KR100578744B1 - 1 Pepper geneCAHIR1 of hypersensitive reaction induced protein and transformed plant using the same - Google Patents

Abstract

The present invention relates to a pepper hypersensitivity inducing protein gene, a transgenic plant using the same, and a method for detecting plant disease resistance and environmental stress using the gene, and more particularly, the present invention relates to pepper bacterial spot pattern ( Xanthomonas campestris pv. Vesicatoria ). Isolation of the hypersensitivity-inducing protein gene from the red pepper cultivars that are resistant to the strain to determine its nucleotide sequence and provide an amino acid sequence and related primers encoded therein Provide a transition plant. In addition, the present invention also provides a method for detecting plant disease resistance and environmental stress using the gene to search for the expression of induction resistance during biological / chemical resistance induction treatment. According to the present invention described above, it is possible to provide a genetic material for labeling the protective reaction against plant pathogens and molecular breeding of plant disease resistant crops, and to facilitate the search for plant disease resistance.

Red pepper, hypersensitivity-induced protein gene, plant disease, resistant, bacterial spot disease

Description

Pepper gene (CAHIR1) of hypersensitive reaction induced protein and transformed plant using the same}

Figure 1 shows the nucleotide sequence of the hypersensitivity-induced protein gene (CAHIR1) isolated from Capsicum annuum L. cv. Hanbyul according to the present invention and the amino acid sequence encoded by it.

Figure 2 shows the hypersensitivity inducing protein gene (CAHIR1) according to the present invention in infected leaves when inoculated with the red pepper bacterial spot bacterium ( Xanthomonas campestris pv.vesicatoria ) of the pathogenic strain Ds1 and non-pathogenic strain Bv5-4a Expression induction results are shown.

Figure 3 when inoculated with the non visible primary resistance to pepper varieties hanbyeol Pseudomonas bacterium (Pseudomonas syringae pv. Tomato), shows the result of expression inducing hypersensitivity induced protein gene (CAHIR1) according to the present invention.

Figure 4 shows the expression of hypersensitivity-induced protein gene (CAHIR1) according to the present invention over time after treatment with salicylic acid (ABS) and ABA (abscisic acid), which is one of the plant defense reaction inducing substances on the leaves of the red pepper varieties Induced results are shown.

Figure 5 shows the results of induction of the hypersensitivity reaction protein protein (CAHIR1) according to the present invention according to the elapsed time after the treatment of ethylene and methyl jasmonate on the leaves of red pepper varieties.

Figure 6 shows a schematic diagram of a recombinant vector into which the hypersensitivity-induced protein gene (CAHIR1) according to the present invention is used for the production of transgenic plants.

Figure 7 shows the expression of the gene in Arabidopsis plants transformed with the hypersensitivity-induced protein gene (CAHIR1) according to the present invention.

Figure 8 shows the expression of other types of disease-related genes in Arabidopsis plants transformed with the hypersensitivity-induced protein gene (CAHIR1) according to the present invention.

Figure 9 shows the plant cell killing reaction that occurs when the hypersensitivity inducing protein gene of the present invention is effectively expressed in the plant.

Figure 10 shows the plant disease resistance effect expressed when inoculated with Pseudomonas pathogen bacteria transformed Arabidopsis plants according to the present invention.

The present invention relates to pepper hypersensitivity inducing protein gene (CAHIR1) and transgenic plants using the same. More specifically, hypersensitivity from Capsicum annuum L. cv. Hanbyul known to be resistant to pepper bacterial spot disease By separating and sequencing the CAHIR1 gene, which is a novel gene of the reaction-inducing protein, the base sequence and the amino acid sequence encoded by the gene are provided, the recombinant vector and the transformed plant including the gene are provided, and the base of the gene is provided. The present invention relates to a method for searching for plant disease resistance and environmental stress that searches for expression of induction resistance in biological / chemical resistance induction treatment using sequences.

Once the plant is infected, the host plant activates several intracellular metabolic systems to initiate defense mechanisms. By this defense mechanism, the reaction between host plants and phytopathogens at the beginning of pathogen infection is divided into friendly reactions and incompatible reactions, and accordingly, it is possible to limit the progression of the disease.

