KR100778941B1 - 623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature - Google Patents

Abstract

Fomitopsis pinicola Eugene 623-C is provided which has excellent cultivation potential of a hypha and a fruit body even at low temperature compared to a conventional Fomitopsis pinicola, thereby being widely used for preparing a functional good with anti-diabetic or anti-oxidative effect. A Fomitopsis pinicola Eugene 623-C showing excellent cultivation potential at low temperature from 10 to 25 deg.C is deposited as a deposition no. KACC 93040P, wherein the Fomitopsis pinicola Eugene 623-C is mutated by treating a wild Fomitopsis pinicola with 0.3% EMS(ethylmethanesulfonate). A Fomitopsis pinicola includes a gene consisting of a sequence described in SEQ ID : NO. 2.

Description

The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature}

The present invention relates to a novel pine needle butterfly Eugene 623-C (KACC 93042P) excellent in low temperature culture. More specifically, the present invention relates to Eugene 623-C (KACC 93042P), a new species of the genus Pinemi butterfly, which shows excellent water temperature and excellent water quality even in a low temperature region at the time of culture.

Fomitopsis pinicola ( Fomitopsis pinicola ) is a genus of fungus funguses belonging to the Democratic Mushroom Prickly Prickly Pear Mushrooms and Rhizome Mushrooms, and grows not only on pine but also on the trunks or trees of various conifers such as fir, spruce, larch, etc. . There is no sack, and the shade is attached to a tree trunk in a shelf shape and forms a semi-circle. The diameter of the shade is about 30cm and the thickness is about 15cm, and the top is covered with a thick cuticle, and the reddish brown strip is surrounded around the mushroom shade. The underside is yellowish white and has a feature of dense micropores. In addition, jannabi pine mushroom grows in the northern hemisphere temperate north, in the country known to have been extinct, but recently updated by farmers 'pine mushrooms jannabi play' (Fomitopsis pinicola Jeseng), a mushroom registered with the National Seed Administration (application number: 2003-498).

In recent years, as interest in health has increased, interest in various special crops that have been introduced has been increased, and among them, the excellent pharmacological effect of pine mushrooms among the rare mushrooms transmitted from the private sector has been revealed. For example, Korean Patent Application No. 10-2006-1430 discloses 'pine pine butterfly extract and its use, which shows the effect of preventing diabetic complications or improving diabetes-induced hypercholesterolemia,' and the Korean Patent Application No. 10-2006. 2006-1431 discloses' pine pine butterfly extract and its use 'showing the inhibitory effect of pancreatic cell damage, and Korean Patent Application No. 10-2006-11691 discloses' pine pine butterfly mushroom culture mycelium extract and blood sugar drop containing it The composition for 'is disclosed, and Korean Patent Application No. 10-2006-9346 discloses' pine pine butterfly extract and its use showing an anti-inflammatory effect,' and other studies that have excellent antioxidant or anti-diabetic effect The results are continuing to come out, and foods made from pine needles mushrooms that show such excellent pharmacological effects For example, red ginseng Cheonggukjang prepared by adding bread composition (see Korean Patent Application No. 10-2006-11690) or pine myrtle mushroom culture mycelium or mycelium culture filtrate (refer to Korean Patent Application No. 10-2006 -8502).

In addition, the main component of the extract of pine zanbi mushrooms exhibiting the pharmacological effect as described above is β-1,3-glucano-β to which β-1,3-glucan and β-1,6-heterogalactomannan are bound It is known as -1,6-heterogalactomannan (see Korean Patent Application No. 10-2006-1430), and it has been studied to increase the yield of polysaccharides extracted from pine needles. There is a lot of research on new varieties. For example, in order to increase the yield of the polysaccharides extracted from the pine berry butterfly, the culture method of increasing the yield of pine berry butterfly mycelium (see Korean Patent Application No. 10-2005-133989) and polysaccharides from pine regenerated mushrooms Extraction method (reference: Korean Patent Application No. 10-2006-45328) and new species of pine zanbi mushroom exhibiting excellent water quality (Refer: Korean Patent Application No. 10-2006-73234).

