KR100778941B1 - 623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature - Google Patents

623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature Download PDF

Info

Publication number
KR100778941B1
KR100778941B1 KR1020060115324A KR20060115324A KR100778941B1 KR 100778941 B1 KR100778941 B1 KR 100778941B1 KR 1020060115324 A KR1020060115324 A KR 1020060115324A KR 20060115324 A KR20060115324 A KR 20060115324A KR 100778941 B1 KR100778941 B1 KR 100778941B1
Authority
KR
South Korea
Prior art keywords
pine
eugene
butterfly
low temperature
fomitopsis pinicola
Prior art date
Application number
KR1020060115324A
Other languages
Korean (ko)
Inventor
이현구
이선인
Original Assignee
유진바이오팜영농조합법인
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 유진바이오팜영농조합법인 filed Critical 유진바이오팜영농조합법인
Priority to KR1020060115324A priority Critical patent/KR100778941B1/en
Application granted granted Critical
Publication of KR100778941B1 publication Critical patent/KR100778941B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H15/00Fungi; Lichens
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14Fungi; Culture media therefor
    • C12N1/145Fungal isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/645Fungi ; Processes using fungi

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Biomedical Technology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Fomitopsis pinicola Eugene 623-C is provided which has excellent cultivation potential of a hypha and a fruit body even at low temperature compared to a conventional Fomitopsis pinicola, thereby being widely used for preparing a functional good with anti-diabetic or anti-oxidative effect. A Fomitopsis pinicola Eugene 623-C showing excellent cultivation potential at low temperature from 10 to 25 deg.C is deposited as a deposition no. KACC 93040P, wherein the Fomitopsis pinicola Eugene 623-C is mutated by treating a wild Fomitopsis pinicola with 0.3% EMS(ethylmethanesulfonate). A Fomitopsis pinicola includes a gene consisting of a sequence described in SEQ ID : NO. 2.

Description

저온 배양성이 우수한 신규한 소나무잔나비버섯 유진 623-C{The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature}The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature}

본 발명은 저온 배양성이 우수한 신규한 소나무잔나비버섯 유진 623-C(KACC 93042P)에 관한 것이다. 보다 상세하게는 본 발명은 저온 배양성이 우수하여 배양 시기에 기온이 낮은 지역에서도 우수한 수량성을 나타내는 포미톱시스속 신품종 소나무잔나비버섯 유진 623-C(KACC 93042P)에 관한 것이다. The present invention relates to a novel pine needle butterfly Eugene 623-C (KACC 93042P) excellent in low temperature culture. More specifically, the present invention relates to Eugene 623-C (KACC 93042P), a new species of the genus Pinemi butterfly, which shows excellent water temperature and excellent water quality even in a low temperature region at the time of culture.

소나무잔나비버섯(Fomitopsis pinicola)은 진균류에 속하는 담자균류 버섯 중 민주름버섯목 구멍장이 버섯과 잔나비버섯속에 속하며, 소나무뿐만 아니라 전나무, 가문비나무, 낙엽송 등의 각종 침엽수의 고목 또는 생목의 줄기에도 자생한다. 자루가 없고 갓은 나무줄기에 선반모양으로 붙어서 반원형을 이루며, 갓의 지름은 30cm, 두께는 15cm 정도되는 버섯으로 상단은 두꺼운 각피로 덮여 있어 단단하고, 버섯 갓 둘레 부분에 적갈색의 띠가 둘러져 있으며, 밑면은 황백색으로 미세한 관 공이 밀포된 특징을 가지고 있다. 또한, 소나무잔나비버섯은 북반구 온대 이북에서 자라며, 우리나라에서는 멸종되었다고 알려져 있으나, 최근 한 농민에 의하여 새롭게 '소나무잔나비 재생버섯'(Fomitopsis pinicola Jeseng)으로 명명되고, 국립종자관리소에 등록(출원번호: 2003-498)된 버섯이다. Fomitopsis pinicola ( Fomitopsis pinicola ) is a genus of fungus funguses belonging to the Democratic Mushroom Prickly Prickly Pear Mushrooms and Rhizome Mushrooms, and grows not only on pine but also on the trunks or trees of various conifers such as fir, spruce, larch, etc. . There is no sack, and the shade is attached to a tree trunk in a shelf shape and forms a semi-circle. The diameter of the shade is about 30cm and the thickness is about 15cm, and the top is covered with a thick cuticle, and the reddish brown strip is surrounded around the mushroom shade. The underside is yellowish white and has a feature of dense micropores. In addition, jannabi pine mushroom grows in the northern hemisphere temperate north, in the country known to have been extinct, but recently updated by farmers 'pine mushrooms jannabi play' (Fomitopsis pinicola Jeseng), a mushroom registered with the National Seed Administration (application number: 2003-498).

