KR0177312B1 - Production method of urease agent of Helicobacter pylori from recombinant E. coli - Google Patents

Production method of urease agent of Helicobacter pylori from recombinant E. coli Download PDF

Info

Publication number
KR0177312B1
KR0177312B1 KR1019960020904A KR19960020904A KR0177312B1 KR 0177312 B1 KR0177312 B1 KR 0177312B1 KR 1019960020904 A KR1019960020904 A KR 1019960020904A KR 19960020904 A KR19960020904 A KR 19960020904A KR 0177312 B1 KR0177312 B1 KR 0177312B1
Authority
KR
South Korea
Prior art keywords
fusion protein
urease
gene
coli
ure
Prior art date
Application number
KR1019960020904A
Other languages
Korean (ko)
Other versions
KR980002257A (en
Inventor
장호진
김천형
황상연
유영준
Original Assignee
성재갑
주식회사엘지화학
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 성재갑, 주식회사엘지화학 filed Critical 성재갑
Priority to KR1019960020904A priority Critical patent/KR0177312B1/en
Publication of KR980002257A publication Critical patent/KR980002257A/en
Application granted granted Critical
Publication of KR0177312B1 publication Critical patent/KR0177312B1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C12N9/80Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5) acting on amide bonds in linear amides (3.5.1)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K1/00General methods for the preparation of peptides, i.e. processes for the organic chemical preparation of peptides or proteins of any length
    • C07K1/14Extraction; Separation; Purification
    • C07K1/16Extraction; Separation; Purification by chromatography
    • C07K1/22Affinity chromatography or related techniques based upon selective absorption processes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70Vectors or expression systems specially adapted for E. coli
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/20Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/21Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a His-tag
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/95Fusion polypeptide containing a motif/fusion for degradation (ubiquitin fusions, PEST sequence)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/01Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in linear amides (3.5.1)
    • C12Y305/01005Urease (3.5.1.5)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 대장균을 이용하여 헬리코박터 필로리(Helicobacter pylori : H. pylori)의 항원 결정부위 단백질인 우레아제 A(Urease A)를 융합단백질의 형태로 제조하는 방법에 관한 것으로, 헬리코박터 필로이의 우레아제 A 유전자에 히스티딘과 유비퀴틴 유전자가 연결된 융합유전자를 포함하는 His-Ub-Ure A 융합단백질 발현벡터로 형질전환된 대장균을 융합단백질의 발현에 적합한 조건에서 배양하고, 융합단백질이 발현된 재조합 대장균 세포를 구아니딘 염이 포함된 완충용액에서 분쇄하고, 원심분리한 상등액을 히스티딘 결합수지 친화성 크로마토그래피하는 단계를 포함하는 본 발명의 His-Ub-Ure A 융합단백질의 제조방법에 의하면 H. pylori 감염 진단과 백신 개발에 유용하게 사용될 수 있는 His-Ub-Ure A 융합단백질을 높은 수율로 대량 생산할 수 있다.The present invention relates to a method for producing an antigenic determinant site protein of Helicobacter pylori (H. pylori), Urease A, in the form of a fusion protein using E. coli, and relates to a method for producing a urease A gene of Helicobacter pylori Ub-Ure A fusion protein expression vector containing a fusion gene in which histidine and ubiquitin gene are linked, is cultured under conditions suitable for expression of the fusion protein, and the recombinant E. coli cells expressing the fusion protein are treated with a guanidine salt Ub-Ure A fusion protein of the present invention comprising a step of subjecting the supernatant obtained by pulverization in an included buffer solution to histidine-binding affinity affinity chromatography of the present invention is used for the diagnosis of H. pylori infection and the development of a vaccine The His-Ub-Ure A fusion protein which can be usefully used can be mass-produced at a high yield.

Description

재조합 대장균으로부터 헬리코박터 필로리의 우레아제 에이 제조방법Production method of urease agent of Helicobacter pylori from recombinant E. coli

제1도는 우레아제 A(Urease A) 유전자를 본 발명의 대장균 발현벡터 pETHUB-UREA로 클로닝하는 과정을 도시한 것이고,FIG. 1 shows the process of cloning Urease A gene into the E. coli expression vector pETHUB-UREA of the present invention,

제2도는 본 발명의 발현벡터 pETHUB-UREA로 형질전환된 대장균을 배양하여 얻은 세포 침전물을 변성 폴리아크릴아미드 겔 전기영동한 결과를 나타낸 것이고,FIG. 2 shows the result of denaturing polyacrylamide gel electrophoresis of cell precipitate obtained by culturing Escherichia coli transformed with the expression vector pETHUB-UREA of the present invention,

제3도는 본 발명의 발현벡터 pETHUB-UREA로 형질전환된 대장균을 배양하여 얻은 세포 침전물을 변성 폴리아크릴 아미드 겔 전기영동한 후 유비퀴틴 단일 항체를 이용하여 웨스턴 블롯팅(western blotting)한 결과를 나타낸 것이다.FIG. 3 shows the result of western blotting of a cell precipitate obtained by culturing Escherichia coli transformed with the expression vector pETHUB-UREA of the present invention by denaturing polyacrylamide gel electrophoresis followed by ubiquitin single antibody .

본 발명은 대장균을 이용하여 헬리코박터 필로리(Helicobacter pylori, 이하 H. pylori라 함)의 항원 결정부위 단백질인 우레아제 A(Urease A)를 제조하는 방법에 관한 것으로, 더욱 상세하게는 위, 십이지장 궤양의 원인균으로 보고된 헬리코박터 필로리의 항원인 우레아제 A(Urease A, 이하 Ure A라 함)를 히스티딘(Histidine, 이하 His라 함)과 유비퀴틴(Ubiquitin, 이하 UB라 함)과의 융합단백질(His-Ub-Ure A)로 발현시켜 H. pylori 감염 진단과 백신 개발에 유용하게 사용될 수 있도록 한 것이다.The present invention relates to a method for producing an antigenic determinant site protein, Urease A, of Helicobacter pylori (hereinafter referred to as H. pylori) using E. coli, and more particularly, Urease A, hereinafter referred to as Urease A, which is an antigen of Helicobacter pylori reported as a causative microorganism is called a fusion protein (His-Ub) with histidine (hereinafter referred to as His) and Ubiquitin (hereinafter referred to as UB) -Ure A) to be useful for the diagnosis of H. pylori infection and vaccine development.

