KR100773141B1 - 3 3 Variant ORF3 protein derived from PEDV a nuceleic acid encoding the protein method of differentiating wild type and attenuated PEDV using the variant ORF3 protein and gene thereof and a kit for differentiating wild type and attenuated PEDV - Google Patents

Abstract

A porcine epidemic diarrhea virus(PEDV) ORF3 polypeptide which includes 17 amino acids deletion compared to a wild type is provided to play an important role in attenuating the PEDV. A method for detecting attenuated PEDV and a kit for detecting the attenuated PEDV are provided to distinguish a wild type PEDV from an attenuated PEDV easily. A PEDV ORF3 polypeptide includes an amino acid sequence described as SEQ ID : NO. 1. A method for detecting attenuated PEDV comprises the steps of: (a) amplifying an ORF3 gene from a sample including PEDV using a primer set including a first primer binding to the upstream of a nucleotide at position 245 of the ORF3 gene and a second primer binding to the downstream of a nucleotide at position 295 of the ORF3 gene; and (b) identifying the existence of the amplified product or analyzing the size of the amplified product. A kit comprises the primer set and operation instructions.

Description

Porcine Pandemic Diarrhea Virus ORF3 Polypeptide Variants, Nucleic Acids Encoding Nucleic Acids, ORF3 Variants and Mutation Genes to Identify Wild and Attenuated PEVDs nuceleic acid encoding the protein, method of differentiating wild type and attenuated PEDV using the variant ORF3 protein and gene according, and a kit for differentiating wild type and attenuated PEDV}

1A and 1B are diagrams showing the nucleotide sequence and amino acid sequence of ORF3 derived from PEDV DR13 (Accession No. KCCM-10474) and the result of alignment of these with the standard sequence.

2 is a diagram showing the result of electrophoresis of a product obtained on a 2.5% agarose gel by RT-PCR using oligonucleotides of SEQ ID NOs: 5 and 6 as primers and a genome of parent DR13 and attenuated DR13 as a template. to be.

3 is a diagram showing the results of electrophoresis on 2.5% agarose gel of a product obtained by performing RT-PCR using oligonucleotides of SEQ ID NOs: 5 and 6 as primers and templates of various commercial vaccine strains used in Korea. .

FIG. 4 is a diagram showing the result of electrophoresis on the product obtained by performing RT-PCR using oligonucleotides of SEQ ID NOs: 5 and 6 as primers and 12 field isolates as templates. FIG.

The present invention relates to a swine pandemic diarrhea virus (PEDV) ORF3 polypeptide variant, a nucleic acid encoding the same, a method for distinguishing wild-type and attenuated PEDV using ORF3 variants and variant genes, and a kit for distinguishing wild-type and attenuated PEDV. will be.

Porcine epidemic diarrhea virus (PEDV) is a coronavirus And ( Coronaviridae As a member of the family, it is a single-stranded RNA virus with an envelope, causing severe intestinal diarrhea in pigs, leading to severe economic losses in Asia. PEDV related symptoms include diarrhea, anorexia and pyremia.

PEDV the spike (S), membrane (M), a small membrane (sM), made of ORF3 and the nucleocapsid (N) gene, and all of which have been sequenced (Bridgen A, J. Gen Virol 1993 ..; 74:. 1795~1804; Duarte M, etc., J. Gen Virol 1994; 75: . 1195~1200). Adaptation of wild type PEDV to cell culture reduces the toxicity of wild type viruses, which is known to be associated with the loss of ORF3 products (Bridgen A et al . , Adv . Exp . Med. Biol . 1998; 101: 781-786; Tobler K et al . , Adv . Exp . Med . Biol . 1995; 86: 541-542). It is known that the disease is attenuated when the piglets are inoculated with PEDV serially cultured in Vero cells (Kweon CH et al., Vaccine). 1999; 17: 2546-2553).

PEDV attenuated strains have been developed as vaccines to prevent or treat pandemic diarrhea. An example of such an attenuated vaccine is the currently available KPEDV9 strain (KCTC 8641P). Korean Patent Publication No. 1996-023048 discloses KPEDV9. According to the patent document, KPEDV9 isolates the virus from the small intestine and intestine of 6-day-old piglets died of epidemic diarrheal disease, propagates it in Vero cells (ATCC C1008), and continuously passages about 90 times at intervals of 4-5 days. As attenuated strain by carrying out, it is safe but induces immunity in pigs inoculated. In addition, Korean Patent Publication No. 2004-92760 discloses attenuated PEDV DR13 that is attenuated by continuous passage culture of a wild PEDV DR13 strain in Vero cells but has excellent immunogenicity, particularly immunogenicity by oral administration (eg, accession number). PEDV, which is KCCM-10474, is disclosed.