In an incompatible reaction, the infected plant recognizes the invasion of the pathogen by its own cognitive action, and in response, hypersensitive reactions such as local cell death in the cells of the infected site, accumulation of callose, lignin It shows a reaction such as thickening of the cell wall due to ligninization, produces various kinds of antimicrobial substances such as phytoalexin, and forms a protective protein called pathogenesis related (PR) protein. It is known to produce.

As a representative phenomenon of these various defense reactions, research on the hypersensitivity reaction, which is one of the plant cell death reactions, is being actively conducted. The hypersensitivity reaction, one of these apoptosis reactions, is known to begin with rapid activation of free radicals, changes in ions in vivo, and the accumulation of various signaling substances. It is also known that various protein kinase enzymes are involved in this process of plant cell death.

On the other hand, the defense mechanisms are reported not only when invading pathogens, but also by artificial chemical stimulation such as ethylene or methyl jasmonate, and by environmental stress such as physical wounds, salinity and temperature.

This resistance induced by artificial biological / physical / environmental stress is generally referred to as induction resistance, which is evaluated as a signaling pathway that plays an important role in the plant's ability to defend against pathogens.

In general, plants that exhibit local apoptosis have been known to exhibit disease resistance to pathogen invasion unlike healthy plants. For this reason, research on the process of plant cell death, especially hypersensitivity to pathogens, will be the basis for novel research on the genetic structure and role, as well as the search for plant disease resistance and the study of disease resistant plants.

The present invention has been made to solve the above problems in the prior art, an object of the present invention is to provide a hypersensitivity-inducing protein gene that can represent the disease response to understand the disease defense response of the plant at the molecular level It is isolated to provide the base sequence and the amino acid sequence encoded by it.

Another object of the present invention is to provide a recombinant vector and a transgenic plant comprising the hypersensitivity inducing protein gene.

In addition, an object of the present invention is to provide a method for detecting plant disease resistance and environmental stress to detect whether or not to induce resistance to pathogens and chemicals, such as pepper bacterial spot pattern disease.

The object of the present invention is to isolate the mRNA from the red pepper varieties ( Capsicum annuum L. cv. Hanbyul) showed hypersensitivity by inoculation of red pepper bacterial spot disease ( Xanthomonas campestris pv.vesicatoria) and then screening them after preparing cDNA library. By selecting the pepper hypersensitivity inducing protein gene (CAHIR1) to determine the nucleotide sequence, and was inoculated or treated with any one of pathogens, chemicals and environmental stress in the pepper was achieved by examining the expression of the CAHIR1 gene.

The present invention also provides a recombinant vector and a transgenic plant comprising the hypersensitivity inducing protein gene (CAHIR1).

Hereinafter, the configuration of the present invention with reference to the accompanying drawings will be described in detail.

1) Nucleotide Sequence and Amino Acid Sequence of Hypersensitivity Induction Protein Gene

A cDNA library was prepared by separating mRNA from pepper varieties which showed hypersensitivity reactions resistant to red pepper bacterial inoculation of Xanthomonas campestris pv.vesicatoria . To apply the yeast two-hybrid system used in protein-protein interaction studies, a plasmid library for yeast two-hybrid is prepared using the cDNA library.

Using the library thus prepared, the inventors conducted a gene search using a protein-protein interaction with the ELAL protein (patent application No. 2003-13133) gene, the invention of which was patented by the present inventors, Separate multiple groups of proteins that interact with the egg protein. Among these reported maize hypersensitivity inducing proteins (Nadimpalli, R., Yalpani, N., Johal, GS, and Simmons, CR (2000) Prohibitins, stomatins, and plant disease response genes compose a protein superfamily that controls cell proliferation, ion channel regulation, and death.Journal of Biological Chemistry 185: 29579-29586), a gene that is homologous is selected and named as a pepper hypersensitivity-induced protein gene, and the base sequence and amino acid sequence encoded by the base sequence Are provided as SEQ ID NO: 1 and SEQ ID NO: 2 (see Figure 1).