H. pylori는 워렌과 마샬에 의해 십이지 궤양 환자에게서 최초로 분리배양된 미호기성의 그람음성 나선형 박테리아로서(Warren and Marshall, Lancet, 1, 1273-1275(1983)), 위점막 상피세포 사이에서 서식하는 것으로 알려졌다. H. pylori는 일단 서식하기 시작하면 평생동안 기생하는 미생물로 각종 위, 십이지장 질환환자의 위 점막에서 높은 빈도로 발견되는데, 최근의 여러 보고들에 의해 위염 및 위, 십이지장 궤양을 일으키는 근본적인 원인균인 것으로 밝혀졌으며(Alper J., et al., Science, 260, 159-160(1993)), 위암까지 일으킬 가능성이 있다는 사실도 보고된 바 있다(Parsonnet, et al., New Eng. J. Med., 325, 1127-1131(1991); The Urogust Study Group, Lancet, 341, 1359-1362(1993)).H. pylori is a microaerophilic gram-negative spiral bacterium first isolated and isolated from patients with duodenal ulcers by Warren and Marshall (Warren and Marshall, Lancet, 1, 1273-1275 (1983)), . H. pylori is a parasitic microorganism that is found in the gastric mucosa of patients with various stomach and duodenal diseases once it has started to live. It is a fundamental cause of gastritis and gastric and duodenal ulcers by various reports (Parsonnet, et al., New Eng. J. Med., ≪ RTI ID = 0.0 > 325, 1127-1131 (1991); The Urogust Study Group, Lancet, 341, 1359-1362 (1993)).

1994년 미국 보건성(National Institute of Health, U.S.A.) 주최 컨센서스 회의에서는 위, 십이지장 궤양을 H. pylori에 의한 질병으로 규정하고, 기존의 위산 조절제 요법 대신 항생제를 이용하여 H. pylori를 박멸시키는 것을 치료요법으로 추천할 것을 결정하였다(NIH, NIH concensus development conference Helicobacter pylori in pepticulcer disease(1994)).In 1994, the consensus conference organized by the National Institute of Health (USA) defined stomach and duodenal ulcer as a disease caused by H. pylori and eradication of H. pylori by using antibiotics instead of existing gastric acid therapy (NIH, NIH concensus development conference, Helicobacter pylori in pepticulcer disease (1994)).

위 질환 증상이 없는 정상인을 대상으로 위내시경 검사, 방사성 동위원소로 표지된 요소호흡 실험 및 혈청학적인 실험을 통해 H. pylori 보균율을 조사한 결과, 미국 등의 선진국에서는 20대중 10내지 20%가 H. pylori 보균자였으며, 연령이 증가함에 따라 보균율이 증가하여 50 내지 60대에서는 50% 정도의 감염율을 보였다(Berkowicz J and Lee A, Lancet 2, 680-681(1987); Goodwin C. S., et al., J, Infect. Dis. 155, 488-494(1987); von Wulffen H., et al., J. Clin. Microbiol., 24, 716-720(1986); Jones D. M., et al., J. Clin. Pathol., 37, 1002-1006(1984)). 반면 후진국이나 개발 도상국에서는 어린 연령층에서도 보균율이 높은 것으로 보고되었는데(Graham D. Y., et al., Scand. J. Gastroenterol., 23, 9-13(1988), Meraud F., et al., J. Clin. Microbiol., 27, 1870-1873(1989)), 우리나라의 경우도 후진국의 H. pylori 보균율과 유사하여 20 내지 30대중 약 80 내지 90%가 감염되어 있는 것으로 나타났다(정현채 등, 대한 소화기 병학회지, 20, 47-56(1988)); 백승철 등, 대한 미생물 학회지, 25(6), 455-462(1990)).H. pylori colonization rate was measured by gastroscopy, urea breath test and serologic test with radioisotopes in normal subjects without gastrointestinal symptoms. In the developed countries such as USA, 10 ~ 20% of H. (Berkowicz J and Lee A, Lancet 2, 680-681 (1987)), Goodwin CS, et al., J , Jones DM, et al., J. Clin. Clin. Microbiol., 24, 716-720 (1986); Infect. Dis. 155, 488-494 (1987); von Wulffen H., et al. Pathol., 37, 1002-1006 (1984)). On the other hand, in low-income countries and developing countries, higher mortality rates have been reported in younger age groups (Graham DY, et al., Scand. J. Gastroenterol., 23, 9-13 (1988), Meraud F., et al., J. Clin ), 27, 1870-1873 (1989)), and in Korea, about 80 to 90% of the 20 to 30 generations were infected with H. pylori infection in the backward countries (Jung Hyun Chae et al. , 20, 47-56 (1988)); Baek Seung-Cheol et al., Journal of Microbiology, 25 (6), 455-462 (1990)).

H. pylori의 항원중 하나인 우레아제(urease)는 분자량이 각각 다른 두개의 서브유니트(우레아제 A: 29.5kDa와 우레아제 B:66kDa)로 이루어지며, 이들은 각각 동일 몰비 형태로 육중체를 형성한다. 우레아제는 우레아(urea)를 암모니아로 가수분해하여 주위 환경의 pH를 상승시킴으로써 H. pylori의 생존을 돕는 작용을 한다. 또한 우레아제는 여러가지의 검사방법, 예를 들어 혈청내에 형성된 우레아제 항체를 측정하거나 우레아 호흡검사를 통해 방사성 동위원소로 표지된 이산화탄소를 검출하는 방법에 의해 쉽게 검출될 수 있다(Graham D. Y., et al., Lancet, 1, 1174-1177(1987)). 따라서 H. pylori로부터 우레아제를 정제하여 그의 특성을 밝힌 보고가 많이 나오고 있다(Hu L. T. and Mobley HLT., Infection and Immunity 58, 992-998(1990); Nagata K. et al., Infection and Immunity, 60, 4826-4831(1992); Evans D. J., et al., Micobiol, Pathgenesis, 10, 15-26(1991); Dunn B. E. et al., JBC, 265, 9464-9469(1990); Turbett G. R., et al., Infection and Immunity, 60, 5259-5266(1992)).Urease, one of the antigens of H. pylori, consists of two subunits of different molecular weights (urease A: 29.5 kDa and urease B: 66 kDa), which form masses in the same molar ratio. Urease acts to help H. pylori survival by hydrolyzing urea with ammonia to raise the pH of the surrounding environment. Urease can also be easily detected by various assay methods, for example, by detecting urea antibody formed in serum or by detecting radioactive isotope labeled carbon dioxide through urea breath test (Graham DY, et al. Lancet, 1, 1174-1177 (1987)). Thus, many reports have been published that purify urease from H. pylori and characterize it (Hu, LT and Mobley, HLT, Infection and Immunity 58, 992-998 (1990); Nagata K. et al., Infection and Immunity, 60 JB, 265, 9464-9469 (1990); Turbett GR, et al. (1992); Evans DJ, et al., Micobiol, Pathgenesis, 10, 15-26 ., Infection and Immunity, 60, 5259-5266 (1992)).

우레아제의 정제는 H. pylori를 배양한 후 세포를 파쇄하거나 적정 완충용액으로 용출한 후 겔 여과 칼럼 크로마토그래피, 양이온 교환 칼럼 크로마토그래피 및 페닐 소수성 칼럼 크로마토그래피를 실시하는 등 일련의 과정을 포함하고 있다. 그러나 이러한 방법에서는 여러가지 문제점이 야기되는데, 첫째 H. pylori는 미호기성 박테리아이므로 배양이 까다로워 많은 양의 배양이 어렵다는 문제점이 있고, 또한 감염될 우려가 있기 때문에 취급시 주의를 요한다.Purification of urease includes a series of procedures such as culturing of H. pylori, disruption of cells or elution with a suitable buffer solution followed by gel filtration column chromatography, cation exchange column chromatography and phenylhydrophobic column chromatography . However, this method poses various problems. First, H. pylori is a microaerobic bacteria, so it is difficult to cultivate in a large amount due to difficult cultivation. Also, since it is likely to be infected, careful handling is required.

