The term "stop codon" refers to a trinucleotide sequence that terminates peptide chain elongation during protein synthesis using mRNA as a template. Common stop codons are UAG, UAA and UGA, and the corresponding stop codon sequences on the coding DNA are TAG, TAA and TGA.

Reference to an AD sequence (or functional variant thereof) being "after" a stop codon means that the AD sequence (or functional variant thereof) is located downstream (i.e. in the 3' direction) of, and in particular downstream and immediately adjacent to, a stop codon (such as TAG, TAA or TGA) in the expression cassette in which it is located.

When an AD sequence (or functional variant thereof) "is located between" two promoters, it means that the two promoters are relatively close together (e.g., several tens to several hundreds of nucleotides apart) and are not separated by other functionally long sequences (e.g., other expression cassettes). In this case, the two promoters may be considered to be present "back-to-back" and drive transcription in different directions, e.g., pFastBac ^TM P10 promoter and Polh promoter in Dual vectorAnd (4) adding the active ingredients.

The term "host cell" refers to a cell in which an expression vector can be maintained and/or replicated, and includes prokaryotic and eukaryotic cells, such as bacteria (e.g., E.coli), fungi (yeast), insect cells, and mammalian cells. In the method of making rAAv provided herein, the host cell used is preferably an insect cell, such as an SF9, SF21 or high five cell line.

The term "intron" refers to a non-coding sequence of a gene sequence that can be transcribed but is spliced out during mRNA processing maturation so that its sequence is not present on the mature mRNA. Thus, in one expression cassette for the production of a protein of interest, the encoding DNA sequences may be separated by one or more introns, but all may be transcribed and translated into the same protein of interest.

The term "promoter-containing intron" means that the promoter contained in the intron can initiate transcription of a coding sequence downstream thereof, but does not substantially affect transcription of a coding sequence driven by the upstream promoter (which is interrupted by the intron). Such promoter-containing introns are particularly useful for driving transcription of genes of interest that overlap one another. In a particular example, it can be used to drive transcription of Rep proteins (including Rep78, rep68, rep52, and Rep40 subunits) or VP proteins (including VP1, VP2, and VP3 subunits).

An intron comprising a Polh promoter, which can be used for simultaneously expressing various subunits of a Rep protein or a VP protein, is described in the patent literature (CN 200780037031.2), and the intron sequence is as follows:

<xnotran> GTAAGTACTCCCTATCAGTGATAGAGATCTATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGGATTATTCATACCGTCCCACCATCGGGCGCGAAGGGGGAGACCTGTAGTCAGAGCCCCCGGGCAGCACACACTGACATCCACTCCCTTCCTATTGTTTCAG (SEQ ID NO: 57). </xnotran> The sequence of the polh promoter within this intron is:

ATCATGGAGATAATTAAAATGATAACCATCTCGCAAATAAATAAGTATTTTACTGTTTTCGTAACAGTTTTGTAATAAAAAAACCTATAAATATTCCGGATTATTCATACCGTCCCACCATCGGGCGCG(SEQ ID NO:58)。

similarly, functional variants of the above-described intron sequences may be used in addition to the above-described intron sequences, as long as they can achieve or substantially achieve the above-described functions. A functional variant of this intron retains or substantially retains the ability to drive transcription of the coding sequence downstream of it (while not affecting or substantially affecting transcription of the coding sequence driven by its upstream promoter (which is interrupted by the intron)), but differs in nucleotide sequence from that shown in SEQ ID NO: 57. In some embodiments, the functional variant has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotide substitutions, additions or deletions relative to the sequence set forth in SEQ ID No. 57. In other embodiments, the functional variant has at least 60%, e.g., at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity with respect to the sequence set forth in SEQ ID NO. 57. Those skilled in the art can obtain such functional variants by performing various substitutions, additions or deletions of the sequence shown in SEQ ID NO. 57 and verifying the function of the obtained sequence.

When referring to nucleotide sequences, the term "sequence identity" (also referred to as "sequence identity") refers to the amount of degree of identity, typically expressed as a percentage, between two nucleotide sequences, e.g., a query sequence and a reference sequence. Typically, prior to calculating the percent identity between two nucleotide sequences, sequence alignments (alignment) and gaps (gaps), if any, are introduced. If the bases in the two sequences are the same at a certain alignment position, the two sequences are considered to be consistent or matched at the position; when bases in the two sequences are different, it is considered that the base sequences are not matched or mismatched at the positions. In some algorithms, the number of matched positions is divided by the total number of positions in the alignment window to obtain sequence identity. In other algorithms, the number of gaps and/or the length of the gaps are also taken into account. Commonly used sequence alignment algorithms or software include DANMAN, CLUSTALW, MAFFT, BLAST, MUSCLE, etc. For the purposes of the present invention, the disclosed alignment software BLAST (available from https:// www.ncbi.nlm.nih.gov.) can be used to obtain optimal sequence alignment and to calculate sequence identity between two nucleotide sequences by using default settings.