However, even with these prior arts, the ORF3 genes and proteins that are a common cause of attenuation have not been disclosed.

It is an object of the present invention to provide novel PEDV ORF3 proteins and genes encoding them.

Another object of the present invention is to provide a method for distinguishing wild-type and attenuated PEDV by using a deletion portion of the protein or gene.

Another object of the present invention is to provide a kit for distinguishing wild-type and attenuated PEDV, comprising a primer or probe capable of specifically detecting a deletion portion of a gene encoding PEDV ORF3.

The present invention provides swine pandemic diarrhea virus (PEDV) ORF3 polypeptide having the amino acid sequence of SEQ ID NO: 1.

The ORF3 polypeptide of the present invention is a variant protein in which 17 oligopeptides of amino acids 82 to 98 are deleted as compared to the wild type ORF3 polypeptide. This deletion is believed to attenuate the pathogenicity of PEDV and increase immunogenicity. That is, all of the attenuated PEDVs in the PEDV had a deletion of the 17 amino acids, and none of the pathogenic or inactivated PEDVs had a deletion of the 17 amino acids.

Thus, the ORF3 mutant protein can be usefully used to distinguish pathogenic or inactive PEDV from attenuated PEDV.

The present invention also provides a polynucleotide encoding a swine epidemic diarrhea virus (PEDV) ORF3 polypeptide having a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1.

The polynucleotide of the present invention is a variant gene encoding the ORF3 variant protein. As long as it encodes the said ORF3 mutant protein, you may have any nucleotide sequence. Preferably, the polynucleotide has a nucleotide sequence of SEQ ID NO. The polynucleotide is deleted from 245 to 295 nucleotides based on the wild type ORF3 gene. This deletion is believed to coat variant ORF3 protein, which attenuates the pathogenicity of PEDV and increases immunogenicity. That is, all of the attenuated PEDVs in the PEDV had the deletion of the 51 nucleotides in the ORF3 gene, and neither the pathogenic or the inactive PEDV had the 51 nucleotide deletions in the ORF3 gene.

Thus, the ORF3 variant gene can be usefully used to distinguish between pathogenic or inactive PEDV and attenuated PEDV.

The present invention also includes attenuated swine epidemic diarrhea virus, comprising analyzing the sequence of the ORF3 gene from a sample comprising swine pandemic diarrhea virus (PEDV) to determine if there is a deletion of 245 to 295 nucleotides. PEDV) provides a method for detecting.

As a result of the analysis, if nucleotides 245 to 295 are deleted based on the wild-type ORF3 gene, it may be determined as an attenuated PEDV, otherwise it may be determined as a pathogenic or inactive PEDV.

In the method of the present invention, "attenuated PEDV" refers to a PEDV that is infectious but does not exhibit the characteristics of pathogenic PEDV such as diarrhea, dehydration and lethality.

Analysis of the sequence of the ORF3 gene can be performed by any method known in the art. For example, direct sequencing, or indirect sequencing such as PCR, hybridization, restriction enzyme digestion and western blotting may be used, but is not limited to these examples. In the case of using the hybridization, a probe specifically binding to the deletion portion may be achieved by hybridizing with a target sequence and measuring the degree of hybridization. The probe used for hybridization may be immobilized on a substrate such as glass or microarray.

When using a PCR assay, for example, PCR is performed using a primer set comprising a first primer binding upstream of the deletion site and a second primer binding downstream of the deletion site, and the amplification product By analyzing the size. In this case, when the size of the amplification product is small by a difference of about 51 nucleotides compared to the wild type, it may be determined that the attenuated PEDV is present in the sample. The size of the amplification product can be analyzed by any method known in the art. For example, electrophoresis, western blotting, mass spectrometry, and the like can be used, but are not limited to these examples.

When using a PCR assay, as another example, a first primer consisting of a primer that binds upstream of the deletion site or a primer that binds downstream of the deletion site, and a second primer that binds to the deletion site PCR may be performed using a primer set, and the presence or absence of the amplification product may be analyzed. As a result of the analysis, when no amplification product is present, it may be determined that attenuated PEDV is present in the sample. Otherwise, it may be determined that pathogenic PEDV or inactivated PEDV is present in the sample.

Thus, one embodiment of a method for detecting attenuated swine pandemic diarrhea virus (PEDV) of the present invention comprises amplifying the ORF3 gene from a sample comprising swine pandemic diarrhea virus (PEDV); And

It may be a method for detecting attenuated swine epidemic diarrhea virus (PEDV) comprising the step of analyzing the presence of the amplification product or the size of the amplification product.

