KR102049147B1 - A novel attenuated PEDV strain and a vaccine composition comprising thereof - Google Patents

Abstract

 We obtained four distinct DEL strains in an in vitro serial pass procedure, showing in vivo virulence loss of cell-adapted viruses with large deletions in ORF3 and potent immunogenic retention in pigs of cell-adapted strains. Proved. Genetic factors are involved in the phenotypic properties of PEDV, so ORF3 may be an important viral component that determines pathogenic characteristics. According to the present invention, in vivo infection with cell-adapted S DEL2 / ORF3 and S DEL5 / ORF3 viruses showed attenuated results, and the present invention provides attenuated porcine pancreatic diarrheal virus (PEDV) and vaccine compositions using the same. It is about. More specifically, the attenuated PED virus of the present invention was prepared by serial passage using Vero cells. In the present invention, the attenuated PEDV shows an excellent antibody value, maintains a desirable blood virus content, and does not cause serious tissue lesions.

Description

Novel attenuated PEDV strain and a vaccine composition comprising the same

The present invention relates to attenuated porcine epidemic diarrhea virus (PEDV) strains, attenuated methods, genes associated with attenuated and attenuated methods. The present invention also relates to a vaccine comprising a PEDV strain comprising a gene associated with attenuation and an immunization method using the same.

Swine pandemic diarrhea virus (PED) is a fatal and highly contagious swine intestinal disease, characterized by acute diarrhea / vomiting and dehydration, resulting in high mortality in newborn piglets (Lee, 2015; Saif et al., 2012). The disease was first reported in the United Kingdom in 1971, spread rapidly throughout Europe, and is believed to have crossed over into the Asian continent in the 1980s (Oldham, 1972; Takahashi et al., 1983). In 1978, the coronavirus-analogue, originally named CV777, was identified as a causative pathogen in Belgium (Pensaert and Debouck, 1978).

Pathogenesis of viral Chain PED PED large, Ginny said outer shell, a single-strand of a positive sense RNA virus belongs in Nidovirales neck, Coronaviridae and, Alphacoronavirus (Pensaert and Debouck, 1978 ; Lee, 2015). The PEDV genome has a 5 'cap and a 3' polyadenylated tail, about 28 kb in length, with 5'-untranslated region (UTR), ORF1a, ORF1b and ORFs 2-6 7 or more open reading frames (ORFs) designated, and 3'-UTR (Pensaert and Debouck, 1978; Kocherhans et al., 2001; Saif et al., 2012). The first two large ORFs, ORF1a and 1b, correspond to 5'-proximal 2/3 of the genome and encode nonstructural proteins (nps). ORF1a translation produces replica polyprotein (pp) la, while ORF1b is expressed by 1 ribosomal frame shift (RFS), which converts polyprotein 1a at the C-terminus to polyprotein 1ab To extend. These polyproteins undergo autoproteolysis by viral proteases to produce at least 16 processing end products (nsp16). The remaining portion of the ORFs in the 3'-proxymal portion of the genome encodes the four standardized structural proteins of the coronavirus and the single accessory gene of ORF3, which is the 3'-hole of the subgenomic (sg) mRNAs. It is expressed independently from a co-terminal nested set. In the above, the former includes spike (S), membrane (M), envelope (E), and nucleocapsid (N) proteins (Duarte et al., 1994; Lai et al., 2007; Lee, 2015) . Of these, the coding region of the S gene was considered a viral loci suitable for sequencing to investigate the genetic association and molecular dynamics of PEDV isolates (Chen et al., 2014; Gerber et al., 2014). Lee et al., 2010; Lee and Lee, 2014; Oh et al., 2014). Based on phylogenetic analysis of the S gene, PEDV has two genotypes: genogroup I (G1; standard strain or recombinant, low pathogenic) and genogroup II (G2; wild pandemic or extensive pandemic, high pathogenic) Are different in genetic and antigenicity. Each gene group contains two subgroups, namely 1a and 1b, and 2a and 2b, respectively (Lee, 2015; Lee et al., 2010; Lee and Lee, 2014; Oh et al., 2014).

There has recently been a massive, severe PED outbreak in South Korea, Japan, and Taiwan, and North American prototype-like G2b PEDV (US prototype-like G2b PEDV) has been identified as the leading cause of PED outbreaks in these countries (Lee and Lee, 2014). Lin et al., 2014; Suzuki et al., 2015). In addition, PEDV has recurred throughout western and central Europe (Boniotti et al., 2016; Hanke et al., 2015; Grasland et al., 2015; Mesquita et al., 2015; Steinrigl et al., 2015; Theuns et al., 2015). In particular, these recurrent PEDVs were genetically nearly identical to each other and most closely associated with the low pathogenic G1b variants found in the United States, Korea and Japan since they were first genetically discovered in China (Lee et al., 2014b; Li et al., 2012; Suzuki et al., 2015; Wang et al., 2014). As such, PED is a swine virus disease that develops or re-occurs all over the world, resulting in huge financial losses worldwide and is considered one of the most economically serious diseases in countries with a concentrated pig industry. Four different PEDV genotypes have been reported in Korea, including vaccine strains (G1a), new variants (G1b), past pandemic strains (G2a), and the now widespread pandemic strain (G2b) (Lee, 2015; Lee). et al., 2010; Lee et al., 2014b; Lee and Lee, 2014). Currently a limited number of PEDV vaccines, ie modified live or inactivated killed vaccines, are commercially available in Korea. These vaccines include a single Gla standard strain (Korean SM98-1, DR-13 or Japanese 83P-5 strain), and most likely do not fully defend against genetically different wild strains. As such, the incomplete efficacy of commercial PEDV vaccines may be due to antigenic, genetic and phylogenetic variations between the vaccine's major S glycoproteins and wild pandemic strains (Kim et al., 2015; Lee, 2015) Lee et al., 2010; Lee and Lee, 2014; Lee et al., 2014a; Oh et al., 2014). Thus, there is a need for the development of new vaccines against G2b pandemic strains or related strains that are currently prevalent in the wild.

Accordingly, the present inventors have serially cultured Korean wild G2b strains in Vero cells to identify attenuated mutant strains, and analyzed the antibody formation and immunogenicity in vivo to complete the present invention.

Boniotti, MB, Papetti, A., Lavazza, A., Alborali, G., Sozzi, E., Chiapponi, C., Faccini, S., Bonilauri, P., Cordioli, P., Marthaler, D., 2016 Porcine epidemic diarrhea virus and discovery of a recombinant swine enteric coronavirus, Italy. Emerg. Infect. Dis. 22, 8387. Chen, Q., Li, G., Stasko, J., Thomas, JT, Stensland, WR, Pillatzki, AE, Gauger, PC, Schwartz, KJ, Madson, D., Yoon, KJ, Stevenson, GW, Burrough, ER, Harmon, KM, Main, RG, Zhang, J., 2014. Isolation and characterization of porcine epidemic diarrhea viruses associated with the 2013 disease outbreak among swine in the United States. J. Clin. Microbiol. 52, 234243. Duarte, M., Laude, H., 1994.Sequence of the spike protein of the porcine epidemic diarrhoea virus. J. Gen. Virol. 75, 11951200. Gerber, P.F., Gong, Q., Huang, Y.W., Wang, C., Holtkamp, D., Opriessnig, T., 2014. Detection of antibodies against porcine epidemic diarrhea virus in serum and colostrum by indirect ELISA. Vet. J. 202, 3336. Grasland, B., Bigault, L., Bernard, C., Quenault, H., Toulouse, O., Fablet, C., Rose, N., Touzain, F., Blanchard, Y., 2015.Complete genome sequence of a porcine epidemic diarrhea S gene indel strain isolated in France in December 2014. Genome Announc. 3, e00535-15. Hanke, D., Jenckel, M., Petrov, A., Ritzmann, M., Stadler, J., Akimkin, V., Blome, S., Pohlmann, A., Schirrmeier, H., Beer, M., Hoper, D., 2015. Comparison of porcine epidemic diarrhea viruses from Germany and the United States, 2014. Emerg. Infect. Dis. 21, 493496. Kim, SH, Lee, JM, Jung, J., Kim, IJ, Hyun, BH, Kim, HI, Park, CK, Oem, JK, Kim, YH, Lee, MH, Lee, KK, 2015.Genetic characterization of porcine epidemic diarrhea virus in Korea from 1998 to 2013.Arch. Virol. 160, 10551064. Kocherhans, R., Bridgen, A., Ackermann, M., Tobler, K., 2001. Completion of the porcine epidemic diarrhoea coronavirus (PEDV) genome sequence. Virus Genes 23, 137144. Kweon, C.H., Kwon, B.J., Jung, T.S., Kee, Y.J., Hur, D.H., Hwang, E.K., Rhee, J.C., An, S.H., 1993.Isolation of porcine epidemic diarrhea virus (PEDV) in Korea. Korean J. Vet. Res. 33, 249254. Lai, M. M., Perlman, S., Anderson L. J., 2007. Coronaviridae. In: Knipe, D.M., Howley, P.M., Griffin, D.E., Martin, M.A., Lamb, R.A., Roizman, B., Straus, S.E. (Eds.), Fields Virology. 5th ed. Lippincott Williams & Wilkins, Philadelphia, USA, pp. 13061336. Lee, C., 2015. Porcine epidemic diarrhea virus: An emerging and re-emerging epizootic swine virus. Virol. J. 12, 193. Lee, D.K., Park, C.K., Kim, S.H., Lee, C., 2010. Heterogeneity in spike protein genes of porcine epidemic diarrhea viruses isolated in Korea. Virus Res. 149, 175 182. Lee, S., Kim, Y., Lee, C., 2015. Isolation and characterization of a Korean porcine epidemic diarrhea virus strain KNU-141112. Virus Res. 208, 215 224. Lee, S., Ko, D.H., Kwak, W.K., Lim, C.H., Moon, S.U., Lee, D.S., Lee, C., 2014a. Reemergence of porcine epidemic diarrhea virus on Jeju Island. Korean J. Vet. Res. 54, 185188. Lee, S., Lee, C., 2014. Outbreak-related porcine epidemic diarrhea virus strains similar to US strains, South Korea, 2013. Emerg. Infect. Dis. 20, 12231226. Lee, S., Lee, C., 2015. Phenotypic and genotypic characterization associated with cell adaptation of porcine epidemic diarrhea virus. In: Proceedings of the 2015 North American PRRS Symposium, pp. 62. Lee, S., Park, G. S., Shin, J. H., Lee, C., 2014b. Full-genome sequence analysis of a variant strain of porcine epidemic diarrhea virus in South Korea. Genome Announc. 2, e01116-14. Lee, Y.N., Lee, C., 2013. Complete genome sequence of a novel porcine parainfluenza virus 5 isolate in Korea. Arch. Virol. 158, 17651 772. Li, W., Li, H., Liu, Y., Pan, Y., Deng, F., Song, Y., Tang, X., He, Q., 2012. New variants of porcine epidemic diarrhea virus, China, 2011. Emerg. Infect. Dis. 8, 13501353. Lin, C.N., Chung, W.B., Chang, S.W., Wen, C.C., Liu, H., Chien, C.H., Chiou, M.T., 2014.US-like strain of porcine epidemic diarrhea virus outbreaks in Taiwan, 2013 2014. J. Vet. Med. Sci. 76, 12971299. Mesquita, J.R., Hakze-van der Honing, R., Almeida, A., Lourenco, M., van der Poel, W.H., Nascimento, M.S., 2015.Outbreak of porcine epidemic diarrhea virus in Portugal, 2015.Transbound. Emerg. Dis. 62, 586588. Mole, B., 2013. Deadly pig virus slips through US borders. Nature 499, 388. Oh, J., Lee, K.W., Choi, H.W., Lee, C., 2014. Immunogenicity and protective efficacy of recombinant S1 domain of the porcine epidemic diarrhea virus spike protein. Arch. Virol. 159, 29772987. Oldham, J., 1972. Letter to the editor. Pig Farming 10, 7273. Park, C.K., Lee, C., 2009. Clinical examination and control measures in a commercial pig farm persistently infected with porcine epidemic diarrhea virus. J. Vet. Clin. 26, 463 466. Park, C.K., Lee, K.K., Lee, C., 2011.PED past, present, and future. In: Proceedings of the 5th Asian Pig Veterinary Society Congress, Pattaya, Thailand, pp. S1920. Pensaert, M.B., Debouck, P., 1978. A new coronavirus-like particle associated with diarrhea in swine. Arch. Virol. 58, 243247. Saif, L.J., Pensaert, M.B., Sestak, K., Yeo, S.G., Jung, K., 2012. Coronaviruses. In: Zimmerman, J.J., Karriker, L.A., Ramirez, A., Schwartz, K.J., Stevenson, G.W. (Eds.), Diseases of Swine, 10th ed. Wiley-Blackwell, Ames, IA, USA, pp. 501524. Steinrigl, A., Fernandez, S.R., Stoiber, F., Pikalo, J., Sattler, T., Schmoll, F., 2015. First detection, clinical presentation and phylogenetic characterization of porcine epidemic diarrhea virus in Austria. BMC Vet. Res. 11, 310. Stevenson, GW, Hoang, H., Schwartz, KJ, Burrough, ER, Sun, D., Madson, D., Cooper, VL, Pillatzki, A., Gauger, P., Schmitt, BJ, Koster, LG, Killian , ML, Yoon, KJ, 2013. Emergence of Porcine epidemic diarrhea virus in the United States: clinical signs, lesions, and viral genomic sequences. J. Vet. Diagn. Invest. 25, 649654. Suzuki, T., Murakami, S., Takahashi, O., Kodera, A., Masuda, T., Itoh, S., Miyazaki, A., Ohashi, S., Tsutsui, T., 2015.Molecular characterization of pig epidemic diarrhoea viruses isolated in Japan from 2013 to 2014. Infect. Genet. Evol. 36, 363368. Theuns, S., Conceicao-Neto, N., Christiaens, I., Zeller, M., Desmarets, LM, Roukaerts, ID, Acar, DD, Heylen, E., Matthijnssens, J., Nauwynck, HJ, 2015. Complete genome sequence of a porcine epidemic diarrhea virus from a novel outbreak in Belgium, January 2015. Genome Announc. 3, e00506-15. Vanhee, M., Delputte, P.L., Delrue, I., Geldhof, M.F., Nauwynck, H.J., 2009. Development of an experimental inactivated PRRSV vaccine that induces virus-neutralizing antibodies. Vet. Res. 40, 63. Vlasova, AN, Marthaler, D., Wang, Q., Culhane, MR, Rossow, KD, Rovira, A., Collins, J., Saif, LJ, 2014.Distinct characteristics and complex evolution of PEDV strains, North America, May 2013February 2014. Emerg. Infect. Dis. 20, 16201628. Wang, L., Byrum, B., Zhang, Y., 2014. New variant of porcine epidemic diarrhea virus, United States, 2014. Emerg. Infect. Dis. 20, 917919.

The present invention aims to provide a novel attenuated PEDV strain.

It is also an object of the present invention to provide an attenuated vaccine comprising the novel PEDV strain.

Another object of the present invention is to provide an inactivated vaccine comprising the inactivated PEDV strain.

It is another object of the present invention to provide a PED vaccine further comprising the inactivated vaccine and an immunopotentiator.

It is another object of the present invention to provide a method for inducing an immune response against PED in pigs, the method comprising inducing an immune effective amount of the attenuated or inactivated vaccine to pigs.

In order to achieve the above object, the present invention is a mutant strain that is attenuated by successive 100 passages of porcine epidemic diarrhea (PED) virus (Genebank accession no. KR873434) in Vero cells, The mutant strain includes the deletion of all or part of the 56th to 60th nucleotide sequences of the N-terminal region based on the entire genome among the N-terminal regions of the S (spike) glycoprotein gene, and has been deposited with the Korea Research Institute of Bioscience and Biotechnology. Provided are swine pancreatic diarrheal virus mutants, deposited with KCTC13201BP, KCTC13202BP, KCTC13203BP or KCTC13204BP.

In addition, the present invention provides a vaccine composition for the prevention, treatment, or prevention and treatment of swine pandemic diarrhea, comprising the mutant strain as an active ingredient, the vaccine composition is a pharmacologically acceptable carrier, diluent, preservative and It may further comprise one or more selected from the group consisting of an adjuvant.

The present invention also provides a mixed vaccine composition for the prevention, treatment, or prevention and treatment of swine pandemic diarrheal disease comprising at least two mutant strains and optionally at least one conventional vaccine strain, wherein the vaccine composition is pharmacologically acceptable. It may further comprise one or more selected from the group consisting of one carrier, diluent, preservative and immunoadjuvant.

The present invention also provides a method of immunizing pigs by administering the vaccine composition, and provides a method of preventing, treating, or preventing and treating PED by administering the vaccine composition to pigs.

In addition, the present invention is attenuated by successive 100 passages of swine pandemic diarrheal virus (Genebank accession no. KR873434) in Vero cells, and based on the entire genome of the entire genome of the N-terminal region of the S protein gene of the virus. To obtain a mutant strain in which all or a part of the 56th to 60th nucleotide sequence of the N-terminal region was deleted, and the swine pancreatic diarrheal virus mutant strain deposited with the deposit number KCTC13201BP, KCTC13202BP, KCTC13203BP or KCTC13204BP at the Korea Research Institute of Bioscience and Biotechnology. Provided is a method of preparing a vaccine composition for preventing, treating, or preventing and treating swine pandemic diarrhea.

In addition, the present invention is a mutant strain that was attenuated by successive 100 passages of swine pandemic diarrheal virus PED virus (Genebank accession no. KR873434) in Vero cells, the mutant strain whole virus in the N-terminal region of the S glycoprotein gene All or part of the 56th to 60th nucleotide sequences of the N-terminal region on the basis of the entire genome are deleted, and the 24,771 to the 1st to the viral whole genome of the junction of the S glycoprotein gene and the ORF gene are deleted. Provided, comprising the deletion of the 24,816 nucleotide sequence, swine pandemic diarrhea virus variant strain. The mutant strain may further include deletions of the 24th, 794th to 24,863th nucleotide sequences in the ORF3 N-terminal region based on the whole virus genome. The present invention also provides a vaccine composition for the prevention, treatment, or prevention and treatment of swine pandemic diarrheal disease, comprising the mutant strain as an active ingredient, wherein the vaccine composition is a pharmacologically acceptable carrier, diluent, preservative and It may further comprise one or more selected from the group consisting of an adjuvant.

In addition, the present invention is attenuated by successive 100 passages of swine pandemic diarrheal virus (Genebank accession no. KR873434) in Vero cells, the virus whole gene in the N-terminal region of the S (spike) glycoprotein gene N-terminal region All or part of the 56th to 60th nucleotide sequences of the N-terminal region based on the entire genome of the genome are deleted, and the 24,771 th to the first genus of the viral genome in the junction of the S glycoprotein gene and the ORF gene. Provided is a method for preparing a vaccine composition for the prevention, treatment, or prevention and treatment of swine pandemic diarrheal disease, including preparing a swine pancreatic diarrheal virus mutant strain, wherein the 24,816 nucleotide sequence is deleted. -May be a mutant strain in which the 24th, 794th to 24,863th nucleotide sequences are further deleted in the terminal region based on the whole genome of the virus. All.

The novel attenuated PED virus strain of the present invention is prepared by attenuating successive passages of Korean strains isolated in Korea. The attenuated PEDV of the present invention has been shown to form high antibody titers in serum, maintain a favorable virus content in blood, and not cause severe lesions in tissues. Therefore, the novel attenuated PED virus strain of the present invention may be usefully used for the production of live (poisonous) vaccines for the prevention, treatment or prevention and treatment of swine pandemic diarrhea.

1 shows cytopathology and IFA of cell-adapted DEL strains in virulent PEDV isolate KNU-141112 and Vero cells infected with it.
2 shows growth kinetics and plaque morphology of parental and cell-adapted strains in Vero cells.
Figure 3 schematically shows amino acid differences between KNU-141112-P5 and its cell-adapted DEL derivatives.
4 shows the 5′-terminal or N-terminal region nucleotide (A) and putative amino acid (B) sequences of the S glycoprotein gene in the PEDV G1a reference strain, parental virus KNU-141112-P5 and cell-adapted DEL strains. The alignment is shown. Continuous boxes indicate putative signal peptides. The interrupt line (-) indicates the deleted sequence.
Figure 5 shows the nucleotide sequence alignment of the 3'-terminal regions of the S and whole ORF3 genes in the PEDV Gla reference strain, parental virus KNU-141112-P5 and cell-adapted DEL strains. Continuous boxes represent transcriptional regulatory sequences (TRS) of PEDV ORF3. The interrupt line (-) indicates the deleted sequence. The original (blue) and altered (red) 'TGA' stop codons for the S gene are shown in bold, and the true (black) and predicted (red) 'ATG' start codons for the ORF3 gene are shown in bold underline. . Nucleotide substitutions from the 'GCT' to the 'TGA' terminator in the DEL2 / ORF3 strain were shaded in bold.
6 shows the amino acid sequence alignment of the C-terminal regions of S protein (A) and total ORF3 protein among PEDV G1a reference strain, parental virus KNU-141112-P5 and cell-adapted DEL strains. The interrupt line (-) indicates the deletion sequence.
Figure 7 shows a phylogenetic analysis based on the nucleotide sequences of the Spike gene (A) and full-length genome (B) of the PEDV strain.
8 shows clinical significance scores (A) and virus shedding (B) in four groups of piglets. (A) CSS was measured as described in Materials and Methods. (B) PEDV titers in rectal swab samples at each time point were measured by quantitative real-time RT-PCR. Ct values shown in each figure are mean Ct values of PCR-positive pigs. Virus titers (Log ₁₀ TCID ₅₀ / ml) is the mean viral titer of all pigs. Error bars indicate standard deviation. P Values were calculated by comparing parental and cell-adapted DEL virus inoculated groups using Student's t test. *, P = 0.001 to 0.05; **, P <0.001.
9 is a visual observation of the intestines of piglets inoculated with the parental virus and cell-adapted DEL strains. Indicates. Visual inspection of representative small intestine inoculated with S DEL2 / ORF3 (Panels A and B), S DEL5 / ORF3 (Panels C and D), and KNU-141112-P5 (Panel E), and negative controls (F) It was. Only piglets inoculated with parental virus showed a thin, transparent barrier and expanded stomachs filled with altered milk (E).
10 shows histopathology of piglets intestine inoculated with parental and cell-adapted DEL strains. (Panel AF) Hematoxylin and eosin-stained tissue sections of jejunum from virus inoculated negative control pigs (100 × magnification). Virulence KNU-141112-P5-inoculated piglets showed acute diffuse and severe atrophic enteritis with conjugate to superficial epithelial cells (E). Normal plant villous epithelium was observed in KNU-141112-S DEL2 / ORF3 (A and B) and KNU-141112-S DEL5 / ORF3 (C and D), and temporarily-inoculated (F) piglets. (Panel GL) PEDV infection detection (200 × magnification) by IHC analysis of jejunal tissue sections from virus-vaccinated and negative control pigs. PEDV antigen signals are shown in brown and detected in whole epithelial cells in the jejunum of PEDV KNU-141112-P5-inoculated piglets (K). PEDV was not challenged in the piglets inoculated with KNU-141112-S DEL2 / ORF3 (G and H) and S DEL5 / ORF3 (I and J), and in the plants of temporary-vaccinated piglets (L).