최근에 와서, 건강에 관한 관심이 고조되면서 전래되어 오던 각종 특용작물에 대한 관심이 증대되고 있는데, 그 중 민간에서 전해오던 희귀 버섯 중에 소나무잔나비버섯의 우수한 약리효과가 밝혀지고 있다. 예를 들어, 대한민국 특허출원 제 10-2006-1430호에는 '당뇨합병증 예방효과 또는 당뇨 유도성 고콜레스테롤 혈증 개선효과를 나타내는 소나무잔나비버섯 추출물 및 그 용도'가 개시되어 있고, 대한민국 특허출원 제 10-2006-1431호에는 '췌장세포 손상 억제효과를 나타내는 소나무잔나비버섯 추출물 및 그 용도'가 개시되어 있으며, 대한민국 특허출원 제 10-2006-11691호에는 '소나무잔나비버섯 배양균사체 추출물 및 그를 함유한 혈당강하용 조성물'이 개시되어 있고, 대한민국 특허출원 제 10-2006-9346호에는 '항염증 효과를 나타내는 소나무잔나비버섯 추출물 및 그 용도'가 개시되어 있으며, 그 밖에 항산화 효과 또는 항당뇨 효과가 우수하다는 연구 결과가 계속하여 나오고 있고, 이러한 우수한 약리효과를 나타내는 소나무잔나비버섯을 사용하여 만든 식품들도 개발되고 있는데 예를 들어, 빵 조성물(참조: 대한민국 특허출원 제 10-2006-11690호)이나 소나무잔나비버섯 배양 균사체 또는 균사체 배양여액을 첨가하여 제조한 홍삼 청국장(참조: 대한민국 특허출원 제 10-2006-8502호)을 들 수 있다. In recent years, as interest in health has increased, interest in various special crops that have been introduced has been increased, and among them, the excellent pharmacological effect of pine mushrooms among the rare mushrooms transmitted from the private sector has been revealed. For example, Korean Patent Application No. 10-2006-1430 discloses 'pine pine butterfly extract and its use, which shows the effect of preventing diabetic complications or improving diabetes-induced hypercholesterolemia,' and the Korean Patent Application No. 10-2006. 2006-1431 discloses' pine pine butterfly extract and its use 'showing the inhibitory effect of pancreatic cell damage, and Korean Patent Application No. 10-2006-11691 discloses' pine pine butterfly mushroom culture mycelium extract and blood sugar drop containing it The composition for 'is disclosed, and Korean Patent Application No. 10-2006-9346 discloses' pine pine butterfly extract and its use showing an anti-inflammatory effect,' and other studies that have excellent antioxidant or anti-diabetic effect The results are continuing to come out, and foods made from pine needles mushrooms that show such excellent pharmacological effects For example, red ginseng Cheonggukjang prepared by adding bread composition (see Korean Patent Application No. 10-2006-11690) or pine myrtle mushroom culture mycelium or mycelium culture filtrate (refer to Korean Patent Application No. 10-2006 -8502).

또한, 상기와 같은 약리효과를 나타내는 소나무잔나비버섯의 추출물의 주성 분은 β-1,3-글루칸과 β-1,6-헤테로갈락토만난이 결합되어 있는 β-1,3-글루카노-β-1,6-헤테로갈락토만난으로 알려져 있는데(참조: 대한민국 특허출원 제 10-2006-1430호), 이러한 소나무잔나비버섯으로부터 추출된 다당류의 수율을 증가시키기 위한 연구 및 수량성이 우수한 소나무잔나비버섯의 신품종에 대한 연구가 많이 이루어지고 있다. 예를 들면, 상기 소나무잔나비버섯으로부터 추출된 다당류의 수율을 증가시키기 위한, 소나무잔나비버섯 균사체의 수율을 높이는 배양방법(참조: 대한민국 특허출원 제 10-2005-133989호)과 소나무재생버섯으로부터의 다당류 추출법(참조: 대한민국 특허출원 제 10-2006-45328호) 및 우수한 수량성을 나타내는 소나무잔나비버섯 신품종(참조: 대한민국 특허출원 제 10-2006-73234호)을 들 수 있다. In addition, the main component of the extract of pine zanbi mushrooms exhibiting the pharmacological effect as described above is β-1,3-glucano-β to which β-1,3-glucan and β-1,6-heterogalactomannan are bound It is known as -1,6-heterogalactomannan (see Korean Patent Application No. 10-2006-1430), and it has been studied to increase the yield of polysaccharides extracted from pine needles. There is a lot of research on new varieties. For example, in order to increase the yield of the polysaccharides extracted from the pine berry butterfly, the culture method of increasing the yield of pine berry butterfly mycelium (see Korean Patent Application No. 10-2005-133989) and polysaccharides from pine regenerated mushrooms Extraction method (reference: Korean Patent Application No. 10-2006-45328) and new species of pine zanbi mushroom exhibiting excellent water quality (Refer: Korean Patent Application No. 10-2006-73234).