Bac-to-Bac ^TM Baculovirus expression System an insect baculovirus expression system was provided for Thermo Fisher corporation that relies on a site-specific transposition to recombine a DNA sequence of interest (e.g., one or more expression cassettes) onto a baculovirus shuttle plasmid (bacmid). The system comprises the following elements: pFastBac ^TM Vectors or the like (e.g. pFastBac) ^TM Dual), containing transposon elements Tn7-L and Tn7R, between which DNA sequences (e.g., one or more expression cassettes, resistance genes, etc.) can be spliced and inserted into a target site (e.g., mini-attTn 7) by the transposable protein; DH10Bac Strain, competent E.coli, also pFastBac ^TM The host bacterium of the vector comprises an escherichia coli-baculovirus shuttle plasmid (bacmid) and an auxiliary plasmid, wherein the bacmid contains a mini-attTn7 site, and the auxiliary plasmid encodes a transposable protein. Once pFastBac ^TM And (3) transforming the isovector into a DH10Bac strain, transposing a DNA sequence between Tn7-L and Tn7R and inserting a mini-attTn7 site of bacmid to form the recombinant bacmid. Recombinant bacmid infects insect cells to form recombinant baculovirus, which can be subsequently infected for multiple generations and expressed as large-scale recombinant protein. Relating to Bac-to-Bac ^TM For more description of baculovirus expression systems, see the manufacturer's instructions.

pFastBac ^TM Dual expression vector and pFastBac ^TM The vector is similar, but contains two multiple cloning sites for introducing foreign genes, located downstream of the promoter P10 and Polh, respectively, and thus can be used to express two foreign proteins simultaneously in insect cells.

Relating to Bac-to-Bac ^TM Baculovirus expression system and pFastBac ^TM For more description of the Dual expression vector, see the instructions provided by Thermo Fisher, inc.

This document is based, at least in part, on the unexpected discovery that when AD sequences are introduced into an expression vector (e.g., baculovirus expression), production of baculoviruses is facilitated, and that when such baculoviruses are used to produce rAAV, production of rAAV can be greatly increased.

Thus, in some embodiments, provided herein are nucleic acid molecules comprising AD sequences. The nucleic acid molecule may include one or more expression cassettes for expression of the protein of interest.

When the nucleic acid molecule comprises an expression cassette, the AD sequence may be located upstream, downstream or within the expression cassette. When the AD sequence is not located in an expression cassette, it is preferably not more than 5kb from the expression cassette, for example 4kb, 3kb, 2kb, 1kb, 0.5kb, 0.4kb, 0.3kb, 0.2kb, 0.1kb or closer to the expression cassette. When the AD sequence is located in an expression cassette, it may be located in the 5 'untranslated region (5' -UTR) or the 3 'untranslated region (3' -UTR), or it may be placed in an intron and the intron placed between coding sequences. Preferably, when the AD sequence is located in an expression cassette, it is located after the stop codon; more preferably, it is located after and immediately after the stop codon.

When the nucleic acid molecule comprises two expression cassettes, the AD sequence may be located upstream, downstream or in either expression cassette. When the AD sequence is not located in either expression cassette, it is preferably no more than 5kb from both expression cassettes, e.g. 4kb, 3kb, 2kb, 1kb, 0.5kb, 0.4kb, 0.3kb, 0.2kb, 0.1kb or closer to both expression cassettes. In particular, when the two expression cassettes are expressed by "back-to-back" two promoters, the AD sequence may be located between the two promoters.

In some embodiments, the nucleic acid molecule comprises a Rep expression cassette for expressing a Rep protein (Rep 78, rep68, rep52, and Rep 40). In other embodiments, the nucleic acid molecule comprises a Cap expression cassette for expression of VP proteins (VP 1, VP2, and VP 3). In still other embodiments, the nucleic acid molecule comprises a Rep expression cassette for expressing Rep proteins (Rep 78, rep68, rep52, and Rep 40) and a Cap expression cassette for expressing VP proteins (VP 1, VP2, and VP 3).

Accordingly, provided herein are expression vectors, particularly baculovirus expression vectors, comprising the above-described nucleic acid molecules. In some embodiments, the baculovirus expression vector can be passed through Bac-to-Bac ^TM Baculovirus expression system production.

In some embodiments, the baculovirus vector comprises, in 5 'to 3' order, the AD sequence, the Cap expression cassette and the Rep expression cassette combination.

In some embodiments, the baculovirus vector comprises the AD sequence, rep expression cassette and Cap expression cassette combination in 5 'to 3' order.

In some embodiments, the baculovirus vector comprises the Rep expression cassette, AD sequence, and Cap expression cassette combination in 5 'to 3' order.

In some embodiments, the baculovirus vector comprises the Cap expression cassette, AD sequence, and Rep expression cassette combination in 5 'to 3' order.

In some embodiments, the baculovirus vector comprises the Cap expression cassette, the Rep expression cassette, and the AD sequence combination in 5 'to 3' order.

In some embodiments, the baculovirus vector comprises the combination of the Rep expression cassette, cap expression cassette and AD sequence in 5 'to 3' order.

Additionally, provided herein are methods of producing recombinant adeno-associated virus (rAAV) by baculovirus vectors.

In some embodiments, a baculovirus system is used to produce rAAV. In some embodiments, a nucleic acid molecule comprising a Rep expression cassette, a Cap expression cassette, and an AD sequence (or functional variants thereof) can be integrated into a host cell, such as an insect cell, and a gene of interest (e.g., a therapeutic protein of interest coding sequence) expression vector with an ITR sequence of an AAV can be introduced into the host cell, and a rAAV useful for containing the gene of interest can be generated and obtained. In other embodiments, a nucleic acid molecule comprising a Rep expression cassette, a Cap expression cassette, and AD sequences (or functional variants thereof), and a gene of interest expression cassette flanked by AAV ITR sequences, can be introduced into the same baculovirus expression vector, and host cells (e.g., insect cells) infected with the baculovirus can produce and obtain rAAV useful for containing the gene of interest.