이와 같은 문제점을 해결하기 위해, 재조합 유전자 조작기술을 이용하여 대장균으로부터 H. pylori 우레아제를 발현시킨 바 있으며(Cussac V., et al., J. of Bacteriology, 174, 2466-2473(1992); Hu L. T. and Mobley HLT Infection and Immunity, 61, 2563-2569(1993)), 또한 재조합 대장균에서 발현된 H. pylori 우레아제를 음이온 교환, 페닐 소수성, Mono Q, 그리고 겔 여과 칼럼 크로마토그래피하여 비활성인 두개의 우레아제 서브유니트 단백질을 확인하였다(Hu L. T. et al., Infection and Immunity, 60, 2657-2666(1992)). 이 방법에서는 세포를 파쇄하여 상등액을 이용하는데, 세포 파쇄시 상등액에는 일반적으로 대장균에 존재하는 단백질 가수분해 효소가 많이 발생하여 우레아제를 분해시킬 우려가 있으며, 또한 초원심분리하여 세포막 성분을 제거하는 방법은 대량생산에 적합하지 않다는 문제점이 있다.In order to solve such problems, H. pylori urease was expressed from Escherichia coli using a recombinant gene manipulation technique (Cussac V., et al., J. of Bacteriology, 174, 2466-2473 (1992); Hu And the H. pylori urease expressed in recombinant Escherichia coli was subjected to anion exchange, phenyl hydrophobicity, Mono Q, and gel filtration column chromatography to obtain two inactive urease Subunit proteins were identified (Hu LT et al., Infection and Immunity, 60, 2657-2666 (1992)). In this method, the cell is disrupted and the supernatant is used. In the supernatant during cell disruption, a large amount of protein hydrolytic enzymes existing in Escherichia coli generally occurs, which may cause degradation of urease. In addition, ultracentrifugation may be used to remove cell membrane components Is not suitable for mass production.

본 발명자들은 상기와 같은 문제점을 개선하고 우레아제 단백질을 효율적으로 대량생산할 수 있는 방법에 관해 연구하던 중, 히스티딘과 유비퀴틴 유전자를 우레아제 A 유전자에 연결시켜 His-Ub-Ure A 융합단백질을 유전공학적인 방법으로 대장균에서 대량생산하는데 성공함으로써 본 발명의 완성에 이르게 되었다.The inventors of the present invention have been studying a method for efficiently mass-producing urease proteins while improving the above problems. The inventors of the present invention have found that by conjugating the His-Ub-Ure A fusion protein with a urease A gene by a histidine and ubiquitin gene, And succeeded in mass production of E. coli.

본 발명의 목적은 대장균으로부터 발현될 수 있는 H. pylori 우레아제 A의 융합단백질을 코딩하는 유전자, 이를 포함하는 발현벡터 및 상기 발현벡터로 형질전환된 형질전환체를 제공하는 것이다.It is an object of the present invention to provide a gene encoding a fusion protein of H. pylori urease A that can be expressed from Escherichia coli, an expression vector containing the fusion protein, and a transformant transformed with the expression vector.

본 발명의 다른 목적은 H. pylori의 우레아제를 융합단백질의 형태로 제조하는 방법을 제공하는 것이다.Another object of the present invention is to provide a method for producing urease of H. pylori in the form of a fusion protein.

상기 목적에 따라, 본 발명에서는 헬리코박터 필로리(Helicobacter pylori; H. pylori) 우레아제 A 유전자에 히스티딘과 유비퀴틴 유전자가 연결된 융합유전자, 상기 융합유전자를 포함하는 히스티딘-유비퀴틴-우레아제 A(His-Ub-Ure A) 융합단백질 발현벡터 및 상기 발현벡터로 형질전환된 대장균을 제공한다.According to the above object, the present invention provides a fusion gene in which histidine and ubiquitin gene are linked to Helicobacter pylori (H. pylori) urease A gene, histidine-ubiquitin-urease A (His-Ub-Ure A) a fusion protein expression vector and E. coli transformed with the expression vector.

상기 다른 목적에 따라, 본 발명에서는 상기 히스티딘-유비퀴틴-우레아제 A(His-Ub-Ure A) 융합유전자를 포함하는 발현벡터로 형질전환된 대장균을 융합단백질의 발현에 적합한 조건에서 배양하고, 융합단백질이 발현된 재조합 대장균 세포를 구아니딘 염이 포함된 완충용액에서 분쇄하고, 원심분리한 상등액을 히스티딘 결합수지 친화성 크로마토그래피하는 단계를 포함하는 His-Ub-Ure A 융합단백질의 제조방법을 제공한다.According to another aspect of the present invention, there is provided a method for producing a fusion protein, which comprises culturing E. coli transformed with an expression vector comprising the histidine-ubiquitin-urease A fusion gene under conditions suitable for expression of the fusion protein, Ub-Ure A fusion protein comprising a step of pulverizing the expressed recombinant E. coli cells in a buffer solution containing a guanidine salt, and subjecting the supernatant obtained by centrifugation to histidine-binding affinity affinity chromatography.

이하, 본 발명을 좀 더 상세히 설명한다.Hereinafter, the present invention will be described in more detail.

본 발명의 융합단백질에 사용되는 유비퀴틴은 76개의 아미노산으로 구성된 분자량 8,500 달톤의 단백질로서 모든 진핵세포에 존재하나 대장균과 같은 원핵세포에는 존재하지 않는다. 이러한 유비퀴틴에 단백질을 연결시켜 융합단백질 형태로 발현시키면 유비퀴틴은 연결된 단백질의 발현율을 증가시키거나 단백질 분해효소로부터 단백질을 보호해 주는 역할을 한다(Sabin E. A. et al., Biotechnology, 7, 705-709(1989)). 또한 유비퀴틴은 항 유비퀴틴 항체를 이용함으로써 그 발현을 확인할 수 있고, 정제에도 유용하게 사용될 수 있다.The ubiquitin used in the fusion protein of the present invention is a protein having a molecular weight of 8,500 daltons consisting of 76 amino acids and is present in all eukaryotic cells but not in prokaryotic cells such as E. coli. When the ubiquitin is expressed in the form of a fusion protein by linking the protein to the ubiquitin, the ubiquitin increases the expression of the protein to be linked or protects the protein from the protease (Sabin EA et al., Biotechnology, 7, 705-709 1989). Ubiquitin can also be used for purification by confirming its expression by using an anti-ubiquitin antibody.