한편, 소나무잔나비버섯은 고온성 버섯으로 우리나라의 원료 수급 사정상 봄철 2월에서 5월 사이에 배양이 이루어지는데, 이 시기에는 외부 기온이 낮아 접종이 이루어져도 배양시 고온을 유지하기가 매우 힘들고 난방비가 가중되어, 저온에서 우수한 수량성을 나타내는 소나무잔나비버섯의 신품종을 확보하여야 할 필요성이 대두되고 있다. On the other hand, pine mushrooms are high-temperature mushrooms, which are cultivated between February and May in spring, due to the supply and demand of raw materials in Korea. At this time, it is very difficult to maintain high temperature during incubation even when the inoculation is low due to low outside temperature. Increasingly, there is a need to secure new varieties of pine needles mushrooms that exhibit excellent water quality at low temperatures.

본 발명의 목적은 야생 소나무잔나비버섯 개체를 EMS 처리에 의하여 돌연변이 시킨 다음 1차로 수량성이 우수한 개체를 선발하고 각자의 특성을 비교하여 저온에서 배양성이 우수한 소나무잔나비버섯의 새로운 품종을 개발하는 데 있다. An object of the present invention is to mutant wild pine beetle mushrooms by EMS treatment, and then, to firstly select individuals with high yield and compare their characteristics to develop new varieties of pine beetle mushrooms with excellent culture at low temperature. have.

본 발명은 균사체의 저온 배양성이 우수한 포미톱시스 피니콜라의 우량품종인 소나무잔나비버섯 유진 623-C(Fomitopsis pinicola Eugene 623-C)(KACC 93042P)를 제공한다. The present invention is Eugene 623-C ( Fomitopsis) which is a superior species of pomitopsis pinicola excellent in low temperature culture of mycelium. pinicola Eugene 623-C) (KACC 93042P).

구체적으로 본 발명은 10℃ 내지 25℃ 범위의 저온에서의 배양성이 우수한 소나무잔나비버섯 유진 623-C를 제공하며, 상기 소나무잔나비버섯 유진 623-C는 특별히 이에 제한되지는 않지만, 야생 소나무잔나비버섯 개체를 0.3%의 EMS로 처리하여 돌연변이 시킨 것이 바람직하다. Specifically, the present invention provides an excellent cultivation of pine grasshopper butterfly Eugene 623-C at low temperature in the range of 10 ℃ to 25 ℃, the pine grass butterfly mushroom Eugene 623-C is not particularly limited, wild pine grass butterfly mushroom It is preferred that the subjects are mutated by treatment with 0.3% EMS.

또한, 본 발명은 서열번호 2에 기재된 염기서열로 구성되는 유전자를 갖는 것을 특징으로 하는 소나무잔나비버섯을 제공하며, 상기 소나무잔나비버섯은 특별히 이에 제한되지는 않지만, 야생 소나무잔나비버섯 개체를 0.3%의 EMS로 처리하여 돌연변이 시킨 소나무잔나비버섯 623-C인 것이 바람직하다. In addition, the present invention provides a pine grass butterfly, characterized in that it has a gene consisting of the nucleotide sequence described in SEQ ID NO: 2, the pine grass butterfly is not particularly limited to this, 0.3% of wild pine grass butterfly Pineapple butterfly 623-C mutated by treatment with EMS is preferred.

본 발명자들은 기존에 알려진 소나무잔나비버섯보다 균사체의 저온 배양성이 우수한 신규한 소나무잔나비버섯 품종을 개발하기 위하여 예의 연구 노력한 결과 본 발명을 완성하게 되었다. The present inventors have completed the present invention as a result of earnest research efforts to develop a novel pine berry butterfly variety excellent in low temperature cultivation of mycelium than the known pine berry butterfly.

본 발명에 따른 신 균주 소나무잔나비버섯 유진 623-C의 선발 과정은 다음과 같다. Selection process of the new strain pine grasshopper butterfly Eugene 623-C according to the present invention is as follows.