In some embodiments, a two-baculovirus system is used in the preparation of rAAV. For example, a nucleic acid molecule comprising a Rep expression cassette, a Cap expression cassette, and an AD sequence (or functional variants thereof) can be constructed in one baculovirus expression vector, while a gene of interest expression cassette flanked by AAV ITR sequences can be constructed in another baculovirus expression vector, and when both baculoviruses infect the same host cell (e.g., an insect cell), a rAAV useful for containing the gene of interest can be produced and obtained.

In other embodiments, a three-baculovirus system is used in the production of rAAV. For example, the Rep expression cassette and the Cap expression cassette are constructed separately in two different baculovirus expression vectors, either or both of which may contain AD sequences; meanwhile, the target gene expression cassette with the ITR sequences of AAV on both sides is constructed in another baculovirus expression vector, and when the three baculoviruses are infected into the same host cell (such as insect cell), rAAV which can be used for containing the target gene can be generated and obtained.

The obtained rAAV can then be used to infect a mammal or a mammalian cell, such as a human or human cell, and express a gene of interest. The gene of interest can be any nucleotide sequence as long as the resulting construct remains within the packaging capabilities of the AAV viral genome.

The gene of interest may encode a protein of interest or an RNA of interest (e.g., various interfering small RNAs), and both may be therapeutic gene products. The therapeutic gene product may be a polypeptide or RNA molecule, or other gene product that provides a desired therapeutic effect when expressed in a target cell. Examples of therapeutic effects include elimination of undesirable activity, e.g., elimination of enzymatic activity, or compensation for genetic defects, etc. Alternatively or additionally, the protein of interest encoded by the polynucleotide may be used as a marker protein for assessing cell transformation and expression. Suitable marker proteins for this purpose are, for example, the fluorescent protein GFP or firefly luciferase.

When a two-baculovirus vector or a three-baculovirus vector is used to prepare rAAv, a two-baculovirus vector combination or a three-baculovirus vector combination is provided herein. In addition, since the desired gene expression cassette can be prepared independently according to the use requirements, baculovirus vectors containing the Rep expression cassette, the Cap expression cassette, or both the Rep expression cassette and the Cap expression cassette, which can be used in combination with the user-built desired gene expression cassette to produce rAAV with the desired gene, are also provided herein.

In a specific example, a method of producing a rAAV provided herein comprises the steps of:

1) A baculovirus package comprising REP, CAP and AD sequences;

2) Amplifying a baculovirus vector;

3) Infecting insect cells with the baculovirus vector, collecting adeno-associated virus, analyzing and purifying.

Preferably, pFastBac is used in the method ^TM A Dual shuttle plasmid, and Bac-to-Bac system based baculovirus vector production.

Compared with the prior art, the invention has the following beneficial effects: the method for improving the production of the adeno-associated virus by the baculovirus system, disclosed by the invention, has the advantages that the packaging titer of the baculovirus is obviously improved by arranging and combining the AD sequence and Rep and Cap at different positions by about 3-33 times, so that the generation times of the baculovirus are reduced, and the generation instability caused by excessive generation times is avoided. Meanwhile, the efficiency of producing the adeno-associated virus by the baculovirus system is improved, and compared with the combination without the AD sequence, the yield of the adeno-associated virus produced by the baculovirus vector with the AD sequence is improved by 2-5 times. Thereby reducing the cost of production of the adeno-associated virus, increasing the clinical application of the adeno-associated virus and reducing the research and development cost.

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention will be described in further detail with reference to the accompanying drawings and examples. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. Here, features involved in the respective embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

Provided herein are methods for enhancing the production of adeno-associated virus by a baculovirus system. Through the mutual combination of the AD sequence and Rep and Cap proteins at different positions, the titer of the baculovirus and the packaging efficiency of the adeno-associated virus are improved. Can be used for producing adeno-associated virus by different baculovirus systems, such as a one-baculovirus system (one-bacular system), a two-baculovirus system (two-bacular system) or a three-baculovirus system (three-bacular system). The production of AAV2 by a two-baculovirus system with an intron-inserted promoter is described below as an example in the patent publication (CN 200780037031.2).

Insect cell culture

Insect cell growth was maintained at a cell density of 5E +6cell/ml at 28 ℃. The medium used was ESF921 medium serum-free medium (Expression Systems) containing 100 units/ml penicillin and 100ug/ml streptomycin.

Preparation of the plasmid of interest and Bacmid

By Bac-to-Bac ^TM System, pFastBac ^TM The Dual expression plasmid was derived from Thermofoisher (cat. No. 10712024). Constructing Rep and Cap protein gene expression frame and AD sequence into pFastBac by PCR amplification and other molecular operations ^TM The first plasmid was formed in Dual. A second plasmid containing flanking ITRs and an EGFP gene expression cassette was constructed in the same manner. Constructed plasmids were diluted to a concentration of 2ng/ul and 2ul of plasmid DNA was used to transform DH10Bac competent cells according to the instructions. After 2 days of incubation, white colonies were picked and miniprep baculovirus DNA Bacmid was prepared. Miniprep baculovirus DNA Bacmid was used to transfect Sf9 cells to produce recombinant baculovirus.