In the method of the present invention, the amplification is performed using a primer set comprising a first primer that binds upstream of 245 nucleotides of the wild-type ORF3 gene and a second primer that binds downstream of nucleotide 295 of the wild-type ORF3 gene. It may be to be performed by PCR.

In the method of the present invention, the first primer is an oligonucleotide of SEQ ID NO: 3, the second primer is an oligonucleotide of SEQ ID NO: 4, or the first primer is an oligonucleotide of SEQ ID NO: 5, the second primer May be an oligonucleotide of SEQ ID NO: 6, but is not limited to these examples. One skilled in the art can readily design primers that bind upstream of 245 nucleotides or downstream of 295 nucleotides of the wild-type ORF3 gene.

In the method of the present invention, if the result of analysis of the amplification product, 245 to 295 nucleotides are deleted in the ORF gene, it may include the step of determining that attenuated swine epidemic diarrhea virus (PEDV) is present. have.

In addition, in the method of the present invention, the amplification is performed by the first primer consisting of a primer that binds upstream of 245 nucleotides of the wild-type ORF3 gene or a primer that binds downstream of nucleotide 295 of the wild-type ORF3 gene and a wild-type ORF3 gene. It may be performed by PCR using a primer set including a second primer binding to nucleotides 245 to 295 as a primer.

The method of the present invention may include determining that attenuated swine pandemic diarrhea virus (PEDV) is present when the target sequence is not amplified by the PCR.

The present invention also provides a method of preparing a protein, comprising the steps of: separating an ORF3 protein from a sample comprising porcine epidemic diarrhea virus (PEDV); And

It provides a method for detecting attenuated porcine epidemic diarrhea virus (PEDV) comprising the step of analyzing the sequence of the ORF3 protein.

In the method of the present invention, the isolation of the ORF3 protein can be made by any method known in the art. For example, methods such as salting out, filtration, precipitation and chromatography can be used.

In the method of the present invention, the analysis of the ORF3 protein sequence can be made by any method known in the art. Sequencing can be done using direct amino acid sequencing as well as specific reagents such as antibodies that specifically bind to the deletion sites.

In the method of the present invention, if the ORF3 protein is deleted from amino acids 82-98 based on the wild-type ORF3 protein, comprising the step of determining the presence of attenuated porcine epidemic diarrhea virus (PEDV) Can be.

The present invention also provides a kit for detecting attenuated porcine epidemic diarrhea virus (PEDV), the first primer that binds upstream of 245 nucleotides of wild-type ORF3 gene and downstream of nucleotide 295 of wild-type ORF3 gene. Provided is a kit comprising a primer set comprising a second primer and instructions for use.

The first primer is an oligonucleotide of SEQ ID NO: 3, the second primer is an oligonucleotide of SEQ ID NO: 4, the first primer is an oligonucleotide of SEQ ID NO: 5, and the second primer is an oligonucleotide of SEQ ID NO: 6 It may be, but is not limited to these examples. One skilled in the art can readily design primers that bind upstream of 245 nucleotides or downstream of 295 nucleotides of the wild-type ORF3 gene.

The present invention also provides a kit for detecting attenuated porcine epidemic diarrhea virus (PEDV), comprising a primer that binds upstream of 245 nucleotides of wild-type ORF3 gene or a primer that binds downstream of nucleotide 295 of wild-type ORF3 gene. Provided is a kit comprising a primer set and instructions for use comprising a first primer made up and a second primer that binds to nucleotides 245-295 of the wild-type ORF3 gene.

The first primer may be an oligonucleotide of SEQ ID NO: 3 or an oligonucleotide of SEQ ID NO: 4, or the first primer may be an oligonucleotide of SEQ ID NO: 5, and the second primer may be an oligonucleotide of SEQ ID NO: 6, but these It is not limited to the example. One skilled in the art can readily design primers that bind upstream of 245 nucleotides or downstream of 295 nucleotides of the wild-type ORF3 gene.

In the kit of the present invention, the instruction manual performs amplification, for example, PCR using the primer, and attenuates PEDV and pathogenic PEDV depending on the presence or absence of the amplification product obtained as a result of the amplification. The process of dividing is described.

Kits of the present invention may further comprise conventional samples required for the analysis of reagents and / or amplification products required for the amplification of other nucleic acids.

The present invention also provides a kit for detecting attenuated porcine epidemic diarrhea virus (PEDV), the kit comprising a probe and instructions for binding specifically to nucleotides 245 to 295 of the wild-type ORF3 gene.

Those skilled in the art can easily design probes that specifically bind to nucleotides 245-295 of the wild-type ORF3 gene.