The red pepper hypersensitivity-inducing protein has an N-myrystoylation site at the N-terminal site and also has a transmembrane site.

2) Induced Expression of Hypersensitivity Induced Protein Genes in Red Pepper Plants by Bacterial Pathogens

Plants resistant to disease show various protective reactions during invasion and infection of pathogens. Differentiation-induced expression of hypersensitivity inducing protein genes is induced in the leaves of pepper plants during bacterial pathogen invasion. Therefore, the induced expression of the hypersensitivity-induced protein gene according to the present invention can be seen as a molecular label indicating local resistance and systemic acquisition resistance appearing on the infected site.

Experiments confirmed that the hypersensitivity-induced protein genes of the present invention derived from infected pepper plant tissues inoculated with pepper bacterial spot bacteria were differentially induced and expressed against invasion of various plant pathogens.

Figure 2 shows the hypersensitivity inducing protein gene (CAHIR1) according to the present invention in infected leaves when inoculated with the red pepper bacterial spot bacterium ( Xanthomonas campestris pv.vesicatoria ) of the pathogenic strain Ds1 and non-pathogenic strain Bv5-4a Expression induction results are shown. As shown in FIG. 2, it was found that the pepper hypersensitivity-induced protein gene was induced and expressed in both friendly and incompatible interactions, and the expression time was faster and the expression amount was higher in incompatible interactions. More specifically, in the friendly interaction, the expression was weak after 10 hours after inoculation, whereas in the case of incompatible interaction, the expression of the hypersensitivity-inducing protein gene was 1 hour after inoculation. It can be seen that it appears relatively stronger.

3) Systemic expression of hypersensitivity-induced protein genes by treatment with non-pathogenic bacteria that induce non-host resistance in red pepper

When treating pathogens that cause non-host resistant reactions in plants, a representative phenomenon among the various reactions that occur is to cause hypersensitivity to plants. This hypersensitivity is similar to that seen in incompatible interactions.

When inoculated with Pseudomonas syringae pv. Tomato , which causes non-host resistance in red pepper, the expression of the hypersensitivity-induced protein gene according to the present invention is strongly induced from 1 hour after the inoculation and persists for 20 hours after inoculation. (See FIG. 3).

4) Induction of hypersensitivity-induced protein genes by abiotic derivatives of plants

Northern blotting after treatment of these substances in plants to determine the mechanism by which the hypersensitivity-induced protein genes according to the present invention are expressed through various mechanisms known as plant disease resistance inducing substances. ) Was performed.

As a result, as shown in Figures 4 and 5, it was found that the hypersensitivity-induced protein gene according to the present invention is strongly induced expression in the leaves of plants treated with ethylene, methyl jasmonate, salicylic acid. On the other hand, ABA was confirmed that does not have a strong effect on the induction of expression of the gene.

Looking at the expression pattern of pepper hypersensitivity-induced protein gene according to the present invention according to the time elapsed after the derivative treatment, salicylic acid is 10 hours to 20 hours after treatment, and methyl jasmonate is 5 hours to 10 hours after treatment Induced expression was found to appear. On the other hand, when treated with ethylene, it showed the strongest expression after 1 hour of treatment, after that it was shown to last up to 20 hours, although decreased.

5) Preparation of recombinant vector and transgenic plant into which the gene (CAHIR1) according to the present invention is inserted

As described above, it was confirmed that the hypersensitivity-inducing protein gene according to the present invention is strongly expressed at the time of induction of hypersensitivity reaction, which is one of disease resistance reactions in plants. Accordingly, transgenic plants were prepared to more closely examine the in vivo role of the gene (CAHIR1) according to the present invention.

A pepper bacterium was transformed into a specific region of the pBIN35S vector, which is a plant transformation vector, and transformed into Agrobacterium. The Arabidopsis plant was transformed to induce pepper hypersensitivity according to the present invention. A transgenic plant with the protein gene inserted could be obtained. Using the total RNA of the transgenic plants obtained as described above, the insertion of pepper hypersensitivity protein protein was confirmed using reverse transcriptase. As a result, the gene was actually expressed (see FIG. 7).