Preparation of baculovirus

And mixing the extracted Bacmid with a transfection reagent according to the mass ratio of Bacmid: transfection reagent =1ug: SF9 cells were transfected at a rate of 3 ul. The transfected cells were cultured in an incubator at 28 ℃ for 5 to 7 days, and the growth state of the cells was carefully observed. After 5-7 days, the supernatant was collected and centrifuged. As P0-generation virus fluid. Aspirate 10-100ul for P1 generation amplification. The simple steps are as follows: sucking 100ul of P0 generation liquid, adding into 15cm dish SF9 cells, culturing for 5-6 days, and observing cell morphology. After 6 days, the supernatant was collected as P1 generation. Repeating the above steps, sucking 100ul, and continuing to infect SF9 cells as P2 generation.

Baculovirus titer assay

First, dnase I was used for digestion to remove nucleic acid contamination contained in the virus solution. Brief description: 5ul of the sample was added to 15ul of the prepared DNAse I digestion system, incubated at 37 ℃ for 30 minutes, and inactivated at 100 ℃ for 10 minutes. The supernatant was centrifuged and subjected to QPCR assay with the primers shown in Table 1 (SEQ ID NOS: 1 and 2).

Adeno-associated virus packaging and titer determination

SF9 cells in logarithmic growth phase are taken, centrifuged and collected, and subpackaged and cultured according to 1E +8cell/ml, wherein the total volume is 15ml. A first baculovirus expression vector containing Rep and Cap protein gene expression frames and AD sequences, a second baculovirus expression vector containing ITRs at two sides and EGFP gene expression frames _， First baculovirus expression vector at MOI ratio: second baculovirus expression vector =10:5 infection, and culturing in 28 ℃ cell shaker for 3 days. Cells and medium were collected. Appropriate amounts of chloroform and sodium chloride were added to lyse the cells. The resulting lysates were titered to reflect adeno-associated virus packaging titer, and the primers are shown in Table 1 (SEQ ID NOS: 3 and 4).

TABLE 1 construction of baculovirus vectors and amplification primers for detection thereof

/>

/>

Example 1

This example uses a two-baculovirus system to produce AAV2 adeno-associated virus. In this example, a first baculovirus BAC-CAP-REP- (REP-AD) comprises an AD sequence following the termination codon TAA of the AAV2 REP gene expression cassette, which is transcribed with the CAP gene expression cassette under the action of the P10, PH promoter, respectively, to produce AAV2 in insect cells, as shown in fig. 1.

pFastBac ^TM The Dual expression plasmid was derived from Thermofisiher (Cat. No. 10712024), and pRep2Cap2 containing Rep2 and Cap2 was obtained from this company, and the sequence information thereof was referred to AAV genome (NCBI accession No. AF 043303). The pfast-CAP-REP control plasmid is constructed by means of gene synthesis, seamless cloning and the like. The intron sequence containing the PH promoter is referred to patent 200780037031.2. Briefly described as follows. An intron sequence containing the PH promoter is inserted between nucleotides 530 and 531 of the Rep coding sequence, the sequence information of which can be referenced to the AAV genome (NCBI accession number: AF 043303) for Rep52/Rep40 expression. Meanwhile, the Rep sequence is driven by the P10 promoter to express Rep78/Rep68. VP1 is expressed using the PH promoter, while an intron containing the PH promoter is placed between nucleotides 25 and 26 of the CAP coding sequence to drive transcriptional expression of VP2 and VP3 proteins, the sequence information of which can be referenced to the AAV genome (NCBI accession No.: AF 043303). The constructed pfast-CAP-REP control plasmid was transformed into DH10BAC (Thermofisiher) competent to construct the corresponding bacmid, which was transfected into SF9 cells to package BAC-CAP-REP baculovirus. The relevant primers are shown in Table 1.

On the basis of constructing a pfast-CAP-REP control plasmid, an AD sequence is placed at the position of a TAA stop codon of a nucleotide of a REP coding sequence, so that a pfast-CAP-REP- (REP-AD) plasmid is constructed, and baculovirus is packaged. The relevant primers are shown in Table 1.

Example 2

This example uses a two-baculovirus system to produce AAV2 adeno-associated virus. In this example, the first baculovirus BAC-CAP-REP- (PH-AD) comprises an AD sequence positioned between the AAV2 REP gene expression cassette and the CAP gene expression cassette to produce AAV2 in an insect cell, as shown in figure 2. Reference example 1 was constructed with plasmid pfast-CAP-REP- (PH-AD). The relevant primers are shown in Table 1.

Example 3

This example uses a two-baculovirus system to produce AAV2 adeno-associated virus. In this example, the first baculovirus BAC-CAP-REP- (CAP-AD) comprises an AD sequence following the stop codon of the Cap gene expression cassette for production of AAV2 in insect cells, as shown in FIG. 3. Reference example 1 was constructed from the plasmid pfast-CAP-REP- (CAP-AD). The relevant primers are shown in Table 1.

Example 4

In this example, the first baculovirus containing AD sequences at different positions constructed in example 1, example 2, example 3 was packaged. Baculovirus titer assays were performed according to the methods described. By comparison with a control BAC-CAP-REP containing Rep gene expression cassettes and Cap gene expression cassettes, but no AD sequences. Different permutations containing AD sequences were found to have different titer-enhancing effects on baculoviruses, and the results are shown in fig. 4 and table 2. Wherein the AD sequence is positioned behind the CAP gene expression frame, namely BAC-CAP-REP- (CAP-AD), and is improved by 3.3 times. The AD sequence is positioned between the REP gene expression frame and the CAP gene, namely BAC-CAP-REP- (PH-AD), and is improved by 33.1 times. AD was located behind the REP gene expression cassette, i.e., BAC-CAP-REP- (REP-AD), and was increased 21.3 times.