본 발명에 따라 우레아제 A를 히스티딘 및 유비퀴틴과의 융합단백질로 제조하기 위해서, 먼저 H. pylori(ATCC 43504)로부터 핵산(DNA)을 추출하고 우레아제 A(Ure A)의 염기서열 정보(Labigne A., et al., J. Bacteriol., 173, 1920(1991))로부터 Ure A 단백질을 코드하는 Ure A 유전자의 5'-말단과 3'-말단에 대응하는 종합효소 연쇄반응(polymerase chain reaction : PCR)용 시발체를 고안 합성한다. 이들 시발체는 5'-말단에 본 발명에서 합성한 유비퀴틴 유전자의 3'-말단의 중복되는 염기서열이 존재하도록 하고 이에 대응되는 시발체에는 종료코돈과 제한효소 인식부위를 삽입하여, 5'-말단에 8개의 히스티딘이 첨가된 유비퀴틴의 시작코돈으로부터 단백질이 합성되어 인위적으로 삽입한 종료코돈에서 단백질 합성이 완료되도록 하고, 동시에 대장균 발현벡터로 클로닝이 용이하도록 한다.In order to prepare urease A as a fusion protein with histidine and ubiquitin according to the present invention, nucleic acid (DNA) is first extracted from H. pylori (ATCC 43504) and the nucleotide sequence information of Urease A (Labigne A., (polymerase chain reaction (PCR)) corresponding to the 5'-terminal and 3'-terminal ends of the Ure A gene encoding the Ure A protein from E. coli and Bacteriol, et al., J. Bacteriol., 173, 1920 Design and synthesize a primer. These primers were designed such that the 3'-terminal overlapping nucleotide sequence of the ubiquitin gene synthesized in the present invention was present at the 5'-end, and a stop codon and a restriction enzyme recognition site were inserted in the corresponding primer, The protein is synthesized from the start codon of ubiquitin to which 8 histidine is added, thereby completing the protein synthesis at the artificially inserted end codon, and at the same time, cloning into an E. coli expression vector is facilitated.

상기 시발체를 이용하고 H. pylori의 DNA를 주형으로 해서 PCR 반응으로 원하는 부위의 유전자를 증폭하고, 증폭된 유전자를 인공합성된 히스티딘과 유비퀴틴 유전자와 결합시킨다(His-Ub-Ure A). 이어서 결합된 His-Ub-Ure A 유전자를 PCR 반응으로 대량 증폭하고, 증폭된 유전자를 제한효소로 절단하여 얻은 유전자 단편을 적절한 대장균 발현벡터에 삽입하여 His-Ub-Ure A 융합단백질 발현벡터를 제조한다. 상기의 재조합 벡터로 대장균을 형질전환시킨 다음, 본 유전자의 발현에 적당한 조건에서 배양한다. 단백질의 생성여부는 통상적으로 폴리아크릴아미드 겔 전기영동한 후 유틴 단일 항체를 이용하여 웨스턴 블롯팅 분석으로 His-Ub-Ure A의 발현을 확인할 수 있다.Using the above primer and amplifying the gene of the desired region by PCR reaction using the DNA of H. pylori as the template, the amplified gene is bound to artificially synthesized histidine and ubiquitin gene (His-Ub-Ure A). The His-Ub-Ure-A fusion protein expression vector was prepared by amplifying the His-Ub-Ure A gene in a large amount by PCR and then digesting the amplified gene with a restriction enzyme into a suitable E. coli expression vector. do. E. coli is transformed with the above recombinant vector and then cultured under conditions suitable for expression of the present gene. Whether or not the protein is produced can be confirmed by Western blotting analysis using a mutant of Utiline monoclonal antibody after polyacrylamide gel electrophoresis, and the expression of His-Ub-Ure A can be confirmed.

재조합 His-Ub-Ure A 유전자를 포함하는 발현벡터로 형질전환된 대장균을 앰피실린이 함유된 루리아(Luria) 배지에서 진탕배양한 후 이를 M9 배양액에 옮겨 진탕배양하여, 박테리아의 성장속도가 650nm에서 흡광도 0.3 정도로 될 때 IPTG(Isopropyl-β-D-thiogalactopyranoside)를 첨가하여 His-Ub-Ure A의 발현을 유도한다. 상기 배양액을 원심분리하여 대장균 세포를 침전시킨 후, 단백질의 가수분해 활성을 막기 위해 카오트로픽(chaotrophic) 시약인 구아니딘 염을 침전된 세포에 첨가하여 초음파 분쇄기로 세포를 파쇄한 다음 흔들어 주고 원심분리한다. 상등액을 취하여 구아니딘 염, 50mM 트리스 완충용액으로 미리 평형된 히스티딘 결합수지 친화성 칼럼에 흘려보내 결합시킨 후 유리된 상태로 남아 있는 불순물을 상기 완충용액으로 씻어낸다. 이어서 카오트로픽 활성이 낮은 완충용액으로 바꾸기 위해 우레아를 함유하는 완충용액으로 칼럼을 세척한 다음, 동일한 완충용액에 15mM의 이미다졸이 함유된 완충용액으로 세척하여 결합된 오염 단백질을 제거한다. 칼럼에 결합된 His-Ub-Ure A 융합단백질은 동일 완충용액에 0.4M의 이미다졸이 함유된 완충용액으로 충분히 용출시키고 각 부분을 SDS-폴리아크릴아미드 겔 전기영동하여 His-Ub-Ure A 융합단백질 부분만을 모음으로써 고순도의 His-Ub-Ure A 융합단백질을 얻을 수 있다.Escherichia coli transformed with an expression vector containing a recombinant His-Ub-Ure A gene was shake-cultured in Luria medium containing ampicillin, transferred to M9 culture medium and shake-cultured, and the growth rate of the bacteria was adjusted to 650 nm When the absorbance is about 0.3, IPTG (isopropyl-β-D-thiogalactopyranoside) is added to induce the expression of His-Ub-Ure A. The culture solution was centrifuged to precipitate E. coli cells. To prevent hydrolytic activity of proteins, guanidine salt, a chaotropic reagent, was added to the precipitated cells, and the cells were disrupted with an ultrasonic mill, followed by shaking and centrifugation . The supernatant is taken out and bound to a histidine-binding resin affinity column previously equilibrated with a 50 mM Tris buffer solution, and the remaining impurities remaining in a free state are washed away with the buffer solution. Subsequently, the column is washed with a buffer solution containing urea to convert it to a buffer solution having a low chaotropic activity, and then washed with a buffer solution containing 15 mM imidazole in the same buffer solution to remove the bound contaminating protein. The His-Ub-Ure A fusion protein bound to the column was sufficiently eluted with buffer solution containing 0.4 M imidazole in the same buffer solution, and each portion was subjected to SDS-polyacrylamide gel electrophoresis to obtain His-Ub-Ure A fusion A high purity His-Ub-Ure A fusion protein can be obtained by collecting only the protein moiety.