We have demonstrated that pathogenic isolates of large-scale PED outbreaks in Korea are closely associated with emerging North American strains belonging to the G2b group that have recently caused worldwide outbreaks in Asia and America (Lee and Lee, 2014; Lin et. al., 2014; Suzuki et al., 2015). Phylogenetic analysis indicated that two PEDV vaccine strains, SM98-1 and DR-13, which are commercial vaccine seeds in Korea, are the classic G1a gene family. In addition, we have demonstrated antigenic and genetic variations between vaccines and wild strains that result in more than 10% amino acid differences in the S1 domain (Lee et al., 2010; Lee and Lee, 2014; Lee, 2015; Oh et al., 2014). This variation appears to be the cause of the incomplete effect of the vaccine currently used in South Korea, suggesting the need to study new safe and effective vaccines using wild pandemic strains. We have recently successfully isolated and propagated Korean highly enteric-pathogenic PEDV strains in Vero cells that are identical in genotyping with the global wild G2b strain (Lee et al., 2015).

The present inventors obtained a PEDV vaccine candidate by passing 100 highly virulent Korean G2b strain KOR / KNU-141112 / 2014 in Vero cells, and identified the genetic and virulence characteristics related to its cell adaptation process. During cell-adaptation through passage in Vero cells, we obtained four deletion (DEL) variants and confirmed their properties, indicating that they independently comprise unique deletion features in S or S and ORF3. Confirmed. Specifically, initial sequencing analysis by the Sanger method, either containing a small DEL pattern at the N-terminus of S (S DEL2 and S DEL5), or S DEL and large in the intergenic junction of S and ORF3. Four cell-adapted derivatives were identified that individually comprise a combination of DEL features (S DEL2 / ORF3 and S DEL5 / ORF3).

In one example of the present invention. Virological characteristics of DEL strains produced by serial passage in Vero cells were determined. Cell-adapted DEL virus proliferated more rapidly at high titers compared to the parental virus in cultured cells and formed larger plaques. The parent virus KNU-141112-P5 produced the smallest plaques of the same kind of very small size (pinpoint-size), while the DEL strains were heterogeneous (mixed at least two sizes) of various sizes ranging from small to large. Were generated independently (FIG. 1C). Interestingly, the S DEL2 / ORF3 and S DEL5 / ORF3 strains predominantly exhibited similar largest plaque morphology with a small number of small sized plaques. This suggests that cell-adapted DEL strains have good viral fitness in cultured cells, and that the DEL pattern has a positive effect on virus growth in vitro.

In another embodiment of the present invention, the inventors sequenced the entire genome of the DEL strain to identify the exact DEL patterns and genetic variations that appear during the cell culture adaptation process. The genome size of the DEL strains was dependent on the number of their deleted nucleotides. We identified a total of at least 19 and at most 27 random nucleotide substitutions throughout each DEL strain. Although the DEL strain had one or two mutations in the 3 'UTR, the UTRs of KNU-141112 were perfectly maintained during cell passage. In addition, not all substitutions in the 3 'UTR were found in all DEL strains. Thus, the inventors have assumed that UTRs will play a minor role in the virulence of PEDV, despite their importance in PEDV genome replication. The remainder included 12 or 14 different (non-synonymous) variants located within ORFs 1-4, of which six amino acid substitutions were common to the nonstructural viral protease nsp3, nsp5, structures S and E of all DEL strains. Present, suggesting that some of these changes may be involved in viral adaptation in cultured cell systems. PEDV infection produces distinct CPE characterized by the fusion (syncytium or polykaryon formation) of infected cells in Vero cells. However, cell-adapted strains formed more severe syncytia and resulted in an increase in the conjugated area, which was proportional to plaque size. All DEL strains contained two G888R and E1287 variants in the same position in the S2 fusion domain, suggesting that these genetic variations may be related to in vitro phenotypic changes. The S protein of PEDV is a type I membrane glycoprotein and the virulent G2b KNU-141112 strain has 21 predicted N-glycosylation sites. It was found that all cell-adapted DEL strains had N381K or T383N mutations in the N-S-T sequence at positions 381-383 of the parental S protein. In addition, the S DEL2 / ORF3 strain deleted one or more potential sequences (NIT at positions 514-516 of S) by including strain specific T516I changes. In conclusion, by missing one or two potential motifs, 20 or 19 N-glycosylation sites in the DEL strain were predicted. This finding is consistent with previous studies, but new motifs are created at closely adjacent or distinct positions, compensating for one loss in other cell-attenuated strains and consequently having the same number of N-glycosylation sites. It is different in coming terms (Park et al., 2007; Sato et al., 2011). Changes in one or two glycan motifs appear to affect the virulence of cell-adapted DEL strains, while preservation of other N-glycosylation sites results in N-linked glyco in the S protein in protein identification and function. The importance of a true story is hinted

In the present invention, the most interesting genome change was the occurrence of four different minor and / or major DEL features. The first S N-DEL2 or S N-DEL5, and the fourth ORF3 C-DEL1, were simply and directly classified into minor DEL patterns according to the number of deletions of nucleotides at each corresponding position in S or ORF3. The standard G1a prototype CV777 and cell-adapted vaccine strains had four aa deletions (S N-DEL4) at positions nearly identical to the first DEL footprint of the cell-adapted G2b DEL strain. In addition, new G1b epidemic variants that appear to be by recombination between standard G1a and pathogenic wild G2 viruses included the same S N-DEL4 as the G1a standard strain (Lee et al., 2014, Lee, 2015). Indeed, the S gene of the PEDV wild isolate in the G2 group, compared to the prototype CV777 strain, has two non-contiguous 4-aa insertions at positions 55/56 and 135/136 in the N-terminal hypervariable region of S, And specific genetic features consisting of one 2-aa deletion at 160 and 161 (Lee et al., 2010, Lee et al., 2014, Lee and Lee, 2014, Lee, 2015). The standard and cell-adapted G1a strains contain 4-aa deletions at positions 55/56, whereas the G2 pandemic strains have 4-aa insertions, whereas the G2 pandemic strain has a 4-aa insertion, thus resulting in a first DEL pattern It can be expected that this may occur at similar locations during in vitro passage. The fourth ORF3 C-DEL1 involved changes in the reading frame, but included spontaneous removal of valine residues at position 164 in ORF3 of the parent virus, which was unpredictable in previous studies. The second pattern is a major DEL feature due to large 46 nucleotide deletions at genome positions 24,771 to 24,816 spanning the junction between S and ORF3. This simultaneously modified the expression of the S and ORF3 proteins. For the S protein, a truncated S product can be produced with a 5-aa truncated cell substrate domain (S C-DEL5). For ORF3, a wide range of N-terminal 70-aa truncated ORF3 forms (ORF3 N-DEL70) are generated when the ATG codon for translation initiation is knocked out and there is no ORF3 expression, or when the second ATG initiator is replaced for ORF3 expression Can be. Interestingly, this major DEL feature is almost equally present in the cell-adapted Korean vaccine strain SM98-1 (Genbank accession no. GU937797), which contains a wide range of 52 nucleotide deletions at similar positions (FIGS. 1 and 6B). ). Thus, SM98-1 is expected to encode a variant S protein with a 7-aa deleted cytoplasmic domain, which is 2 amino acids shorter than the S DEL2 / ORF3 and S DEL5 / ORF3 strains, with the same ORF3 or N-DEL70 cleavage. ORF3 was not identified in the present invention. In addition, the other Korean vaccine strain DR-13 also had a large 17-aa deletion region at positions 82-98 in ORF3, which spontaneously developed following subsequent nucleotide deletions at the corresponding positions (Park et al. , 2008). Finally, the remaining DEL features are indirect mutations where the triplet 'GCT' encoding alanine is mutated to the end codon 'TGA', followed by premature termination resulting in extensive 88-aa deletion (ORF3 C-DEL88) at the C terminus of ORF3. Caused by, was classified as an abnormal major deletion. Similarly, Wang et al. (2012) reported that attenuated-type PEDV encodes a 91 amino acid C-terminal truncated ORF3 protein as compared to 224 amino acids of wild type virus. However, our findings differ in the previous studies that the ORF3 gene of the attenuated virus has 49 nucleotide deletions, which means that at the 274th nucleotide of ORF3, much upstream than ReadingFrameshift and ORF3 C-DEL88, TAG 'terminator. More surprisingly, with the exception of KNU-141112-S DEL2, most cell-adapted DEL strains contained discrete SEL features, including: i) S N-DEL5 and ORF3 C-DEL1, ii ) S N-DEL2, S C-DEL5 and ORF3 N-DEL70 combination, and ORF3 C-DEL88, and iii) S N-DEL5, S C-DEL5 and ORF3 N-DEL70 combination, and ORF3 C-DEL1. As above, several cell-attenuated vaccine strains individually maintained large deletion regions in ORF3 encoding their truncated ORF3 variants, suggesting that this genotype feature is associated with the loss of virulence of PEDV. Interestingly, two cell-adapted DEL strains, KNU-141112-S DEL2 / ORF3 (SEQ ID NO: 1) and KNU-141112S DEL5 / ORF3 (SEQ ID NO: 2), compared to the 224 amino acids of the parent virus, It is expected to encode strain-specific broadly cleaved ORF3 of 66 and 153 amino acids, respectively.

In another embodiment of the present invention, animal challenge experiments using these two DEL strains were performed to analyze in vivo phenotypic changes of virulent KNU-141112 strains associated with in vitro virus serialization. The parental virus KNU-141112-P5 and its cell-passage derivatives, KNU-141112-S DEL2 / ORF3 and KNU-141112-S DEL5 / ORF3, were characterized in pigs and compared for their pathogenicity. Clinical signs, including lethargy and watery diarrhea caused by KNU-141112-P5 infection, were found as early as 1 DPI, after which the severity of clinical signs and fecal shedding of PEDV were markedly increased. All animals in Group 1 inoculated with KNU-141112-P5 continued to experience more severe watery diarrhea and dehydration, worsening over time, and all died in periods up to 5 DPI. This disease course is typical for pigs that are naturally or experimentally infected by the PEDV G2b strain (Debouck et al., 1981; Jung et al., 2014; Lee et al., 2015; Madson et al., 2014; Stevenson et al. , 2013). In contrast, we could not observe any typical clinical signs and PEDV-related deaths in all pigs challenged with S DEL2 / ORF3 and S DEL5 / ORF3 in Groups 2 and 3: these were similar to the non-infected controls as a whole. Clinical score was shown. PEDV genomes were detected from rectal swab samples in 100% of inoculated pigs in groups 2 and 3 over a period of up to 3 DPI, but significantly reduced virus amount (more than 2-log) compared to KNU-141112-P5 group This suggests limited viral shedding for the S DEL2 / ORF3 and S DEL5 / ORF3 strains. At necropsy, small intestinal lesions with gross and thin barriers were observed in parentally infected pigs, but small intestine tissue in S DEL2 / ORF3- and S DEL5 / ORF3 infected groups was normal and similar to the negative control. Likewise, histopathological lesions in the small intestine were distinguished between parental virus KNU-141112-P5 and cell-adapted S DEL2 / ORF3 or S DEL5 / ORF3 viruses. All piglets in the KNU-141112-P5 group had acute viral enteritis with general marked villous atrophy. In contrast, the two groups infected with cell-adapted DEL strains did not show significant gross lesions in all segments of the small intestine, which were similar to negative control pigs.

In another embodiment of the invention, we immunized pigs twice with each cell-adapted strain and analyzed by SN test whether the animal had humoral immunity. Surprisingly, porcine serum similarly contained high levels of neutralizing antibodies, supporting that the cell-attenuated virus of the present invention elicited an immune response. Both KNU-141112-S DEL2 / ORF3 and KNU-141112-S DEL5 / ORF3 of the present invention are virologically and clinically attenuated in vivo, including effective protection against PEDV, and markedly in natural hosts. It was confirmed to be immunogenic.

As such, according to previous studies and the results of the present invention, major genetic changes in ORF3 derived from cell culture adaptation are virulent PEDV, even though contributions by other mutations and deletions, particularly within the S gene, cannot be explicitly excluded. It may be associated with weakened pathogenicity of the strain. However, the exact function of the PEDV ORF3 protein is currently unknown. PEDV ORF3 is known to contain four membrane protein (TM) domains and form tetrameric assemblies (Wang et al., 2012). It has been found that PEDV ORF3 encodes an ion channel protein, and TM4 at the 151-172 amino acid position of ORF3 may play an important role in potassium channel activity (Wang et al., 2012). More interestingly, attenuated PEDV encoding truncated ORF3 lacking TM3 and TM4 domains was known to have no ion channel activity (Wang et al., 2012). However, one of the attenuated strains, KNU-141112-S DEL5 / ORF3, includes the TM2 to TM4 domains and thus contains a truncated 153 aa that is predicted to maintain ion channel activity. Thus, ion channel activity of the ORF3 product may be independent of the virulence of PEDV. Specific knockdown of ORF3 by siRNA in PEDV infected cells reduced the number of viral particles from the cells, indicating that ORF3 regulates virus production (Wang et al., 2012). Inconsistent with this previous study, we found that cell-adapted DEL strains with large deletion regions in ORF3 grow efficiently in cell culture. Recent studies have also revealed that PEDV ORF3 protein is unnecessary for viral replication in cultured cells (Li et al., 2013). According to these results, some results suggest that the accessory ORF3 gene is unnecessary for in vitro PEDV replication. Despite the negligible function in virus propagation in vitro, preservation of complete ORF3 in wild PEDV isolates suggests that ORF3 protein plays an important role in natural infection in animal hosts.

In conclusion, we obtained four distinct DEL strains in vitro serial passage and lost virulence in vivo of cell-adapted viruses with large deletions in ORF3 and potent immunity in pigs of cell-adapted strains. Demonstrated originality retention. Genetic factors are involved in the phenotypic properties of PEDV, so ORF3 may be an important viral component that determines pathogenic characteristics. According to the present invention, in vivo infection with cell-adapted S DEL2 / ORF3 and S DEL5 / ORF3 viruses resulted in attenuated results, which resulted in PEDV pathogenicity in which the functional defect of ORF3 resulting from a wide range of deletions was altered in natural hosts. Present your contribution. The present invention revealed that genetic changes associated with virulence hallmarks in PEDV may be related to ORF3 genes. However, there is still the possibility that other genetic variations identified in the attenuated DEL virus may be involved in the virulence of PEDV.

Vaccine compositions comprising the attenuated virus of the present invention are generally 10 ³ ~. 10 ¹⁰ viral particles. The vaccine composition according to the present invention may comprise one or more selected from the group consisting of pharmaceutically acceptable carriers, diluents, preservatives or immunosuppressants. For example, a carrier that can be used in the present invention is a physiological salt solution. One or more emulsifiers such as adjuvant, Tween, and Span can be used with the live vaccine according to the present invention. Suitable adjuvants include, for example, vitamin-E acetate solubilizers, aluminum hydroxide, aluminum phosphate or aluminum oxide, oil emulsions, saponins and the like. The vaccine according to the invention can be prepared in lyophilized form, in which case it is preferred to add stabilizers to the attenuated virus. Suitable stabilizers include, for example, SPGA (Bovarnik et al., J. Bacteriology 59, 509, 1950), carbohydrates (sorbitol, mannitol, trehalose, starch, sucrose, dextran or glucose, etc.), proteins ( Albumin or casein), or degradation products thereof, and buffers (alkali metal phosphates).

Vaccine compositions according to the invention may be administered by intramuscular or subcutaneous injection or by intranasal, intratracheal, oral, dermal, transdermal / endothelial or intradermal administration. Physiological salt solutions are simple and suitable carriers for intradermal or intramuscular administration. The vaccine according to the invention can be administered to healthy pigs 10 days of age or older. The vaccines of the present invention comprise other attenuated vaccines or antigenic substances from inactivated pathogens or other pathogens along with live vaccine PRRS virus. Such pathogens can be, for example, bacteria or parasites, and can also be viral sources. Usually, irrelevant pathogens or antigenic substances will be swine pathogens. Antigens are understood as substances capable of inducing an immune response and include proteins, polysaccharides, and lipopolysaccharides.

Hereinafter, the present invention will be described in more detail based on Examples. The following examples are only intended to illustrate the invention, but are not intended to limit the scope of the invention.

Materials and methods

Cells, viruses and antibodies

Cultured Vero cells (ATCC CCL-81) in α-Minimum Essential Medium (α-MEM; Invitrogen, Carlsbad, CA) containing 5% Fetal Bovine Serum (FBS; Invitrogen) and Antibacterial and Antifungal Solution (100x; Invitrogen) And placed in a 37% humidified 5% CO ₂ incubator. Virulence The Korean-type PEDV strain, KOR / KNU-141112 / 2014, was identified according to the previous literature (Lee et al., 2015, page 216) (please refer to the page where the relevant contents are listed) and grew in Vero cells . The virus of the fifth passage in cell culture (KNU-141112-P5) was prepared as a stock and used as parental virus (GenBank accession no. KR873434) for the present invention. PEDV N protein-specific monoclonal antibody (MAb) was obtained from the Central Vaccine Institute (CAVAC; Daejeon, South Korea).

Serial passage of the virus

PEDV strain KNU-141112-P5 was plaque purified twice in Vero cells and the purified virus was serially passaged in Vero cells according to the method described in Lee et al., 2015, page 216. Confluent Vero cells cultured in a 100 mm diameter tissue culture dish were washed with PBS and inoculated with 1 ml of 10-fold diluted PEDV KNU-141112 containing trypsin (USB, Cleveland, OH). After 1 hour of incubation at 37 ° C., virus growth medium [α-MEM, 0.3% tyrosine phosphate broth (TPB; Sigma, St. Louis, MO) added with antibacterial and antifungal solution, 0.02% yeast extract (yeast) extract) (Difco, Detroit, MI), 10 mM HEPES (Invitrogen), and 5 μg / ml trypsin] were added. The inoculated cells were placed at 37 ° C. under 5% CO ₂ , and cytopathic effects (CPE) were monitored daily. When 70% CPE appeared, three freeze and thaw procedures were performed on the inoculated cells. The culture supernatant was then centrifuged at 400 x g (Hanil Centrifuge FLETA5, Incheon, South Korea) for 10 minutes and filtered using a 0.45 μm pore size filter (Millipore, Billerica, Mass.). The filtered supernatant was aliquoted and stored at 80 ° C. as virus stock for the next experiment. In the same way, 100 serial passages were performed on Vero cells. At the 70th passage of cell culture, the virus was plaque cloned every 10 passages. Single plaques were selected and nucleotide sequencing confirmed mutations in the S gene and further passage of the selected virus.

Immunofluorescence assay ( Immunofluorescence assay (IFA)

Vero cells cultured on microscope coverslips placed on 6-well tissue culture plates were infected with PEDV at a multiplicity of infection (MOI) of 0.1. The virus infected cells were then expanded to 24 hpi. Fix with 4% paraformaldehyde (paraformaldehyde) for 10 minutes at room temperature (RT) and permeate for 10 minutes at room temperature with 0.2% Triton X-100 in PBS. The cells were blocked with 1% bovine serum albumin (BSA) in PBS for 30 minutes at room temperature and then incubated for 2 hours with N-specific MAb. After washing 5 times in PBS, the cells were incubated with goat anti-mouse secondary antibody conjugated to Alexa Fluor 488 (Invitrogen) for 1 hour at room temperature, and 4 ', 6-diimidino-2-phenylindole. Counterstained with (4 ', 6-diamidino-2-phenylindole (DAPI; Sigma)). The coverslips were placed on microscope glass slides in mounting buffer and cell staining was observed with a Leica DM IL LED microscope (Leica, Wetzlar, Germany).

Virus titer

As described above, Vero cells were infected with each KNU-141112 virus stock under trypsin. Culture supernatants were harvested 24 or 48 hours post infection with 70% CPE commonly occurring. For growth kinetics experiments, the supernatants were harvested at different time points (6, 12, 24, 36, and 48 hpi) from cells infected with each virus strain and stored at 80 ° C. Virus titers were duplicated in plaque assays using Vero cells and plaque-forming units (mL) were determined per ml. That is, 200 μl of serially diluted virus suspension containing trypsin was used for each well to inoculate Vero cells grown in 6-well plates and adsorbed at 37 ° C. for 1 hour. 2 ml of premixed virus growth medium and 1.5% Bacto agar (Difco) were added to the inoculated cells and incubated at 37 ° C for 2 days. 48 hours after inoculation (48 hpi), plaque morphology was analyzed by staining with 1% crystal violet in ethanol.

Nucleotide sequencing

The full-length dielectric sequence of the cell-adapted KNU-141112 DEL strain was analyzed by next-generation sequencing (NGS). Total RNA from serialized virus stocks in Vero cells was extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions and used as a template for cDNA fragment amplification (Lee and Lee, 2014; Lee et. al., 2014b; Lee et al., 2015). Ten overlapping cDNAs were constructed to cover the entire genome of each sample and NGS was used using an Ion Torrent Personal Genome Machine (PGM) Sequencer System (Life Technologies, Carlsbad, Calif.) And a 316 v2 sequencing chip (Life Technologies). (Lee and Lee, 2014, page 1223; Rothberg et al., 2011, page 350). Single base mutations (SNPs) were analyzed with CLC Genomic Workbench version 7.0 (CLC Bio, Cambridge, Mass.) And individual NGS readings were analyzed using the complete genome of the PRRSV reference strain KNU-141112-P5 (Genbank accession no. KR873434). Assembled. The 5 'and 3' ends of the cell-adapted KNU-141112 genome were analyzed by rapid amplification of cDNA ends (RACE) (Lee and Lee, 2013, page 1766). High passage KNU-141112 DEL derivatives (KNU-141112-S DEL2, KNU-141112-S DEL2 / ORF3 (SEQ ID NO: 1), KNU-141112-S DEL5, and KNU-141112-S DEL5 / ORF3 (SEQ ID NO: : 2) Full-length dielectric nucleotide sequences were deposited in the GenBank database from KY825240 to KY825243 , respectively (Genebank, March 27, 2017.) In addition, the unique nucleotide deletions identified in S and / or ORF3 were converted to the traditional Sanger method. Two or three overlapping cDNA fragments spanning the coding regions corresponding to the entire S and ORF3 genes of each strain were amplified by RT-PCR (Lee et al., 2010.) Individual cDNA amplification products Gels were purified and cloned into pGEM-T easy (Promega, Madison, Wis.) And sequenced bidirectionally using two commercial vector-specific T7 and SP6 primers and viral gene-specific primers.

Primer Name Nucleotide sequence (5′-3 ′) Purpose Primer Position (nt *) S-Fwd-1 ACGTAAACAAATGAGGTCTTT PCR 2062420644 S-Rev-1 ATACACCAACACAGGCTCTGT RT and PCR 2286622886 S-Fwd-2 GGTTTCTTCTACCATTCTAATGACG PCR 2283022854 S-Rev-2 GTATTGAAAAAGTCCAAGAAACA RT and PCR 2479524817 S-Fwd-808 GTGGTTTCCAACCAACCC sequencing 2145021467 S-Fwd-2991 TGAGTCTTTTAACTCTGC sequencing 2363323650 S-ORF3-Fwd ACTGGTGAAATTGCAGA PCR 2447024487 S-ORF3-Rev CCACGTATAGCTAGATACAAGTCGATGCTACTAACA RT and PCR 2528225317

* Number same as in KNU-141112 genome.