TABLE 2 baculovirus titer test results

Example 5

In this example, AAV2 adeno-associated virus was packaged using a first baculovirus expression vector containing the Rep and Cap protein gene expression cassettes and AD sequences packaged in example 4, and a second baculovirus expression vector containing flanking ITR and GFP gene expression cassettes. The results show that different AD sequence positions have different enhancing effects on baculovirus-mediated adeno-associated virus packaging as shown in fig. 5 and table 3. Wherein the AD sequence is positioned behind the CAP gene, namely AAV-CAP-REP- (CAP-AD), is improved by 1.34 times. The AD sequence is located behind the REP gene, i.e., the AAV-CAP-REP- (REP-AD) is increased by 3.77 times. The AD sequence is located between the REP gene and the CAP gene, namely AAV-CAP-REP- (PH-AD), and is improved by 2.58 times.

TABLE 3 results of measurement of adeno-associated Virus titres

Reference documents:

[1]Feng D M,Chen J Z,Yue Y B,et al.A 16bp Rep binding element is sufficient for mediating Rep-dependent integration into AAVS1.[J].Journal of Molecular Biology,2006,358(1):38-45.

[2]Zhou Q,Tian W,Liu C,et al.Deletion of the B-B'and C-C'regions of inverted terminal repeats reduces rAAV productivity but increases transgene expression[J].Rep,2017,7(1):5432.

[3]Ling C,Wang Y,Lu Y,et al.Enhanced Transgene Expression from Recombinant Single-Stranded D-Sequence-Substituted Adeno-Associated Virus Vectors in Human Cell Lines In Vitro and in Murine Hepatocytes In Vivo[J].Journal of Virology,2015,89(2):952-61.

[4]Wang X S,Ponnazhagan S,Srivastava A.Rescue and Replication Signals of the Adeno-associated Virus 2Genome[J].Journal of Molecular Biology,1995,250(5):573-580.

[5]Haberman R P,Mccown T J,Samulski R J.Novel Transcriptional Regulatory Signals in the Adeno-Associated Virus Terminal Repeat A/D Junction Element[J].Journal of Virology,2000,74(18):8732-8739.

[6]Aslanidi G,Lamb K,Zolotukhin S.An inducible system for highly efficient production of recombinant adeno-associated virus(rAAV)vectors in insect Sf9 cells[J].Proceedings of the National Academy of Sciences of the United States of America,2009,106(13):5059-5064.

SEQUENCE LISTING

<110> Guangzhou Pachy Biotechnology Ltd

<120> method for improving production of adeno-associated virus by baculovirus system and application

<130> P10946-I

<160> 58

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

<213> Artificial

<220>

<223> primers for baculovirus titer determination

<400> 1

acggagcaag ttcccgagg 19

<210> 2

<211> 26

<212> DNA

<213> Artificial

<220>

<223> primers for baculovirus titer determination

<400> 2

caaagttagg tggctcaagt atgggc 26

<210> 3

<211> 21

<212> DNA

<213> Artificial

<220>

<223> primers for measurement of adeno-associated Virus Titers

<400> 3

ggaaccccta gtgatggagt t 21

<210> 4

<211> 16

<212> DNA

<213> Artificial

<220>

<223> primers for measurement of adeno-associated Virus Titers

<400> 4

cggcctcagt gagcga 16

<210> 5

<211> 53

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep52

<400> 5

gcctccccca tctcccggta ccttattgtt caaagatgca gtcatccaaa tcc 53

<210> 6

<211> 30

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep52

<400> 6

tgtttgaatc tcacggagcg taaacggttg 30

<210> 7

<211> 26

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 7

gtaagtactc cctatcagtg atagag 26

<210> 8

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 8

atggttatca ttttaattat ctccatgata gatctctatc actgataggg agtactta 58

<210> 9

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 9

atcatggaga taattaaaat gataaccatc tcgcaaataa ataagtattt tactgttt 58

<210> 10

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 10

taggtttttt tattacaaaa ctgttacgaa aacagtaaaa tacttattta tttgcgag 58

<210> 11

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 11

tcgtaacagt tttgtaataa aaaaacctat aaatattccg gattattcat accgtccc 58

<210> 12

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 12

gctctgacta caggtctccc ccttcgcgcc cgatggtggg acggtatgaa taatccgg 58

<210> 13

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 13

gggagacctg tagtcagagc ccccgggcag cacacactga catccactcc cttcctat 58

<210> 14

<211> 29

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing intron + polh gene of artificial intron

<400> 14

ctgaaacaat aggaagggag tggatgtca 29

<210> 15

<211> 57

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying inserted Rep Artificial intron

<400> 15

ccgtttacgc tccgtgagat tcaaacaggc gctgaaacaa taggaaggga gtggatg 57

<210> 16

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying inserted Rep Artificial intron