6) Overexpression of disease-related genes caused by pepper hypersensitivity protein

As a result of confirming the change in phenotype of Arabidopsis plants transformed by the pepper hypersensitivity inducing protein gene, the specific thing is that the disease defense-related genes are constantly expressed in the transgenic plants.

Expression of these genes was confirmed by reverse transcription-polymerization using primers prepared around the total RNA of the transformed plant and the nucleotide sequences of specific genes. As a result, PR-1 and PR-2 showed a salicylic acid-dependent expression pattern. , PR-5, NPR1 and UBQ genes were induced expression of the phenomenon, while in the case of the PDF1.2 gene showing a cassonic acid dependent expression pattern was not confirmed expression (see Figure 8).

7) Formation of apoptosis by pepper hypersensitivity protein

When the pepper hypersensitivity-induced protein gene according to the present invention is overexpressed in plants, it can be seen that apoptosis similar to the hypersensitivity reaction by pathogens is induced in plants.

In the Arabidopsis plants expressing the red pepper hypersensitivity-induced protein according to the present invention, apoptosis was not found in wild-type Arabidopsis at the leaf edge and end. To prove this, staining using a lactophenol-tryphan blue reagent showed that the formation of these lesions was associated with apoptosis (see FIG. 9).

8) Enhancement of disease resistance effect in transgenic plants of red pepper hypersensitivity protein

In order to demonstrate a direct correlation with the disease resistance response of pepper hypersensitivity-induced protein inducing apoptosis and expression of disease defense-related genes in Arabidopsis plants transformed by the gene according to the present invention, The inverted Arabidopsis plants were inoculated with pathogenic Pseudomonas bacteria and confirmed the disease response. As a result, about 100-fold reduction in bacteria was observed in the transformed plants (see FIG. 10).

Hereinafter, the present invention will be described in more detail with reference to examples. However, the following examples are for illustrating the present invention, and the scope of the present invention is not limited by the following examples.

Example 1 Base Sequence and Amino Acid Sequence Determination of Pepper Hypersensitivity Induced Protein Gene

Capsicum annuum cv.Hanbyul was inoculated with BV5-4a ( Xanthomonas campestris pv.vesicatoria strain BV5-4a), which is a non-pathogenic bacterium of red pepper bacterial spot pattern disease. The leaves were removed from the wet room.

Then, cDNA library was prepared by extracting mRNA from the collected leaf samples, reverse transcripting, and amplifying it with PCR (Polymerase Chain Reaction).

To apply the yeast two-hybrid system to be used in protein-protein interaction studies, the cDNA library is inserted into a specific region of the pGADT7 plasmid provided by Clontech. Hereinafter referred to as plasmid library for yeast two-hybrid.

Protein-protein interaction with the ELAL protein (Patent Application No. 2003-13133) gene, the invention of which is patented by the present inventors using the plasmid library for yeast two-hybrid thus produced Gene exploration using action was performed to isolate multiple groups of proteins that interact with ELAL proteins.

Among them, a gene showing homology with the reported hypersensitivity-induced protein of maize was selected and named as the pepper hypersensitivity-induced protein gene, and the nucleotide sequence and the amino acid sequence encoded by the nucleotide sequence were SEQ ID NO: 1 and SEQ ID NO: Summed up to 2 (see FIG. 1).

Example 2 Induced Expression of Pepper Hypersensitivity Induced Protein Gene by Bacterial and Non-Host Host Pathogens

       Experimental Example 1.

Among the red pepper bacterial spot pathogens, the cultured pathogenic strain Ds1 and the non-pathogenic strain Bv5-4a showing incompatible reaction were incubated in a six-leaf pepper plant at a concentration of 5x10 ⁸ cfu / ml. Inoculated by infiltration using a connected nebulizer and wet-treated for 18 hours at 28 ° C., 100% relative humidity.

After 1, 5, 10, 20 hours of inoculation, pepper leaves were sampled to isolate RNA, and the isolated RNA was electrophoresed on a gel containing formaldehyde and then transferred to a nylon membrane (Hybond N +).