이하, 본 발명을 하기 실시예에 의거하여 좀더 상세히 설명하고자 한다. 단, 하기 실시예는 본 발명을 예시하기 위한 것일 뿐, 본 발명의 범위가 이들 만으로 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail based on the following examples. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[실시예 1][Example 1]

[H. pylori DNA로부터 우레아제 A 유전자의 증폭][H. Amplification of urease A gene from pylori DNA]

[단계 1][Step 1]

슐레이프의 방법(Schleif R. F., et al., Practical Methods in Molecular Biology, p98 Springer, New York(1981))에 따라 H. pylori(ATCC 43504)로부터 전체 DNA를 추출하였다. 즉, H. pylori 균주를 5%의 소 태아 혈청이 첨가된 브루셀라 액체배지(Brucella Broth, Difco Cat No. 0495-01-1)에 접종한 뒤 혐기성 배양용기(Anaerobic jar : Difco Cat No. 1951-30-1)에서 5% O2와 10% CO2존재하 37℃에서 4 내지 5일간 배양하였다. 세포 침전물을 GES 용액(60% 구아니디움 티오시아네이트, 0.1M EDTA, 0.5% 사르코실)에 용존시켜 동일부피의 페놀/클로로포름 용액으로 추출한 다음 이소프로판올로 전체 DNA를 침전시켰다. 이 침전물을 100㎕의 TE 완충용액(10mM Tris-HCl, 1mM EDTA, pH 7.5)에 용존시켰다.Total DNA was extracted from H. pylori (ATCC 43504) according to the method of Schleif RF, et al., Practical Methods in Molecular Biology, p98 Springer, New York (1981). H. pylori strains were inoculated into Brucella broth (Difco Cat No. 0495-01-1) supplemented with 5% fetal bovine serum, and then anaerobic jar (Difco Cat No. 1951- 30-1) in the presence of 5% O 2 and 10% CO 2 at 37 ° C for 4 to 5 days. The cell precipitate was dissolved in a GES solution (60% guanidium thiocyanate, 0.1 M EDTA, 0.5% sarcosyl), extracted with an equal volume of phenol / chloroform solution, and then precipitated with isopropanol. This precipitate was dissolved in 100 占 퐇 of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 7.5).

[단계 2][Step 2]

기존에 알려진 Ure A 유전자의 염기서열 정보(Labigne A., et al., J. Bacteriol., 173, 1920(1991))로부터 다음과 같은 시발체를 합성하였다 :The following primers were synthesized from the known sequence information of the UreA gene (Labigne A., et al., J. Bacteriol., 173, 1920 (1991)):

시발체 PUREAT2 : 5'-CTTGGTGTTGAGACTCCGCGGTGGTATGAAACTCACCCCAAAAGA-3'(5'-말단의 25번째 핵산까지는 유비퀴틴 유전자 3'-말단의 25번째 핵산까지와 동일한 염기서열을 갖고, 26번째 핵산부터는 우레아제 A 유전자 5'-말단의 20개 핵산과 동일한 염기서열을 갖도록 고안되었다)The primer PUREAT2: 5'-CTTGGTGTTGAGACTCCGCGGTGGTATGAAACTCACCCCAAAAGA-3 '(the 25th nucleotide at the 5'-end has the same base sequence as the 25th nucleotide at the 3'-end of the ubiquitin gene and the 26th nucleotide has the 5'- It is designed to have the same base sequence as the 20 nucleic acids)

시발체 PUREABAML : 5'-AAAAAGGATCCGTCGACTATTACTCCTTAATTGTTTTTAC-3'(우레아제 A의 해독이 종료되도록 두개의 종료코돈을 가지고 있고, 동시에 제한효소 SalI 및 BamHI 인지부위를 갖고 있다).The primer PUREABAML: 5'-AAAAAGGATCCGTCGACTATTACTCCTTAATTGTTTTTTAC-3 '(which has two stop codons to terminate the decoding of urease A, and at the same time has restriction enzyme SalI and BamHI recognition sites).

[단계 3][Step 3]

반응 튜브에 단계 1에서 얻은 H. pylori DNA 1ng을 주형으로 시발체 PUREAT2 2㎍, 시발체 PUREABAML 2㎍을 넣은 다음, 10㎕의 10배 중합 완충용액(500mM KCl, 100mM Tris-HCl, pH 9.0, 1.0% 트리톤 X-100), 10㎕의 2mM dNTP(각각 2mM dGTP, 2mM dCTP, 2mM dATP 및 2mM dTTP), 2.5 단위체 Taq 중합효소와 증류수를 가하여 총부피가 100㎕가 되도록 하여, 95℃에서 1분(변성단계), 55℃에서 40초(담금단계), 72℃에서 2분(중합단계)의 조건으로 PCR을 40회 실시하였다. 상기에서 얻은 PCR 산물을 5% 아가로즈 겔에서 분리하여 약 740 염기쌍의 DNA가 증폭되었음을 확인하였고, 동일 조건의 아가로즈 겔로부터 분리정제하였다(이하, 이 DNA 단편을 '단편 UREA'라 함).1 μl of the H. pylori DNA obtained in step 1 was used as a template and 2 μg of the primer PUREAT2 and 2 μg of the primer PUREABAML were added to the reaction tube. Then, 10 μl of 10 × polymerization buffer (500 mM KCl, 100 mM Tris-HCl, pH 9.0, Triton X-100), 10 μl of 2 mM dNTPs (2 mM dGTP, 2 mM dCTP, 2 mM dATP and 2 mM dTTP, respectively), 2.5 units of Taq polymerase and distilled water were added to the reaction mixture to adjust the total volume to 100 μl, (Denaturation step), 40 seconds at 55 占 폚 (immersion step), and 2 minutes at 72 占 폚 (polymerization step). The PCR product thus obtained was separated from 5% agarose gel to confirm that about 740 base pairs of DNA was amplified and purified from agarose gel under the same conditions (hereinafter, this DNA fragment was referred to as a 'fragment UREA').

[실시예 2][Example 2]

[유비퀴틴 유전자의 합성][Synthesis of ubiquitin gene]

[단계 1][Step 1]

기존에 알려진 유비퀴틴 유전자의 염기서열 정보(Ozkaynak, et al., EMBO, J., 6, 1429-1439(1987))로부터 다음과 같은 시발체를 합성하였다 :The following primers were synthesized from the known sequence information of ubiquitin genes (Ozkaynak, et al., EMBO, J., 6, 1429-1439 (1987)):

시발체 UBI1 : 5'-CCCCATATGCATCATCACCATCATCACCATCATCAAATTTTCGTCAAAACTCTAACAGGGAAGACTATAACCCTAGAGGTTGAATCTTCCGACAcTATTGACAACGTCAA-3'(이는 5'-말단에 제한효소 NdeI 인지부위(밑줄)를 갖고, 시작코돈인 메티오닌 코돈 다음에 8개의 히스티딘 코돈을 갖도록 고안되었고)The primer UBI1: 5'-CCCCATATGCATCATCACCATCATCACCATCATCAAATTTTCGTCAAAACTCTAACAGGGAAGACTATAACCCTAGAGGTTGAATCTTCCGACACTATTGACAACGTCAA-3 '(which has a restriction enzyme NdeI recognition site (underlined) at the 5'-end and is designed to have 8 histidine codons after the methionine codon as the start codon)