충남 천안시 광덕산의 8부 능선 전나무에서 소나무잔나비버섯(유진 601-F)을 채취하였다. 상기 채취한 소나무잔나비버섯을 모주로 하여 그 자실체로부터 조직분리한 후 PDA 배지에 보관하고, 이를 Hyponex 액체 배지에 치상한 후 4일째 되는 날에 화학적 돌연변이 유기원인 EMS(ethylmethanesulfonate)를 0.3% 처리하였다. 상기 EMS를 처리한 후 12시간 지나서 증류수로 수세하고, 호모게나이저를 이용하여 미세하게 분쇄한 후 0.3cc를 1000배의 증류수에 희석하고 여기에서 각각 1cc를 채취하고 페트리디쉬에 도말하여 각각의 독립된 단일 균사체를 분리하였다. 이 중 40개체를 선발하여 각각의 특성을 조사하고 모주와 동일한 특징을 나타내는 29개체는 도태시키고 모주와 특이성이 다른 나머지 11개체의 품종 특성을 조사하여 그 중 균사체 및 자실체 수량성이 우수하고 저온 배양성이 가장 우수한 개체를 선별하여 이를 포미톱시스 피니콜라 유진 623-C라 명명하고, 농촌진흥청 농업생명공학연구원(NIAB: National Institute of Agricultural Biotechnology)에 기탁하였다(기탁번호: KACC 93042P).Pine shoot butterfly (Eugene 601-F) was collected from 8 ridge fir of Gwangdeoksan, Cheonan, Chungnam. The pine needles were harvested from the fruiting body as a parent, and then separated from the fruiting body, and stored in PDA medium, and then treated with 0.3% of EMS (ethylmethanesulfonate), a chemically-mutated organic source, on the fourth day after being placed in Hyponex liquid medium. 12 hours after the EMS treatment, washed with distilled water, finely ground using a homogenizer and diluted 0.3cc in 1000-fold distilled water, 1cc each of them were collected and plated in petri dishes to separate Single mycelium was isolated. Among them, 40 individuals were selected to investigate their respective characteristics, and 29 individuals showing the same characteristics as those of the parent strain were culled and the characteristics of the remaining 11 individuals having different specificities from those of the parent strain were excellent. The most benign individuals were selected and named as pomitopsis finicola eugene 623-C and deposited with the National Institute of Agricultural Biotechnology (NIAB) (Accession Number: KACC 93042P).

상기 돌연변이 시킨 11개체 품종의 각각의 재료별 온도 특성을 조사하여 가장 저온 배양이 우수하고 수량성도 양호한 최적의 품종을 선별하였다. By examining the temperature characteristics of each of the mutated 11 individual varieties, the best varieties were selected for the best low temperature culture and good water quality.

이하, 본 발명의 구체적인 방법을 실시예를 들어 상세히 설명하고자 하지만, 본 발명의 권리범위는 이들 실시예에만 한정되는 것은 아니다. Hereinafter, the specific method of the present invention will be described in detail with reference to Examples, but the scope of the present invention is not limited only to these Examples.

실시예Example

실시예 1: 돌연변이 포미톱시스 피니콜라 유진 623-C의 제조 Example 1 Preparation of Mutant Formitopsis Finicola Eugene 623-C

충남 천안시 광덕산 8부 능선 전나무에서 소나무잔나비버섯(유진 601-F)을 채취하였다. 상기 채취한 소나무잔나비버섯을 모주로 하여 그 자실체로부터 조직분리한 후 이를 PDA 배지에 보관하고, 이를 Hyponex 액체 배지에 치상한 후 4일째 날에 화학적 돌연변이 유기원인 EMS(ethylmethanesulfonate)를 0.3% 처리하였다. 상기 EMS를 처리한 후 12시간 지나서 증류수로 수세하였고, 호모게나이저를 이용하여 미세하게 분쇄한 후, 0.3cc를 1000배의 증류수에 희석하고 여기에서 각각 1cc를 채취하고 페트리디쉬에 도말하여 각각의 독립된 단일 균사체를 분리하였다. Pine shoot butterfly (Eugene 601-F) was collected from 8 ridges of Gwangdeoksan, Cheonan, Chungnam. The pine needles were harvested from the fruiting body as a parent and separated from the fruiting body and stored in PDA medium, which was then placed in Hyponex liquid medium and treated with 0.3% of EMS (ethylmethanesulfonate), a chemically mutated organic source, on the fourth day. 12 hours after the EMS treatment, the water was washed with distilled water, finely ground using a homogenizer, and then diluted 0.3cc in 1000 times distilled water, 1cc each of which was collected and plated in petri dishes. Independent single mycelium was isolated.

상기 분리된 단일 균사체 중 40개체를 선별하여 각각의 특성을 조사하고, 모주와 동일한 특성을 나타내는 29개체는 도태시키고, 모주와 특성이 다른 나머지 11개체와 야생균주 3종을 각각의 배양 재료에 따른 저온 15℃ 및 20℃에서의 생장 비교를 통하여 가장 저온배양 생육이 우수한 개체를 조사하였다(참조: 표 1 내지 표 3). 40 isolates of the isolated single mycelium were selected to investigate their respective characteristics, 29 individuals showing the same characteristics as the parent strain were removed, and the remaining 11 individuals having different characteristics from the parent strain and three wild strains according to each culture material. The most excellent low temperature culture growth was investigated by comparing growth at low temperature of 15 ° C. and 20 ° C. (see Tables 1 to 3).

각각의 배지는 종류별로 PDA 배지(참조: 표 1)와 내열성 PP병에 톱밥 85%와 미강 15%를 혼합하고 수분을 가하여 121℃에서 70분 멸균한 종균용 내열성 PP용기(참조: 표 2) 및 전나무 원목 두께 20cm, 직경 14cm를 내열성 비닐 PP백에 담아 121℃, 70분 멸균한 후 접종한(참조: 표 3) 3개 구역으로 나누어 측정하였고 각각은 5개씩 조사하여 평균하였다. For each medium, PDA medium (Ref. Table 1) and heat-resistant PP bottle were mixed with 85% of sawdust and 15% of rice bran, and added with moisture. 20 cm thick and 14 cm in diameter were placed in a heat-resistant vinyl PP bag and sterilized at 121 ° C. for 70 minutes and then inoculated (see Table 3).