On the other hand, pine mushrooms are high-temperature mushrooms, which are cultivated between February and May in spring, due to the supply and demand of raw materials in Korea. At this time, it is very difficult to maintain high temperature during incubation even when the inoculation is low due to low outside temperature. Increasingly, there is a need to secure new varieties of pine needles mushrooms that exhibit excellent water quality at low temperatures.

An object of the present invention is to mutant wild pine beetle mushrooms by EMS treatment, and then, to firstly select individuals with high yield and compare their characteristics to develop new varieties of pine beetle mushrooms with excellent culture at low temperature. have.

The present invention is Eugene 623-C ( Fomitopsis) which is a superior species of pomitopsis pinicola excellent in low temperature culture of mycelium. pinicola Eugene 623-C) (KACC 93042P).

Specifically, the present invention provides an excellent cultivation of pine grasshopper butterfly Eugene 623-C at low temperature in the range of 10 ℃ to 25 ℃, the pine grass butterfly mushroom Eugene 623-C is not particularly limited, wild pine grass butterfly mushroom It is preferred that the subjects are mutated by treatment with 0.3% EMS.

In addition, the present invention provides a pine grass butterfly, characterized in that it has a gene consisting of the nucleotide sequence described in SEQ ID NO: 2, the pine grass butterfly is not particularly limited to this, 0.3% of wild pine grass butterfly Pineapple butterfly 623-C mutated by treatment with EMS is preferred.

The present inventors have completed the present invention as a result of earnest research efforts to develop a novel pine berry butterfly variety excellent in low temperature cultivation of mycelium than the known pine berry butterfly.

Selection process of the new strain pine grasshopper butterfly Eugene 623-C according to the present invention is as follows.

Pine shoot butterfly (Eugene 601-F) was collected from 8 ridge fir of Gwangdeoksan, Cheonan, Chungnam. The pine needles were harvested from the fruiting body as a parent, and then separated from the fruiting body, and stored in PDA medium, and then treated with 0.3% of EMS (ethylmethanesulfonate), a chemically-mutated organic source, on the fourth day after being placed in Hyponex liquid medium. 12 hours after the EMS treatment, washed with distilled water, finely ground using a homogenizer and diluted 0.3cc in 1000-fold distilled water, 1cc each of them were collected and plated in petri dishes to separate Single mycelium was isolated. Among them, 40 individuals were selected to investigate their respective characteristics, and 29 individuals showing the same characteristics as those of the parent strain were culled and the characteristics of the remaining 11 individuals having different specificities from those of the parent strain were excellent. The most benign individuals were selected and named as pomitopsis finicola eugene 623-C and deposited with the National Institute of Agricultural Biotechnology (NIAB) (Accession Number: KACC 93042P).

By examining the temperature characteristics of each of the mutated 11 individual varieties, the best varieties were selected for the best low temperature culture and good water quality.

Hereinafter, the specific method of the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited only to these Examples.

Example

Example 1 Preparation of Mutant Formitopsis Finicola Eugene 623-C

Pine shoot butterfly (Eugene 601-F) was collected from 8 ridges of Gwangdeoksan, Cheonan, Chungnam. The pine needles were harvested from the fruiting body as a parent and separated from the fruiting body and stored in PDA medium, which was then placed in Hyponex liquid medium and treated with 0.3% of EMS (ethylmethanesulfonate), a chemically mutated organic source, on the fourth day. 12 hours after the EMS treatment, the water was washed with distilled water, finely ground using a homogenizer, and then diluted 0.3cc in 1000 times distilled water, 1cc each of which was collected and plated in petri dishes. Independent single mycelium was isolated.