시발체 UBI2 : 5'-TAGTTGCTTACCAGCAAAAATCAATCTCTGCTGATCCGGAGGGATACCTTCTTTATCTTTGAATTTTACTTTTGACGTTGTCAATAGTCTC-3'(이는 5'-말단의 20개 핵산이 시발체 UBI3의 3'-말단의 핵산과 동일한 염기서열을 갖도록 고안되었고)The primer UBI2: 5'-TAGTTGCTTACCAGCAAAAATCAATCTCTGCTGATCCGGAGGGATACCTTCTTTATCTTTGAATTTTACTTTTGACGTTGTCAATAGTCTC-3 '(which means that 20 nucleotides at the 5'-end are designed to have the same base sequence as the 3'-terminal nucleic acid of the primer UBI3)

시발체 UBI3 : 5'-ACCACCGCGGAGTCTCAACACCAAGTGAAGAGTAGATTCCTTTTGGATGTTGTAGTCAGACAAGGTTCTACCATCTTCTAGTTGCTTACCAGCAAAAA-3'(이는 5'-말단에 SacII 인지부위(밑줄)를 갖고, 3'-말단의 20개 핵산은 시발체 UBI2의 5'-말단의 핵산과 동일한 염기서열을 갖도록 고안되었다).The primer UBI3: 5'-ACCACCGCGGAGTCTCAACACCAAGTGAAGAGTAGATTCCTTTTGGATGTTGTAGTCAGACAAGGTTCTACCATCTTCTAGTTGCTTACCAGCAAAAA-3 '(which has a SacII recognition site at the 5'-end (underlined) and 20 nucleotides at the 3'- end have the same base sequence as the 5'- terminal nucleic acid of the primer UBI2 Lt; / RTI >

[단계 2][Step 2]

반응 튜브에 단계 1에서 합성한 3개의 올리고뉴클레오티드, 즉, 시발체 UBI1 2㎍, 시발체 UBI2 0.02㎍ 및 시발체 UBI3 2㎍을 넣은 다음, 10㎕의 10배 중합 완충용액(500mM KCl, 100mM Tris-HCl, pH 9.0, 1.0% 트리톤 X-100, 2.5mM MgCl2), 10㎕의 2mM dNTP, 2.5 단위체의 Taq 중합효소와 증류수를 가하여 총부피가 100㎕가 되도록 하여 실시예 1의 단계 3과 동일한 방법으로 PCR 반응을 실시하였다. 상기에서 얻은 PCR 산물을 5% 폴리아크릴아미드 겔에서 분리하여 약 270염기쌍의 DNA를 추출정제한 후(이하, 이 DNA 단편을 '단편 His-Ub'라 칭한다), 20㎕의 TE 용액에 용존시켰다.To the reaction tube was added 3 μl of the oligonucleotide synthesized in step 1, namely 2 μg of the primer UBI1, 0.02 μg of the primer UBI2 and 2 μg of the primer UBI3, and then 10 μl of 10 times polymerization buffer (500 mM KCl, 100 mM Tris- pH 9.0, 1.0% Triton X-100, 2.5 mM MgCl 2 ), 10 μl of 2 mM dNTP, 2.5 units of Taq polymerase and distilled water to give a total volume of 100 μl, PCR reaction was carried out. The PCR product thus obtained was separated from 5% polyacrylamide gel to extract and purify about 270 base pairs of DNA (hereinafter referred to as 'fragment His-Ub') and dissolved in 20 μl of TE solution .

[실시예 3][Example 3]

[UREA 유전자 발현벡터의 제조][Production of UREA gene expression vector]

Novagen 사에서 구입한 플라스미드 pET11C(Novagen Inc., Madison WI 53711, U.S.A.) 2㎍을 제한효소 NdeI과 BamHI으로 NEB 완충용액 3(10mM Tris-HCl, 10mM MgCl2, 100mM NaCl, 1mM dTT, pH 7.0)의 조건하에서 완전절단한 뒤 이를 0.7% 아가로즈 겔로 분리하여 약 5.6kb 단편을 분리정제하였다(이하, 이 단편을 '단편 PNB'라 칭함).2 μg of the plasmid pET11C (Novagen Inc., Madison WI 53711, USA) purchased from Novagen was diluted with NEB buffer 3 (10 mM Tris-HCl, 10 mM MgCl 2 , 100 mM NaCl, 1 mM dTT, pH 7.0) with restriction enzymes NdeI and BamHI, , And the fragment was separated into 0.7% agarose gel to isolate and purify a 5.6 kb fragment (hereinafter, this fragment was referred to as 'short PNB').

한편, 실시예 1에서 얻은 단편 UREA 유전자의 5'-말단과 실시예 2에서 얻은 단편 His-Ub의 3'-말단은 25개 염기가 서로 중복됨으로써 이들을 다음과 같이 PCR 반응으로 결합시켰다. 반응 튜브에 단편 UREA 10ng, 단편 His-Ub 10ng, 시발체 UBI1 2㎍ 및 시발체 PUREABAML 2㎍을 넣은 다음 10㎕의 10배 중합 완충용액, 10㎕의 2mM dNTP, 2.5 단위체 Taq 중합효소와 증류수를 가하여 총부피가 100㎕가 되도록 하여 실시예 1의 단계 3과 동일한 방법으로 PCR 반응을 실시하였다. 상기에서 얻은 PCR 산물을 제한효소 NdeI 및 BamHI으로 NEB 완충용액 3의 조건하에서 완전절단한 후 이들을 페놀/클로로포름으로 추출하여 20㎕의 TE 용액에 용존시켰다. 이를 '단편 His-UB-UREA-N/B'라 한다. 접합반응 튜브에 상기에서 얻은 100ng의 단편 His-UB-UREA-N/B와 100ng의 단편 PNB, 2㎕의 10배 접합 반응용액, 10 단위체의 T4 리가제와 증류수를 가하여 총부피가 20㎕가 되도록 하여 16℃에서 12시간 동안 반응시켰다. 반응이 끝난 뒤 대장균 HB101(ATCC 33694) 컴피턴트 세포에 형질전환시켜 단편 His-UB-UREA를 포함하는 발현벡터 pETHUB-UREA를 얻었다.On the other hand, 25 bases of the 5'-end of the fragment UREA gene obtained in Example 1 and the 3'-end of the fragment His-Ub obtained in Example 2 were overlapped with each other so that they were combined by PCR reaction as follows. 10 ng of fragment UREA, 10 ng of fragment UBI1, 2 μg of primer UBI1 and 2 μg of primer PUREABAML were added to the reaction tube and then 10 μl of 10-fold polymerization buffer, 10 μl of 2 mM dNTP, 2.5 μl of Taq polymerase and distilled water PCR was carried out in the same manner as in step 3 of Example 1 so as to have a volume of 100 μl. The PCR products thus obtained were completely digested with restriction enzymes NdeI and BamHI under the conditions of NEB buffer solution 3, and then they were extracted with phenol / chloroform and dissolved in 20 μl of TE solution. This is referred to as the 'fragment His-UB-UREA-N / B'. Ub-UREA-N / B, 100 ng of fragment PNB, 2 μl of 10-fold conjugation reaction solution, 10 units of T4 ligase and distilled water were added to the junction reaction tube to obtain a total volume of 20 μl And allowed to react at 16 占 폚 for 12 hours. After the reaction, E. coli HB101 (ATCC 33694) competent cells were transformed to obtain an expression vector pETHUB-UREA containing the fragment His-UB-UREA.