In the kit of the present invention, the instruction manual hybridizes with the target sequence amplified from PEDV or PEDV using the probe, and the process of distinguishing attenuated PEDV from pathogenic PEDV according to the degree of hybridization measured as a result of the amplification is described. have. For example, if hybridization is not possible, it can be determined as an attenuated PEDV.

Hereinafter, the present invention will be described in more detail with reference to Examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.

Example

1. Materials and Methods

Materials and methods used in this example are as follows.

(1) cells and viruses

Minimum essential media supplemented with continuous Vero cell line (ATCC, CCL-81) with 5% fetal bovine serum, penicillin (100 units / ml), streptomycin (100 μg / ml) and amphotericin B (0.25 μg / ml) (minimum essential medium: MEM) was maintained regularly. DR13 isolate of PEDV (Accession No. KCCM-10474) continued passage in a 25 cm ² flask by level 100 according to the previously disclosed method (Hofmann, M., 1988, J. Clin. Microbiol. 26: 2235-2239). . PEDV was confirmed by reverse transcriptase polymerase chain reaction (RT-PCR).

(2) virus RNA  extraction

Infected cells were prepared to extract viral RNA. Infected cells were harvested when the cells reached a 70-80% cytopathic effect (CPE). RNA was extracted from the infected cells using TRIzol LS (Invitrogen Corp., Carlsbad, Calif.) According to the manufacturer's instructions.

For PEDV infected cells, 250 μl suspension was directly disrupted by adding 750 μl TRIzol LS reagent in 1.7 mL microtubes. Next, 200 μl of chloroform was added to the mixture and the suspension was centrifuged at 12,000 × g for 10 minutes. The RNA-containing aqueous phase was precipitated with the same amount of isopropanol, maintained at −70 ° C. for 2 hours, and centrifuged at 12,000 × g for 10 minutes. The RNA pellet was washed with 1 ml of 75% ethanol, centrifuged at 12,000 × g for 10 minutes, dried and resuspended in 30 μl of diethyl-pyrocarbonate (DEPC) treated distilled water.

(3) battlefield ORF3  gene RT - PCR Used for primer

To generate the full-length ORF3 gene of PEDV, published primers designed based on published sequences of spikes (S) and small membranes (sM) were used (Song, DS et al. 2003, Vaccine. 21: 1833). -1842). That is, forward primer, 5'-TCCTAGACTTCAACCTTACG-3 '(SEQ ID NO: 3) and reverse primer 5'-GGTGACAAGTGAAGCACAGA-3' (SEQ ID NO: 4) were used to amplify the full length ORF3 gene of PEDV. The size of the amplification product is 833 bp.

(4) battlefield ORF3  For genes RT - PCR

For reverse transcription, 10 μl of extracted RNA and 1 μl of a random primer (hexa-deoxyribonucleotide mixture (TaKaRa BIO INC., Japan)) were mixed. The mixture was denatured by heating to 95 ° C. and immediately placed in ice. In the remaining reagents, 50 μl final volume, 10 μl 5X first strand buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl ₂ ), 10 mM DTT, 0.3 mM of each dNTP and M-MLV reverse transcriptase 100 Unit was added. The mixture was incubated at 37 ° C. for 60 minutes and heated at 95 ° C. for 2-3 minutes to stop the reaction. The cDNA obtained was stored at -20 ° C or immediately amplified.

In PCR, a pair of specific primers were used to amplify the full length ORF3 gene of PEDV. To be precise, 2 μl of cDNA was added to 2.5 μl of 10 × Taq DNA polymerase buffer (Promega, Madison, Wis.), MgCl ₂ Mix with a reaction mixture containing 3 mM, 2.0 μl of dNTPs (2.5 mM / μl), 0.5 μl of each specific primer (10 pmol), 1 μl of Taq DNA polymerase (Promega, Madison, WI), sterilized and filtered 25 μl with distilled (0.2 μm) distilled water. Amplification was performed using a commercial amplification system (Perkin-Elmer, Applied Biosystems, Foster City, Calif). RT-PCR was allowed to stand at 94 ° C. for 5 minutes, then repeated 94 ° C. 30 sec, 53 ° C. 30 sec, and 72 ° C. 30 sec 30 times, finally extended at 72 ° C. for 10 minutes, and then stored at 4 ° C. Was performed.

The RT-PCR product was visualized by electrophoresis in 1.5% agarose gel containing EtBr. Bands of the correct size were cut out and purified using the QIAquick Gel Extraction Kit (QIAGEN) according to the manufacturer's instructions. The ORF3 gene of serially passaged PEDV was amplified via RT-PCR to 0 levels (parent PEDV DR13) and 100 levels (attenuated PEDV DR13).