Genetic analysis

Sequencing and phylogenetic analysis were performed using the 36 fully sequenced S gene sequences of the PEDV isolate and the sequences of 30 completed genomes independently. Multi-sequencing alignments were generated with the ClustalX 2.0 program (Thompson et al., 1997) and the percentage of nucleotide sequence differences was evaluated with the same software program. Construct a phylogenetic tree from aligned nucleotide or amino acid sequences using a neighbor-joining method, and then perform bootstrap analysis with 1,000 replicates to each internal node of the tree. ) (%) Was determined (Saitou and Nei, 1987). Trees were generated using Mega 4.0 software (Tamura et al., 2007).

Pig infection experiment

In vivo pig studies in the present invention were performed at the Central Vaccine Institute according to the guidelines of the Institutional Animal Care and Use Committee. A total of 14 three-day-old weaning pigs were obtained from a breeding sow (Great Yorkshire x Dutch Landrace) in a commercial breeding wild, well sanitized and without PEDV development or vaccination. Virus-specific PCRs using rectal swabs from the animals used in the experiments were performed on PEDV, transmissible gastroenteritis virus (TGEV), porcine deltacoronavirus and porcine rotaviruses. All animals were negative and no antibody to PEDV, TGEV and PRRSV. Pigs were randomly divided into four experimental groups: parental KNU-141112-P5-vaccinated group ( n = 3), KNU-141112-S DEL2 / ORF3-vaccinated group ( n = 4), KNU-141112-S DEL5 / ORF3-vaccinated group ( n = 4), and sham-inoculated control ( n = 3). Commercial milk substitutes were frequently fed to the experimental animals (3 to 4 times per day) and allowed to drink freely during the experimental period (8 days). After 2 days of adaptation, each virus was orally administered to 1 ml of 10 ^5.0 TCID ₅₀ / ml (equivalent to 100 median lethal doses LD ₅₀ of KNU-141112) in piglets (5 days old) of the vaccinated group (Baek). et al., 2016; Lee et al., 2015; Lee and Lee, 2015). For the vaccinated pigs, the cell culture medium was administered as a placebo. As clinical signs, vomiting, diarrhea and death were monitored daily during the experiment. Prior to inoculation, stool samples were collected from all experimental groups with a 16-inch swab and RT-PCR and real-time RT-PCR were performed using i- TGE / PED Detection Kit (iNtRON Biotechnology, Seongnam, South Korea) to confirm the presence of PEDV shedding. . Clinical Significance Score (CSS) was determined based on visual inspection for 7 days post vaccination (DPI) and according to the following scoring criteria: normal and no diarrhea (average Ct value>45); +, Mild to moderate fluidic feces; ++, moderate watery diarrhea; +++, severe watery and projectile diarrhea (average Ct value <20). Piglets died after challenge during the experiment were autopsied and all surviving pigs and control pigs were euthanized 7 days after challenge for post hoc assay.

For immunogenicity evaluation, a total of 11 three week old pigs were obtained and tested as above. Pigs were randomly grouped: parental inoculation group KNU-141112-P5 ( n = 3), KNU-141112-S DEL2 / ORF3 inoculation group ( n = 3), KNU-141112-S DEL5 / ORF3 inoculation group ( n = 3), and the inoculation control ( n = 2). After 2 days acclimation, 1 ml of each virus was immunized orally with 9 pigs (24 days old) and boosted with the corresponding virus at 2 week intervals. Two inoculated pigs were administered and boosted with cell culture media. Blood serum before immunization was collected before immunization and antiserum was collected 2 weeks after the last boost. Serum samples were tested for PEDV antibodies by virus neutralization reaction.

Quantitative Real-Time RT-PCR

Viral RNA was extracted from the stool samples prepared above using the i- TGE / PED Detection Kit according to the manufacturer's instructions. One Step SYBR PrimeScript RT-PCR Kit (TaKaRa, Otsu, Japan) and primers (potential primer 5′-ACGTCCCTTTACTTTCAATTCACA-3 ′ (SEQ ID NO: 3), inversion primer 5′-TATACTTGGTACACACATCCAGAGTCA-3 ′ (SEQ ID NO: 4) and Real-time RT-PCR was performed using a probe (5-FAM-TGAGTTGATTACTGGCACGCCTAAACCAC-BHQ1-3 '(SEQ ID NO: 5) according to the description of the prior art (Kim et al., 2007; Sagong and Lee, 2011). The Thermal Cycler Dice Real Time System (TaKaRa) was reacted under the manufacturer's protocol under the following conditions: 30 minutes 1 cycle at 45 ° C., 10 minutes 1 cycle at 95 ° C., and 15 seconds at 95 ° C. and 60 ° C. 1 minute 40 cycles The results were analyzed by software (Sagong and Lee, 2011) In order to generate a standard curve on each PCT plate, 10-fold serial dilutions of PEDV isolates with known infectivity were performed. virus concentration of the sample and hold the (TCID ₅₀ / ㎖) Was. The average Ct (threshold cycle) value is calculated based on the PCR-positive samples, was calculated based on the average virus titer for all the pigs in the group.

Histopathology and Immunohistochemistry of the Small Intestine

At necropsy, small intestine tissue specimens (<3 mm thick) were collected from each pig in accordance with standard laboratory manuals, fixed with 10% formalin at room temperature for 24 hours and then immersed in paraffin. Formalin-fixed and paraffin-immersed tissue was cut to 5-8 μm thickness on a microtome (Leica) and transferred onto glass slides. Next, paraffin was removed from the tissues for 5 minutes in xylene and washed for 3 minutes at each concentration while lowering the ethanol concentration (100%, 95%, 90%, 80%, and 70%). The paraffin-depleted tissue fragments were stained with hematoxylin and eosin (Sigma) for histopathology, or PEDV N-specific according to the contents described in Lee et al., 2015. Immunohistochemistry (IHC) was performed using red MAb. In summary, paraffin was removed from the paraffin-immersed tissue fragments, treated with 0.01 M citrate buffer (pH 6.0) for 5 minutes in a microwave oven, and cooled at room temperature for 20 minutes. Then, incubated with 0.3% hydrogen peroxide for 20 minutes in distilled water (DW) to block the underlying peroxidase. After three washes in PBS, the tissue sections were blocked with normal horse serum (VECTASTAIN ABC Kit; Vector Laboratories, Burlingame, Calif.) And incubated with N-specific MAbs for 1 hour at room temperature. After washing in PBS, the samples were reacted with horse anti-mouse secondary antibody (VECTASTAIN ABC Kit) for 45 minutes at room temperature, incubated with avidin-biotin peroxidase complex, and then DAB Substrate Kit (Vector Laboratories) was developed using the manufacturer's instructions. Next, the slides were counterstained with hematoxylin, dehydrated, washed with xylene and placed on microscope glass in mounting buffer. Tissue staining was visually observed under a microscope.

Serum neutralization

Determination of the presence of PEDV-specific neutralizing antibodies in serum samples collected from all experimental pigs using the PEDV isolate KNU-141112 and serum neutralization (SN) tests in 96-well microtiter plates. It was. In summary, Vero cells were propagated at 2 × 10 ⁴ / well for 1 day in 96-well tissue culture plates. The KNU-141112-P5 virus stock was diluted in serum free α-MEM to prepare 50 μl of 200 TCIP. The diluted virus was then mixed with 50 μl of individual 2-fold serially diluted inactivated serum and incubated at 37 ° C. for 1 hour. The mixture was inoculated into Vero cells and incubated at 37 ° C. for 1 hour. After removing the mixture, the cells were thoroughly washed 5 times with PBS and then placed in virus growth medium at 37 ° C. in a 5% CO ₂ incubator for 2 days. Neutralization titers were calculated corresponding to the highest serum dilutions that inhibited virus-specific CPE in all duplicated wells.

Statistical analysis

Student's t test was used (Student's t test) in all statistical analysis, P less than 0.05 - the value was considered to be statistically significant.

Example

Example 1: Characterization of phenotype of serial passage NU-141112 DEL strain

The inventors have recently isolated the virulent G2b strain KOR / KNU-141112 / 2014, which was the cause of the massive PEDV epidemic in Korea (Lee et al., 2015). In the present invention, we first performed in vitro serial growth and plaque cloning at specific passages. KNU-141112, KNU-141112-P80 and KNU-141112P90 (80th of KNU-141112 and In the high passage derivative plaque purification of passage 90), a single plaque was selected and the nucleotide sequence of the full length S gene was analyzed separately. Preliminary nucleotide (nt) sequencing identified four different deletion patterns: 6-nt (2 amino acids) DEL at the N-terminus of S1 (S DEL2), 15-nt at the N-terminus of S1 (S DEL2) (5 amino acids), S DEL2 plus large-scale 46-nt deletion of the intergenic-linked region located from the C-terminus of S and the N-terminus of ORF3 (S DEL2 / ORF3); And S DEL5 plus the same (S DEL5 / ORF3). Plaque cloned viruses with individual DEL patterns were further propagated up to 100 passages and KNU-141112-S DEL2, KNU-141112-S DEL5, KNU-141112-S DEL2 / ORF3 (SEQ ID NO: 1) and KNU-141112 Virus stocks designated as -S DEL5 / ORF3 (SEQ ID NO: 2) were prepared.

Like parent viruses, all cell-adapted DEL strains are characterized by distinct CPEs typical for PEDV infection in infected Vero cells, such as cell fusion, multi-nucleated cell formation (syncytium), and isolation of CPEs (cells). Lesion effect). The onset of CPE was 12 hpi, which resulted in significant CPE within 24 hpi in parental and cell-adapted viruses. Virus proliferation was confirmed by PEDV antigen detection by IFA using PEDV N protein-specific MAbs. Distinct staining was distributed in the cytoplasm of typical syncytial cells (FIG. 1). Vero cells were infected with PEDV KNU-141112-P5 and cell-adapted DEL virus. PEDV-specific CPEs were observed daily and photographed at 24 hpi using a 200 magnification inverted microscope (FIG. 1, first panel). For immunostaining, infected cells were fixed at 24 hpi, incubated with MAb for N protein and then treated with Alexa green-conjugated goat-anti mouse secondary antibody (FIG. 1, second panel). Next, the cells were counterstained with DAPI (FIG. 1, third panel) and observed with a fluorescence microscope at 200 magnification. Arrows in FIG. 1 show distinct conjugation in Vero cells infected with S DEL2 / ORF3 and S DEL5 / ORF3 strains. Interestingly, the DEL strain had prominent FA and CPE showing fear formation with syncytia caused by multinucleated giant cells, which was KNU-141112-S DEL2 / ORF3 and KNU-141112-S DEL5 / ORF3. It was larger and predominant than in infected cells (see FIG. 1 arrow).

To investigate the in vitro phenotypic characteristics of serial passage DEL strains, infectivity levels for each virus were assessed by virus titer. The infectious titer of parental virus KNU-141112-P5 was 10 ^6.20 PFU / ml (letter broken), whereas the titer of cell-adapted virus was 10 ^6.92 to 10 ^7.47 PFU / ml (FIG. 2A). 2A shows viral titers of parental KNU-141112-P5 and cell-adapted DEL strains, at 24 or 48 hpi, viral supernatants were harvested and virus titers analyzed by plaque assay. FIG. 2B shows the one-stop growth curve for the KNU-141112 strain, the culture supernatant recovered after the indicated infection, and the virus titer measured by plaque assay. The results are expressed as the average of two independent duplicate experiments, with error bars representing standard deviations. One-step growth kinetics showed that the growth curve of the parental virus gradually increased, reaching a peak at 48 hpi after inoculation (FIG. 2B). In contrast, the growth kinetics of cell-passage DEL strains were faster compared to the parent strain and showed higher titers down to 24 or 36 hpi. In addition, all cell-passage DEL strains showed the highest titers at 24 hpi, after which the decrease in titers increased. 2C is the result of plaque morphology of parental and cell-adapted viruses. A single layer of Verocells grown in 6-well plates was infected with each virus. Each cell was placed in 0.75% agarose and incubated for 2 days. Plaques were stained with 1% crystal violet at 48 hpi and photographed. Next, we observed the plaque morphology of KNU-141112. As shown in FIG. 2C, the size of the plaques increased in cell-adapted DEL strains compared to the parental virus, of which KNU-141112-S DEL2 / ORF3 and KNU-141112-S DEL5 / ORF3 were the largest plaques. Was formed. These results suggest that each DEL signature in the cell adaptation process contributes independently to viral fitness.

Example 2: Complete genome characterization of 100-passage KNU-141112 DEL strain

To investigate genome changes that may be related to viral fitness identified during in vitro serial passage of Vero cells, full-length nucleotide sequences of cell culture-passage DEL strains were analyzed by NGS. For each NGS, a complete KNU-141112-P5 genome (GenBank accession no. KR873434) was used as an initial reference, and individual whole genome sequences were successfully verified by combining each NGS reading. Sequencing of the 5 'and 3' ends of these genomes with RACE also showed that the lengths of the 5 'and 3' UTRs of all cell-adapted DEL viruses were 292-nt and 334-nt, the same as the parent virus. With the exception of unique DEL patterns in S and / or ORF3 of each strain, no further insertion or deletion mutations could be identified across the entire genome in cell culture passages. Thus, the genome sizes of the S DEL2, S DEL5, S DEL2 / ORF3 and S DEL5 / ORF3 strains were 6-nt, 53-nt, respectively, compared to the parental genome of 628,038-nt because of their overall DEL number. 18-nt and 64-nt appeared to be short. The genome of KNU-141112-P5 had a high level of similarity (99.7-99.9%) with its cell-adapted DEL strain at the nucleotide level. The numbers of nucleotide / amino acid substituents excluding deletions compared to the parent strain are summarized in Table 1. Table 1 shows the number of changes in nucleotides and amino acids between parental virus KNU-141112-P5 and cell-adapted DEL virus.

UTRs / ORFs Encoded protein No. of nucleotide / amino acid changes P5 DEL2 DEL2 / ORF3 DEL5 DEL5 / ORF3 5′-UTR 0/0 0/0 0/0 0/0 0/0 ORF1a nsp1 0/0 0/0 0/0 0/0 0/0 nsp2 0/0 1/0 1/0 1/1 0/0 nsp3 0/0 4/3 3/3 1/1 1/1 nsp4 0/0 0/0 0/0 0/0 0/0 nsp5 0/0 1/1 1/1 1/1 1/1 nsp6 0/0 0/0 0/0 1/0 1/0 nsp7 0/0 0/0 0/0 0/0 0/0 nsp8 0/0 0/0 0/0 0/0 0/0 nsp9 0/0 0/0 0/0 1/0 1/0 nsp10 0/0 0/0 0/0 0/0 0/0 nsp11 0/0 0/0 0/0 0/0 0/0 ORF1b nsp12 0/0 1/1 0/0 0/0 1/0 nsp13 0/0 1/1 0/0 2/2 2/2 nsp14 0/0 0/0 0/0 0/0 0/0 nsp15 0/0 0/0 0/0 0/0 0/0 nsp16 0/0 0/0 0/0 0/0 0/0 ORF2 S 0/0 7/5 8/8 4/4 4/6 ORF3 ORF3 0/0 6/2 12/1 5/2 5/1 ORF4 E 0/0 1/1 1/1 1/1 1/1 ORF5 M 0/0 0/0 0/0 1/0 1/0 ORF6 N 0/0 0/0 0/0 0/0 0/0 3′-UTR 0/0 0/0 2/0 1/0 1/0 Total number 22/14 28/14 19/12 19/12

S DEL2 and S DEL2 / ORF3 strains had a total of 22-nt and 28-nt mutations, respectively, compared to KNU-141112-P5, while S DEL5 and S DEL5 / ORF3 identically included 19-nt mutations. Interestingly, the 5'-UTRs of all DEL strains remained unchanged, while the 3 'UTR was completely conserved only in S DEL2. The other strains replaced G with T at position 6 in 3 'UTR (S DEL5 and S DEL5 / ORF3) or A with T and G in position A at positions 135 and 193 in 3' UTR, respectively (S DEL2 / ORF3). These mutations in the 3 'UTR do not appear to naturally exist at the corresponding positions of other isolates available at GenBank, cis-acting elements ( cis) within this region that play an important role in RNA replication and transcription. -acting elements).

The 22-nt substitution at the 100th passage of S DEL2 is present in the coding region, 14 of these variants are non-synonymous and encode 7 viral proteins (4 non-structural, 2 structural and 1 accessory) Results in randomly distributed amino acid changes within ORFs 1a, 1b, 2, 3, and 4 (Table 2). Table 2 shows amino acid variations in parental virus KNU-141112-P5 and DEL derivative virus during in vitro serial passage.

ORF Encoding protein (aa length) aa position ^a Mutation at indicated no. of passages P5 DEL2 DEL2 / ORF3 DEL5 DEL5 / ORF3 ORF1a nsp2 192 T T T I T nsp3 1564 S F F F F 2178 I L L I I 2182 C F F C C nsp5 3186 T I I I I ORF1b nsp12 142 K N K K K nsp13 1025 T I T I I 1165 A A A S S ORF2 S 272 K T T T T 381 N N K N N 383 T N T N N 516 T T I T T 888 G R R R R 1287 E Q Q Q Q 1380 F F H F H 1381 E E D E D ORF3 ORF3 26 D Y b Y 135 K K S K K 166 N S S S ORF4 E 70 P S S S S

^a represents the amino acid position based on the sequence of Amino acid position numbering is based on the sequence of KNU-141112-P5 strain.

The 25-nt change in the S DEL2 / ORF3 strain is within the coding region, and the same number of substitutions as S DEL2 encode the five viral proteins (2 non-structural, 2 structural and 1 accessory) as non-silent. To induce amino acid (aa) mutations located within ORFs 1a, 2, 3 and 4. The 18-nt substitutions located within the coding regions of S DEL5 and S DEL5 / ORF3 are ORFs 1a, 1b, 2, 3 and 4, and 6 encoding seven viral proteins (4 non-structural, 2 structural and 1 accessory), respectively. Equally induced 12-aa mutations in ORFs 1a, 1b, 2, and 4 encoding dog viral proteins (3 nonstructural, 2 structural and 1 accessory). Overall, 28.6% to 42.9% (4-6 changes) of 12 or 14 non-silent mutations occur within nsps, while 57.1% to 71.4% (7-10 changes) show structure S and E and accessory ORF3 proteins Occurred within (Figure 3). The genome sequence in FIG. 3 was determined as described in Table 2. About 28 kb of KNU-141112 genomic tissue is shown above. Coding regions for each nsp in ORFs 1a and 1b and coding regions for each structural protein are shown. The lower panel shows the genome of KNU-141112-P5 and its in vitro passaged DEL derivatives, where the vertical line represents 1 aa substitutions relative to the predicted aa sequence of KNU-141112-P5. In Figure 3, the vertical dotted line shows minor DEL features (S N-DEL2, S N-DEL5, and ORF3 C-DEL5), while the gaps represent major DEL patterns (S C-DEL5 plus ORF3 N-DEL70 and ORF3 C-DEL88). Of the mutations in the coding regions for S, ORF3 and E, most of the changes (57.1-80.0%) were significant in the major structural S genes. Nsp1, nsp4, nsp611, nsp1416, M and N proteins are highly conserved and remained unchanged throughout the cell lineage. In addition, each genomic region of KNU-141112 spanning amino acid substitutions in the indicated DEL strains was individually sequenced by traditional sequencing methods. The mutated sequences of the corresponding DEL viruses were identical to those determined by NGS. From these results, the present invention suggests that nonstructural protein and S glycoprotein may contribute to the attenuation of KNU-141112 strain.

Two overlapping ORF1a and ORF1b of PEDV encode 4,117 and 2,681-amino acid polyproteins, respectively, which were cleaved to functional 16 nsps by proteolysis. A total of six amino acid changes in KNU-141112-S DEL2 were distributed over four nsps, including nsp3, nsp5, nsp12, and nsp13, respectively, as compared to KNU-141112-P5 individually 3, 1, 1, and One variation was included. Compared with the parental virus, KNU-141112-S DEL2 / ORF3 contained three and one amino acid mutations in nsp3 and nsp5, which were evenly present in S DEL2. Five amino acid substitutions in KNU-141112-S DEL5 were distributed over four nsps including nsp2, nsp3, nsp5 and nsp13, each containing 1, 1, 1, and 2 variants. Interestingly, the variation pattern in nsps of S DEL5 / ORF3 was almost identical to the S DEL5 strain, except that there was no one variation in nsp2 (T1921). PEDV is a papain-like cysteine protease PL ^pro that processes two viral proteases in ORF1a, the N-terminus of ORF1a. (nsp3) and chymotrypsin-like protease 3CL ^pro involved in the cleavage of nsp16 at nsp4 encode (nsp5) (Lee, 2015). All four cell-adapted DEL strains contained one mutation in common in both nsp3 (S1564F) and nsp5 (T3186I). However, the other two variants (I2178L and C2182F) nsp3 were only seen in the S DEL2 and S DEL2 / ORF3 strains. PEDV ORF1b is expected to encode nucleases and replicas, including viral RNA-dependent RNA polymerase (RdRp; nsp12) and multifunctional helicase protein (nsp13). The remainder of the nsp mutations are often found in the virus RdRp nsp12 and the helicase nsp13. The S DEL2 strain independently included one mutation in each nsp12 (K142N) and nsp13 (T1025I), which was not present in S DEL2 / ORF3. In contrast, both S DEL5 and S DEL5 / ORF3 strains had two mutations (T1025I and A1165S) within nsp13. In addition, the slippery heptamer sequence (TTTAAAC) and the subsequent stem-loop structure of the ORF1a and ORF1b junctions in the PEDV genome, a potential RFS signal in the translation process producing pp 1ab, are complete in the cellular process. Was maintained. Given these results, the present invention suggests that changes in viral proteases and / or amino acids in the helicase play a role in the virulence of KNU-141112.

Compared to the KNU-141112-P5 parent strain, a total of 7, 8, or 10 amino acid variations dependent on cell-adapted DEL strains were respectively found in ORF2 to ORF4 encoding Structure S, Accessory ORF3 and Structure E proteins, respectively. It was confirmed (Table 2). As expected, S showed the highest mutation rate (4-8 changes) among the structural and accessory proteins. The S protein can be divided into four structural domains: a signal peptide, S1 and S2, a membrane protein domain, and a short carboxyl terminal substrate / virus-internal, which are additionally large external domains separated into two subdomains. Endodomain (carboxylterminal cytosolic / virus-internal endodomain). (Lai et al., 2007). Most of the amino acid substitutions within S have accumulated within the S1 and S2 ectodomains of the topology domain. S DEL2 and S DEL2 / ORF3 strains contained 3 (I55K, K272T, and T383N) and 4 (I55K, K272T, N381K, and T516I) mutations in S1, respectively, and the remaining DEL strains had identical mutations (K272T and T383N) within S1. ). Interestingly, all cell-adapted DEL strains contained only two (G888R and E1287) mutations in the S2 region. These variations identified in S2 are unique because the S2 sequences that make up the stock of spikes are more conservative than S1 (Lai et al., 2007; Lee et al., 2010). In addition, the S protein induces the fusion of the viral envelope and the host cell membrane, and the membrane fusion activity is believed to be conferred by the hydrophobic sequence inherent in the S2 protein (Lai et al., 2007; Lee, 2015).