표 1: 돌연변이 포미톱시스 피니콜라와 야생균주의 PDA 배지에서의 저온배양 생육조사*1(단위: mm) Table 1 : Low temperature culture growth study in PDA medium of mutant pomitopsis pinicola and wild strains * 1 (unit: mm)

포미톱시스 피니콜라 품종*2 Formitopsis Finicola variety * 2 15℃ 배양15 ℃ culture 20℃ 배양20 ℃ culture 623-A623-A 16.116.1 37.937.9 623-B623-B 20.320.3 40.840.8 623-C623-C 38.538.5 52.152.1 623-D623-D 13.613.6 36.336.3 623-E623-E 26.226.2 43.343.3 623-F623-F 19.419.4 42.442.4 623-G623-G 30.430.4 43.843.8 623-H623-H 22.722.7 37.537.5 623-I623-I 8.98.9 23.223.2 623-J623-J 27.427.4 44.044.0 623-K623-K 18.018.0 36.236.2 601-A*3 601-A * 3 25.125.1 42.342.3 601-B*4 601-B * 4 34.234.2 46.746.7 601-F*5 601-F * 5 17.817.8 37.937.9

*1: 각각 7일 배양 후 측정* 1: measured after 7 days of culture

*2: 623-A ~ 623-K : 돌연변이 균주* 2: 623-A ~ 623-K: mutant strain

*3: 601-A: 설악산 채취 야생균주* 3: 601-A: Wild bacteria from Seoraksan

*4: 601-B: 설악산 채취 야생균주* 4: 601-B: wild bacteria from Seorak

*5: 601-F: 천안 광덕산 채취 야생균주* 5: 601-F: Cheongan Gwangdeoksan Wild Bacteria

표 2: 돌연변이 포미톱시스 피니콜라와 야생균주의 내열성 PP 병배지에서의 저온배양 생육조사*1(단위: cm) Table 2 : Low Temperature Culture Growth Studies in Heat-Resistant PP Bottles of Mutant Formitopsis Finica and Wild Strains * 1 (Unit: cm)

포미톱시스 피니콜라 품종*2 Formitopsis Finicola variety * 2 15℃ 배양15 ℃ culture 20℃ 배양20 ℃ culture 623-A623-A 7.27.2 11.411.4 623-B623-B 8.08.0 13.613.6 623-C623-C 11.811.8 16.716.7 623-D623-D 7.47.4 11.011.0 623-E623-E 8.38.3 12.312.3 623-F623-F 8.18.1 12.312.3 623-G623-G 9.39.3 13.713.7 623-H623-H 6.96.9 11.211.2 623-I623-I 5.15.1 10.110.1 623-J623-J 9.09.0 10.910.9 623-K623-K 7.57.5 11.711.7 601-A*3 601-A * 3 9.49.4 14.014.0 601-B*4 601-B * 4 10.210.2 15.415.4 601-F*5 601-F * 5 8.48.4 12.112.1

*1: 각각 15일 배양 후 측정* 1: measured after 15 days of incubation

*2: 623-A ~ 623-K : 돌연변이 균주* 2: 623-A ~ 623-K: mutant strain

*3: 601-A: 설악산 채취 야생균주* 3: 601-A: Wild bacteria from Seoraksan

*4: 601-B: 설악산 채취 야생균주* 4: 601-B: wild bacteria from Seorak

*5: 601-F: 천안 광덕산 채취 야생균주* 5: 601-F: Cheongan Gwangdeoksan Wild Bacteria

표 3: 돌연변이 포미톱시스 피니콜라와 야생균주의 내열성 PP백 원목 배지에서의 저온배양 생육조사*1(단위: cm) Table 3 : Cultivation of low-temperature culture in heat-resistant PP bag wood medium of mutant pomitopsis finicola and wild strains * 1 (unit: cm)

포미톱시스 피니콜라 품종*2 Formitopsis Finicola variety * 2 15℃ 배양15 ℃ culture 20℃ 배양20 ℃ culture 623-A623-A 1212 1717 623-B623-B 1414 1818 623-C623-C 1919 2020 623-D623-D 1111 1616 623-E623-E 1212 1717 623-F623-F 1212 1616 623-G623-G 1111 1616 623-H623-H 1010 1414 623-I623-I 1010 1515 623-J623-J 1313 1717 623-K623-K 1111 1616 601-A*3 601-A * 3 1414 1717 601-B*4 601-B * 4 1414 1818 601-F*5 601-F * 5 1111 1515