(5) Cloning of cDNA

Purified RT-PCR products corresponding to the full length ORF3 gene were cloned using the QIAGEN PCR Cloning ^plus Kit (QIAGEN) according to the manufacturer's instructions with minor modifications.

For cloning of cDNA, 4 μl of purified RT-PCR product, 1 μl of pDrive Cloning Vector (50 ng / μl) and 5 μl of 2X ligation master mix were gently mixed and incubated at 16 ° C. for 4 hours.

The transformation protocol was applied to the ligation reaction mixture to allow cells to be competent by heat shock. For transformation, many tubes of QIAGEN EZ competent cells are thawed on ice, SOC medium is warmed at room temperature, then 5 μl of ligation reaction mixture is added per cell tube, gently mixed for 3 seconds, and mixed for 30 minutes. Incubated on ice.

The tube was heated in a 42 ° C. water bath for 90 seconds and immediately incubated on ice. Room temperature SOC medium (250 μl) was added to each tube and 100 μl of each transfection mixture was immediately plated onto LB agar plates containing ampicillin.

The plates were incubated at room temperature until the transformation mixture was absorbed into the agar, then upside down and incubated overnight at 37 ° C. Colonies grown on LB agar plates were incubated in LB broth with shaking at 37 ° C. overnight, and DNA was extracted from the cells using Wizard ^™ Plus Minipreps DNA Purification System (Promega).

To identify the recombinant DNA, restriction enzyme digestion was performed with an enzyme such as EcoRI, followed by electrophoresis through a 1.5% agarose gel.

(6) sequence analysis

All ORF3 recombinant DNA clones are available from Genotech Co. It was sequenced by Ltd (Korea). All sequencing reactions were performed in duplicate, and all sequences were confirmed by sequencing both strands.

(7) alignment and sequencing

Nucleotides and derived amino acid sequences were analyzed by the CLUSTALX v1.83 program and MegAlign software (DNAStar Inc., Madison, Wis., USA).

ORF3 gene nucleotides and derived amino acid sequences of the parental and attenuated PEDV DR13 were compared with the PEDV CV777 (EMBL accession No. Z24733) and Br1 / 87 (EMBL accession No. Z24733) strains (Duart, M. et al. Virology , 198: 466-476).

(8) wild type and vaccine type PEDV To distinguish RT - PCR primer

Primers were designed and aligned based on the ORF3 gene nucleotide sequences of the parental and attenuated PEDV DR13 as well as the CV777 and Br1 / 87 ORF3 gene nucleotide sequences of the GenBank database (National Center for Biotechnology Information, USA). These primers were used to generate cDNA for the ORF3 gene containing a large deletion region. Table 1 shows the nucleotide sequence of the primer, Figure 1a is a diagram showing the relative position of the primer to distinguish between the wild type and vaccine type PEDV.

Table 1. RT-PCR primers to distinguish between wild type PEDV and vaccine type PEDV

primer Nucleotide Sequence (5 '-> 3') Length % GC piece Wild-type products Attenuated product PEDO1 GATGCTGTCCAAGAGTTGGA (SEQ ID NO: 5) 20 50.0 + 245bp 194bp PEDO2 CAAAGCCTGCCAATAAGTGT (SEQ ID NO: 6) 20 45.0 -

(9) partial including large deletion regions ORF3  For genes RT - PCR

Reverse transcription was performed as described above. In PCR, strategies such as amplification of partial ORF3 genes containing large deletion regions were used to distinguish between wild-type and attenuated PEDV through RT-PCR product band size. PCR was performed as described above with simple modifications. PCR was allowed to stand at 94 ° C. for 5 minutes, then repeated 20 seconds at 94 ° C., 20 seconds at 52 ° C., 30 seconds at 72 ° C., and finally extended at 72 ° C. for 7 minutes, and maintained at 4 ° C. . RT-PCR products were visualized by electrophoresis on a 2.5% agarose gel containing EtBr. The amplification products of wild type and attenuated PEDV were 245 bp and 194 bp, respectively.

In order to analyze whether this RT-PCR is useful in terms of differentiation between wild type and attenuated PEDV, the reaction was carried out with the following reagents.

Parent DR13 (Korean Patent Publication No. 2004-92760), commercial vaccine strain (Korean PED oral vaccine strain, attenuated DR13 (Accession No. KCCM-10474), isolated from a piglet infected with pandemic diarrheal disease (Green Cross Veterinary Product Co. , Ltd., Yong-In, Korea), Korea PED live virus vaccine strain KPEDV-9 (Accession No. KCTC8641P) (Green Cross Veterinary Product Co., Ltd., Yong-In, Korea), Japan PED live virus vaccine strain Phosphorus P-5V (Nisseiken Co., Ltd., Tokyo, Japan), inactivated vaccine strain SM98-1 (Green Cross Veterinary Product Co., Ltd., Yong-In, Korea)). In addition, twelve field isolates of PEDV, already identified as positive for PEDV by RT-PCR or histopathological examination, were analyzed by RT-PCR for partial ORF3 genes containing large deletion regions.