Next, the plasmid vector [pGADT7] containing the red pepper hypersensitivity inducing protein gene prepared in Example 1 was cut with restriction enzymes Eco RI and Xho I, and only the inserted DNA was recovered and labeled with ³² P, followed by reaction. Hybridization was performed by incubating the solution (0.25 M phosphate buffer, 7% SDS, 1 mM EDTA, 5% Dextran Sulfate) at 65 ° C. for 16 to 24 hours.

The ³² P-labeled DNA probe is attached to the mRNA attached to the nylon membrane, and if the X-ray film is placed on the nylon membrane, the ^32- P labeled DNA photosensitizes the X-ray film. I could recognize it.

Figure 2 shows the results of the expression of pepper hypersensitivity-induced protein genes in the friendly reaction after inoculation of pathogenic strains of pepper bacterial bacterial pathogens and incompatible reactions after inoculation with non-pathogenic strains.

In FIG. 2, healthy indicates plants that have not been vaccinated, and friendly reactions refer to cases in which pathogenic strains are inoculated with susceptible symptoms, and incompatible interactions result in resistance hypersensitivity to plants by inoculation with non-pathogenic strains. In this case, the numbers in the figures represent the time elapsed after inoculation.

Experimental Example 2.

RNA was isolated from red pepper leaves inoculated with Pseudomonas syringae pv. Tomato , which exhibits non-host resistance. The isolated RNA was electrophoresed on a gel containing formaldehyde, and then transferred to a nylon membrane (Hybond N ⁺ ), followed by the red pepper hypersensitivity protein protein labeled with ³² P and 16 using the same method as in Experimental Example 1 above. Incubate for 20 hours.

As such, after inoculating Pseudomonas to the pepper leaves, the results of the expression of the pepper hypersensitivity-induced protein gene appearing with time are shown in FIG. 3.

Example 3: Induced Expression of Pepper Hypersensitivity Induced Protein Gene by Abiotic Derivatives of Plants

In order to find out whether the pepper hypersensitivity-induced protein gene according to the present invention can be induced by abiotic derivatives which are usually used for resistance induction, the following test was performed.

First, various RNAs known to induce disease resistance in plants (salicylic acid, ABA, ethylene gas, methyl jasmonate) were treated with plants, and total RNA was isolated from the plants over time.

At this time, the treatment of each substance is as follows. Ethylene gas was injected through a syringe in an amount of 5 μl / liter in a 500 ml bottle. Methyl jasmonate and ABA were foliarly sprayed at 100 μM each and 5 mM for silicic acid.

After treatment with each inducer, the leaves were taken from each plant as a predetermined time passes, and RNA was purified from the plants, and Northern blotting was performed as follows. The isolated RNA was electrophoresed on a gel containing formaldehyde and then transferred to a nylon membrane (Hybond N +). Next, the red pepper hypersensitivity inducing protein gene according to the present invention labeled with ³² P was incubated for 16 to 24 hours in the same manner as in Experiment 1 of Example 2.

The results are shown in Figures 4 and 5, Figure 4 shows the results of the expression of pepper hypersensitivity protein protein according to the present invention over time after treatment with salicylic acid and ABA. Figure 5 shows the results of the expression of pepper hypersensitivity protein protein according to the present invention over time after treatment with ethylene and methyl jasmonate. Sound is leaves that have not been treated with any material, and numbers represent the time elapsed after inoculation.

Example 4 Preparation and Analysis of Transgenic Plant Inserted with Red Pepper Hypersensitivity Induced Protein Gene

Experimental Example 1.

In order to clarify the biological function of the hypersensitivity-induced protein gene according to the present invention, which is strongly expressed not only in the incompatible interaction between red pepper and red pepper bacterial bacillus bacteria but also by plant defense-related hormone treatment, Arabidopsis (ecotype Col-O) The pepper hypersensitivity inducing protein gene according to the present invention was introduced into.

At this time, pBIN35S vector was used as a binary vector for plant transformation. To prepare a recombinant plant expression binary vector, both ends of the hypersensitivity-induced protein gene inserted at the EcoRI and XhoI positions of pGADT7vector were separated using the synthesized primers, followed by HindIII- of pBIN35S vector. The BamHI site was introduced using T4 DNA ligase.