제1도는 우레아제 A(Urease A) 유전자를 대장균 발현벡터 pETHUB-UREA로 클로닝하는 과정을 도시한 것이다.FIG. 1 shows the process of cloning Urease A gene into Escherichia coli expression vector pETHUB-UREA.

상기 형질전환된 대장균(E. coli) BL21(DE3) pLYS.S(pETHUB-UREA)를 1996년 1월 9일자로 한국과학기술연구원 부설 생명공학 연구소 유전자은행에 기탁번호 제KCTC 0224BP호로서 기탁하였다.The transformed E. coli BL21 (DE3) pLYS.S (pETHUB-UREA) was deposited on Jan. 9, 1996 as a deposit number KCTC 0224BP at the Institute of Genetics, Institute of Bioscience and Biotechnology, Korea Research Institute of Science and Technology .

[실시예 4][Example 4]

[대장균으로부터 UREA 유전자의 발현유도][Induction of expression of UREA gene from E. coli]

상기 실시예 3에서 얻은 발현벡터 pETHUB-UREA를 발현숙주인 대장균 BL21/(DE3)/pLys(Novagen Inc., Madison W I53711, U.S.A.)에 형질전환시켰다.The expression vector pETHUB-UREA obtained in Example 3 was transformed into the expression host E. coli BL21 / (DE3) / pLys (Novagen Inc., Madison WI 57111, U.S.A.).

형질전환된 대장균 균주를 50㎍/㎖의 앰피실린과 34㎍/㎖의 클로람페니콜이 함유된 루리아(Luria) 배지(6% 박토트립톤, 0.5% 효모 추출물, 1% 염화나트륨)에서 12시간 동안 진탕배양한 다음, 이중 1㎖을 100㎖의 앰피실린과 클로람페니콜을 함유하는 루리아 배지로 옮겨 37℃에서 약 4시간동안 진탕배양항져 박테리아의 흡광도가 650nm에서 약 0.3정도가 될 때 IPTG(Isopropyl-β-D-thiogalactopyranoside)를 최종농도가 0.5mM이 되게 첨가하였다. IPTG를 첨가하기 직전, 그리고 첨가한지 1, 5 및 7시간 후에 각각 10㎖씩을 취하고 이를 10,000×G에서 15분간 원심분리하여 각각 세포 침전물을 수거하였다. 수거한 세포 침전물을 램리 등의 방법(Laemmli et al., Nature 227, 680(1970))에 따라 10% SDS-폴리아크릴아미드 겔 전기영동시킨 후, 쿠마시블루(Coomassie Brilliant blue R250)로 단백질을 염색하였다.The transformed Escherichia coli strain was shake-cultured for 12 hours in Luria medium (6% pectin, 0.5% yeast extract, 1% sodium chloride) containing 50 μg / ml of ampicillin and 34 μg / ml of chloramphenicol Then, 1 ml of the suspension was transferred to a ruria medium containing 100 ml of ampicillin and chloramphenicol, and shaken at 37 ° C for about 4 hours. When the absorbance of the agar bacteria was about 0.3 at 650 nm, IPTG (Isopropyl-β-D -thiogalactopyranoside) was added to a final concentration of 0.5 mM. Immediately prior to addition of IPTG and at 1, 5 and 7 hours after addition, 10 ml of each was taken and centrifuged at 10,000 x G for 15 minutes to collect cell precipitates. The collected cell precipitate was subjected to 10% SDS-polyacrylamide gel electrophoresis according to the method of Laemmli et al., Nature 227, 680 (1970), and then the protein was coagulated with Coomassie Brilliant blue R250 Lt; / RTI >

이어서, 겔상에서 분리된 단백질을 가지고 유비퀴틴 단일항체를 이용하여 웨스턴 블롯팅을 실시한다. 먼저, 겔상에서 분리된 단백질을 토빈의 방법(Towbin, et al., Proc. Natl. Acad. Sci. U.S.A. 76, 4750(1979))에 따라 니트로 셀룰로즈 막(Bio-Rad Lab., Pore size 0.22㎛, CA, U.S.A.)으로 전달시키고 이 막을 0.5% 트윈 20이 함유된 PBS(10mM 인산, pH 7.0, 0.15M 염화나트륨)에 넣고 상온에서 2시간 동안 약하게 흔들면서 파쇄시켰다. 이어서 0.5% 젤라틴과 0.05% 트윈 20을 함유한 PBS에 유비퀴틴 단일항체를 1000배 희석하여 첨가하고 상온에서 1시간동안 약하게 흔들면서 반응시켰다. 계속해서 서양 고추냉이 퍼옥시다제(horseradish peroxidase)로 표지된 항 사람 면역글로블린 G(Bio-Rad Lab, anti-human IgG-HRP, 0.01㎎, CA U.S.A.)를 0.2% 트윈 20이 함유된 PBS로 1:500배 희석시켜 첨가한 다음 상온에서 1시간 동안 흔들면서 반응시키고, 0.2% 트윈 20을 함유한 PBS로 5분씩 4회 세척한 다음 50mM 트리스 완충용액(pH 7.0)으로 2회 세척하였다. 이 막을 400㎍/㎖의 4-클로로-1-나프톨과 0.03% 과산화수소수가 함유된 50mM 트리스 완충용액을 가하여 발색시켰다.Western blotting is then performed using the ubiquitin monoclonal antibody with the protein separated on the gel. First, the proteins separated on the gel were loaded on a nitrocellulose membrane (Bio-Rad Lab., Pore size 0.22 탆) according to Tobin's method (Towbin, et al., Proc. Natl. Acad. Sci. USA 76, 4750 , CA, USA) and the membrane was placed in PBS (10 mM phosphate, pH 7.0, 0.15 M sodium chloride) containing 0.5% Tween 20 and shaken for 2 hours at room temperature while shaking gently. The ubiquitin monoclonal antibody was then diluted 1000 fold with PBS containing 0.5% gelatin and 0.05% Tween 20 and reacted with shaking at room temperature for 1 hour. Subsequently, an anti-human immunoglobulin G (Bio-Rad Lab, anti-human IgG-HRP, 0.01 mg, CA USA) labeled with horseradish peroxidase was dissolved in PBS containing 0.2% Tween 20 : 500-fold dilution, followed by shaking at room temperature for 1 hour with shaking, washing 4 times with PBS containing 0.2% Tween 20 for 5 minutes each, followed by washing twice with 50 mM Tris buffer solution (pH 7.0). This membrane was developed by adding 400 μg / ml of 4-chloro-1-naphthol and 50 mM Tris buffer solution containing 0.03% aqueous hydrogen peroxide.