Example  One : ORF3 Variant  Nucleotide and Deduced Amino Acid Sequence Analysis

The base sequence of ORF3 from attenuated PEDV PEDV DR13 (Accession No. KCCM-10474) was analyzed and the amino acid sequence was deduced therefrom.

FIG. 1A is a diagram showing the nucleotide sequence of ORF3 derived from PEDV DR13 (Accession No. KCCM-10474) and the result of alignment with the standard sequence. The part indicated by a back row in FIG. 1A represents a primer of SEQ ID NO: 5 located upstream of the deletion site and a primer of SEQ ID NO: 6 located downstream.

As shown in FIG. 1A, the nucleotide sequence encoding the full-length ORF3 of the parent PEDV DR13 comprises a single 675 base ORF starting with A nucleotide of ATG, the start codon, starting with 1 nucleotide, and 675 nucleotides of A of the TGA, the stop codon. do. The ORF3 has 18 and 20 nucleotide mismatches and 3 nucleotide insertions, respectively, compared to the standard strains CV777 and Brl / 87. The ORF3 has a GC content of 159 adenine (23.56%), 132 cytosine (19.56%), 130 guanine (19.26%) and 254 thymine (37.63%) nucleotides, and 37.71%.

1B is a diagram showing the results of aligning the amino acids of ORF3 derived from PEDV DR13 (Accession No. KCCM-10474) and the standard sequence thereof.

As shown in FIG. 1B, the full length ORF13 gene of the parent PEDV DR13 encodes a protein of 224 amino acids with an expected molecular weight of 25.3 kDa. The ORF3 protein has 7 and 9 amino acid mismatches and one amino acid insertion, respectively, compared to the standard strains CV777 and Brl / 87.

As shown in FIG. 1A, the nucleotide sequence encoding the full-length ORF3 of the attenuated PEDV DR13 is a single 624 base ORF consisting of nucleotide 624 of A of the start codon ATG and starting with nucleotide 1 of the stop codon TGA. It includes. The coding region of the gene has 12 (14) and 12 nucleotide mismatches as compared to CV777 (Brl / 87) and parent DR13, respectively, and has three nucleotide insertions compared to CV777 (Brl / 87), CV777 (Brl / 87) and 51 nucleotide deletions relative to the parent DR13. The ORF3 has a GC content of 149 adenine (23.88%), 119 cytosine (19.07%), 123 guanine (19.71%) and 233 thymine (37.34%) nucleotides, and 38.78%.

As shown in FIG. 1B, the full length ORF13 gene of attenuated PEDV DR13 encodes a protein of 207 amino acids with an expected molecular weight of 23.4 kDa. The attenuated PEDV DR13 ORF3 protein has 5 (7) and 1 amino acid mismatches as compared to the standard strains CV777 (Brl / 87) and parent DR13, respectively, compared to CV777 (Brl / 87) and parent DR13 Has 17 amino acid deletions.

Example  2: sequence Homology  analysis

The sequences of attenuated PEDV DR13 ORF3 and standard PEDV ORF3 were compared. Table 2 is a table showing nucleotide and amino acid sequence homology.

Table 2.

Identity (%) PEDV CV77 Brl / 87 DR13 (0) DR13 (100)  % Identity b CV77 - 99.7 96.9 90.2 Brl / 87 99.1 - 96.6 89.9 DR13 (0) 96.4 95.5 - 90.7 DR13 (100) 89.7 88.8 92.0 -

a: nucleotide identity (top right corner diagonal)

b: amino acid identity (lower left relative to diagonal)

DR13 (0) and DR13 (100) (KCCM-10474) show strains in which PEDV DR13 strains were passaged 0 and 100 times in Vero cell lines, respectively.

 As shown in Table 2, the parent PEDV DR13 ORF3 gene has 96.9% and 96.6% identity with the CV777 and Brl / 87 genes, respectively. Similarly, amino acid homology of the same genes was 96.4% and 95.5%.

The attenuated PEDV DR13 ORF3 gene has 90.2%, 89.9% and 90.7% identity with CV777, Brl / 87 and parental DR13 genes, respectively. Similarly, amino acid homology of the same genes was 89.7%, 88.8% and 92.0%.

Example  3: wild type and Attenuation type PEDV Distinction of

In this example, RT-PCR was performed using the primer set of Table 1 as a primer and the genomes of various PEDVs as templates.