*1: 각각 20일 배양 후 측정* 1: measured after 20 days of incubation

*2: 623-A ~ 623-K : 돌연변이 균주* 2: 623-A ~ 623-K: mutant strain

*3: 601-A: 설악산 채취 야생균주* 3: 601-A: Wild bacteria from Seoraksan

*4: 601-B: 설악산 채취 야생균주* 4: 601-B: wild bacteria from Seorak

*5: 601-F: 천안 광덕산 채취 야생균주* 5: 601-F: Cheongan Gwangdeoksan Wild Bacteria

상기 표 1 내지 표 3에서 보는 바와 같이, 돌연변이 소나무잔나비버섯 11개체 중, 623-C 개체가 15℃ 및 20℃의 저온에서 배양성이 가장 우수함을 알 수 있었다. 구체적으로, 상기 표 1의 PDA 배지에서는, 623-C 개체가 나머지 돌연변이 10개체의 평균에 비하여, 15℃에서는 1.89배, 20℃에서는 1.35배의 배양 우수성을 나타내었다. 한편, 623-C 개체는 모주인 601-F에 비하여, 15℃에서는 2.16배, 20℃에서는 1.37배의 배양 우수성을 나타내었다. As shown in Tables 1 to 3, among the 11 mutant pine beetle mushrooms, 623-C individuals were found to have the best culture at low temperatures of 15 ℃ and 20 ℃. Specifically, in the PDA medium of Table 1, 623-C individuals showed 1.89-fold culture excellence at 15 ° C and 1.35-fold at 20 ° C, compared to the average of the remaining 10 mutants. On the other hand, 623-C individuals showed culture superiority of 2.16 times at 15 ° C. and 1.37 times at 20 ° C. compared to 601-F, the parent strain.

또한, 상기 표 2의 내열성 PP 병 배지에서는, 623-C 개체가 나머지 돌연변이 10개체의 평균에 비하여, 15℃에서는 1.53배, 20℃에서는 1.42배의 배양 우수성을 나타내었으며, 모주인 601-F에 비하여는, 15℃에서 1.40배, 20℃에서는 1.38배의 배양 우수성을 나타내었다. In addition, in the heat-resistant PP bottle medium of Table 2, the 623-C individual showed 1.53 times higher culture rate at 15 ° C and 1.42 times higher at 20 ° C than the average of the remaining 10 mutants. In comparison, the culture excellence was 1.40 times at 15 ° C and 1.38 times at 20 ° C.

아울러, 상기 표 3의 내열성 PP백 원목 배지에서는, 623-C 개체가 나머지 돌연변이 10개체의 평균에 비하여, 15℃에서는 1.63배, 20℃에서는 1.23배의 배양 우수성을 나타내었으며, 모주인 601-F에 비하여는, 15℃에서 1.72배, 20℃에서는 1.33배의 배양 우수성을 나타내었다.In addition, in the heat-resistant PP bag log medium of Table 3, 623-C individuals showed 1.63 times better culture at 15 ° C and 1.23 times at 20 ° C than the average of the remaining 10 mutants. Compared with that, the culture excellence was 1.72 times at 15 ° C and 1.33 times at 20 ° C.

실시예 2: 유전체 분석 Example 2 Genome Analysis

돌연변이시킨 소나무잔나비버섯 유진 623-C와 그의 모주인 유진 601-F의 유전체를 비교하기 위하여 상기 두 개체의 염기서열(Fomitopsis pinicola internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA, complete sequence; and internal transcribed spacer 2, partial sequence)을 분석하고 그 결과를 하기 서열번호 1 및 서열번호 2에 나타내었다. To compare the genomes of the mutated pine needle butterfly Eugene 623-C and its parent, Eugene 601-F, the nucleotide sequence of the two individuals (Fomitopsis pinicola internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA, complete sequence; and internal transcribed spacer 2, partial sequence) were analyzed and the results are shown in SEQ ID NO: 1 and SEQ ID NO: 2.

서열번호 1: 소나무잔나비버섯 유진 601-F의 염기서열 SEQ ID NO: 1 : Nucleotide Sequence of Pineapple Butterfly Eugene 601-F

TCATTAATGAATTCTGAGAGGGGTTGTAGCTGGCCGTTTCGTTTGAGCGGCATGTGCACGCCCTGATCATTATCCATCTCACACACCTGTGCACATACTGTAGGTCGGCTTTTGATTGGAGTGGGGTCTTCATCGACTCTGCTTTTTAATTGGGGCCTTCCTATGTTTTATCACACACTACTTCAGTTTAAAGAATGTCCTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCA TGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGACTTGGAGGTTTATTGCCGGTACCTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTTGTGGATCAGCTTATCGGTGTGATAAAATGTCTACCCCGTTACTGGGAAACATATTATTCGGCTTCCAATCCTCCTTCACGGGACAATAACTTTGACCTTTCATTAATGAATTCTGAGAGGGGTTGTAGCTGGCCG T TT C GTTTGAGCGGCATGTGCACGCCCTGATCATTATCCATCTCACACACCTGTGCACATACTGTAGGTCGGCTTTTGATTGGAGTGGGGTCTTCATCGACTCTGCTTTTTA TTGGGGCCTTCCTATGTTTTATCACACACTACTTCAGTTTAAAGAATGTCCTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCA TGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGACTTGGAGGTTTATTGCCGGTACCTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTTGTGGATCAGCTTATCGGTGTGATAAAATGTCTAC A C A GAA G CCGTTACTG CATATTATTCGGCTTCCAATC C TCCTTCACGGGACAATAACTTTGACCTT

서열번호 2: 소나무잔나비버섯 유진 623-C의 염기서열 SEQ ID NO: 2 shows a base sequence of Eugene 623-C.