Thus, amino acid substitutions in S2 that occur during cell culture adaptation may contribute to cytopathology, including PEDV-specific CPE formation. There were two additional variations in the cytoplasmic domain of S, which occurred in common only in the S DEL2 / ORF3 and S DEL5 / ORF3 strains. Within the S protein of PEDV, two neutralizing epitopes were identified at amino acid positions 748-755 and 764-771 (Sun et al., 2008). Amino acid residues containing these epitopes remained unchanged during cell passage. The PEDV S protein is heavily glycosylated and the parental KNU-141112-P5 strain contains 21 potential N-glycosylation sites defined as N-X-S / T. Where X is any amino acid except proline. The predicted N-glycosylation site in the S protein of KNU-14111-P5 is the common deletion of the N-glycosylation sequence NST at positions 381-383 in the parental virus caused by N381K or T383N found in all DEL strains, and It was almost completely conserved in cell-adapted DEL strains, with the exception of certain deletions of the sequence NIT at positions 514-516 in the parental viral S protein, caused by the T516I mutation found in the S DEL2-ORF3 strain. PEDV ORF3 has been proposed to encode ion channel proteins, and tyrosine residues at position 170 in ORF3 are important for its potassium channel activity (Wang et al., 2012). The cell-adapted DEL strains had one or two changes in other positions instead of no mutations in the same position: S DEL2 and S DEL5 strains contained two mutations (D26Y and N166S) at positions 26 and 166 in ORF3. In contrast, the S DEL2 / ORF3 and S DEL5 / ORF3 strains contained only one variation (K135S or N166S, respectively) at different positions within ORF3. The last non-synonymous change was present in the E protein, and all DEL strains included P70S substitutions in the E protein. There was no variation in the M and N protein coding regions.

The most prominent feature of the change in nucleotides resulting from the passage of KNU-141112 in Vero cells is the abnormally small and / or large deletions in the high passage (after at least 70 passages) virus. The first mode of DEL pattern is a short 6-nt or 15-nt deletion in the S gene-coding region, with 2-aa (S N-DEL2) at positions 56-57 and 56-60, respectively, in the N-terminus of S. Or an extended 5-aa (S N-DEL5) deletion thereof. Compared to the standard G1a strain, the S gene of the G2 pandemic wild strain, including KNU-141112, has distinct genetic characteristics, namely two notable 4-aa and 1- in positions 55/56 and 135/136, respectively. Longer than 9-nt (3-aa) due to indels (S INDELs), consisting of aa insertions and 2-aa deletions at 160 and 161 positions of S (Lee et al., 2010; Lee, 2015 ). The S N-DEL2 and S N-DEL5 appeared in the first insertion footprint of the G2 wild strain, so the S N-DEL characteristics of the cell-adapted strain were similar to the standard G1a except for its length. It was. The second is a combination pattern with large 46-nt deletions at the intergenic positions of S and ORF3 (24,771 to 24,8l6 at the genome level), which leads to true termination and malfunction in the initiation of S and ORF3. (FIG. 5). As a result, alternative TGA termination of S occurs at the seventh downstream from the last T sequence just before the onset of deletion, which includes 2-aa mutations (F1380H and E1381D) at two positions in S compared to the parental virus. Generate 5-aa short cell substrate domain (FIG. 6A). In addition, due to impairment of the first initiation codon for ORF3, one of two potential events could be expected: impairment of ORF3 expression or search for its second initiation codon for ORF3 expression. The former would result in no production of the corresponding protein, while the latter would facilitate the use of a second ATG initiator present 188 nt downstream from the deleted region, potentially resulting in a 70-aa deletion. Will lead to the production of an N-terminal truncated ORF3 form (ORF3 N-DEL70) (FIG. 6B). The third type is an unusual DEL that replaces GCT nucleotides with TGC termination sequences at positions 409-411 in ORF3 (25,202-25,204 at the dielectric level) (FIG. 5). This change resulted in immature termination 264 nt upstream from the expected termination position, which indirectly removed the 88 amino acid residues in the C-terminus of ORF3 (ORF3 C-DEL88) (FIG. 6B). A fourth feature is the minor 3-nt 'TCG' deletion corresponding to the gene codons for the two residues of phenylalanine and valine at positions 163 and 164 in the C-terminus of ORF3. The first two letters are located in the last two underlined portions of the 'T TC ' corresponding to phenylalanine, and the last letter relates to the first underlined portion of the ' G TT' codon for valine. This variation resulted in a leading frame shift, but the remaining first 'T' and last 'TT' of the triplet for phenylalanine and valine respectively produced a new 'TTT' triplet for phenylalanine, which was next to position 164 of ORF3. This resulted in a single loss of valine residues followed by recovery of the altered frame shift (ORF3 C-DEL1) without causing further mutations (FIGS. 5 and 6B). Finally, the whole genome sequencing data of the present invention completely confirmed the exact DEL pattern of each cell-adapted strain: KNU-141112-S DEL2 (single S N-DEL2), KNU-141112-S DEL5 (S N -DEL5 and ORF3C-DEL1), KNU-141112-S DEL2 / ORF3 (S N-DEL2, S C-DEL5 / ORF3 N-DEL70 combination, and ORF3 C-DEL88), and KNU-141112-S DEL5 / ORF3 ( S N-DEL5, S C-DEL5 / ORF3 N-DEL70 combination, and ORF3 C-DEL1). According to their own DEL patterns, the cell-adapted DEL strains are expected to individually encode S and ORF3 proteins with shorter lengths in a variety of forms than parent viruses (S, 1386-aa; ORF3, 224-aa). KNU-141112-S DEL2 (S, 1384-aa; ORF3, 224-aa), KNU-141112-S DEL5 (S, 1381-aa; ORF3, 223-aa), KNU-141112-S DEL2 / ORF3 (S, 1379-aa; ORF3, 66-aa), and KNU-141112-S DEL5 / ORF3 (S, 1376-aa; ORF3, 153-aa).

Consistent with previous results (Lee et al., 2010; Lee and Lee, 2014; Lee et al., 2014a, b; Lee et al., 2015; Lee, 2015), the complete S protein-based phylogenetic tree is a PEDV strain. Was clearly distinguished into two distinct genotype group clusters, G1 and G2, which clusters could be further classified into subgroups of 1a, 1b, 2a and 2b (FIG. 7A). In FIG. 7, the complete genome sequence of TGEV and similar regions presumed to be spike protein were included as outgroups in each panel. Multi-Sequencing Alignment The ClustalX program was performed and the phylogenetic tree was completed from the aligned nucleotide sequences by the neighbor-joining method. The number of each branch represents a bootstrap value greater than 50% of 1,000 copies. The strain name, country and identification year, GenBank accession number, and gene group and subgroup presented in the present invention are indicated. The parental virus KNU-141112-P5 and cell-adapted DEL strains identified in the present invention are indicated by continuous circles. Scale bars represent nucleotide substitutions. Cell-adapted DEL strains through all 100 passages still belonged to subgroup G2b, along with the parent virus and the recent domestic wild isolates, most closely together with the emerging North American strains in adjacent clades with the same subgroup. Clustered. Subsequent phylogenetic analysis of the S1 region indicated that the S gene-based tree and the grouping structure were identical (data not shown). In addition, phylogenetic analysis of the entire genome sequence demonstrated that the KNU-141112 DEL virus was grouped into the same cluster as the pandemic strains worldwide (FIG. 7B).

Example 3: Experimental Infection of Piglets

High passage derivatives of PEDV showed experimentally reduced pathogenicity in pigs, and large deletions were present in the ORF3 region in attenuated or live vaccines (Park et al., 2008; Wang et al., 2012), as confirmed in the present invention. Second and third DEL patterns (ORF3 N-DEL70 and ORF3 C-DEL88) (Park et al., 2008; Wang et al., 2012) were considered to be most closely related to the virulence of KNU-141112. Thus, cell-adapted KNU-141112-S DEL2 / ORF3 and KNU-141112-S DEL5 / ORF3 strains were used in subsequent animal experiments. Toxicity To assess and compare the in vivo effects on KNU-141112-P5 and its natural host of selected cell-adapted strains thereof, porcine inoculation experiments were performed. The 14 piglets were divided into 4 groups containing 3 or 4 and parent virus KNU-141112-P5 (group 1), KNU-141112-S DEL2 / ORF3 (group 2), or KNU-141112-S DEL5 / ORF3 (Group 3) was challenged orally, the other three were inoculated with cell culture medium as a control. Clinical signs were recorded daily during the conduct of the experiment, and swabs were collected before and after challenge. During the acclimation period, all piglets were active, with no clinical signs with normal stool concentrations, and no PEDV genetic material was detected in the stool samples of any piglets in PEDV-specific RT-PCR. After challenge, the negative control did not show typical clinical signs throughout the pathogenic study, and KNU-141112-P5-challenge piglets (Group 1) had a lethal and soft stool (mean CSS of 0.33 ) 1 day after inoculation (DPI). Clinical signs of broken letters), severe juicy diarrhea and subsequent vomiting (mean CSS of> 3.0 ) (breaked letters) (FIG. 8A). All inoculated animals in group 1 had PEDV-related deaths at 4 or 5 DPI. Surprisingly, the cell-adapted DEL virus-vaccinated piglets of group 2 and group 3 had no PEDV-specific clinical signs and deaths in the course of the experiment, comparable to the control group. All inoculated piglets in group 1 were positive for PEDV with an average Ct value of 29.88 (equivalent to 10 ^2.25 TCID50 / ml) at 1 DPI and from 8.49 to 12.02 (10 ^5.17 to 10) until death. Increasing amounts of PEDV in the Ct range of ^5.74 TCID 50 / ml) were shed on the stools (FIG. 8B). Although PEDV side shedding was recorded at 21.96 (10 ^3.54 TCID50 / mL) and 30.11 (10 ^2.21 TCID50 / mL) up to 2 DPI, respectively, in all piglets in Group 2 and Group 3, this similarly peaked at 4 DPI and then Gradually decreased, overall virus shedding was significantly decreased compared to animals in group 1, with 28.67 to 17.58 (10 ^2.45 to ^4.26 TCID50 / mL) and 31.77 to 21.33 (10 ^1.94 to 10 ^3.64 ) in each of the two groups until the end of the experiment. TCID 50 / mL) showed a wide range of Ct values. Negative control pigs were active with normal stools during the entire experiment and no PEDV shedding was detected in the stools.

All pigs of the parental KNU-141112-P5-infected group were necropsied after death at 4 or 5 DPI. Whole animals from different groups were euthanized at the end of the experiment for post hoc analysis. Intestinal lesions were not observed in the negative control pigs by visual or microscopic examination. Virulence All pigs inoculated with the KNU-141112-P5 strain showed typical PED-like gross lesions. The small intestine was enlarged and yellow fluid was accumulated due to villous degeneration, and the small intestinal wall became thin and transparent (FIG. 9). While the stomach was swollen, solidified and filled with undigested milk, other organ tubes looked normal with the naked eye. In contrast, all pigs infected with group 2 and group 3 cell-adapted KNU-141112-S DEL2-ORF3 or KNU-141112-S DEL5-ORF3 were visually visible to the gastrointestinal tract, similar to the negative control. It did not have any pathological lesions. The small intestine of all dead piglets in group 1 exhibited the general characteristics of acute viral enteritis, including shortening and fusion of small intestinal villi with conjugated surface epithelial cells. In addition, IHC staining markedly detected viral antigen in the cytoplasm of atrophic chorionic epithelial cells in all segments of the small intestine (FIG. 10). However, cell-adapted virus-inoculated pigs of group 2 and group 3 showed normal histopathological intestinal observations similar to the negative control. The small intestine of group 2 and group 3 animals has very little or no virus detected. According to the present invention, two cell-adapted KNU-141112-S DEL2-ORF3 and KNU-141112-S DEL5-ORF3 strains were shown to have significantly attenuated virulence with an attenuated phenotype in experimentally inoculated piglets. appear.

Next, we evaluated the immunogenicity of the natural hosts of these attenuated strains. Pig antiserum was collected before immunization (pre-immune) and tested for their neutralizing activity against KNU-141112 isolated two weeks after the last boost with each virus. Serum samples obtained from pigs immunized with cell-adapted KNU-141112-S DEL2-ORF3 or KNU-141112-S DEL5-ORF3 strains had KNU with mean neutralizing antibody titers greater than 1:64 and 1: 128, respectively. It was very effective in inhibiting -141112-P5 infection, comparable to porcine antiserum against parental virus. In contrast, both pre-isolated and non-immunized serum showed no neutralizing activity against PEDV. From this result, the present invention induces potent antibody responses in animals immunized with cell-adapted KNU-141112-S DEL2-ORF3 and KNU-141112-S DEL5-ORF3 strains, resulting in potent protective against PEDV infection. Suggest immunity.

The attenuated strains of the present invention can be usefully used for the production of vaccines for preventing, treating or preventing and treating swine infections caused by porcine epidemic diarrhea virus (PEDV).

Korea Research Institute of Bioscience and Biotechnology KCTC13201BP 20170208 Korea Research Institute of Bioscience and Biotechnology KCTC13202BP 20170208 Korea Research Institute of Bioscience and Biotechnology KCTC13203BP 20170208 Korea Research Institute of Bioscience and Biotechnology KCTC13204BP 20170208