2 is a diagram showing the result of electrophoresis of a product obtained on a 2.5% agarose gel by RT-PCR using oligonucleotides of SEQ ID NOs: 5 and 6 as primers and a genome of parent DR13 and attenuated DR13 as a template. to be. In Figure 2 lane M: 25/100 bp DNA leather, lane 1: parent DR13, lane 2: attenuated DR13, lane 3: negative control

As shown in FIG. 2, RT-PCR resulted in bands of expected sizes of 245 bp and 194 bp, respectively, from the parent DR13 and the attenuated DR13, which resulted in parental DR13 and attenuated DR13 by agarose gel electrophoresis. It can be easily distinguished.

3 is a diagram showing the results of electrophoresis on 2.5% agarose gel of a product obtained by performing RT-PCR using oligonucleotides of SEQ ID NOs: 5 and 6 as primers and templates of various commercial vaccine strains used in Korea. . In Figure 3 lane M: 25/100 bp DNA leather, lane 1: parent DR13, lane 2: Korean PED oral vaccine strain attenuated DR13 (Accession No. KCCM-10474), lane 3: Korean PED live virus vaccine strain KPEDV-9 (Accession No. KCTC8641P), lane 4: Japanese PED live virus vaccine strain P-5V, lane 5: inactivated vaccine strain SM98-1, lane 6: negative control

As shown in FIG. 3, wild-type PEDV parent DR13 and inactivated vaccine strain SM98-1 were amplified by a 245 bp fragment and attenuated DR13, a Korean PED oral vaccine strain in attenuated form of PEDV (Accession No. KCCM-10474), the Korean PED live virus vaccine strain KPEDV-9 (Accession No. KCTC8641P), and the Japanese PED live virus vaccine strain P-5V were all amplified by 194bp fragments. This indicates that PEDV attenuated by agarose gel electrophoresis can be easily distinguished from those not.

FIG. 4 is a diagram showing the result of electrophoresis on the product obtained by performing RT-PCR using oligonucleotides of SEQ ID NOs: 5 and 6 as primers and 12 field isolates as templates. FIG. In Figure 4 lane M: 25/100 bp DNA leather, lane 1: parent DR13, lane 2: Korean PED oral vaccine strain attenuated DR13 (Accession No. KCCM-10474), lane 3: negative control, lane 4: DBI825 Lane 5: BI976, Lane 6: BI1166, Lane 7: M1763, Lane 8: e1834, Lane 9: M2503, Lane 10: e2539, Lane 11: BI2804, Lane 12: e3991, Lane 13: PF4275, Lane 14: M4758 Lane 15: BI5321. The twelve field isolates used in FIG. 4 were directly isolated from specimens (gut, feces) showing PEDV clinical symptoms.

As shown in FIG. 4, all 12 isolates were amplified with the same DNA fragment as wild-type PEDV.

The ORF3 variant gene of the present invention is isolated from attenuated DR13 strain (Accession No. KCCM-10474). The attenuated DR13 strain was obtained by separating the swine epidemic diarrheal virus DR13 strain from a swine pig suffering from swine epidemic diarrheal disease and serially culturing it up to 100 times in Vero cells. The attenuated DR13 strain has high immunogenicity but no pathogenicity. In addition, even when administered orally to pigs, immunity can be induced, and when administered to sows are characterized in that piglets are protected more than 80%.

Eight nucleotide changes and three nucleotide insertions of the ORF3 variant genes of the present invention are considered to be simple strain variations because they cannot be found in CV777 and Brl / 87, but only in parental and attenuated DR13. It is also believed that the four nucleotide changes found only in attenuated DR13 are not important for attenuation because they do not induce amino acid changes. Attenuated DR13 has 51 nucleotides and 17 amino acid deletions not found in CV777, Brl / 87, and parent DR13. Therefore, 51 nucleotides and 17 amino acid deletions are involved in the attenuation of PEDV.

Sequence homology analysis revealed that ORF3 of the parent PEDV DR13 of the present invention was more homologous to CV777 and Brl / 87 than ORF3 of attenuated PEDV DR13. This difference is believed to lead to the attenuated properties of attenuated PEDV DR13.

RT-PCR results for the partial ORF3 gene showed that all PEDVs could be divided into two types: wild type and attenuated PEDV. All PEDV vaccines except the inactivated vaccine strain SM98-1 had a 194 bp band size, whereas PEDVs containing the parent DR13 and 12 field isolates had a 245 bp band size. All PEDV vaccines except the inactivated vaccine strain SM98-1 were used as live virus vaccines and showed low pathogenicity. Therefore, a large deletion region of 51 nucleotides, present in all vaccine strains except inactivated vaccines, is critical for PEDV attenuation and can be used to distinguish between wild type and attenuated PEDV.