40 isolates of the isolated single mycelium were selected to investigate their respective characteristics, 29 individuals showing the same characteristics as the parent strain were removed, and the remaining 11 individuals having different characteristics from the parent strain and three wild strains according to each culture material. The most excellent low temperature culture growth was investigated by comparing growth at low temperature of 15 ° C. and 20 ° C. (see Tables 1 to 3).

For each medium, PDA medium (Ref. Table 1) and heat-resistant PP bottle were mixed with 85% of sawdust and 15% of rice bran, and added with moisture. 20 cm thick and 14 cm in diameter were placed in a heat-resistant vinyl PP bag and sterilized at 121 ° C. for 70 minutes and then inoculated (see Table 3).

Table 1 : Low temperature culture growth study in PDA medium of mutant pomitopsis pinicola and wild strains ^{* 1} (unit: mm)

Formitopsis Finicola variety ^{* 2} 15 ℃ culture 20 ℃ culture 623-A 16.1 37.9 623-B 20.3 40.8 623-C 38.5 52.1 623-D 13.6 36.3 623-E 26.2 43.3 623-F 19.4 42.4 623-G 30.4 43.8 623-H 22.7 37.5 623-I 8.9 23.2 623-J 27.4 44.0 623-K 18.0 36.2 601-A ^{* 3} 25.1 42.3 601-B ^{* 4} 34.2 46.7 601-F ^{* 5} 17.8 37.9

* 1: measured after 7 days of culture

* 2: 623-A ~ 623-K: mutant strain

* 3: 601-A: Wild bacteria from Seoraksan

* 4: 601-B: wild bacteria from Seorak

* 5: 601-F: Cheongan Gwangdeoksan Wild Bacteria

Table 2 : Low Temperature Culture Growth Studies in Heat-Resistant PP Bottles of Mutant Formitopsis Finica and Wild Strains ^{* 1} (Unit: cm)

Formitopsis Finicola variety ^{* 2} 15 ℃ culture 20 ℃ culture 623-A 7.2 11.4 623-B 8.0 13.6 623-C 11.8 16.7 623-D 7.4 11.0 623-E 8.3 12.3 623-F 8.1 12.3 623-G 9.3 13.7 623-H 6.9 11.2 623-I 5.1 10.1 623-J 9.0 10.9 623-K 7.5 11.7 601-A ^{* 3} 9.4 14.0 601-B ^{* 4} 10.2 15.4 601-F ^{* 5} 8.4 12.1

* 1: measured after 15 days of incubation

* 2: 623-A ~ 623-K: mutant strain

* 3: 601-A: Wild bacteria from Seoraksan

* 4: 601-B: wild bacteria from Seorak

* 5: 601-F: Cheongan Gwangdeoksan Wild Bacteria

Table 3 : Cultivation of low-temperature culture in heat-resistant PP bag wood medium of mutant pomitopsis finicola and wild strains ^{* 1} (unit: cm)

Formitopsis Finicola variety ^{* 2} 15 ℃ culture 20 ℃ culture 623-A 12 17 623-B 14 18 623-C 19 20 623-D 11 16 623-E 12 17 623-F 12 16 623-G 11 16 623-H 10 14 623-I 10 15 623-J 13 17 623-K 11 16 601-A ^{* 3} 14 17 601-B ^{* 4} 14 18 601-F ^{* 5} 11 15

* 1: measured after 20 days of incubation

* 2: 623-A ~ 623-K: mutant strain

* 3: 601-A: Wild bacteria from Seoraksan

* 4: 601-B: wild bacteria from Seorak

* 5: 601-F: Cheongan Gwangdeoksan Wild Bacteria

As shown in Tables 1 to 3, among the 11 mutant pine beetle mushrooms, 623-C individuals were found to have the best culture at low temperatures of 15 ℃ and 20 ℃. Specifically, in the PDA medium of Table 1, 623-C individuals showed 1.89-fold culture excellence at 15 ° C and 1.35-fold at 20 ° C, compared to the average of the remaining 10 mutants. On the other hand, 623-C individuals showed culture superiority of 2.16 times at 15 ° C. and 1.37 times at 20 ° C. compared to 601-F, the parent strain.