6 shows a schematic diagram of the genetic recombinants used for the production of transgenic plants.

Experimental Example 2.

The recombinant plant expression vector (pBIN :: CALTP) into which the red pepper hypersensitivity-induced protein gene according to the present invention prepared by the method of Experimental Example 1 was inserted into the agrobacterium tumer through electroporation. Agrobacterium tumefaciens EHA105 strain was transformed.

The transformed Agrobacterium tumeface was selected in YEP medium to which 50 μg / ml of kanamycin was added, and then plasmid DNA was isolated from the transformed bacteria. The plasmid DNA thus isolated was used as a template, and a combination of pepper hypersensitivity-induced protein gene specific primers (CAHIR1-foward: atg ggc aat ttg ttc tgc tgt gtg caa: SEQ ID NO: 3, CAHIR1-reverse: tta atg ccc aac aga agc ctg: By using the SEQ ID No. 4) to amplify the pepper hypersensitivity inducing protein gene region by PCR method, it was confirmed that the pepper hypersensitivity inducing protein gene was correctly inserted into the recombinant plant expression vector.

In the case of Arabidopsis, transformation is performed by Arabidopsis floral dipping method using the transformed Agrobacterium tumerface obtained through the method in Experimental Example 1 and Experimental Example 2. It was. First, the bacteria into which the recombinant gene was inserted were incubated in a medium to which 50 µg / ml kanamycin and an appropriate amount of rifampicin were added, and then diluted to OD 600 = 0.8 using 5% sucrose solution, and then 0.05. Bacterial fluid was prepared by adding about 10% of a silkt (silwet L-77) or an appropriate electrodeposition agent. In order to prepare the Arabidopsis to be used for transformation, after removing the primary peduncle and using a number of secondary peduncles were used plants were used that have a number of immature flowers and flowers in a few moisture stages.

The plants thus prepared were soaked in the bacterial suspension for 2 minutes and left for 16 to 24 hours in a humid condition to facilitate the invasion of bacteria into the plants. Thereafter, a number of seeds were obtained from the cultivation until the seeds matured under normal growth conditions. The seeds thus secured were sterilized in 50 μg / L kanamycin-added MS medium and incubated at 22 ° C. for 16 hours under light conditions to obtain a transgenic plant in which the red pepper hypersensitivity protein gene of the present invention was inserted. The plants thus secured were transferred to soil and cultivated at 22 ° C. for 8 hours under light conditions until the seeds grew trough.

Induced pepper hypersensitivity reaction according to the present invention through the reverse transcription-polymerization experiment using the pepper hypersensitivity induction protein gene specific primers (SEQ ID NO: 3 and SEQ ID NO: 4) by separating the total RNA from the transgenic plants thus secured Correct insertion and expression of protein genes were confirmed.

7 shows whether the pepper hypersensitivity inducing protein gene expression in the transgenic plant according to the present invention. Healthy means plants that have not been transformed, and numbers represent the independent line numbers of the plants transformed by the present invention.

Experimental Example 3.

In order to observe the change in the molecular phenotype of the transformed plant according to the present invention confirmed in Experimental Example 2, the expression of other disease defense related genes was investigated using total RNA isolated from the leaf tissue of the transformed plant. The primers used at this time (see Table 1) were prepared using specific base sequences of Arabidopsis genes that have been reported previously, and the expression of genes was evaluated using reverse transcriptase.