<400> 16

ctaatatgga acagtattta aggtaagtac tccctatcag tgatagagat ctatcatg 58

<210> 17

<211> 55

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep78

<400> 17

cactgatagg gagtacttac cttaaatact gttccatatt agtccacgcc cactg 55

<210> 18

<211> 55

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep78

<400> 18

gacttgatca cccgggatct cgagatgccg gggttttacg agattgtgat taagg 55

<210> 19

<211> 34

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying P10 and PH promoter

<400> 19

gcatctcgag atcccgggtg atcaagtctt cgtc 34

<210> 20

<211> 50

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying P10 and PH promoter

<400> 20

ctggaagata accatcggca gccatggatc cgcgcccgat ggtgggacgg 50

<210> 21

<211> 54

<212> DNA

<213> Artificial

<220>

<223> amplification of primers for the insertion of CAP Artificial intron

<400> 21

atggctgccg atggttatct tccaggtaag tactccctat cagtgataga gatc 54

<210> 22

<211> 44

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying the Artificial intron inserted into CAP

<400> 22

gtgtcctcga gccaatctga aacaatagga agggagtgga tgtc 44

<210> 23

<211> 56

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying VP2/VP3

<400> 23

gacatccact cccttcctat tgtttcagat tggctcgagg acactctctc tgaagg 56

<210> 24

<211> 55

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying VP2/VP3

<400> 24

gcttgtcgag actgcaggct ctagattaca gattacgagt caggtatctg gtgcc 55

<210> 25

<211> 54

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing AD + Rep78 (1743-1866 bp) from gene

<400> 25

gcctccccca tctcccggta ccgcctcagt gagcgagcga gcgcgcagag aggg 54

<210> 26

<211> 59

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing AD + Rep78 (1743-1866 bp) from gene

<400> 26

tctttgaaca ataaaggaac ccctagtgat ggagttggcc actccctctc tgcgcgctc 59

<210> 27

<211> 59

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing AD + Rep78 (1743-1866 bp) from gene

<400> 27

ggggttcctt tattgttcaa agatgcagtc atccaaatcc acattgacca gatcgcagg 59

<210> 28

<211> 59

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing AD + Rep78 (1743-1866 bp) from gene

<400> 28

attcatcata tcatgggaaa ggtgccagac gcttgcactg cctgcgatct ggtcaatgt 59

<210> 29

<211> 59

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing AD + Rep78 (1743-1866 bp) from gene

<400> 29

cacctttccc atgatatgat gaatgtagca cagtttctga tacgcctttt tgacgacag 59

<210> 30

<211> 39

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing AD + Rep78 (1743-1866 bp) from gene

<400> 30

cagaatctca acccgtttct gtcgtcaaaa aggcgtatc 39

<210> 31

<211> 35

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying AD

<400> 31

gcctccccca tctcccggta ccgcctcagt gagcg 35

<210> 32

<211> 26

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying AD

<400> 32

cagaatctca acccgtttct gtcgtc 26

<210> 33

<211> 26

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep

<400> 33

gacgacagaa acgggttgag attctg 26

<210> 34

<211> 43

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep

<400> 34

gaagacttga tcacccggga tctcgagatg ccggggtttt acg 43

<210> 35

<211> 48

<212> DNA

<213> Artificial

<220>

<223> primers for Cap amplification

<400> 35

ccccggcatc tcgagatccc gggtgatcaa gtcttcgtcg agtgattg 48

<210> 36

<211> 51

<212> DNA

<213> Artificial

<220>

<223> primers for Cap amplification

<400> 36

gcttgtcgag actgcaggct ctagattaca gattacgagt caggtatctg g 51

<210> 37

<211> 53

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep + AD

<400> 37

gcctccccca tctcccggta ccttattgtt caaagatgca gtcatccaaa tcc 53

<210> 38

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep + AD

<400> 38

gcgcgctcgc tcgctcactg aggcgacctt taattcaacc caacacaata tattatag 58

<210> 39

<211> 59

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep + AD

<400> 39

gaacccctag tgatggagtt ggccactccc tctctgcgcg ctcgctcgct cactgaggc 59

<210> 40

<211> 55

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Cap + AD

<400> 40

gccaactcca tcactagggg ttcctcgtat actccggaat attaatagat catgg 55

<210> 41

<211> 51

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Cap + AD

<400> 41

gcttgtcgag actgcaggct ctagattaca gattacgagt caggtatctg g 51

<210> 42

<211> 53

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep

<400> 42

gcctccccca tctcccggta ccttattgtt caaagatgca gtcatccaaa tcc 53

<210> 43

<211> 43

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying Rep

<400> 43

gaagacttga tcacccggga tctcgagatg ccggggtttt acg 43

<210> 44

<211> 48

<212> DNA

<213> Artificial

<220>

<223> primers for Cap amplification

<400> 44

ccccggcatc tcgagatccc gggtgatcaa gtcttcgtcg agtgattg 48

<210> 45

<211> 38

<212> DNA

<213> Artificial

<220>

<223> primers for Cap amplification

<400> 45

cattagtgtc cacagtaaag tccacattaa cagacttg 38

<210> 46

<211> 27

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing CAP (2115-2208 bp) + AD from gene

<400> 46

caagtctgtt aatgtggact ttactgt 27

<210> 47

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing CAP (2115-2208 bp) + AD from gene

<400> 47

ggggcgaggc tctgaataca cgccattagt gtccacagta aagtccacat taacagac 58

<210> 48

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing CAP (2115-2208 bp) + AD from gene