In addition, in the heat-resistant PP bottle medium of Table 2, the 623-C individual showed 1.53 times higher culture rate at 15 ° C and 1.42 times higher at 20 ° C than the average of the remaining 10 mutants. In comparison, the culture excellence was 1.40 times at 15 ° C and 1.38 times at 20 ° C.

In addition, in the heat-resistant PP bag log medium of Table 3, 623-C individuals showed 1.63 times better culture at 15 ° C and 1.23 times at 20 ° C than the average of the remaining 10 mutants. Compared with that, the culture excellence was 1.72 times at 15 ° C and 1.33 times at 20 ° C.

Example 2 Genome Analysis

To compare the genomes of the mutated pine needle butterfly Eugene 623-C and its parent, Eugene 601-F, the nucleotide sequence of the two individuals (Fomitopsis pinicola internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA, complete sequence; and internal transcribed spacer 2, partial sequence) were analyzed and the results are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

SEQ ID NO: 1 : Nucleotide Sequence of Pineapple Butterfly Eugene 601-F

TCATTAATGAATTCTGAGAGGGGTTGTAGCTGGCCG T TT C GTTTGAGCGGCATGTGCACGCCCTGATCATTATCCATCTCACACACCTGTGCACATACTGTAGGTCGGCTTTTGATTGGAGTGGGGTCTTCATCGACTCTGCTTTTTA TTGGGGCCTTCCTATGTTTTATCACACACTACTTCAGTTTAAAGAATGTCCTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCA TGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGACTTGGAGGTTTATTGCCGGTACCTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTTGTGGATCAGCTTATCGGTGTGATAAAATGTCTAC A C A GAA G CCGTTACTG CATATTATTCGGCTTCCAATC C TCCTTCACGGGACAATAACTTTGACCTT

SEQ ID NO: 2 shows a base sequence of Eugene 623-C.

TCATTAATGAATTCTGAGAGGGGTTGTAGCTGGCCG C TT T GTTTGAGCGGCATGTGCACGCCCTGATCATTATCCATCTCACACACCTGTGCACATACTGTAGGTCGGCTTTTGATTGGAGTGGGGTCTTCATCGACTCTGCTTTTTA G TTGGGGCCTTCCTATGTTTTATCACACACTACTTCAGTTTAAAGAATGTCCTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGACTTGGAGGTTTATTGCCGGTACCTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTTGTGGATCAGCTTATCGGTGTGATAAAATGTCTAC G CCGTTACTG T GAA G CATATTATTCGGCTTCCAATC G TCCTTCACGGGACAATAACTTTGACCTT

As shown in SEQ ID NOs: 1 and 2, the base sequence of Eugene 623-C pine needle butterfly mushroom Eugene 623-C and the base sequence with the parent Eugene 601-F were all 7 different places, and the underlined.

Eugene 623-C of the present invention, pine needle butterfly mushroom Eugene 623-C, compared to conventional pine butterfly butterfly or bovine butterfly butterfly mushrooms, because of excellent low temperature culture of mycelium and fruiting body containing pine needle butterfly that exhibits anti-diabetic effect or antioxidant effect It can be widely used in the manufacture of functional foods.

Attach sequence list electronic file  

Claims (4)

Fomitopsis pinicola Eugene 623-C (Accession No .: KACC 93040P) with excellent cultureability at low temperatures ranging from 10 ° C to 25 ° C. The method of claim 1, Eugene 623-C pine grass butterfly butterfly Eugene 623-C, characterized in that mutated by treating the wild pine grass butterfly individual with 0.3% (ethylmethanesulfonate) EMS. Pine needles mushrooms having a gene consisting of the nucleotide sequence of SEQ ID NO: 2. The method of claim 3, wherein The pine grass butterfly mushroom is a pine grass butterfly butterfly, characterized in that the jinjin 623-C pine mutant mushroom mutated by treating 0.3% EMS of wild pine berry butterfly.