<110> Choong Ang Vaccine Lab. <120> A novel attenuated PEDV strain and a vaccine composition          configuring <130> CVA17P-0007-KR <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 27985 <212> DNA <213> porcine epidemic diarrhea virus <400> 1 acttaaagag attttctatc tacggatagt tagctctttt tctagactct tgtctactca 60 attcaactaa acgaaatttt gtccttccgg ccgcatgtcc atgctgctgg aagctgacgt 120 ggaatttcat taggtttgct taagtagcca tcgcaagtgc tgtgctgtcc tctagttcct 180 ggttggcgtt ccgtcgcctt ctacatacta gacaaacagc cttcctccgg ttccgtctgg 240 gggttgtgtg gataactagt tccgtctagt ttgaaaccag taactgtcgg ctatggctag 300 caaccatgtt acattggctt ttgccaatga tgcagaaatt tcagcttttg gcttttgcac 360 tgctagtgaa gccgtctcat actattctga ggccgccgct agtggattta tgcaatgccg 420 tttcgtgtcc ttcgatctcg ctgacactgt tgagggattg cttcccgaag actatgtcat 480 ggtggtggtc ggcactacca agcttagtgc gtatgtggac acttttggta gccgccccaa 540 aaacatttgt ggttggctgt tattttctaa ctgtaattac ttcctcgaag agttagagct 600 tacttttggt cgtcgtggtg gtaacatcgt gccagttgac caatacatgt gtggcgctga 660 cggtaaacct gttcttcagg aatccgaatg ggagtataca gatttctttg ctgactccga 720 agacggtcaa ctcaacattg ctggtatcac ttatgtgaag gcctggattg tagagcgatc 780 ggatgtctct tatgcgagtc agaatttaac atctattaag tctattactt actgttcaac 840 ctatgagcat acttttcctg atggtactgc catgaaggtt gcacgtactc caaagattaa 900 gaagactgtt gtcttgtctg agccacttgc tactatctac agggaaattg gttctccttt 960 tgtggataat gggagcgatg ctcgttctat cattaagaga ccagtgttcc tccacgcttt 1020 tgttaagtgt aagtgtggta gttatcattg gactgttggt gattggactt cctatgtctc 1080 cacttgctgt ggctttaagt gtaagccagt ccttgtggct tcatgctctg ctacgcctgg 1140 ttctgttgtg gttacgcgcg ctggtgctgg cactggtgtt aagtattaca acaacatgtt 1200 cctgcgccat gtggcagaca ttgatgggtt ggcattctgg cgaattctca aggtgcagtc 1260 caaagacgac ctcgcttgct ctggtaaatt ccttgaacac catgaggaag gtttcacaga 1320 tccttgctac tttttgaatg actcgagcat tgctactaag ctcaagtttg acatccttag 1380 tggcaagttt tctgatgaag tcaaacaagc tatctttgct ggtcatgttg ttgttggcag 1440 cgcgctcgtt gacattgttg acgatgcact gggacagcct tggtttatac gtaagcttgg 1500 tgaccttgca agtgcagctt gggagcagct taaggctgtc gttagaggcc ttaacctcct 1560 gtctgatgag gtcgtgctct ttggcaaaag acttagctgt gccactctta gtatcgttaa 1620 cggtgttttt gagttcatcg ccgaagtgcc tgagaagttg gctgcggctg ttacagtttt 1680 tgtcaacttc ttgaatgagc tttttgagtc tgcctgtgac tgcttaaagg tcggaggtaa 1740 aacctttaac aaggttggct cttatgttct ttttgacaac gcattggtta agcttgtcaa 1800 ggcaaaagtt cgcggcccac gacaggcagg tgtttgtgaa gttcgttaca caagccttgt 1860 tattgggagt actaccaagg tggtttccaa gcgcgttgaa aatgccaatg tgaatctcgt 1920 cgtcgttgac gaggatgtga ccctcaacac cactggtcgt acagttgttg ttgacggact 1980 tgcattcttc gagagtgacg ggttttacag acatcttgct gatgctgacg ttgtcattga 2040 acatcctgtt tataagtctg cttgtgagct caagccagtt tttgagtgtg acccaatacc 2100 tgattttcct atgcctgtgg ccgctagtgt tgcagagctt tgtgtgcaaa ctgatctgtt 2160 gcttaaaaat tacaacactc cttataaaac ttacagctgc gttgtgagag gtgataagtg 2220 ttgcatcact tgcaccttac atatcacagc accaagttat atggaggatg ctgctaattt 2280 tgtagacctc tgtaccaaga acattggtac tgctggtttt catgagtttt acattacggc 2340 ccatgaacaa caggatctgc aagggttcgt aaccacttgt tgcacgatgt caggttttga 2400 gtgttttatg cctataatcc cacagtgtcc agcagtgctt gaagagattg atggtggtag 2460 catctggcgg tcttttatca ctggtcttaa tacaatgtgg gatttttgca agcatcttaa 2520 agtcagcttt ggactagatg gcattgttgt cactgtagca cgcaaattta aacgacttgg 2580 tgctctcttg gcagaaatgt ataacactta cctttcaact gtggtggaaa acttggtact 2640 ggccggtgtt agcttcaagt attatgccac cagtgtccca aaaattgttt tgggctgttg 2700 ttttcacagt gttaaaagtg ttcttgcaag tgccttccag attcctgtcc aggcaggcat 2760 tgagaagttt aaagtcttcc ttaactgtgt tcaccctgtt gtaccacgcg tcattgaaac 2820 ttcttttgtg gaattagaag agacgacatt taaaccacca gcactcaatg gtagtattgc 2880 tattgttgat ggctttgctt tctattatga tggaacacta tactatccaa ccgatggtaa 2940 tagtgttgtg cctatttgtt ttaagaagaa gggtggtggt gatgtcaaat tctctgatga 3000 agtctctgtt agaaccattg acccagttta taaggtctcc cttgaatttg agttcgagtc 3060 tgagactatt atggctgtgc ttaataaggc tgttggtaat cgtatcaagg ttacaggtgg 3120 ttgggacgat gttgttgagt atatcaacgt tgccattgag gttcttaaag atcatatcga 3180 tgtgcctaag tactacatct atgatgagga aggtggcacc gatcctaatc ttcccgtaat 3240 ggtttctcag tggccgttga atgatgacac gatctcacag gatctgcttg atgtggaagt 3300 tgttactgat gcaccaattg atttcgaggg tgatgaagta gactcctctg accctgataa 3360 ggtggcagat gtggctaact ctgagcctga ggatgatggt cctaatgtag ctcctgaaac 3420 aaatgtagag tctgaagttg aggaagttgc cgcaaccttg tcttttatta aagatacacc 3480 ttccacagtt actaaggatc cttttgcttt tgactttgca agctatggag gacttaaggt 3540 tttaagacaa tctcataaca actgctgggt tacttctacc ttggtgcagc tacaattgct 3600 tggcatcgtt gatgaccctg caatggagct ttttagtgct ggtagagttg gtccaatggt 3660 tcgcaaatgc tatgagtcac aaaaggctat cttgggatct ttgggtgatg tgtcggcttg 3720 cctagagtct ctgactaagg acctacacac acttaagatt acctgttctg tagtctgtgg 3780 ttgtggtact ggtgaacgta tctatgaggg ttgtgctttt cgtatgacgc caactttgga 3840 accgttccca tatggtgctt gtgctcagtg tgctcaagtt ttgatgcaca cttttaaaag 3900 tattgttggc accggcatct tttgtcgaga tactactgct ctctccttgg attctttggt 3960 tgtaaaacct ctttgtgcgg ctgcttttat aggcaaggac agtggtcatt atgtcactaa 4020 cttttatgat gctgctatgg ctattgatgg ttatggtcgt catcagataa agtatgacac 4080 actgaacact atttgtgtta aagacgttaa ttggacagca ccttttgtcc cagacgttga 4140 gcctgtattg gagcctgttg tcaaaccgtt ctattcttat aagaatgttg atttttacca 4200 aggagatttt agtgaccttg ttaaacttcc atgtgacttt gttgttaatg ctgcaaatga 4260 gaatttgtct cacggtggcg gcatagcaaa ggccattgat gtttatacca agggcatgtt 4320 gcagaagtgc tcgaatgatt acattaaagc acacggtccc attaaagttg gacgtggtgt 4380 catgttggag gcattaggtc ttaaggtctt taatgttgtt ggtccacgta agggtaagca 4440 tgcacctgag cttcttgtta aggcttataa gtccgttttt gctaattcag gtgttgctct 4500 tacacctttg attagtgttg gaatttttag tgttcctttg gaagaatctt tatctgcttt 4560 tcttgcatgt gttggtgatc gccactgtaa gtgcttttgt tatagtgaca aagagcgcga 4620 ggcgatcatt aattacatgg atggcttggt agatgctatt ttcaaagatg cacttgttga 4680 tactactcct gtccaggaag atgttcaaca agtttcacaa aaaccagttt tgcctaattt 4740 tgaacctttc aggattgaag gtgctcatgc tttctatgag tgcaaccctg aaggtttgat 4800 gtcattaggt gctgacaagc tggtgttgtt tacaaattcc aatttggatt tttgtagcgt 4860 tggtaagtgt cttaacaatg tgactggcgg tgcattgctt gaagccataa atgtatttaa 4920 aaagagtaac aaaacagtgc ctgctggcaa ctgtgttact tttgagtgtg cagatatgat 4980 ttttattact atggtagtat tgccatctga cggtgatgct aattatgaca aaaattatgc 5040 acgcgccgtc gtcaaggtat ctaagcttaa aggcaagtta ttgcttgctg ttggtgatgc 5100 catgttgtat tccaagttgt cccacctcag cgtgttaggt ttcgtatcca cacctgatga 5160 tgtggagcgt ttctacgcaa ataagagtgt ggttattaaa gttactgagg atacacgtag 5220 tgttaagact gttaaagtag aatccactgt tacttatgga caacaaattg gaccttgtct 5280 tgttaatgac accgttgtca cagacaacaa acctgttgtt gctgatgttg tagctaaggt 5340 tgtaccaagt gctaattggg attcacatta tggttttgat aaggctggtg agttccacat 5400 gctagaccat actgggtttg cctttcctag tgaagttgtt aacggtaggc gtgtgcttaa 5460 aaccacagat aataactgtt gggttaatgt tacatgttta caattacagt ttgctagatt 5520 taggttcaag tcagcaggtc tacaggctat gtgggagtcc tattgtactg gtgatgttgc 5580 tatgtttgtg cattggttgt actggcttac tggtgttgac aaaggtcagc ctagtgattc 5640 agaaaatgca cttaacatgt tgtctaagta cattgttcct gctggttctg tcactattga 5700 acgtgtcacg catgacggtt gttgttgtag taagcgtgtt gtcactgcac cagttgtgaa 5760 tgctagcgtg ttgaagcttg gcgtcgagga tggtctttgt ccacatggtc ttaactacat 5820 tgacaaagtt gttgtagtta aaggtactac aattgttgtc aatgttggaa aacctgtagt 5880 ggcaccatcg cacctctttc ttaagggtgt ttcctacaca acattcctag ataatggtaa 5940 cggtgttgcc ggccattata ctgtttttga tcatgacact ggtatggtgc atgatggaga 6000 tgtttttgta ccaggtgatc tcaatgtgtc tcctgttaca aatgttgtcg tctcagagca 6060 gacggctgtt gtgattaaag accctgtgaa gaaagtagag ttagacgcta caaagctgtt 6120 agacactatg aattatgcat cggaaagatt cttttccttt ggtgatttta tgtcacgtaa 6180 tttaattaca gtgtttttgt acatccttag tattttgggt ctctgtttta gggcctttcg 6240 taagagggat gttaaagttc tagctggtgt accccaacgt actggtatta tattgcgtaa 6300 aagtgtgcgc tataatgcaa aggctttggg tgtcttcttc aagctaaaac tttattggtt 6360 caaagttctt ggtaagttta gtttgggtat ttatgcattg tatgcattac tattcatgac 6420 aatacgcttt acacctatag gtggccctgt ttgtgatgat gttgttgctg gttatgctaa 6480 ttctagtttt gacaagaatg agtattgcaa cagtgttatt tgtaaggtct gtctctatgg 6540 gtaccaggaa ctttcggact tctctcacac acaggtagta tggcaacacc ttagagaccc 6600 attaattggt aatgtgatgc ctttctttta tttggcattt ctggcaattt ttgggggtgt 6660 ttatgtaaag gctattactc tctattttat tttccagtat cttaacatac ttggtgtgtt 6720 tttgggccta caacagtcca tttggttttt gcagcttgtg ccttttgatg tctttggtga 6780 cgagatcgtc gtctttttca tcgttacacg cgtattgatg ttccttaagc atgttttcct 6840 tggctgcgat aaggcatctt gtgtggcttg ctctaagagt gctcgcctta agcgcgttcc 6900 tgtccagact atttttcagg gtactagcaa atccttctac gtacatgcca atggtggttc 6960 taagttctgt aagaagcaca atttcttttg tttaaattgt gattcttatg gtccaggctg 7020 cacttttatt aatgacgtca ttgcaactga agttggtaat gttgtcaaac ttaatgtgca 7080 accgacaggt cctgccacta ttcttattga caaggttgaa ttcagtaatg gtttttacta 7140 tctttatagt ggtgacacat tttggaagta caactttgac ataacagata acaaatacac 7200 ttgcaaagag tcacttaaaa attgtagcat aatcacagac tttattgttt ttaacaataa 7260 tggttccaat gtaaatcagg ttaagaatgc atgtgtgtat ttttcacaga tgctttgtaa 7320 acctgttaag ttagtggact cagcgttgtt ggccagtttg tctgttgatt ttggtgcaag 7380 cttacatagt gcttttgtta gtgtgttgtc gaatagtttt ggcaaagacc tgtcaagttg 7440 taatgacatg caggattgca agagcacatt gggttttgat gatgtaccat tggatacctt 7500 taatgctgct gttgctgagg ctcatcgtta cgatgtcctc ttgactgaca tgtcgttcaa 7560 caattttacc accagttatg caaaaccaga ggaaaaactt cccgtccatg acattgccac 7620 gtgtatgcgt gtaggtgcca agattgttaa tcataacgtt cttgtcaagg atagtatacc 7680 tgtggtgtgg cttgtacgtg atttcattgt cctttctgaa gaaactagga agtacattat 7740 tcgtacgact aaagttaagg gtataacctt catgttgacc tttaatgatt gtcgtatgca 7800 tactaccata cctactgttt gcattgcaaa taagaagggt gcaggtcttc ctagtttttc 7860 aaaggttaag aaattcttct ggtttttgtg tctgttcata gttgctgttt tctttgcact 7920 aagctttttt gattttagta ctcaggttag cagtgatagt gattatgact tcaagtatat 7980 tgagagtggc cagttgaaga cttttgacaa tccacttagt tgtgtgcata atgtctttag 8040 taacttcgac cagtggcatg atgccaagtt tggtttcacc cccgtcaaca atcctagttg 8100 tcctatagtc gttggtgtat cagacgaagc gcgcactgtt ccaggtatcc cagcaggtgt 8160 ttatttagct ggtaaaacac ttgtttttgc tattaacacc atttttggta catctggttt 8220 gtgctttgat gctagtggcg ttgctgataa gggcgcttgc atttttaatt cggcttgcac 8280 cacattatct ggtttgggtg gaactgctgt ctactgttat aagaatggtc tagttgaagg 8340 tgctaaactt tatagtgagt tggcacctca tagctactat aaaatggtag atggtaatgc 8400 tgtgtcttta cctgaaatta tctcacgcgg ctttggcatc cgtactatcc gtacaaaggc 8460 tatgacctac tgtcgcgttg gccagtgtgt gcaatctgca gaaggtgttt gttttggcgc 8520 cgatagattc tttgtctata atgcagaatc tggttctgac tttgtttgtg gcacagggct 8580 ctttacattg ttgatgaacg ttattagtgt tttttccaag acagtaccag taactgtgtt 8640 gtctggtcaa atacttttta attgcattat tgcttttgct gctgttgcgg tgtgtttctt 8700 atttacaaag tttaagcgca tgttcggtga tatgtctgtt ggcgttttca ctgtcggtgc 8760 ttgtactttg ttgaacaatg tttcctacat tgtaacacag aacacacttg gcatgttggg 8820 ctatgcaact ttgtactttt tgtgcactaa aggtgttaga tatatgtgga tttggcattt 8880 gggatttttg atctcatata tacttattgc accatggtgg gttttgatgg tttatgcctt 8940 ttcagccatt tttgagttta tgcctaacct ttttaagctt aaggtttcaa cacaactttt 9000 tgagggtgac aagttcgtag gctcttttga aaatgctgca gcaggtacat ttgtgcttga 9060 tatgcatgcc tatgagagac ttgccaactc tatctcaact gaaaaactgc gtcagtatgc 9120 tagtacttac aataagtaca agtattattc aggcagtgct tcagaggctg attacaggct 9180 tgcttgtttt gcccatttgg ccaaggctat gatggattat gcttctaatc acaacgacac 9240 gttatacaca ccacccactg tgagttacaa ttcaactcta caggctggct tgcgtaagat 9300 ggcacaacca tctggtgttg ttgagaagtg catagttcgt gtttgctatg gtaatatggc 9360 tcttaatggc ctatggcttg gtgatactgt tatctgccca cgccatgtta tagcgtctag 9420 tactactagc actatagatt atgactatgc cctttctgtt ttacgcctcc acaacttctc 9480 catttcatct ggtaatgttt tcctaggtgt tgtgggtgta accatgcgag gtgctttgtt 9540 gcagataaag gttaatcaaa acaatgtcca cacgcctaag tacacctatc gcacagttag 9600 accgggtgaa tcttttaata tcttggcgtg ctatgatggt tctgcagctg gtgtttacgg 9660 cgttaacatg cgctctaatt acactattag aggctcgttc attaatggcg cttgtggttc 9720 acctggttat aacattaaca atggtaccgt tgagttttgc tatttacacc agcttgaact 9780 tggttcaggc tgtcatgttg gtagcgactt agatggtgtt atgtatggtg gttatgagga 9840 ccaacctatt ttgcaagttg aaggcgctag tagtctgttt acagagaatg tgttggcatt 9900 tctttatgca gcactcatta atggttctac ctggtggctt agttcttcta ggattgctgt 9960 agacaggttt aatgagtggg ctgttcataa tggtatgaca acagtagtta atactgattg 10020 cttttctatt cttgctgcta agactggtgt tgatgtacaa cgtttgttgg cctcaatcca 10080 gtctctgcat aagaattttg gtggaaagca aattcttggc tatacctcgt tgacagatga 10140 gtttactaca ggtgaagtta tacgtcaaat gtatggcgtt aatcttcaga gtggttatgt 10200 ttcacgcgcc tgtagaaatg tcttgctggt tggttctttt ctgactttct tttggtcaga 10260 attagtttcc tacactaagt tcttttgggt aaatcctggt tatgtcacac ctatgtttgc 10320 gtgtttgtca ttgctgtcct cacttttgat gttcacactc aagcataaga cattgttttt 10380 ccaggtcttt ctaatacctg ctctgattgt tacatcttgc attaatttgg catttgatgt 10440 tgaagtctac aactatttgg cagagcattt tgattaccat gtttctctca tgggttttaa 10500 tgcacaaggt cttgttaaca tctttgtctg ctttgttgtt accattttac acggcacata 10560 cacatggcgc ttttttaaca cacctgtgag ttctgtcact tatgtggtag ctttgctgac 10620 tgcggcatat aactattttt acgctagtga cattcttagt tgtgctatga cactatttgc 10680 tagtgtgact ggcaactggt tcgttggtgc tgtttgttat aaagctgctg tttatatggc 10740 cttgagattt cctacttttg tggctatttt tggtgatatt aagagtgtta tgttctgtta 10800 ccttgtgttg ggttatttta cctgttgctt ctacggtatt ctctactggt tcaacaggtt 10860 ttttaaggtt agtgtaggtg tctatgacta tactgttagt gctgctgagt ttaagtatat 10920 ggttgctaac ggcctacgtg caccaactgg aacacttgat tcactacttc tgtctgccaa 10980 attgattggt attggtggtg agcggaatat taagatttct tccgttcagt ctaaactgac 11040 tgatattaag tgtagtaacg ttgtgctttt aggctgtctc tctagcatga atgtctcagc 11100 aaattcaaca gaatgggcct attgtgttga cttgcataac aagatcaact tgtgtaatga 11160 cccagaaaaa gcgcaggaaa tgctacttgc tttgttggca tttttcctta gtaagaatag 11220 tgcttttggt ttagatgact tattggaatc ctattttaat gacaatagta tgttgcagag 11280 tgttgcatct acttatgtcg gtttgccttc ttatgtcatt tatgaaaatg cacgccaaca 11340 gtatgaagat gctgttaata atggttctcc acctcagttg gttaagcaat tgcgccatgc 11400 catgaatgta gcaaagagcg aatttgaccg tgaggcttct actcagcgta agcttgatag 11460 aatggcggaa caggctgcag cacagatgta caaagaggca cgagcagtta ataggaagtc 11520 caaagttgta agtgctatgc attcactgct ttttggtatg ttgagacgtt tggacatgtc 11580 ttctgtagac accattctca acttggcaaa ggatggggtt gtacctctgt ctgtcatacc 11640 ggcagtcagt gctactaagc ttaacattgt tacttctgat atcgattctt ataatcgtat 11700 ccagcgtgag ggatgtgtcc actacgctgg taccatttgg aatataattg atatcaagga 11760 caatgatggc aaggtggtac acgttaagga ggtaaccgca cagaatgctg agtccctgtc 11820 atggcccctg gtccttgggt gtgagcgtat tgtcaagctc cagaataatg aaattattcc 11880 tggtaagctg aagcagcgct ccattaaggc agaaggagat ggcatagttg gagaaggtaa 11940 ggcactttac aataatgagg gtggacgtac ttttatgtat gctttcatct cggacaaacc 12000 ggacctgcgt gtagtcaagt gggagttcga tggtggttgt aacactattg agctagaacc 12060 accacgtaag ttcttggtgg attctcctaa tggtgcacag atcaagtatc tctactttgt 12120 tcgtaacctt aacacgttac gtaggggtgc tgttctcggc tacataggtg ccactgtacg 12180 cttgcaggct ggtaaacaaa cagaacaggc tattaactct tcattgttga cactttgcgc 12240 tttcgctgtg gatcctgcta agacctacat cgatgctgtc aaaagtggtc acaaaccagt 12300 aggtaactgt gttaagatgt tggccaatgg ttctggtaat ggacaagctg ttactaatgg 12360 tgtggaggct agtactaacc aggattcata cggtggtgcg tccgtgtgtc tatattgtag 12420 agcacatgtt gagcatccat ctatggatgg tttttgcaga ctgaaaggca agtacgtaca 12480 ggttccacta ggtacagtgg atcctatacg ttttgtactt gagaatgacg tttgcaaggt 12540 ttgtggttgt tggctggcta atggctgcac ttgtgacaga tccattatgc aaagcactga 12600 tatggcttat ttaaacgagt acggggctct agtgcagctc gactagagcc ctgtaacggt 12660 actgatacac aacatgtgta tcgtgctttt gacatctaca acaaggatgt tgcttgtcta 12720 ggtaaattcc tcaaggtgaa ctgtgttcgc ctgaagaatt tggataagca tgatgcattc 12780 tatgttgtca aaagatgtac caagtctgcg atggaacacg agcaatccat ctatagcaga 12840 cttgaaaagt gtggagccgt agccgaacac gatttcttca cttggaagga tggtcgtgcc 12900 atctatggta acgtttgtag aaaggatctt accgagtata ctatgatgga tttgtgttac 12960 gctttacgta actttgatga aaacaattgc gatgttctta agagcatttt aattaaggta 13020 ggcgcttgtg aggagtccta cttcaataat aaagtctggt ttgaccctgt tgaaaatgaa 13080 gacattcatc gtgtctatgc attgttaggt accattgttt cacgtgctat gcttaaatgc 13140 gttaagttct gtgatgcaat ggttgaacaa ggtatagttg gtgttgtcac attagataat 13200 caggatctta atggtgattt ttatgatttt ggtgatttta cttgtagcat caagggaatg 13260 ggtataccca tttgcacatc atattactct tatatgatgc ctgttatggg tatgactaat 13320 tgccttgcta gtgagtgttt tgttaagagt gatatatttg gtgaggattt caagtcatat 13380 gacctgctgg aatatgattt cacggagcat aagacagcac tcttcaacaa gtatttcaag 13440 tattggggac tgcaatacca ccctaactgt gtggactgca gtgatgagca gtgcatagtt 13500 cactgtgcca acttcaatac gttgttttcc actactatac ctattacggc atttggacct 13560 ttgtgtcgca agtgttggat tgatggtgtt ccactggtaa ctacagctgg ttatcatttt 13620 aaacagttag gtatagtttg gaacaatgac ctcaacttac actctagcag gctctctatt 13680 aacgaattac tccagttttg tagtgatcct gcattgctta tagcatcatc accagccctt 13740 gttgatcagc gtactgtttg cttttcagtt gcagcgctag gtacaggtat gactaaccag 13800 actgttaaac ctggccattt caataaggag ttttatgact tcttacttga gcaaggtttc 13860 ttttctgagg gctctgagct tactttaaag cacttcttct ttgcacagaa gggtgatgca 13920 gctgttaagg attttgacta ctataggtat aatagaccta ctgttctgga catttgccaa 13980 gctcgcgtcg tgtatcaaat agtgcaacgc tattttgata tttacgaagg tggttgtatc 14040 actgctaaag aggtggttgt tacaaacctt aacaagagcg caggttatcc tttgaacaag 14100 tttggtaaag ctggtcttta ctatgagtct ttatcctatg aggaacagga tgaactttat 14160 gcttatacta agcgtaacat cctgcccact atgacacagc tcaaccttaa atatgctata 14220 agtggcaaag aacgtgcacg cacagtgggt