<400> 48

attcagagcc tcgccccatt ggcaccagat acctgactcg taatctgtaa gcctcagt 58

<210> 49

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing CAP (2115-2208 bp) + AD from gene

<400> 49

gagttggcca ctccctctct gcgcgctcgc tcgctcactg aggcttacag attacgag 58

<210> 50

<211> 58

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing CAP (2115-2208 bp) + AD from gene

<400> 50

agagggagtg gccaactcca tcactagggg ttcctgaatt caaaggccta cgtcgacg 58

<210> 51

<211> 22

<212> DNA

<213> Artificial

<220>

<223> primers for synthesizing CAP (2115-2208 bp) + AD from gene

<400> 51

agctcgtcga cgtaggcctt tg 22

<210> 52

<211> 38

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying CAP (2115-2208 bp) + AD

<400> 52

caagtctgtt aatgtggact ttactgtgga cactaatg 38

<210> 53

<211> 27

<212> DNA

<213> Artificial

<220>

<223> primers for amplifying CAP (2115-2208 bp) + AD

<400> 53

agctcgtcga cgtaggcctt tgaattc 27

<210> 54

<211> 55

<212> DNA

<213> Artificial

<220>

<223> addition of PSTI site to primer for pFastBac Dual vector

<400> 54

gttagcctcc cccatctccc ggtaccctgc aggcatgcta tgcatcagct gctag 55

<210> 55

<211> 26

<212> DNA

<213> Artificial

<220>

<223> addition of PSTI site to primer for pFastBac Dual vector

<400> 55

tcgacaagct tgtcgagact gcaggc 26

<210> 56

<211> 61

<212> DNA

<213> Artificial

<220>

<223> AD sequences

<400> 56

gcctcagtga gcgagcgagc gcgcagagag ggagtggcca actccatcac taggggttcc 60

t 61

<210> 57

<211> 229

<212> DNA

<213> Artificial

<220>

<223> Intron

<400> 57

gtaagtactc cctatcagtg atagagatct atcatggaga taattaaaat gataaccatc 60

tcgcaaataa ataagtattt tactgttttc gtaacagttt tgtaataaaa aaacctataa 120

atattccgga ttattcatac cgtcccacca tcgggcgcga agggggagac ctgtagtcag 180

agcccccggg cagcacacac tgacatccac tcccttccta ttgtttcag 229

<210> 58

<211> 129

<212> DNA

<213> Artificial

<220>

<223> promoter

<400> 58

atcatggaga taattaaaat gataaccatc tcgcaaataa ataagtattt tactgttttc 60

gtaacagttt tgtaataaaa aaacctataa atattccgga ttattcatac cgtcccacca 120

tcgggcgcg 129

Claims

1. An isolated nucleic acid molecule comprising:

1) An adeno-associated virus (AAV) replication gene (Rep) expression cassette and/or an AAV capsid protein gene (Cap) expression cassette; and

2. The nucleic acid molecule of claim 1, wherein the AD sequence or functional variant thereof is located within or no more than 5kb from the Rep expression cassette.

3. The nucleic acid molecule of claim 1 or 2, wherein the AD sequence or functional variant thereof is located within or no more than 5kb from the Cap expression cassette.

4. The nucleic acid molecule of any one of claims 1-3, wherein:

1) The AD sequence or functional variant thereof is located within the Rep expression cassette and is no more than 5kb from the Cap expression cassette;

2) The AD sequence or functional variant thereof is located within the Cap expression cassette and is no more than 5kb from the Rep expression cassette; or alternatively

3) The AD sequence or functional variant thereof is located outside of the Rep expression cassette and the Cap expression cassette and is no more than 5kb from the Rep expression cassette and the Cap expression cassette.

5. The nucleic acid molecule of any one of claims 1-4, wherein the AD sequence or functional variant thereof is located within the Rep expression cassette and after a stop codon and/or the AD sequence or functional variant thereof is located within the Cap expression cassette and after a stop codon.

6. The nucleic acid molecule of any one of claims 1-5, wherein the Rep expression cassette and the Cap expression cassette are transcribed in different directions and the AD sequence or functional variant thereof is located between the promoter of the Rep expression cassette and the promoter of the Cap expression cassette.

7. The nucleic acid molecule of any one of claims 1-6, wherein the promoter of the Rep expression cassette and/or the Cap expression cassette is an insect cell promoter.

8. The nucleic acid molecule of any one of claims 1-7, wherein the promoters of said Rep expression cassette and said Cap expression cassette are each independently selected from the group consisting of P10 and Polh promoters.

9. The nucleic acid molecule of any one of claims 1-8, wherein the AD sequence comprises the nucleotide sequence set forth in SEQ ID NO 56.

10. A nucleic acid molecule according to any one of claims 1 to 9, wherein a functional variant of the AD sequence comprises a nucleotide sequence having at least 60%, 70%, 80% or 90% sequence identity to the nucleotide sequence shown in SEQ ID No. 56 and, when the nucleic acid molecule is introduced into a suitable host cell, is capable of increasing the amount of expression of the AAV replication gene (Rep) expression cassette and/or the AAV capsid protein gene (Cap) expression cassette in the host cell.

11. The nucleic acid molecule of any one of claims 1-10, wherein the Rep expression cassette is for transcription and expression of Rep78/Rep68 and Rep52/Rep40 proteins.

12. The nucleic acid molecule of any one of claims 1-11, wherein the Cap expression cassette is for transcription and expression of VP1 and VP2/VP3 proteins.