The swine epidemic diarrhea virus (PEDV) ORF3 polypeptide according to the present invention has a 17-amino acid deletion compared to the wild type and plays an important function in PEDV attenuation.

According to the polynucleotide encoding the swine epidemic diarrhea virus (PEDV) ORF3 polypeptide according to the present invention, it encodes a swine epidemic diarrhea virus (PEDV) ORF3 polypeptide, which has a 17-amino acid deletion compared to the wild type and plays an important function in PEDV attenuation. do.

According to the method for detecting attenuated porcine epidemic diarrhea virus (PEDV) according to the present invention, it is possible to easily distinguish between wild type and attenuated PEDV.

According to the kit for detecting attenuated swine pandemic diarrhea virus (PEDV) according to the present invention, it can be conveniently used to easily distinguish between wild type and attenuated PEDV.

Attach sequence list electronic file  

Claims (15)

Porcine epidemic diarrhea virus (PEDV) ORF3 polypeptide having the amino acid sequence of SEQ ID NO: 1. A polynucleotide encoding a swine epidemic diarrhea virus (PEDV) ORF3 polypeptide, having a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1. The polynucleotide of claim 2, wherein the polynucleotide has a nucleotide sequence of SEQ ID NO: 2. 4. Detecting attenuated swine pandemic diarrhea virus (PEDV), comprising analyzing the sequence of the ORF3 gene from a sample comprising swine pandemic diarrhea virus (PEDV) to determine if there are deletions of 245 to 295 nucleotides. Way. The method of claim 4, further comprising: amplifying the ORF3 gene from a sample comprising swine pandemic diarrhea virus (PEDV); And Analyzing attenuated swine pandemic diarrhea virus (PEDV) comprising the step of analyzing the presence of the amplification product or the size of the amplification product. The PCR according to claim 5, wherein the amplification is a PCR using a primer set comprising a first primer binding upstream of 245 nucleotides of the wild-type ORF3 gene and a second primer binding downstream of nucleotide 295 of the wild-type ORF3 gene. Carried out by the method. The method of claim 6, wherein the first primer is an oligonucleotide of SEQ ID NO: 3, the second primer is an oligonucleotide of SEQ ID NO: 4 or the first primer is an oligonucleotide of SEQ ID NO: 5, and the second primer is a sequence The oligonucleotide of number 6. The attenuated swine pandemic diarrhea virus (PEDV) according to any one of claims 5 to 7, wherein, if the result of analysis of the amplification product is 245 to 295 nucleotides deleted in the ORF3 gene, attenuated swine pandemic diarrhea virus (PEDV) exists. A method for detecting attenuated porcine epidemic diarrhea virus (PEDV), comprising determining. The method of claim 5, wherein the amplification is a first primer consisting of a primer that binds upstream of the nucleotide 245 of the wild-type ORF3 gene or a primer that binds downstream of the nucleotide 295 of the wild-type ORF3 gene, and from 245 to the wild-type ORF3 gene And a primer set comprising a second primer that binds to nucleotide 295 as a primer. 10. The attenuated swine pandemic diarrhea virus (PEDV) of claim 9, comprising determining that attenuated swine pandemic diarrhea virus (PEDV) is present if the target sequence is not amplified by PCR. How to detect. Isolating ORF3 protein from a sample comprising swine pandemic diarrhea virus (PEDV); And Analyzing the sequence of the ORF3 protein; a method for detecting attenuated swine pandemic diarrhea virus (PEDV) comprising. 12. The method of claim 11, wherein if the ORF3 protein is deleted from amino acids 82-98 based on the wild-type ORF3 protein, determining that attenuated swine pandemic diarrhea virus (PEDV) is present. A method for detecting attenuated porcine epidemic diarrhea virus (PEDV). A kit for detecting attenuated porcine epidemic diarrhea virus (PEDV), comprising a first primer that binds upstream of 245 nucleotides of wild-type ORF3 gene and a second primer that binds downstream of nucleotide 295 of wild-type ORF3 gene Kit comprising primer set and instructions for use. A kit for detecting attenuated porcine pandemic diarrhea virus (PEDV), comprising: a primer that binds upstream of 245 nucleotides of wild-type ORF3 gene or a primer that binds downstream of nucleotide 295 of wild-type ORF3 gene; , A kit comprising a primer set and instructions for use comprising a second primer that binds to nucleotides 245-295 of the wild-type ORF3 gene. A kit for detecting attenuated porcine epidemic diarrhea virus (PEDV), the kit comprising a probe and instructions for binding specifically to nucleotides 245 to 295 of the wild-type ORF3 gene.

Images