TCATTAATGAATTCTGAGAGGGGTTGTAGCTGGCCGCTTTGTTTGAGCGGCATGTGCACGCCCTGATCATTATCCATCTCACACACCTGTGCACATACTGTAGGTCGGCTTTTGATTGGAGTGGGGTCTTCATCGACTCTGCTTTTTAGTTGGGGCCTTCCTATGTTTTATCACACACTACTTCAGTTTAAAGAATGTCCTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGACTTGGAGGTTTATTGCCGGTACCTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTTGTGGATCAGCTTATCGGTGTGATAAAATGTCTACGCCGTTACTGTGAAGCATATTATTCGGCTTCCAATCGTCCTTCACGGGACAATAACTTTGACCTT TCATTAATGAATTCTGAGAGGGGTTGTAGCTGGCCG C TT T GTTTGAGCGGCATGTGCACGCCCTGATCATTATCCATCTCACACACCTGTGCACATACTGTAGGTCGGCTTTTGATTGGAGTGGGGTCTTCATCGACTCTGCTTTTTA G TTGGGGCCTTCCTATGTTTTATCACACACTACTTCAGTTTAAAGAATGTCCTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGACTTGGAGGTTTATTGCCGGTACCTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTTGTGGATCAGCTTATCGGTGTGATAAAATGTCTAC G CCGTTACTG T GAA G CATATTATTCGGCTTCCAATC G TCCTTCACGGGACAATAACTTTGACCTT

상기 서열번호 1 및 2에서 보듯이, 본 발명의 소나무잔나비버섯 유진 623-C의 염기서열에서 모주인 유진 601-F와의 염기서열과 서로 다른 곳은 모두 7군데 있었으며, 이를 밑줄로 표시하였다. As shown in SEQ ID NOs: 1 and 2, the base sequence of Eugene 623-C pine needle butterfly mushroom Eugene 623-C and the base sequence with the parent Eugene 601-F were all 7 different places, and the underlined.

본 발명의 소나무잔나비버섯 유진 623-C는 종래의 소나무잔나비버섯 또는 소 나무잔나비 재생버섯에 비하여, 균사체 및 자실체의 저온 배양성이 우수하므로 항당뇨 효과 또는 항산화 효과 등을 나타내는 소나무잔나비버섯을 포함하는 기능성 식품의 제조에 널리 활용될 수 있다. Eugene 623-C of the present invention, pine needle butterfly mushroom Eugene 623-C, compared to conventional pine butterfly butterfly or bovine butterfly butterfly mushrooms, because of excellent low temperature culture of mycelium and fruiting body containing pine needle butterfly that exhibits anti-diabetic effect or antioxidant effect It can be widely used in the manufacture of functional foods.

서열목록 전자파일 첨부 Attach sequence list electronic file  

Claims (4)

10℃ 내지 25℃ 범위의 저온에서의 배양성이 우수한 소나무잔나비버섯 유진 623-C(Fomitopsis pinicola Eugene 623-C)(기탁번호: KACC 93040P). Fomitopsis pinicola Eugene 623-C (Accession No .: KACC 93040P) with excellent cultureability at low temperatures ranging from 10 ° C to 25 ° C. 제 1항에 있어서, The method of claim 1, 상기 소나무잔나비버섯 유진 623-C는 야생 소나무잔나비버섯 개체를 0.3%의 EMS(ethylmethanesulfonate)로 처리하여 돌연변이 시킨 것을 특징으로 하는 소나무잔나비버섯 유진 623-C.Eugene 623-C pine grass butterfly butterfly Eugene 623-C, characterized in that mutated by treating the wild pine grass butterfly individual with 0.3% (ethylmethanesulfonate) EMS. 서열번호 2에 기재된 염기서열로 구성되는 유전자를 갖는 것을 특징으로 하는 소나무잔나비버섯. Pine needles mushrooms having a gene consisting of the nucleotide sequence of SEQ ID NO: 2. 제 3항에 있어서, The method of claim 3, wherein 상기 소나무잔나비버섯은 야생 소나무잔나비버섯 개체를 0.3%의 EMS로 처리하여 돌연변이 시킨 소나무잔나비버섯 유진 623-C인 것을 특징으로 하는 소나무잔나비버섯. The pine grass butterfly mushroom is a pine grass butterfly butterfly, characterized in that the jinjin 623-C pine mutant mushroom mutated by treating 0.3% EMS of wild pine berry butterfly.
KR1020060115324A 2006-11-21 2006-11-21 623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature KR100778941B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020060115324A KR100778941B1 (en) 2006-11-21 2006-11-21 623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020060115324A KR100778941B1 (en) 2006-11-21 2006-11-21 623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature

Publications (1)

Publication Number Publication Date
KR100778941B1 true KR100778941B1 (en) 2007-11-28

Family

ID=39080662

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020060115324A KR100778941B1 (en) 2006-11-21 2006-11-21 623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature

Country Status (1)

Country Link
KR (1) KR100778941B1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050060726A (en) * 2003-12-17 2005-06-22 김천환 Hypoglycemics including fomitosis pinicola extraction and preparing method thereof
US20050238655A1 (en) * 2004-01-06 2005-10-27 Paul Stamets Antiviral activity from medicinal mushrooms
KR20060114725A (en) * 2005-04-27 2006-11-08 김혜경 Composition comprising fomitopsis pinicola for accumulation inhibition or preventing and treatmenting of fat, pharmaceutical preparation and functional food product containing the same

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050060726A (en) * 2003-12-17 2005-06-22 김천환 Hypoglycemics including fomitosis pinicola extraction and preparing method thereof
US20050238655A1 (en) * 2004-01-06 2005-10-27 Paul Stamets Antiviral activity from medicinal mushrooms
KR20060114725A (en) * 2005-04-27 2006-11-08 김혜경 Composition comprising fomitopsis pinicola for accumulation inhibition or preventing and treatmenting of fat, pharmaceutical preparation and functional food product containing the same

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
논문1995.12

Similar Documents

Publication Publication Date Title
KR102123594B1 (en) Cultivation Method of the Fruiting Bodies of Bio-active Cordyceps sp. Using an Extract of Salvia plebeia
US20220369648A1 (en) Endophytic falciphora oryzae fo-r20 and its application
CN112725191B (en) Inonotus tumefaciens strain for promoting germination of orchidaceae seeds and application thereof
CN112322560A (en) Bacillus belgii and application thereof in prevention and control of pear diseases
CN117165494A (en) Kiwi fruit canker biocontrol strain Wq-1 and application thereof
CN108752437B (en) Antibacterial lipopeptide and preparation method and application thereof
CN112358971A (en) A fungus DYM25 with antibacterial, antioxidant and anticancer effects, and its application
CN116606774A (en) Streptomyces strain and application thereof
CN114766285B (en) Ganoderma lucidum strain L4495 and cultivation method and application thereof
KR100523263B1 (en) Media containing mushroom and mushroom culturing method using same
KR100778941B1 (en) 623-The Novel Fomitopsis pinicola Eugene 623-C Having Excellent Cultivation Potential at Low Temperature
CN107325973B (en) Beauveria bassiana strain with strong pathogenicity on corylus avenae sinensis and application thereof
CN112673900B (en) A strain of Rumex crispus and its cultivation, picking and preservation method
CN111548951B (en) Bacillus subtilis Pro6A5, microbial inoculum and preparation method thereof, and application of bacillus subtilis Pro6A5 in cultivation of melons
KR100787965B1 (en) 623-The Novel Fomitopsis pinicola Eugene 623-A Having Excellent Yield Potential
Inácio et al. Techniques for inoculation of Sclerotium rolfsii on Neomarica longifolia and Evolvulus pusillus in Brazil
KR100459869B1 (en) A cultivation method of cordyceps sinensis by using silkworm or its chrysalis
KR101107373B1 (en) Composition for controlling anthracnose of plant comprising Pseudomonas corrugata strain CCR80 and controlling method using the same
CN107828664B (en) Schizophyllum commune XT-1 and cultivation method and application thereof
CN105154336B (en) Trichoderma viride XJ-3 and method for preparing cotton stalk decomposed organic fertilizer by using same
KR101212992B1 (en) The Novel Fomitopsis pinicola Jeseng-2 Having Excellent Yield Potential
CN114717139B (en) Oncorhynchus bacteria strain TP-13 with capacity of promoting growth of new dendrobium roots and application thereof
CN116333891B (en) Biocontrol bacterium JSNL-TX55 for gray mold and anthracnose of strawberries and application thereof
CN111909871B (en) Alcaligenes faecalis for antagonizing peach bacterial perforators and application
CN114456951B (en) Horizontalium fungus strain for promoting growth of ginseng, and method and application thereof

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20121029

Year of fee payment: 6

FPAY Annual fee payment

Payment date: 20131115

Year of fee payment: 7

FPAY Annual fee payment

Payment date: 20141111

Year of fee payment: 8

FPAY Annual fee payment

Payment date: 20151116

Year of fee payment: 9

LAPS Lapse due to unpaid annual fee