13. The nucleic acid molecule of any one of claims 1-12, wherein the Rep expression cassette and/or the Cap expression cassette comprises an intron sequence comprising a promoter sequence.

14. The nucleic acid molecule of any one of claims 1-13, wherein the intron sequence comprises the promoter which is a polh promoter.

15. The nucleic acid molecule of any one of claims 1 to 14, wherein the intron sequence comprises the nucleotide sequence set forth in SEQ ID No. 57 or a functional variant thereof.

16. The nucleic acid molecule of any one of claims 1-15, wherein the intron sequence is positioned between the Rep-encoding nucleotide sequences 530 and 531 in the Rep expression cassette to drive transcription of the Rep52/Rep40 subunit coding sequences.

17. The nucleic acid molecule of any one of claims 1-16, wherein the intron sequence is positioned between Cap-encoding nucleotide sequences 25 and 26 in the Rep expression cassette to drive transcription of VP2 and VP3 subunit-encoding sequences.

18. An expression vector comprising the nucleic acid molecule of any one of claims 1-17.

19. The expression vector of claim 18, wherein the expression vector is expressed as pFastBac ^TM Dual is the expression vector of the skeleton.

20. The expression vector of claim 18 or 19, wherein the expression vector is a baculovirus expression vector.

21. The expression vector of any one of claims 18-20, wherein the baculovirus vector passes Bac-to-Bac ^TM Baculovirus expression system preparation.

22. The expression vector of any one of claims 18-21, wherein the expression vector further comprises an additional expression cassette.

23. The expression vector of any one of claims 18-22, wherein the additional expression cassette comprises, from 5 'to 3':

1) ITR of AAV;

2) A promoter;

3) A gene of interest operably linked to the promoter;

4) A polyadenylation signal; and

5) ITR of AAV.

24. The expression vector of any one of claims 18-23, wherein the promoter in the additional expression cassette is a mammalian cell promoter.

25. The expression vector of any one of claims 18-24, wherein the gene of interest comprises a protein or RNA coding sequence.

26. A host cell comprising the nucleic acid molecule of any one of claims 1-17 or the expression vector of any one of claims 18-25.

27. The host cell of claim 26, wherein the nucleic acid molecule is integrated in the genome of the host cell.

28. The host cell of claim 26 or 27, wherein the host cell is an insect cell.

29. The host cell of any one of claims 26-28, wherein the host cell is an insect cell SF9, SF21, or high five.

30. A baculovirus expression vector combination comprising

1) A first baculovirus expression vector comprising the nucleic acid molecule of any one of claims 1-17, wherein said nucleic acid molecule comprises said Rep expression cassette and said Cap expression cassette; and

31. A baculovirus expression vector combination comprising

1) A first baculovirus expression vector comprising the nucleic acid molecule of any one of claims 1-17, wherein said nucleic acid molecule comprises said Rep expression cassette and does not comprise said Cap expression cassette;

2) A second baculovirus expression vector comprising the nucleic acid molecule of any one of claims 1-17, wherein said nucleic acid molecule comprises said Cap expression cassette and does not comprise said Rep expression cassette;

32. A host cell comprising the baculovirus expression vector combination of claim 30 or 31.

33. A host cell comprising

1) A nucleic acid molecule of any one of claims 1-17 integrated into the genome of the host cell; and

34. A method for producing a rAAV comprising

1) Culturing the insect cell of any one of claims 32 or 33 in a culture medium;

2) Recovering the rAAV from the culture medium and/or the insect cell.

35. A method of producing a rAAV in an insect cell, comprising:

1) Co-infecting the host cell with a first baculovirus and a second baculovirus, wherein the first baculovirus comprises the nucleic acid molecule of any one of claims 1-17, wherein the nucleic acid molecule comprises the Rep expression cassette and the Cap expression cassette; the second baculovirus comprises a target gene expression cassette and ITRs of AAV positioned at two sides of the target gene expression cassette;

2) Culturing the insect cell in a culture medium; and

3) Recovering the rAAV from the culture medium and/or the insect cell.

36. A method of producing a rAAV in an insect cell, comprising:

1) Co-infecting the host cell with a first baculovirus, a second baculovirus, and a third baculovirus, wherein the first baculovirus comprises the nucleic acid molecule of any one of claims 1-17, wherein the nucleic acid molecule comprises the Rep expression cassette and does not comprise the Cap expression cassette; a second baculovirus comprising the nucleic acid molecule of any one of claims 1-17, wherein said nucleic acid molecule comprises said Cap expression cassette and does not comprise said Rep expression cassette; the third baculovirus comprises a target gene expression cassette and ITRs of AAV positioned at two sides of the target gene expression cassette;

2) Culturing the insect cell in a culture medium; and

3) Recovering the rAAV from the culture medium and/or the insect cell.

37. A method of producing AAV in an insect cell, comprising:

1) Integrating the nucleic acid molecule of any one of claims 1-17 into the genome of the insect line, wherein the nucleic acid molecule comprises the Rep expression cassette and the Cap expression cassette;

3) Culturing the insect cell in a culture medium; and

4) Recovering the rAAV from the culture medium and/or the insect cell.

38. The nucleic acid molecule of any one of claims 1-17, the expression vector of any one of claims 18-25, the host cell of any one of claims 26-29, 32, 33, the host cell of claim 30 or 31, or the method of claims 34-37, wherein the AAV is of serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13.