ggtgtttcgc ttttgtcaac catgactact 14280 cggcagtatc atcagaaaca ccttaagtcc atagttaata ctaggggcgc ttcggttgtt 14340 attggtacta ctaagtttta tggtggttgg gacaatatgc ttaagaacct tattgatggt 14400 gttgaaaatc cgtgtcttat gggttgggac tacccaaagt gcgacagagc actgcccaat 14460 atgatacgta tgatttcagc catgatttta ggctctaagc acaccacatg ctgcagttcc 14520 actgaccgct ttttcaggtt gtgcaatgaa ttggctcaag tccttactga ggttgtttat 14580 tctaatggag gtttttattt gaagccaggt ggtactacct ctggtgatgc aaccaccgca 14640 tatgcaaact cagtttttaa tatcttccaa gcagtaagtg ccaatgttaa caaacttctt 14700 agtgttgaca gcaatgtctg tcataattta gaagttaagc aattgcagcg taagctttat 14760 gagtgctgtt atagatcaac taccgtcgat gaccagttcg tcgttgagta ttatggttac 14820 ttgcgtaaac atttttcaat gatgattctt tctgatgatg gcgttgtttg ttataacaat 14880 gactatgcat cacttggtta tgtcgctgat cttaacgcat tcaaggctgt tttgtattac 14940 cagaacaatg tcttcatgag cgcctctaaa tgttggatcg agcctgacat taataaaggt 15000 cctcatgaat tttgctcgca gcatactatg cagattgtcg ataaagatgg tacttattac 15060 cttccttacc ctgatccttc aagaattctc tctgcaggtg tgtttgttga tgacgttgtt 15120 aaaactgatg cagttgtatt gcttgaacgt tatgtgtcat tggctataga tgcctacccg 15180 ttatctaagc atgaaaaccc tgaatataag aaggtgtttt atgtgctttt ggattgggtt 15240 aagcatctgt acaaaactct taatgctggt gtgttagagt ctttttctgt cacacttttg 15300 gaagattcta ctgctaaatt ctgggatgag agcttttatg ccaacatgta tgagaaatct 15360 gcagttttac aatctgcagg gctttgtgtt gtttgtggct ctcaaactgt tttacgttgt 15420 ggtgattgtt tacggcgtcc tatgctttgt actaagtgtg cttatgatca tgtcattgga 15480 acaactcaca agttcatttt ggccatcact ccatatgtgt gttgtgcttc agattgtggt 15540 gtcaatgatg taactaagct ctacttaggt ggtcttagtt attggtgtca tgaccacaag 15600 ccacgtcttg cattcccgtt gtgctctgct ggtaatgttt ttggcttgta caaaaattct 15660 gctaccggct cacccgatgt tgaagacttt aatcgcattg ctacatccga ttggactgat 15720 gtttctgact acaggttggc aaatgatgtc aaggactcat tgcgtctgtt tgcagcggaa 15780 actatcaagg ccaaggagga gagcgttaag tcatcctatg cttgtgcaac actacatgag 15840 gttgtaggac ctaaagagtt gttgctcaaa tgggaagtcg gcagacccaa accacccctt 15900 aatagaaatt cggttttcac ttgttatcat ataacgaaga acaccaaatt tcaaatcggt 15960 gagtttgtgt ttgagaaggc agaatatgat aatgatgctg taacatataa aactaccgcc 16020 acaacaaaac ttgttcctgg catggttttt gtgcttacct cacataatgt tcagccattg 16080 cgcgcaccga ccattgctaa tcaagaacgt tattccacta tacataagtt gcatcctgct 16140 tttaacatac ctgaagctta ttctagctta gtgccctatt accaattgat tggtaagcag 16200 aagattacaa ctattcaggg acctcccggt agtggtaaat ctcactgtgt tatagggcta 16260 ggtttgtact atccaggtgc acgtatagtg tttacagctt gttctcatgc agcggtcgat 16320 tcactttgtg tgaaagcttc cactgcttat agcaatgaca aatgttcacg catcatacca 16380 cagcgcgctc gtgttgagtg ttatgatggt ttcaagtcta ataatactag tgctcagtac 16440 cttttctcta ctgtcaatgc tttgccagag tgcaatgcgg acattgttgt ggtggatgag 16500 gtctctatgt gcactaatta tgacttgtct gtcataaatc agcgcatcag ctataggcat 16560 gtagtctatg ttggtgaccc tcaacagctg cctgcaccac gtgttatgat ttcacgtggt 16620 actttggaac caaaggacta caacgttgtc actcaacgca tgtgtgccct taagcctgat 16680 gttttcttgc acaagtgtta tcgctgtcct gctgagatag tgcgtactgt gtctgagatg 16740 gtctatgaaa accaattcat tcctgtgcac ccagatagca agcagtgttt taaaatcttt 16800 tgcaagggta atgttcaggt tgataatggt tcaagcatta atcgcaggca attggatgtt 16860 gtgcgtatgt ttttggctaa aaatcctagg tggtcaaagg ctgtttttat ttctccttat 16920 aacagccaga attatgttgc cagccgcatg ctaggtctac aaattcagac agttgactca 16980 tcccagggta gtgagtatga ctatgtcatt tacacacaaa cttcagatac tgcccatgcc 17040 tgtaatgtta acaggtttaa tgttgccatc acaagggcca agaaaggcat attatgtata 17100 atgtgcgata ggtccctttt tgatgtgctt aaattctttg agcttaaatt gtctgatttg 17160 caggctaatg agggttgtgg tctttttaaa gactgtagca gaggtgatga tctgttgcca 17220 ccatctcacg ctaacacctt catgtcttta gcggacaatt ttaagactga tcaagatctt 17280 gctgttcaaa taggtgttaa tggacccatt aaatatgagc atgttatctc gtttatgggt 17340 ttccgttttg atatcaacat acccaaccat catactctct tttgcacacg cgactttgcc 17400 atgcgcaatg ttagaggttg gttaggcttt gacgttgaag gagcacatgt tgttggctct 17460 aacgtcggta caaatgtccc attgcaatta gggttttcta acggtgttga ttttgttgtc 17520 agacctgaag gttgcgttgt aacagagtct ggtgactaca ttaaacccgt cagagctcgt 17580 gctccaccag gggaacaatt cgcacacctt ttgcctttac ttaaacgcgg ccaaccatgg 17640 gatgttgtcc gcaaacgtat agtgcagatg tgtagtgact acctggccaa cctatcagac 17700 atactaattt ttgtgttgtg ggctggtggt ttggagttga caactatgcg ttattttgtc 17760 aagattggac caagtaagag ttgtgattgt ggtaaggttg ctacttgtta caatagtgcg 17820 ctgcatacgt actgttgttt caaacatgcc cttggttgtg attatctgta taacccatac 17880 tgtattgata tacagcagtg gggatacaag ggatcactta gccttaacca ccatgagcat 17940 tgtaatgtac atagaaacga gcatgtggct tctggtgatg ccataatgac tcgctgtctg 18000 gccatacatg attgctttgt caagaacgtt gactggtcca tcacataccc atttattggt 18060 aatgaggctg ttattaataa gagcggccga attgtgcaat cacacactat gcggtcagtt 18120 cttaagttat acaatccgaa agccatatat gatattggca atcctaaggg cattagatgt 18180 gccgtaacgg atgctaagtg gttttgcttt gacaagaatc ctactaattc taatgtcaag 18240 acattggagt atgactatat aacacatggc caatttgatg ggttgtgctt gttttggaat 18300 tgcaatgtag acatgtatcc agaattttct gtggtctgtc gttttgatac tcgctgtagg 18360 tcaccactca acttggaggg ttgtaatggt ggttcactgt atgttaataa tcatgcattc 18420 catacaccgg cttttgacaa gcgtgctttt gctaagttga agccaatgcc atttttcttt 18480 tatgatgata ctgagtgtga caagttacag gactccataa actatgttcc tcttagggct 18540 agtaactgca ttactaaatg taatgttggt ggtgctgtct gtagtaagca ttgtgctatg 18600 tatcatagct atgttaatgc ttacaacact tttacgtcgg cgggctttac tatttgggtg 18660 cctacttcgt ttgacaccta taatctgtgg cagacattta gtaacaattt gcaaggtctt 18720 gagaacattg ctttcaatgt cgtaaagaaa ggatcttttg ttggtgccga aggtgaactt 18780 cctgtagctg tggttaatga caaagtgctc gttagagatg gtactgttga tactcttgtt 18840 tttacaaaca agacatcact acccactaac gtagcttttg agttgtatgc caagcgtaag 18900 gtaggactca ccccacccat tacgatccta cgtaacttgg gtgtagtttg tacatctaag 18960 tgtgtcattt gggactatga agccgaacgt ccacttacta cttttacaaa ggatgtttgt 19020 aaatataccg actttgaggg tgacgtctgt acactctttg ataacagcat tgttggttca 19080 ttagagcgat tctccatgac ccaaaatgct gtgcttatgt cacttacagc tgttaaaaag 19140 cttactggca taaagttaac ttatggttat cttaatggtg tcccagttaa cacacatgaa 19200 gataaacctt ttacttggta tatttacact aggaagaacg gcaagttcga ggaccatcct 19260 gatggctatt ttacccaagg tagaacaacc gctgatttta gccctcgtag cgacatggaa 19320 aaggacttcc taagtatgga tatgggtctg tttattaaca agtacggact tgaagattac 19380 ggctttgagc acgttgtgta tggtgatgtt tcaaaaacca cccttggtgg tttgcatcta 19440 ctaatttcgc aggtgcgtct ggcctgtatg ggtgtgctca aaatagacga gtttgtgtct 19500 agtaatgata gcacgttaaa gtcttgtact gttacatatg ctgataaccc tagtagtaag 19560 atggtttgta cgtatatgga tctcctgctt gacgattttg tcagcattct taaatctttg 19620 gatttgggcg ttgtatctaa agttcatgaa gttatggtcg attgtaaaat gtggaggtgg 19680 atgttgtggt gtaaggatca taaactccag acattttatc cgcaacttca ggccagtgaa 19740 tggaagtgtg gttattccat gccttctatt tacaagatac aacgtatgtg tttagaacct 19800 tgcaatctct acaactatgg tgctggtatt aagttacctg atggcattat gtttaacgta 19860 gttaaataca cacagctttg tcaatatctc aatagcacca caatgtgtgt accccatcac 19920 atgcgtgtgc tacatcttgg tgctggctcc gacaagggtg ttgcacctgg cacggctgtc 19980 ttacgacgtt ggttgccact ggatgccatt atagttgaca atgatagtgt ggattacgtt 20040 agcgatgctg attatagtgt tacaggagat tgctctacct tatacctgtc agataagttt 20100 gatttagtta tatctgatat gtatgatggt aagattaaaa gttgtgatgg ggagaacgtg 20160 tctaaagaag gcttctttcc ctatattaat ggtgtcatca ccgaaaagtt ggcacttggt 20220 ggtactgtag ctattaaggt gacggagttt agttggaata agaagttgta tgaactcatt 20280 cagaggtttg agtattggac aatgttctgt accagtgtta acacgtcatc gtcagaggca 20340 ttcttaattg gtgttcacta tttaggtgat tttgcaagtg gcgctgtgat tgacggcaac 20400 actatgcatg ccaattatat cttctggcgt aattccacaa ttatgactat gtcttacaat 20460 agtgtacttg atttaagcaa gttcaattgt aagcataagg ctacagttgt cattaattta 20520 aaagattcat ccattagtga tgttgtgtta ggtttgttga agaatggtaa gttgctagtg 20580 cgtaataatg acgccatttg tggtttttct aatcatttgg tcaacgtaaa caaatgaagt 20640 ctttaaccta cttctggttg ttcttaccag tactttcaac acttagccta ccacaagatg 20700 tcaccaggtg ctcagctaac actaatttta ggcggttctt ttcaaaattt aatgttcagg 20760 cgcctgcagt tgttgtactg ggcggttatc tacctaaaaa ccagggtgtc aattcaactt 20820 ggtactgtgc tggccaacat ccaactgcta gtggcgttca tggtatcttt gttagccata 20880 ttagaggtgg tcatggcttt gagattggca tttcgcaaga gccttttgac cctagtggtt 20940 accagcttta tttacataag gctactaacg gtaacactaa tgctactgcg cgactgcgca 21000 tttgccagtt tcctagcatt aaaacattgg gccccactgc taataatgat gttacaacag 21060 gtcgtaattg cctatttaac aaagccatcc cagctcatat gagtgaacat agtgttgtcg 21120 gcataacatg ggataatgat cgtgtcactg tcttttctga caagatctat tatttttatt 21180 ttaaaaatga ttggtcccgt gttgcgacaa agtgttacaa cagtggaggt tgtgctatgc 21240 aatatgttta cgaacccacc tattacatgc ttaatgttac tagtgctggt gaggatggta 21300 tttcttatca accctgtaca gctaattgca ttggttatgc tgccaatgta tttgctactg 21360 agcccaatgg ccacatacca gaaggtttta gttttaataa ttggtttctt ttgtccaatg 21420 attccacttt ggtgcatggt acggtggttt ccaaccaacc attgttggtc aattgtcttt 21480 tggccattcc taagatttat ggactaggcc aatttttctc ctttaatcaa acgatcgatg 21540 gtgtttgtaa tggagctgct gtgcagcgtg caccagaggc tctgaggttt aatattaatg 21600 acacctctgt cattcttgct gaaggctcaa ttgtacttca tactgcttta ggaacaaatt 21660 tttcttttgt ttgcagtaat tcctcaaatc ctcacttagc caccttcgcc atacctttgg 21720 gtgctaccca agtaccctat tattgttttt ttaaagtgga tacttacaaa tccactgttt 21780 ataaattctt ggctgtttta cctccaaccg tcagggaaat tgtcatcacc aagtatggtg 21840 atgtttatgt caatgggttt ggatacttgc atctcggttt gttggatgct gtcacaatta 21900 atttcactgg tcatggcact gacgatgatg tttctggttt ttggaccata gcatcgacta 21960 attttgttga tgcactcatc gaagttcaag gaaccgccat tcagcgtatt ctttattgtg 22020 atgatcctgt tagccaactc aagtgttctc aggttgcttt tgaccttgac gatggttttt 22080 accctatttc ttctagaaac cttctgagtc atgaacagcc aatttctttt gttactctgc 22140 catcatttaa tgatcattct tttgttaaca ttattgtatc tgcttccttt ggtggtcata 22200 gtggtgccaa ccttattgca tctgacacta ctatcaatgg gtttagttct ttctgtgttg 22260 acactagaca atttaccatt tcactgtttt ataacgttac aaacagttat ggttatgtgt 22320 ctaaatcaca ggacagtaat tgccctttca ccttgcaatc tgttaatgat tacctgtctt 22380 ttagcaaatt ttgtgtttcc accagccttt tggctagtgc ctgtaccata gatctttttg 22440 gttaccctga gtttggtagt ggtgttaagt ttacgtccct ttactttcaa ttcacaaagg 22500 gtgagttgat tactggcacg cctaaaccac ttgaaggtgt cacggacgtt tcttttatga 22560 ctctggatgt gtgtaccaag tatactatct atggctttaa aggtgagggt atccttaccc 22620 ttacaaattc tagctttttg gcaggtgttt attacacatc tgattctgga cagttgttag 22680 cctttaagaa tgtcactagt ggtgctgttt attctgttac gccatgttct ttttcagagc 22740 aggctgcata tgttgatgat gatatagtgg gtgttatttc tagtttgtct agctccactt 22800 ttaacagtac tagggagttg cctggtttct tctaccattc taatgatggc tctaattgta 22860 cagagcctgt gttggtgtat agtaacatag gtgtttgtaa atctggcagt attggctacg 22920 tcccatctca gtctggccaa gtcaagattg cacccacggt tactgggaat attagtattc 22980 ccaccaactt tagtatgagt attaggacag aatatttaca gctttacaac acgcctgtta 23040 gtgttgattg tgccacatat gtttgtaatg gtaactctcg ttgtaaacaa ttactcaccc 23100 agtacactgc agcatgtaag accatagagt cagcattaca actcagcgct aggcttgagt 23160 ctgttgaagt taactctatg cttactattt ctgaagaggc tctacagtta gctaccatta 23220 gttcgtttaa tggtgatgga tataatttta ctaatgtgct gggtgtttct gtgtatgatc 23280 ctgcaagtcg cagggtggta caaaaaaggt cttttattga agacctgctt tttaataaag 23340 tggttactaa tggccttggt actgttgatg aagactataa gcgctgttct aatggtcgct 23400 ctgtggcaga tctagtctgt gcacagtatt actctggtgt catggtacta cctggtgttg 23460 ttgacgctga gaagcttcac atgtatagtg cgtctctcat cggtggtatg gtgctaggag 23520 gttttacttc tgcagcggca ttgcctttta gctatgctgt tcaagctaga ctcaattatc 23580 ttgctctaca gacggatgtt ctacagcgga accagcaatt gcttgctgag tcttttaact 23640 ctgctattgg taatataact tcagcctttg agagtgttaa agaggctatt agtcaaactt 23700 ccaagggttt gaacactgtg gctcatgcgc ttactaaggt tcaagaggtt gttaactcgc 23760 agggtgcagc tttgactcaa cttaccgtac agctgcaaca caacttccaa gccatttcta 23820 gttctattga tgacatttac tctcgactgg acattctttc agccgatgtt caggttgacc 23880 gtctcatcac cggcagatta tcagcactta atgcttttgt tgctcaaacc ctcactaagt 23940 atactgaggt tcaggctagc aggaagttag cacagcaaaa ggttaatgag tgcgttaaat 24000 cgcaatctca gcgttatggt ttttgtggtg gtgatggcga gcacattttc tctctggtac 24060 aggcagcacc tcagggcctg ctgtttttac atacagtact tgtaccgagt gattttgtag 24120 atgttattgc catcgctggc ttatgcgtta acgatgaaat tgccttgact ctacgtgagc 24180 ctggcttagt cttgtttacg catgaacttc aaaatcatac tgcgatggaa tattttgttt 24240 catcgcgacg tatgtttgaa cctagaaaac ctaccgttag tgattttgtt caaattgaga 24300 gttgtgtggt cacctatgtc aatttgacta gagaccaact accagatgta atcccagatt 24360 acatcgatgt taacaaaaca cttgatgaga ttttagcttc tctgcccaat agaactggtc 24420 caagtcttcc tttagatgtt tttaatgcca cttatcttaa tctcactggt gaaattgcag 24480 atttacagca gcgttcagag tctctccgta atactacaga ggagctccaa agtcttatat 24540 ataatatcaa caacacacta gttgaccttg agtggctcaa ccgagttgag acatatatca 24600 agtggccgtg gtgggtttgg ttgattattt tcattgttct catctttgtt gtgtcattac 24660 tagtgttctg ctgcatttcc acgggttgtt gtggatgctg cggctgctgc tgtgcttgtt 24720 tctcaggttg ttgtaggggt cctagacttc aaccttacga agttcacgat tgacacagtt 24780 gtcaaagatg tctcaaagtc tgctaacttg tctttgtatg ctgtccaaga gttggagctc 24840 aatgtagttc caattagaca agcttcaaat gtgacgggtt ttcttttcac cagtgttttt 24900 atctacttct ttgcactgtt taaagcgtct tctttgaggc gcaattatat tatgttggca 24960 gcgcgttttg ctgtcattgt tctttattgc ccacttttat attattgtgg tgcattttta 25020 gatgcaacta ttatttgttg cacacttatt ggcaggcttt gtttagtctg cttttactcc 25080 tggcgctata aaaatgcgct ctttattatt tttaatacta cgacactttc tttcctcaat 25140 ggtagtgctt gatatatgac ggcaaatcca ttgtgatttt agaaggtggt gaccattaca 25200 tcacttttgg caactctttt gttgcttttg ttagtagcat cgacttgtat ctagctatac 25260 gtgggcggca agaagctgac ctacagctgt tgcgaactgt tgagcttctt gatggcaaga 25320 agctttatgt cttttcgcaa catcaaattg ttggcattac taatgctgca tttgactcaa 25380 ttcaactaga cgagtatgct acaattagtg aatgataatg gtctagtagt taatgttata 25440 ctttggcttt tcgtactctt tttcctgctt attataagca ttactttcgt ccaattggtt 25500 aatctgtgct tcacttgtca ccggttgtgt aatagcgcag tttacacacc tatagggcgt 25560 ttgtatagag tttataagtc ttacatgcaa atagaccccc tctctagtac tgttattgac 25620 gtataaacga aatatgtcta acggttctat tcccgttgat gaggtgattc aacaccttag 25680 aaactggaat ttcacatgga atatcatact gacgatacta cttgtagtgc ttcagtatgg 25740 ccattacaag tactctgcgt tcttgtatgg tgtcaagatg gctattctat ggatactttg 25800 gcctcttgtg ttagcactgt cactttttga tgcatgggct agctttcagg tcaattgggt 25860 cttttttgct ttcagcatcc ttatggcttg catcactctt atgctgtgga taatgtactt 25920 tgtcaatagc attcggttgt ggcgcaggac acattcttgg tggtctttca atcctgaaac 25980 agacgcgctt ctcactactt ctgtgatggg ccgacaggtc tgcattccag tgcttggagc 26040 accaactggt gtaacgctaa cactccttag tggtacattg cttgtagagg gctataaggt 26100 tgctactggc gtacaggtaa gtcaattacc taatttcgtc acagtcgcca aggccactac 26160 aacaattgtc tacggacgtg ttggtcgttc agtcaatgct tcatctggca ctggttgggc 26220 tttctatgtc cggtccaaac acggcgacta ctcagctgtg agtaatccga gttcggttct 26280 cacagatagt gagaaagtgc ttcatttagt ctaaacagaa actttatggc ttctgtcagt 26340 tttcaggatc gtggccgcaa acgggtgcca ttatccctct atgcccctct tagggttact 26400 aatgacaaac ccctttctaa ggtacttgca aataatgctg tacccactaa taaaggaaat 26460 aaggaccagc aaattggata ctggaatgag caaattcgct ggcgcatgcg ccgtggtgag 26520 cgaattgaac aaccttccaa ttggcatttc tactacctcg gaacaggacc tcacgccgac 26580 ctccgctata ggactcgtac tgagggtgtt ttctgggttg ctaaagaagg cgcaaagact 26640 gaacccacta acctgggtgt cagaaaggcg tctgaaaagc caattattcc aaatttctct 26700 caacagcttc ccagcgtagt tgagattgtt gaacctaaca cacctcctac ttcacgtgca 26760 aattcacgta gcaggagtcg tggtaatggc aacaacaggt ccagatctcc aagtaacaac 26820 agaggcaata accagtcccg cggtaattca cagaatcgtg gaaataacca gggtcgtgga 26880 gcttctcaga acagaggagg caataataat aacaataaca agtctcgtaa ccagtccaag 26940 aacagaaacc agtcaaatga ccgtggtggt gtaacatcac gcgatgatct ggtggctgct 27000 gtcaaggatg cccttaaatc tttgggtatt ggcgaaaacc ctgacaagct taagcaacag 27060 cagaagccca aacaggaaag gtctgacagc agcggcaaaa atacacctaa gaagaacaaa 27120 tccagagcca cttcgaaaga acgtgacctc aaagacatcc cagagtggag gagaattccc 27180 aagggcgaaa atagcgtagc agcttgcttc ggacccaggg gaggcttcaa aaattttgga 27240 gatgcggaat ttgtcgaaaa aggtgttgat gcctcaggct atgctcagat cgccagttta 27300 gcaccaaatg ttgcagcatt gctctttggt ggtaatgtgg ctgttcgtga gctagcggac 27360 tcttacgaga ttacatataa ttataaaatg actgtgccaa agtctgatcc aaatgtagag 27420 cttcttgttt cacaggtgga tgcatttaaa actgggaatg caaaacccca gagaaagaag 27480 gaaaagaaga acaagcgtga aaccacgcag cagctgaatg aagaggccat ctacgatgat 27540 gtgggtgtgc catctgatgt gactcatgcc aatttggaat gggacacagc tgttgatggt 27600 ggtgacacgg ccgttgaaat tatcaacgag atcttcgaca caggaaatta aacaatgttt 27660 gactggctta tcctggctat gtcccagggt agtgccatta cactgttatt actgagtgtt 27720 tttctagcga cttggctgct gggctatggc tttgccctct aactagcggt cttggtcttg 27780 cacactacgg taagccagtg gtaatgtcag tgcaagaagg atattaccat agcactgtca 27840 tgaagggaac gcagtacctt ttcatctaaa cctttgcacg agtaatcaaa gatccgcttg 27900 acgagcctat atggaagagc gtgccaggta tttgactcaa ggactgttag taactgaaga 27960 cctgacggtg ttgatatgga tacac 27985 <210> 2 <211> 27974 <212> DNA <213> porcine epidemic diarrhea virus <400> 2 acttaaagag attttctatc tacggatagt tagctctttt tctagactct tgtctactca 60 attcaactaa acgaaatttt gtccttccgg ccgcatgtcc atgctgctgg aagctgacgt 120 ggaatttcat taggtttgct taagtagcca tcgcaagtgc tgtgctgtcc tctagttcct 180 ggttggcgtt ccgtcgcctt ctacatacta gacaaacagc cttcctccgg ttccgtctgg 240 gggttgtgtg gataactagt tccgtctagt ttgaaaccag taactgtcgg ctatggctag 300 caaccatgtt acattggctt ttgccaatga tgcagaaatt tcagcttttg gcttttgcac 360 tgctagtgaa gccgtctcat actattctga ggccgccgct agtggattta tgcaatgccg 420 tttcgtgtcc ttcgatctcg ctgacactgt tgagggattg cttcccgaag actatgtcat 480 ggtggtggtc ggcactacca agcttagtgc gtatgtggac acttttggta