Arabesque Genes primer Baby Pole PR-1 forward: gtaggtgctcttgttcttccc (SEQ ID NO: 5) reverse: cacataattcccacgaggatc (SEQ ID NO: 6) Baby Pole PR-2 forward: ctacagagatggtgtca (SEQ ID NO: 7) reverse: agctgaagtaagggtag (SEQ ID NO: 8) Baby Pole PR-5 forward: cacattctcttcctcgtgttc (SEQ ID NO: 9) reverse: tagttagctccggtacaagtg (SEQ ID NO: 10) Baby Pole UBQ forward: gtggtgctaagaagaggaaga (SEQ ID NO: 11) reverse: tcaagcttcaactccttcttt (SEQ ID NO: 12) Baby Pole NPR1 forward: ctctttaatttgtgaatttca (SEQ ID NO: 13) reverse: cggcggtctcactctgct (SEQ ID NO: 14) Baby Pole PDF1.2 forward: acacaacacatacatcta (SEQ ID NO: 15) reverse: ggtagatttaacatggga (SEQ ID NO: 16)

Figure 8 shows the expression of Arabidopsis gene gene by overexpression of pepper hypersensitivity protein protein in transgenic plants according to the present invention. Healthy means plants that have not been transformed, and numbers refer to independent individual numbers of plants transformed by the present invention. Also on the right is the Arabidopsis gene name.

Experimental Example 4.

When comparing the Arabidopsis plants prepared by the above method with the non-transformed plants, it was confirmed that apoptosis-like apoptosis was observed in the leaves of the transformed plants according to the present invention.

9 shows apoptosis in transgenic plants according to the present invention. The numbers refer to the line numbers of the independent transgenic plants.

Experimental Example 5.

In order to examine the response to the transformed pathogens according to the present invention, 10 ³ cfu / ml Pseudomonas bacteria were inoculated on the leaves of the 4 week Arabidopsis plants, and the number of pathogens was measured 5 days after the inoculation. Through this, it was found that the growth of pathogenic bacteria is suppressed in the plant overexpressed pepper hypersensitivity protein protein according to the present invention.

Figure 10 shows the effect of inhibiting the growth of pathogenic bacteria in the transformed plants according to the present invention. The numbers refer to the independent line numbers of the transformed plants, and the sound refers to the plants not transformed.

As described above, the present invention isolates the hypersensitivity-induced protein gene from the red pepper cultivars that are resistant to red pepper bacterial spot disease ( Xanthomonas campestris pv.vesicatoria ) to determine its nucleotide sequence and to encode the amino acid sequence and related primers. To provide. The present invention also provides a transformation vector and a transgenic plant using the pepper hypersensitivity protein. Therefore, the present invention can achieve the effect that can be used as a genetic material for labeling the protective response to plant pathogens and molecular breeding of plant disease resistant crops.

Furthermore, the present invention provides an effect of promoting the development of resistant varieties by providing a method for determining the defense response of plants by plant pathogens, chemicals, and environmental stress, which consists in confirming the differential expression of the pepper hypersensitivity-induced protein gene. This is a very useful invention in the plant breeding industry.

Attach sequence list electronic file

Claims (9)

The red pepper hypersensitivity-induced protein gene (CAHIR1) of SEQ ID NO: 1 isolated from Capsicum annuum L. cv. Hanbyul. A peptide having the amino acid sequence of SEQ ID NO: 2 encoded by the gene of claim 1. A recombinant vector (pBIN :: CALTP) prepared by introducing a gene of claim 1 into a pBIN35S_vector. A bacterium transformed by the gene of claim 1 or the recombinant vector of claim 3. A transformed Arabidopsis plant in which the gene of claim 1 is inserted. A primer used for PCR of the gene of Claim 1 shown by SEQ ID NO: 3 and SEQ ID NO: 4. delete In the plant disease resistance and environmental stress screening method, RNA isolated from pepper plants inoculated with one of the pathogenic and non-pathogenic bacteria and Pseudomonas bacteria of red pepper bacterial spot disease, electrophoresed and transferred to a nylon membrane (Hybond N +), and then treated with ³² P. CAHIR1 Plant disease resistance and environmental stress screening method comprising the reaction with a gene probe to confirm the differential expression of the CAHIR1 gene. In the plant disease resistance and environmental stress screening method, RNA was isolated from the pepper plants treated with either ethylene, methyl jasmonate or salicylic acid, electrophoresed and transferred to a nylon membrane (Hybond N +), followed by reaction with the CAHIR1 gene probe as described in claim 1 treated with ³² P. Plant disease resistance and environmental stress screening method comprising the identification of differential expression of the CAHIR1 gene.

Images