gccgccccaa 540 aaacatttgt ggttggctgt tattttctaa ctgtaattac ttcctcgaag agttagagct 600 tacttttggt cgtcgtggtg gtaacatcgt gccagttgac caatacatgt gtggcgctga 660 cggtaaacct gttcttcagg aatccgaatg ggagtataca gatttctttg ctgactccga 720 agacggtcaa ctcaacattg ctggtatcac ttatgtgaag gcctggattg tagagcgatc 780 ggatgtctct tatgcgagtc agaatttaac atctattaag tctattactt actgttcaac 840 ctatgagcat acttttcctg atggtactgc catgaaggtt gcacgtactc caaagattaa 900 gaagactgtt gtcttgtctg agccacttgc tactatctac agggaaattg gttctccttt 960 tgtggataat gggagcgatg ctcgttctat cattaagaga ccagtgttcc tccacgcttt 1020 tgttaagtgt aagtgtggta gttatcattg gactgttggt gattggactt cctatgtctc 1080 cacttgctgt ggctttaagt gtaagccagt ccttgtggct tcatgctctg ctacgcctgg 1140 ttctgttgtg gttacgcgcg ctggtgctgg cactggtgtt aagtattaca acaacatgtt 1200 cctgcgccat gtggcagaca ttgatgggtt ggcattctgg cgaattctca aggtgcagtc 1260 caaagacgac ctcgcttgct ctggtaaatt ccttgaacac catgaggaag gtttcacaga 1320 tccttgctac tttttgaatg actcgagcat tgctactaag ctcaagtttg acatccttag 1380 tggcaagttt tctgatgaag tcaaacaagc tatctttgct ggtcatgttg ttgttggcag 1440 cgcgctcgtt gacattgttg acgatgcact gggacagcct tggtttatac gtaagcttgg 1500 tgaccttgca agtgcagctt gggagcagct taaggctgtc gttagaggcc ttaacctcct 1560 gtctgatgag gtcgtgctct ttggcaaaag acttagctgt gccactctta gtatcgttaa 1620 cggtgttttt gagttcatcg ccgaagtgcc tgagaagttg gctgcggctg ttacagtttt 1680 tgtcaacttc ttgaatgagc tttttgagtc tgcctgtgac tgcttaaagg tcggaggtaa 1740 aacctttaac aaggttggct cttatgttct ttttgacaac gcattggtta agcttgtcaa 1800 ggcaaaagtt cgcggcccac gacaggcagg tgtttgtgaa gttcgttaca caagccttgt 1860 tattgggagt actaccaagg tggtttccaa gcgcgttgaa aatgccaatg tgaatctcgt 1920 cgtcgttgac gaggatgtga ccctcaacac cactggtcgt acagttgttg ttgacggact 1980 tgcattcttc gagagtgacg ggttttacag acatcttgct gatgctgacg ttgtcattga 2040 acatcctgtt tataagtctg cttgtgagct caagccagtt tttgagtgtg acccaatacc 2100 tgattttcct atgcctgtgg ccgctagtgt tgcagagctt tgtgtgcaaa ctgatctgtt 2160 gcttaaaaat tacaacactc cttataaaac ttacagctgc gttgtgagag gtgataagtg 2220 ttgcatcact tgcaccttac atatcacagc accaagttat atggaggatg ctgctaattt 2280 tgtagacctc tgtaccaaga acattggtac tgctggtttt catgagtttt acattacggc 2340 ccatgaacaa caggatctgc aagggttcgt aaccacttgt tgcacgatgt caggttttga 2400 gtgttttatg cctataatcc cacagtgtcc agcagtgctt gaagagattg atggtggtag 2460 catctggcgg tcttttatca ctggtcttaa tacaatgtgg gatttttgca agcatcttaa 2520 agtcagcttt ggactagatg gcattgttgt cactgtagca cgcaaattta aacgacttgg 2580 tgctctcttg gcagaaatgt ataacactta cctttcaact gtggtggaaa acttggtact 2640 ggccggtgtt agcttcaagt attatgccac cagtgtccca aaaattgttt tgggctgttg 2700 ttttcacagt gttaaaagtg ttcttgcaag tgccttccag attcctgtcc aggcaggcat 2760 tgagaagttt aaagtcttcc ttaactgtgt tcaccctgtt gtaccacgcg tcattgaaac 2820 ttcttttgtg gaattagaag agacgacatt taaaccacca gcactcaatg gtagtattgc 2880 tattgttgat ggctttgctt tctattatga tggaacacta tactatccca ccgatggtaa 2940 tagtgttgtg cctatttgtt ttaagaagaa gggtggtggt gatgtcaaat tctctgatga 3000 agtctctgtt agaaccattg acccagttta taaggtctcc cttgaatttg agttcgagtc 3060 tgagactatt atggctgtgc ttaataaggc tgttggtaat cgtatcaagg ttacaggtgg 3120 ttgggacgat gttgttgagt atatcaacgt tgccattgag gttcttaaag atcatatcga 3180 tgtgcctaag tactacatct atgatgagga aggtggcacc gatcctaatc ttcccgtaat 3240 ggtttctcag tggccgttga atgatgacac gatctcacag gatctgcttg atgtggaagt 3300 tgttactgat gcaccaattg atttcgaggg tgatgaagta gactcctctg accctgataa 3360 ggtggcagat gtggctaact ctgagcctga ggatgatggt cctaatgtag ctcctgaaac 3420 aaatgtagag tctgaagttg aggaagttgc cgcaaccttg tcttttatta aagatacacc 3480 ttccacagtt actaaggatc cttttgcttt tgactttgca agctatggag gacttaaggt 3540 tttaagacaa tctcataaca actgctgggt tacttctacc ttggtgcagc tacaattgct 3600 tggcatcgtt gatgaccctg caatggagct ttttagtgct ggtagagttg gtccaatggt 3660 tcgcaaatgc tatgagtcac aaaaggctat cttgggatct ttgggtgatg tgtcggcttg 3720 cctagagtct ctgactaagg acctacacac acttaagatt acctgttctg tagtctgtgg 3780 ttgtggtact ggtgaacgta tctatgaggg ttgtgctttt cgtatgacgc caactttgga 3840 accgttccca tatggtgctt gtgctcagtg tgctcaagtt ttgatgcaca cttttaaaag 3900 tattgttggc accggcatct tttgtcgaga tactactgct ctctccttgg attctttggt 3960 tgtaaaacct ctttgtgcgg ctgcttttat aggcaaggac agtggtcatt atgtcactaa 4020 cttttatgat gctgctatgg ctattgatgg ttatggtcgt catcagataa agtatgacac 4080 actgaacact atttgtgtta aagacgttaa ttggacagca ccttttgtcc cagacgttga 4140 gcctgtattg gagcctgttg tcaaaccgtt ctattcttat aagaatgttg atttttacca 4200 aggagatttt agtgaccttg ttaaacttcc atgtgacttt gttgttaatg ctgcaaatga 4260 gaatttgtct cacggtggcg gcatagcaaa ggccattgat gtttatacca agggcatgtt 4320 gcagaagtgc tcgaatgatt acattaaagc acacggtccc attaaagttg gacgtggtgt 4380 catgttggag gcattaggtc ttaaggtctt taatgttgtt ggtccacgta agggtaagca 4440 tgcacctgag cttcttgtta aggcttataa gtccgttttt gctaattcag gtgttgctct 4500 tacacctttg attagtgttg gaatttttag tgttcctttg gaagaatctt tatctgcttt 4560 tcttgcatgt gttggtgatc gccactgtaa gtgcttttgt tatagtgaca aagagcgcga 4620 ggcgatcatt aattacatgg atggcttggt agatgctatt ttcaaagatg cacttgttga 4680 tactactcct gtccaggaag atgttcaaca agtttcacaa aaaccagttt tgcctaattt 4740 tgaacctttc aggattgaag gtgctcatgc tttctatgag tgcaaccctg aaggtttgat 4800 gtcattaggt gctgacaagc tggtgttgtt tacaaattcc aatttggatt tttgtagcgt 4860 tggtaagtgt cttaacaatg tgactggcgg tgcattgctt gaagccataa atgtatttaa 4920 aaagagtaac aaaacagtgc ctgctggcaa ctgtgttact tttgagtgtg cagatatgat 4980 ttttattact atggtagtat tgccatctga cggtgatgct aattatgaca aaaattatgc 5040 acgcgccgtc gtcaaggtat ctaagcttaa aggcaagtta ttgcttgctg ttggtgatgc 5100 catgttgtat tccaagttgt cccacctcag cgtgttaggt ttcgtatcca cacctgatga 5160 tgtggagcgt ttctacgcaa ataagagtgt ggttattaaa gttactgagg atacacgtag 5220 tgttaagact gttaaagtag aatccactgt tacttatgga caacaaattg gaccttgtct 5280 tgttaatgac accgttgtca cagacaacaa acctgttgtt gctgatgttg tagctaaggt 5340 tgtaccaagt gctaattggg attcacatta tggttttgat aaggctggtg agttccacat 5400 gctagaccat actgggtttg cctttcctag tgaagttgtt aacggtaggc gtgtgcttaa 5460 aaccacagat aataactgtt gggttaatgt tacatgttta caattacagt ttgctagatt 5520 taggttcaag tcagcaggtc tacaggctat gtgggagtcc tattgtactg gtgatgttgc 5580 tatgtttgtg cattggttgt actggcttac tggtgttgac aaaggtcagc ctagtgattc 5640 agaaaatgca cttaacatgt tgtctaagta cattgttcct gctggttctg tcactattga 5700 acgtgtcacg catgacggtt gttgttgtag taagcgtgtt gtcactgcac cagttgtgaa 5760 tgctagcgtg ttgaagcttg gcgtcgagga tggtctttgt ccacatggtc ttaactacat 5820 tgacaaagtt gttgtagtta aaggtactac aattgttgtc aatgttggaa aacctgtagt 5880 ggcaccatcg cacctctttc ttaagggtgt ttcctacaca acattcctag ataatggtaa 5940 cggtgttgcc ggccattata ctgtttttga tcatgacact ggtatggtgc atgatggaga 6000 tgtttttgta ccaggtgatc tcaatgtgtc tcctgttaca aatgttgtcg tctcagagca 6060 gacggctgtt gtgattaaag accctgtgaa gaaagtagag ttagacgcta caaagctgtt 6120 agacactatg aattatgcat cggaaagatt cttttccttt ggtgatttta tgtcacgtaa 6180 tttaattaca gtgtttttgt acatccttag tattttgggt ctctgtttta gggcctttcg 6240 taagagggat gttaaagttc tagctggtgt accccaacgt actggtatta tattgcgtaa 6300 aagtgtgcgc tataatgcaa aggctttggg tgtcttcttc aagctaaaac tttattggtt 6360 caaagttctt ggtaagttta gtttgggtat ttatgcattg tatgcattac tattcatgac 6420 aatacgcttt acacctatag gtggccctgt ttgtgatgat gttgttgctg gttatgctaa 6480 ttctagtttt gacaagaatg agtattgcaa cagtgttatt tgtaaggtct gtctctatgg 6540 gtaccaggaa ctttcggact tctctcacac acaggtagta tggcaacacc ttagagaccc 6600 attaattggt aatgtgatgc ctttctttta tttggcattt ctggcaattt ttgggggtgt 6660 ttatgtaaag gctattactc tctattttat tttccagtat cttaacatac ttggtgtgtt 6720 tttgggccta caacagtcca tttggttttt gcagcttgtg ccttttgatg tctttggtga 6780 cgagatcgtc gtctttttca tcgttacacg cgtattgatg ttcattaagc atgtttgcct 6840 tggctgcgat aaggcatctt gtgtggcttg ctctaagagt gctcgcctta agcgcgttcc 6900 tgtccagact atttttcagg gtactagcaa atccttctac gtacatgcca atggtggttc 6960 taagttctgt aagaagcaca atttcttttg tttaaattgt gattcttatg gtccaggctg 7020 cacttttatt aatgacgtca ttgcaactga agttggtaat gttgtcaaac ttaatgtgca 7080 accgacaggt cctgccacta ttcttattga caaggttgaa ttcagtaatg gtttttacta 7140 tctttatagt ggtgacacat tttggaagta caactttgac ataacagata acaaatacac 7200 ttgcaaagag tcacttaaaa attgtagcat aatcacagac tttattgttt ttaacaataa 7260 tggttccaat gtaaatcagg ttaagaatgc atgtgtgtat ttttcacaga tgctttgtaa 7320 acctgttaag ttagtggact cagcgttgtt ggccagtttg tctgttgatt ttggtgcaag 7380 cttacatagt gcttttgtta gtgtgttgtc gaatagtttt ggcaaagacc tgtcaagttg 7440 taatgacatg caggattgca agagcacatt gggttttgat gatgtaccat tggatacctt 7500 taatgctgct gttgctgagg ctcatcgtta cgatgtcctc ttgactgaca tgtcgttcaa 7560 caattttacc accagttatg caaaaccaga ggaaaaactt cccgtccatg acattgccac 7620 gtgtatgcgt gtaggtgcca agattgttaa tcataacgtt cttgtcaagg atagtatacc 7680 tgtggtgtgg cttgtacgtg atttcattgt cctttctgaa gaaactagga agtacattat 7740 tcgtacgact aaagttaagg gtataacctt catgttgacc tttaatgatt gtcgtatgca 7800 tactaccata cctactgttt gcattgcaaa taagaagggt gcaggtcttc ctagtttttc 7860 aaaggttaag aaattcttct ggtttttgtg tctgttcata gttgctgttt tctttgcact 7920 aagctttttt gattttagta ctcaggttag cagtgatagt gattatgact tcaagtatat 7980 tgagagtggc cagttgaaga cttttgacaa tccacttagt tgtgtgcata atgtctttag 8040 taacttcgac cagtggcatg atgccaagtt tggtttcacc cccgtcaaca atcctagttg 8100 tcctatagtc gttggtgtat cagacgaagc gcgcactgtt ccaggtatcc cagcaggtgt 8160 ttatttagct ggtaaaacac ttgtttttgc tattaacacc atttttggta catctggttt 8220 gtgctttgat gctagtggcg ttgctgataa gggcgcttgc atttttaatt cggcttgcac 8280 cacattatct ggtttgggtg gaactgctgt ctactgttat aagaatggtc tagttgaagg 8340 tgctaaactt tatagtgagt tggcacctca tagctactat aaaatggtag atggtaatgc 8400 tgtgtcttta cctgaaatta tctcacgcgg ctttggcatc cgtactatcc gtacaaaggc 8460 tatgacctac tgtcgcgttg gccagtgtgt gcaatctgca gaaggtgttt gttttggcgc 8520 cgatagattc tttgtctata atgcagaatc tggttctgac tttgtttgtg gcacagggct 8580 ctttacattg ttgatgaacg ttattagtgt tttttccaag acagtaccag taactgtgtt 8640 gtctggtcaa atacttttta attgcattat tgcttttgct gctgttgcgg tgtgtttctt 8700 atttacaaag tttaagcgca tgttcggtga tatgtctgtt ggcgttttca ctgtcggtgc 8760 ttgtactttg ttgaacaatg tttcctacat tgtaacacag aacacacttg gcatgttggg 8820 ctatgcaact ttgtactttt tgtgcactaa aggtgttaga tatatgtgga tttggcattt 8880 gggatttttg atctcatata tacttattgc accatggtgg gttttgatgg tttatgcctt 8940 ttcagccatt tttgagttta tgcctaacct ttttaagctt aaggtttcaa cacaactttt 9000 tgagggtgac aagttcgtag gctcttttga aaatgctgca gcaggtacat ttgtgcttga 9060 tatgcatgcc tatgagagac ttgccaactc tatctcaact gaaaaactgc gtcagtatgc 9120 tagtacttac aataagtaca agtattattc aggcagtgct tcagaggctg attacaggct 9180 tgcttgtttt gcccatttgg ccaaggctat gatggattat gcttctaatc acaacgacac 9240 gttatacaca ccacccactg tgagttacaa ttcaactcta caggctggct tgcgtaagat 9300 ggcacaacca tctggtgttg ttgagaagtg catagttcgt gtttgctatg gtaatatggc 9360 tcttaatggc ctatggcttg gtgatactgt tatctgccca cgccatgtta tagcgtctag 9420 tactactagc actatagatt atgactatgc cctttctgtt ttacgcctcc acaacttctc 9480 catttcatct ggtaatgttt tcctaggtgt tgtgggtgta accatgcgag gtgctttgtt 9540 gcagataaag gttaatcaaa acaatgtcca cacgcctaag tacacctatc gcacagttag 9600 accgggtgaa tcttttaata tcttggcgtg ctatgatggt tctgcagctg gtgtttacgg 9660 cgttaacatg cgctctaatt acactattag aggctcgttc attaatggcg cttgtggttc 9720 acctggttat aacattaaca atggtaccgt tgagttttgc tatttacacc agcttgaact 9780 tggttcaggc tgtcatgttg gtagcgactt agatggtgtt atgtatggtg gttatgagga 9840 ccaacctatt ttgcaagttg aaggcgctag tagtctgttt acagagaatg tgttggcatt 9900 tctttatgca gcactcatta atggttctac ctggtggctt agttcttcta ggattgctgt 9960 agacaggttt aatgagtggg ctgttcataa tggtatgaca acagtagtta atactgattg 10020 cttttctatt cttgctgcta agactggtgt tgatgtacaa cgtttgttgg cctcaatcca 10080 gtctctgcat aagaattttg gtggaaagca aattcttggc tatacctcgt tgacagatga 10140 gtttactaca ggtgaagtta tacgtcaaat gtatggcgtt aatcttcaga gtggttatgt 10200 ttcacgcgcc tgtagaaatg tcttgctggt tggttctttt ctgactttct tttggtcaga 10260 attagtttcc tacactaagt tcttttgggt aaatcctggt tatgtcacac ctatgtttgc 10320 gtgtttgtca ttgctgtcct cacttttgat gttcacactc aagcataaga cattgttttt 10380 ccaggtcttt ctaatacctg ctctgattgt tacatcttgc attaatttgg catttgatgt 10440 tgaagtctac aactatttgg cagagcattt tgattaccat gtttctctca tgggttttaa 10500 tgcacaaggt cttgttaaca tctttgtctg ctttgttgtt accattttac acggcacata 10560 cacatggcgc ttttttaaca cacctgtgag ttctgtcact tatgtggtag ctttgctgac 10620 tgcggcatat aactattttt acgctagtga cattcttagt tgtgctatga cactatttgc 10680 tagtgtgact ggcaactggt tcgttggtgc tgtttgttat aaagctgctg tttatatggc 10740 cttgagattt cctacttttg tggctatttt tggtgatatt aagagtgtta tgttctgtta 10800 ccttgtgttg ggttatttta cctgttgctt ttacggtatt ctctactggt tcaacaggtt 10860 ttttaaggtt agtgtaggtg tctatgacta tactgttagt gctgctgagt ttaagtatat 10920 ggttgctaac ggcctacgtg caccaactgg aacacttgat tcactacttc tgtctgccaa 10980 attgattggt attggtggtg agcggaatat taagatttct tccgttcagt ctaaactgac 11040 tgatattaag tgtagtaacg ttgtgctttt aggctgtctc tctagcatga atgtctcagc 11100 aaattcaaca gaatgggcct attgtgttga cttgcataac aagatcaact tgtgtaatga 11160 cccagaaaaa gcgcaggaaa tgctacttgc tttgttggca tttttcctta gtaagaatag 11220 tgcttttggt ttagatgact tattggaatc ctattttaat gacaatagta tgttgcagag 11280 tgttgcatct acttatgtcg gtttgccttc ttatgtcatt tatgaaaatg cacgccaaca 11340 gtatgaagat gctgttaata atggttctcc acctcagttg gttaagcaat tgcgccatgc 11400 catgaatgta gcaaagagcg aatttgaccg tgaggcttct actcagcgta agcttgatag 11460 aatggcggaa caggctgcag cacagatgta caaagaggca cgagcagtta ataggaagtc 11520 caaagttgta agtgctatgc attcactgct ttttggtatg ttgagacgtt tggacatgtc 11580 ttctgtagac accattctca acttggcaaa ggatggggtt gtacctctgt ctgtcatacc 11640 ggcagtcagt gctactaagc ttaacattgt tacttctgat atcgattctt ataatcgtat 11700 ccagcgtgag ggatgtgtcc actacgctgg taccatttgg aatataattg atatcaagga 11760 caatgatggc aaggtggtac acgttaagga ggtaaccgca cagaatgctg agtccctgtc 11820 atggcccctg gtccttgggt gtgagcgtat tgtcaagctc cagaataatg aaattattcc 11880 tggtaagctg aagcagcgct ccattaaggc agaaggagat ggcatagttg gagaaggtaa 11940 ggcactttac aataatgagg gtggacgtac ttttatgtat gctttcatct cggacaaacc 12000 ggacctgcgt gtagtcaagt gggagttcga tggtggttgt aacactattg agctagaacc 12060 accacgtaag tttttggtgg attctcctaa tggtgcacag atcaagtatc tctactttgt 12120 tcgtaacctt aacacgttac gtaggggtgc tgttctcggc tacataggtg ccactgtacg 12180 cttgcaggct ggtaaacaaa cagaacaggc tattaactct tcattgttga cactttgcgc 12240 tttcgctgtg gatcctgcta agacctacat cgatgctgtc aaaagtggtc acaaaccagt 12300 aggtaactgt gttaagatgt tggccaatgg ttctggtaat ggacaagctg ttactaatgg 12360 tgtggaggct agtactaacc aggattcata cggtggtgcg tccgtgtgtc tatattgtag 12420 agcacatgtt gagcatccat ctatggatgg tttttgcaga ctgaaaggca agtacgtaca 12480 ggttccacta ggtacagtgg atcctatacg ttttgtactt gagaatgacg tttgcaaggt 12540 ttgtggttgt tggctggcta atggctgcac ttgtgacaga tccattatgc aaagcactga 12600 tatggcttat ttaaacgagt acggggctct agtgcagctc gactagagcc ctgtaacggt 12660 actgatacac aacatgtgta tcgtgctttt gacatctaca acaaggatgt tgcttgtcta 12720 ggtaaattcc tcaaggtgaa ctgtgttcgc ctgaagaatt tggataagca tgatgcattc 12780 tatgttgtca aaagatgtac caagtctgcg atggaacacg agcaatccat ctatagcaga 12840 cttgaaaagt gtggagccgt agccgaacac gatttcttca cttggaagga tggtcgtgcc 12900 atctatggta acgtttgtag aaaggatctt accgagtata ctatgatgga tttgtgttac 12960 gctttacgta actttgatga aaacaattgc gatgttctta agagcatttt aattaaggta 13020 ggcgcttgtg aggagtccta cttcaataat aaagtctggt ttgaccctgt tgaaaatgaa 13080 gacattcatc gtgtctatgc attgttaggt accattgttt cacgtgctat gcttaaatgc 13140 gttaagttct gtgatgcaat ggttgaacaa ggtatagttg gtgttgtcac attagataat 13200 caggatctta atggtgattt ttatgatttt ggtgatttta cttgtagcat caagggaatg 13260 ggtataccca tttgcacatc atattactct tatatgatgc ctgttatggg tatgactaat 13320 tgccttgcta gtgagtgttt tgttaagagt gatatatttg gtgaggattt caagtcatat 13380 gacctgctgg aatatgattt cacggagcat aagacagcac tcttcaacaa gtatttcaag 13440 tattggggac tgcaatacca ccctaactgt gtggactgca gtgatgagca gtgcatagtt 13500 cactgtgcca acttcaatac gttgttttcc actactatac ctattacggc atttggacct 13560 ttgtgtcgca agtgttggat tgatggtgtt ccactggtaa ctacagctgg ttatcatttt 13620 aaacagttag gtatagtttg gaacaatgac ctcaacttac actctagcag gctctctatt 13680 aacgaattac tccagttttg tagtgatcct gcattgctta tagcatcatc accagccctt 13740 gttgatcagc gtactgtttg cttttcagtt gcagcgctag gtacaggtat gactaaccag 13800 actgttaaac ctggccattt caataaggag ttttatgact tcttacttga gcaaggtttc 13860 ttttctgagg gctctgagct tactttaaag cacttcttct ttgcacagaa gggtgatgca 13920 gctgttaagg attttgacta ctataggtat aatagaccta ctgttctgga catttgccaa 13980 gctcgcgtcg tgtatcaaat agtgcaacgc tattttgata tttacgaagg tggttgtatc 14040 actgctaaag aggtggttgt tacaaacctt aacaagagcg caggttatcc tttgaacaag 14100 tttggtaaag ctggtcttta ctatgagtct ttatcttatg aggaacagga tgaactttat 14160 gcttatacta agcgtaacat cctgcccact atgacacagc tcaaccttaa atatgctata 14220 agtggcaaag aacgtgcacg cacagtgggt ggtgtttcgc ttttgtcaac catgactact 14280 cggcagtatc atcagaaaca ccttaagtcc atagttaata ctaggggcgc ttcggttgtt 14340 attggtacta ctaagtttta tggtggttgg gacaatatgc ttaagaacct tattgatggt 14400 gttgaaaatc cgtgtcttat gggttgggac tacccaaagt gcgacagagc actgcccaat 14460 atgatacgta tgatttcagc catgatttta ggctctaagc acaccacatg ctgcagttcc 14520 actgaccgct ttttcaggtt gtgcaatgaa ttggctcaag tccttactga ggttgtttat 14580 tctaatggag gtttttattt gaagccaggt ggtactacct ctggtgatgc aaccaccgca 14640 tatgcaaact cagtttttaa tatcttccaa gcagtaagtg ccaatgttaa caaacttctt 14700 agtgttgaca gcaatgtctg tcataattta gaagttaagc aattgcagcg taagctttat 14760 gagtgctgtt atagatcaac taccgtcgat gaccagttcg tcgttgagta ttatggttac 14820 ttgcgtaaac atttttcaat gatgattctt tctgatgatg gcgttgtttg ttataacaat 14880 gactatgcat cacttggtta tgtcgctgat cttaacgcat tcaaggctgt tttgtattac 14940 cagaacaatg tcttcatgag cgcctctaaa tgttggatcg agcctgacat taataaaggt 15000 cctcatgaat tttgctcgca gcatactatg cagattgtcg ataaagatgg tacttattac 15060 cttccttacc ctgatccttc aagaattctc tctgcaggtg tgtttgttga tgacgttgtt 15120 aaaactgatg cagttgtatt gcttgaacgt tatgtgtcat tggctataga tgcctacccg 15180 ttatctaagc atgaaaaccc tgaatataag aaggtgtttt atgtgctttt ggattgggtt 15240 aagcatctgt acaaaactct taatgctggt gtgttagagt ctttttctgt cacacttttg 15300 gaagattcta ctgctaaatt ctgggatgag agcttttatg ccaacatgta tgagaaatct 15360 gcagttttac aatctgcagg gctttgtgtt gtttgtggct ctcaaactgt tttacgttgt 15420 ggtgattgtt tacggcgtcc tatgctttgt actaagtgtg cttatgatca tgtcattgga 15480 acaactcaca agttcatttt ggccatcact ccatatgtgt gttgtgcttc agattgtggt 15540 gtcaatgatg taactaagct ctacttaggt ggtcttagtt attggtgtca tgaccacaag 15600 ccacgtcttg cattcccgtt gtgctctgct ggtaatgttt ttggcttgta caaaaattct 15660 gctatcggct cacccgatgt tgaagacttt aatcgcattg ctacatccga ttggactgat 15720 gtttctgact acaggttggc aaatgatgtc aaggactcat tgcgtctgtt tgcagcggaa 15780 actatcaagg ccaaggagga gagcgttaag tcatcctatg cttgtgcaac actacatgag 15840 gttgtaggac ctaaagagtt gttgctcaaa tgggaagtcg gcagacccaa accacccctt 15900 aatagaaatt cggttttcac ttgttatcat ataacgaaga acaccaaatt tcaaatcggt 15960 gagtttgtgt ttgagaaggc agaatatgat aatgatgctg taacatataa aactaccgcc 16020 acaacaaaac ttgttcctgg catggttttt gtgcttacct cacataatgt tcagccattg 16080 cgctcaccga ccattgctaa tcaagaacgt tattccacta tacataagtt gcatcctgct 16140 tttaacatac ctgaagctta ttctagctta gtgccctatt accaattgat tggtaagcag 16200 aagattacaa ctattcaggg acctcccggt agtggtaaat ctcactgtgt tatagggcta 16260 ggtttgtact atccaggtgc acgtatagtg tttacagctt gttctcatgc agcggtcgat 16320 tcactttgtg tgaaagcttc cactgcttat agcaatgaca aatgttcacg catcatacca 16380 cagcgcgctc gtgttgagtg ttatgatggt ttcaagtcta ataatactag tgctcagtac 16440 cttttctcta ctgtcaatgc tttgccagag tgcaatgcgg acattgttgt ggtggatgag 16500 gtctctatgt gcactaatta tgacttgtct gtcataaatc agcgcatcag ctataggcat 16560 gtagtctatg ttggtgaccc tcaacagctg cctgcaccac gtgttatgat ttcacgtggt 16620 actttggaac caaaggacta caacgttgtc actcaacgca tgtgtgccct taagcctgat 16680 gttttcttgc acaagtgtta tcgctgtcct gctgagatag tgcgtactgt gtctgagatg 16740 gtctatgaaa accaattcat tcctgtgcac ccagatagca agcagtgttt taaaatcttt 16800 tgcaagggta atgttcaggt tgataatggt tcaagcatta atcgcaggca attggatgtt 16860 gtgcgtatgt ttttggctaa aaatcctagg tggtcaaagg ctgtttttat ttctccttat 16920 aacagccaga attatgttgc cagccgcatg ctaggtctac aaattcagac agttgactca 16980 tcccagggta gtgagtatga ctatgtcatt tacacacaaa cttcagatac tgcccatgcc 17040 tgtaatgtta acaggtttaa tgttgccatc acaagggcca agaaaggcat attatgtata 17100 atgtgcgata ggtccctttt tgatgtgctt aaattctttg agcttaaatt gtctgatttg 17160 caggctaatg agggttgtgg tctttttaaa gactgtagca gaggtgatga tctgttgcca 17220 ccatctcacg ctaacacctt catgtcttta gcggacaatt ttaagactga tcaagatctt 17280 gctgttcaaa taggtgttaa tggacccatt aaatatgagc atgttatctc gtttatgggt 17340 ttccgttttg atatcaacat acccaaccat catactctct tttgcacacg cgactttgcc 17400 atgcgcaatg ttagaggttg gttaggcttt gacgttgaag gagcacatgt tgttggctct 17460 aacgtcggta caaatgtccc attgcaatta gggttttcta acggtgttga ttttgttgtc 17520 agacctgaag gttgcgttgt aacagagtct ggtgactaca ttaaacccgt cagagctcgt 17580 gctccaccag gggaacaatt cgcacacctt ttgcctttac ttaaacgcgg ccaaccatgg 17640 gatgttgtcc gcaaacgtat agtgcagatg tgtagtgact acctggccaa cctatcagac 17700 atactaattt ttgtgttgtg ggctggtggt ttggagttga caactatgcg ttattttgtc 17760 aagattggac caagtaagag ttgtgattgt ggtaaggttg ctacttgtta caatagtgcg 17820 ctgcatacgt actgttgttt caaacatgcc cttggttgtg attatctgta taacccatac 17880 tgtattgata tacagcagtg gggatacaag ggatcactta gccttaacca ccatgagcat 17940 tgtaatgtac atagaaacga gcatgtggct tctggtgatg ccataatgac tcgctgtctg 18000 gccatacatg attgctttgt caagaacgtt gactggtcca tcacataccc atttattggt 18060 aatgaggctg ttattaataa gagcggccga attgtgcaat cacacactat gcggtcagtt 18120 cttaagttat acaatccgaa agccatatat gatattggca atcctaaggg cattagatgt 18180 gccgtaacgg atgctaagtg gttttgcttt gacaagaatc ctactaattc taatgtcaag 18240 acattggagt atgactatat aacacatggc caatttgatg ggttgtgctt gttttggaat 18300 tgcaatgtag acatgtatcc agaattttct gtggtctgtc gttttgatac tcgctgtagg 18360 tcaccactca acttggaggg ttgtaatggt ggttcactgt atgttaataa tcatgcattc 18420 catacaccgg cttttgacaa gcgtgctttt gctaagttga agccaatgcc atttttcttt 18480 tatgatgata ctgagtgtga caagttacag gactccataa actatgttcc tcttagggct 18540 agtaactgca ttactaaatg taatgttggt ggtgctgtct gtagtaagca ttgtgctatg 18600 tatcatagct atgttaatgc ttacaacact tttacgtcgg cgggctttac tatttgggtg 18660 cctacttcgt ttgacaccta taatctgtgg cagacattta gtaacaattt gcaaggtctt 18720 gagaacattg ctttcaatgt cgtaaagaaa ggatcttttg ttggtgccga aggtgaactt 18780 cctgtagctg tggttaatga caaagtgctc gttagagatg gtactgttga tactcttgtt 18840 tttacaaaca agacatcact acccactaac gtagcttttg agttgtatgc caagcgtaag 18900 gtaggactca ccccacccat tacgatccta cgtaacttgg gtgtagtttg tacatctaag 18960 tgtgtcattt gggactatga agccgaacgt ccacttacta cttttacaaa ggatgtttgt 19020 aaatataccg actttgaggg tgacgtctgt acactctttg ataacagcat tgttggttca 19080 ttagagcgat tctccatgac ccaaaatgct gtgcttatgt cacttacagc tgttaaaaag 19140 cttactggca taaagttaac ttatggttat cttaatggtg tcccagttaa cacacatgaa 19200 gataaacctt ttacttggta tatttacact aggaagaacg gcaagttcga ggaccatcct 19260 gatggctatt ttacccaagg tagaacaacc gctgatttta gccctcgtag cgacatggaa 19320 aaggacttcc taagtatgga tatgggtctg tttattaaca agtacggact tgaagattac 19380 ggctttgagc acgttgtgta tggtgatgtt tcaaaaacca cccttggtgg tttgcatcta 19440 ctaatttcgc aggtgcgtct ggcctgtatg ggtgtgctca aaatagacga gtttgtgtct 19500 agtaatgata gcacgttaaa gtcttgtact gttacatatg ctgataaccc tagtagtaag 19560 atggtttgta cgtatatgga tctcctgctt gacgattttg tcagcattct taaatctttg 19620 gatttgggcg ttgtatctaa agttcatgaa gttatggtcg attgtaaaat gtggaggtgg 19680 atgttgtggt gtaaggatca taaactccag acattttatc cgcaacttca ggccagtgaa 19740 tggaagtgtg gttattccat gccttctatt tacaagatac aacgtatgtg tttagaacct 19800 tgcaatctct acaactatgg tgctggtatt aagttacctg atggcattat gtttaacgta 19860 gttaaataca cacagctttg tcaatatctc aatagcacca caatgtgtgt accccatcac 19920 atgcgtgtgc tacatcttgg tgctggctcc gacaagggtg ttgcacctgg cacggctgtc 19980 ttacgacgtt ggttgccact ggatgccatt atagttgaca atgatagtgt ggattacgtt 20040 agcgatgctg attatagtgt tacaggagat tgctctacct tatacctgtc agataagttt 20100 gatttagtta tatctgatat gtatgatggt aagattaaaa gttgtgatgg ggagaacgtg 20160 tctaaagaag gcttctttcc ctatattaat ggtgtcatca ccgaaaagtt ggcacttggt 20220 ggtactgtag ctattaaggt gacggagttt agttggaata agaagttgta tgaactcatt 20280 cagaggtttg agtattggac aatgttctgt accagtgtta acacgtcatc gtcagaggca 20340 ttcttaattg gtgttcacta tttaggtgat tttgcaagtg gcgctgtgat tgacggcaac 20400 actatgcatg ccaattatat cttctggcgt aattccacaa ttatgactat gtcttacaat 20460 agtgtacttg atttaagcaa gttcaattgt aagcataagg ctacagttgt cattaattta 20520 aaagattcat ccattagtga tgttgtgtta ggtttgttga agaatggtaa gttgctagtg 20580 cgtaataatg acgccatttg tggtttttct aatcatttgg tcaacgtaaa caaatgaagt 20640 ctttaaccta cttctggttg ttcttaccag tactttcaac acttagccta ccacaagatg 20700 tcaccaggtg ctcagctaac actaatttta ggcggttctt ttcaaaattt aatgttcagg 20760 cgcctgcagt tgttgtactg ggcggttatc tacctattgt caattcaact tggtactgtg 20820 ctggccaaca tccaactgct agtggcgttc atggtatctt tgttagccat attagaggtg 20880 gtcatggctt tgagattggc atttcgcaag agccttttga ccctagtggt taccagcttt 20940 atttacataa ggctactaac ggtaacacta atgctactgc gcgactgcgc atttgccagt 21000 ttcctagcat taaaacattg ggccccactg ctaataatga tgttacaaca ggtcgtaatt 21060 gcctatttaa caaagccatc ccagctcata tgagtgaaca tagtgttgtc ggcataacat 21120 gggataatga tcgtgtcact gtcttttctg acaagatcta ttatttttat tttaaaaatg 21180 attggtcccg tgttgcgaca aagtgttaca acagtggagg ttgtgctatg caatatgttt 21240 acgaacccac ctattacatg cttaatgtta ctagtgctgg tgaggatggt atttcttatc 21300 aaccctgtac agctaattgc attggttatg ctgccaatgt atttgctact gagcccaatg 21360 gccacatacc agaaggtttt agttttaata attggtttct tttgtccaat gattccactt 21420 tggtgcatgg tacggtggtt tccaaccaac cattgttggt caattgtctt ttggccattc 21480 ctaagattta tggactaggc caatttttct cctttaatca aacgatcgat ggtgtttgta 21540 atggagctgc tgtgcagcgt gcaccagagg ctctgaggtt taatattaat gacacctctg 21600 tcattcttgc tgaaggctca attgtacttc atactgcttt aggaacaaat ttttcttttg 21660 tttgcagtaa ttcctcaaat cctcacttag ccaccttcgc catacctttg ggtgctaccc 21720 aagtacccta ttattgtttt tttaaagtgg atacttacaa ctccaatgtt tataaattct 21780 tggctgtttt acctccaacc gtcagggaaa ttgtcatcac caagtatggt gatgtttatg 21840 tcaatgggtt tggatacttg catctcggtt tgttggatgc tgtcacaatt aatttcactg 21900 gtcatggcac tgacgatgat gtttctggtt tttggaccat agcatcgact aattttgttg 21960 atgcactcat cgaagttcaa ggaaccgcca ttcagcgtat tctttattgt gatgatcctg 22020 ttagccaact caagtgttct caggttgctt ttgaccttga cgatggtttt taccctattt 22080 cttctagaaa ccttctgagt catgaacagc caatttcttt tgttactctg ccatcattta 22140 atgatcattc ttttgttaac attactgtat ctgcttcctt tggtggtcat agtggtgcca 22200 accttattgc atctgacact actatcaatg ggtttagttc tttctgtgtt gacactagac 22260 aatttaccat ttcactgttt tataacgtta caaacagtta tggttatgtg tctaaatcac 22320 aggacagtaa ttgccctttc accttgcaat ctgttaatga ttacctgtct tttagcaaat 22380 tttgtgtttc caccagcctt ttggctagtg cctgtaccat agatcttttt ggttaccctg 22440 agtttggtag tggtgttaag tttacgtccc tttactttca attcacaaag ggtgagttga 22500 ttactggcac gcctaaacca cttgaaggtg tcacggacgt ttcttttatg actctggatg 22560 tgtgtaccaa gtatactatc tatggcttta aaggtgaggg tatccttacc cttacaaatt 22620 ctagcttttt ggcaggtgtt tattacacat ctgattctgg acagttgtta gcctttaaga 22680 atgtcactag tggtgctgtt tattctgtta cgccatgttc tttttcagag caggctgcat 22740 atgttgatga tgatatagtg ggtgttattt ctagtttgtc tagctccact tttaacagta 22800 ctagggagtt gcctggtttc ttctaccatt ctaatgatgg ctctaattgt acagagcctg 22860 tgttggtgta tagtaacata ggtgtttgta aatctggcag tattggctac gtcccatctc 22920 agtctggcca agtcaagatt gcacccacgg ttactgggaa tattagtatt cccaccaact 22980 ttagtatgag tattaggaca gaatatttac agctttacaa cacgcctgtt agtgttgatt 23040 gtgccacata tgtttgtaat ggtaactctc gttgtaaaca attactcacc cagtacactg 23100 cagcatgtaa gaccatagag tcagcattac aactcagcgc taggcttgag tctgttgaag 23160 ttaactctat gcttactatt tctgaagagg ctctacagtt agctaccatt agttcgttta 23220 atggtgatgg atataatttt actaatgtgc tgggtgtttc tgtgtatgat cctgcaagtc 23280 gcagggtggt acaaaaaagg tcttttattg aagacctgct ttttaataaa gtggttacta 23340 atggccttgg tactgttgat gaagactata agcgctgttc taatggtcgc tctgtggcag 23400 atctagtctg tgcacagtat tactctggtg tcatggtact acctggtgtt gttgacgctg 23460 agaagcttca catgtatagt gcgtctctca tcggtggtat ggtgctagga ggttttactt 23520 ctgcagcggc attgcctttt agctatgctg ttcaagctag actcaattat cttgctctac 23580 agacggatgt tctacagcgg aaccagcaat tgcttgctga gtcttttaac tctgctattg 23640 gtaatataac ttcagccttt gagagtgtta aagaggctat tagtcaaact tccaagggtt 23700 tgaacactgt ggctcatgcg cttactaagg ttcaagaggt tgttaactcg cagggtgcag 23760 ctttgactca acttaccgta cagctgcaac acaacttcca agccatttct agttctattg 23820 atgacattta ctctcgactg gacattcttt cagccgatgt tcaggttgac cgtctcatca 23880 ccggcagatt atcagcactt aatgcttttg ttgctcaaac cctcactaag tatactgagg 23940 ttcaggctag caggaagtta gcacagcaaa aggttaatga gtgcgttaaa tcgcaatctc 24000 agcgttatgg tttttgtggt ggtgatggcg agcacatttt ctctctggta caggcagcac 24060 ctcagggcct gctgttttta catacagtac ttgtaccgag tgattttgta gatgttattg 24120 ccatcgctgg cttatgcgtt aacgatgaaa ttgccttgac tctacgtgag cctggcttag 24180 tcttgtttac gcatgaactt caaaatcata ctgcgatgga atattttgtt tcatcgcgac 24240 gtatgtttga acctagaaaa cctaccgtta gtgattttgt tcaaattgag agttgtgtgg 24300 tcacctatgt caatttgact agagaccaac taccagatgt aatcccagat tacatcgatg 24360 ttaacaaaac acttgatgag attttagctt ctctgcccaa tagaactggt ccaagtcttc 24420 ctttagatgt ttttaatgcc acttatctta atctcactgg tgaaattgca gatttacagc 24480 agcgttcaga gtctctccgt aatactacag aggagctcca aagtcttata tataatatca 24540 acaacacact agttgacctt gagtggctca accgagttga gacatatatc aagtggccgt 24600 ggtgggtttg gttgattatt ttcattgttc tcatctttgt tgtgtcatta ctagtgttct 24660 gctgcatttc cacgggttgt tgtggatgct gcggctgctg ctgtgcttgt ttctcaggtt 24720 gttgtagggg tcctagactt caaccttacg aagttcacga ttgacacagt tgtcaaagat 24780 gtctcaaagt ctgctaactt gtctttgtat gctgtccaag agttggagct caatgtagtt 24840 ccaattagac aagcttcaaa tgtgacgggt tttcttttca ccagtgtttt tatctacttc 24900 tttgcactgt ttaaagcgtc ttctttgagg cgcaattata ttatgttggc agcgcgtttt 24960 gctgtcattg ttctttattg cccactttta tattattgtg gtgcattttt agatgcaact 25020 attatttgtt gcacacttat tggcaggctt tgtttagtct gcttttactc ctggcgctat 25080 aaaaatgcgc tctttattat ttttaatact acgacacttt ctttcctcaa tggtaaagca 25140 gcttattatg acggcaaatc cattgtgatt ttagaaggtg gtgaccatta catcactttt 25200 ggcaactctt ttgttgcttt tagtagcatc gacttgtatc tagctatacg tgggcggcaa 25260 gaagctgacc tacagctgtt gcgaactgtt gagcttcttg atggcaagaa gctttatgtc 25320 ttttcgcaac atcaaattgt tggcattact aatgctgcat ttgactcaat tcaactagac 25380 gagtatgcta caattagtga atgataatgg tctagtagtt aatgttatac tttggctttt 25440 cgtactcttt ttcctgctta ttataagcat tactttcgtc caattggtta atctgtgctt 25500 cacttgtcac cggttgtgta atagcgcagt ttacacacct atagggcgtt tgtatagagt 25560 ttataagtct tacatgcaaa tagaccccct ctctagtact gttattgacg tataaacgaa 25620 atatgtctaa cggttctatt cccgttgatg aggtgattca acaccttaga aactggaatt 25680 tcacatggaa tatcatactg acgatactac ttgtagtgct tcagtatggc cattacaagt 25740 actctgcgtt cttgtatggt gtcaagatgg ctattctatg gatactttgg cctcttgtgt 25800 tagcactgtc actttttgat gcatgggcta gctttcaggt caattgggtc ttttttgctt 25860 tcagcatcct tatggcttgc atcactctta tgctgtggat aatgtacttt gtcaatagca 25920 ttcggttgtg gcgcaggaca cattcttggt ggtctttcaa tcctgaaaca gacgcgcttc 25980 tcacaacttc tgtgatgggc cgacaggtct gcattccagt gcttggagca ccaactggtg 26040 taacgctaac actccttagt ggtacattgc ttgtagaggg ctataaggtt gctactggcg 26100 tacaggtaag tcaattacct aatttcgtca cagtcgccaa ggccactaca acaattgtct 26160 acggacgtgt tggtcgttca gtcaatgctt catctggcac tggttgggct ttctatgtcc 26220 ggtccaaaca cggcgactac tcagctgtga gtaatccgag ttcggttctc acagatagtg 26280 agaaagtgct tcatttagtc taaacagaaa ctttatggct tctgtcagtt ttcaggatcg 26340 tggccgcaaa cgggtgccat tatccctcta tgcccctctt agggttacta atgacaaacc 26400 cctttctaag gtacttgcaa ataatgctgt acccactaat aaaggaaata aggaccagca 26460 aattggatac tggaatgagc aaattcgctg gcgcatgcgc cgtggtgagc gaattgaaca 26520 accttccaat tggcatttct actacctcgg aacaggacct cacgccgacc tccgctatag 26580 gactcgtact gagggtgttt tctgggttgc taaagaaggc gcaaagactg aacccactaa 26640 cctgggtgtc agaaaggcgt ctgaaaagcc aattattcca aatttctctc aacagcttcc 26700 cagcgtagtt gagattgttg aacctaacac acctcctact tcacgtgcaa attcacgtag 26760 caggagtcgt ggtaatggca acaacaggtc cagatctcca agtaacaaca gaggcaataa 26820 ccagtcccgc ggtaattcac agaatcgtgg aaataaccag ggtcgtggag cttctcagaa 26880 cagaggaggc aataataata acaataacaa gtctcgtaac cagtccaaga acagaaacca 26940 gtcaaatgac cgtggtggtg taacatcacg cgatgatctg gtggctgctg tcaaggatgc 27000 ccttaaatct ttgggtattg gcgaaaaccc tgacaagctt aagcaacagc agaagcccaa 27060 acaggaaagg tctgacagca gcggcaaaaa tacacctaag aagaacaaat ccagagccac 27120 ttcgaaagaa cgtgacctca aagacatccc agagtggagg agaattccca agggcgaaaa 27180 tagcgtagca gcttgcttcg gacccagggg aggcttcaaa aattttggag atgcggaatt 27240 tgtcgaaaaa ggtgttgatg cctcaggcta tgctcagatc gccagtttag caccaaatgt 27300 tgcagcattg ctctttggtg gtaatgtggc tgttcgtgag ctagcggact cttacgagat 27360 tacatataat tataaaatga ctgtgccaaa gtctgatcca aatgtagagc ttcttgtttc 27420 acaggtggat gcatttaaaa ctgggaatgc aaaaccccag agaaagaagg aaaagaagaa 27480 caagcgtgaa accacgcagc agctgaatga agaggccatc tacgatgatg tgggtgtgcc 27540 atctgatgtg actcatgcca atttggaatg ggacacagct gttgatggtg gtgacacggc 27600 cgttgaaatt atcaacgaga tcttcgacac aggaaattaa acaatttttg actggcttat 27660 cctggctatg tcccagggta gtgccattac actgttatta ctgagtgttt ttctagcgac 27720 ttggctgctg ggctatggct ttgccctcta actagcggtc ttggtcttgc acacaacggt 27780 aagccagtgg taatgtcagt gcaagaagga tattaccata gcactgtcat gaggggaacg 27840 cagtaccttt tcatctaaac ctttgcacga gtaatcaaag atccgcttga cgagcctata 27900 tggaagagcg tgccaggtat ttgactcaag gactgttagt aactgaagac ctgacggtgt 27960 tgatatggat acac 27974 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 3 acgtcccttt actttcaatt caca 24 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 4 tatacttggt acacacatcc agagtca 27 <210> 5 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 5 tgagttgatt actggcacgc ctaaaccac 29

Claims (15)

Porcine epidemic diarrhea (PED) virus (parental virus) (Genebank accession no. Swine pandemic diarrheal virus mutation. A vaccine composition for preventing, treating, or preventing and treating swine pandemic diarrhea, comprising the mutant strain of claim 1 as an active ingredient. The method of claim 2, wherein the vaccine composition further comprises one or more selected from the group consisting of a pharmacologically acceptable carrier, diluent, preservative and immunoadjuvant, preventing, treating or preventing and treating swine pandemic diarrheal disease. Vaccine composition for. A method of immunizing pigs by administering the vaccine composition of claim 2. A method of preventing, treating, or preventing and treating PED by administering the vaccine composition of claim 2 or 3 to pigs. Preventing, treating, or preventing swine pandemic diarrheal disease, which comprises a mutant strain deposited with the Korean National Institute of Biotechnology with the deposit number KCTC 13204BP, and further comprises one or more mutant strains selected from the group consisting of accession numbers KCTC13201BP, KCTC13202BP and KCTC13203BP. Mixed vaccine composition for treatment.

delete delete delete delete delete delete delete delete delete

Images