제2도는 발현벡터 pETHUB-UREA로 형질전환된 대장균을 배양하여 얻은 세포 침전물을 변성 폴리아크릴아미드 겔 전기영동한 결과를 나타낸 것이다. 여기에서 제 m 열은 표준단백질 분자량을 표시하는 것이고, 제1열은 IPTG를 가하기 직전의 세포 추출물을 나타낸 것이고, 제2열은 IPTG를 가한 후 배양하여 수득한 세포 추출물을 나타낸 것이고, 제3열은 정제된 His-Ub-Ure A이다.FIG. 2 shows the results of denaturing polyacrylamide gel electrophoresis of the cell precipitate obtained by culturing Escherichia coli transformed with the expression vector pETHUB-UREA. Here, the m column shows the standard protein molecular weight, the first column shows the cell extract immediately before adding IPTG, the second column shows the cell extract obtained by adding IPTG, and the third column Is purified His-Ub-Ure A.

제3도는 발현벡터 pETHUB-UREA로 형질전환된 대장균을 배양하여 얻은 세포 침전물을 변성 폴리아크릴아미드 겔 전기영동한 후 유비퀴틴 단일 항체를 이용하여 웨스턴 블롯팅(western blotting)한 결과를 나타낸 것이다. 여기에서 제 m 열은 표준단백질 분자량을 표시하는 것이고, 제1열은 대조군으로 tPA가 발현된 대장균 배양액의 경우를 나타낸 것이고, 제2열은 His-Ub-Ure A 단백질이 발현된 대장균 배양액의 경우를 나타낸 것이다.FIG. 3 shows the results of western blotting of the cell precipitate obtained by culturing Escherichia coli transformed with the expression vector pETHUB-UREA by denaturing polyacrylamide gel electrophoresis and then using ubiquitin monoclonal antibody. Here, the m column represents the standard protein molecular weight, the first column shows the case of the culture solution of E. coli expressing tPA as a control group, the second column shows the case of the culture solution of Escherichia coli expressing the His-Ub-Ure A protein .

[실시예 5][Example 5]

[His-Ub-Ure A의 정제][Purification of His-Ub-Ure A]

[단계 1] 대장균 세포의 배양과정[Step 1] Culture of Escherichia coli cells

재조합 His-Ub-Ure A 융합유전자를 포함하는 발현벡터 pETHUB-UREA로 형질전환된 재조합 균주(E. coli BL21(DE3) pLYS.S)를 앰피실린이 함유된 루리아(Luria) 배지에서 12시간 동안 진탕배양한 후, 이중 5㎖를 1ℓ의 M9 배양액으로 옮겨 37℃에서 약 3 내지 4시간 동안 진탕배양하였다. 박테리아의 성장속도가 650nm에서 흡광도 0.3 정도로 될 때 IPTG를 최종농도 0.5mM 이 되게 첨가하여 재조합 His-Ub-Ure A의 발현을 유도하였다. IPTG를 첨가한지 약 5시간 후에 세포 배양을 끝내고 원심분리기(Beckman, JB6, Rotor : JS4. 2, 미국)를 이용하여 3,500rpm에서 30분간 원심분리하여 대장균 세포 침전물을 수집하였다.The recombinant strain (E. coli BL21 (DE3) pLYS.S) transformed with the expression vector pETHUB-UREA containing the recombinant His-Ub-UreA fusion gene was cultivated in Luria medium containing ampicillin for 12 hours After shaking culture, 5 ml of the suspension was transferred to 1 L of M9 culture medium and cultured with shaking at 37 DEG C for about 3 to 4 hours. When the bacterial growth rate was 650 nm and the absorbance was about 0.3, IPTG was added to a final concentration of 0.5 mM to induce the expression of recombinant His-Ub-Ure A. Approximately 5 hours after the addition of IPTG, cell culture was terminated and E. coli cell suspensions were collected by centrifugation at 3,500 rpm for 30 minutes using a centrifuge (Beckman, JB6, Rotor: JS4.2, USA).

[단계 2] 세포 용해 및 His-Ub-Ure A 융합단백질의 정제과정[Step 2] Cell lysis and purification of His-Ub-Ure A fusion protein

His-Ub-Ure A 융합단백질이 발현된 대장균 세포 1.5g에 6M 구아니딘 염, 50mM 트리스 완충용액(pH 8.0) 10㎖를 넣은 다음, 초음파분쇄기(HEAT SYSTEMAS-ULTRASONICS, INC., W225, 미국)를 이용하여 50%의 출력으로 약 1분 동안 초음파를 처리하여 세포를 풀어준 후 30분 동안 흔들어 주고, 다시 원심분리기로 12,000rpm에서 20분간 원심분리하였다. 침전물은 버리고 상등액을 취하여 상기 완충용액으로 미리 평형시킨 히스티딘 결합수지(Novagen사, 미국) 친화성 칼럼(1.8㎖bed)에 통과시켜 His-Ub-Ure A를 칼럼에 결합시킨 후, 유리된 상태로 남아있는 불순물을 상기 평형 완충용액으로 제거하였다. 우레아 완충용액(8M 우레아, 50mM 트리스, 0.2M NaCl(pH 8.0))으로 칼럼을 세척하여 카오트로픽 활성이 낮은 상태로 바꾸고, 우레아 완충용액에 15㎖ 이미다졸이 포함된 완충용액으로 오염 단백질을 완전히 제거하였다. 이미다졸의 농도가 0.4M 함유된 우레아 완충용액으로 칼럼에 결합된 His-Ub-Ure A 융합단백질을 용출하여 소디움 도데실 설페이트(SDS)-폴리아크릴아미드 겔 전기영동으로 확인한 후, His-Ub-Ure A 융합단백질 부분만을 모음으로써 고순도의 His-Ub-Ure A 융합단백질을 얻을 수 있었다.(HEAT SYSTEMAS-ULTRASONICS, INC., W225, USA) was added to 1.5 g of Escherichia coli cells expressing the His-Ub-UreA fusion protein and 10 mL of 6 M guanidine salt and 50 mM Tris buffer solution The cells were treated with ultrasound at 50% power for about 1 minute, shaken for 30 minutes, and then centrifuged at 12,000 rpm for 20 minutes using a centrifuge. The precipitate was discarded and the supernatant was taken and passed through a histidine binding resin (Novagen, USA) affinity column (1.8 ml bed) pre-equilibrated with the buffer solution to bind the His-Ub-Ure A to the column, The remaining impurities were removed with the equilibrium buffer solution. The column was washed with urea buffer (8 M urea, 50 mM Tris, 0.2 M NaCl (pH 8.0)) to change the state of the chaotropic activity to a low state, and the contaminating protein was completely washed with a buffer solution containing 15 ml of imidazole in the urea buffer solution Respectively. The His-Ub-Ure A fusion protein bound to the column was eluted with urea buffer solution containing 0.4 M imidazole concentration and confirmed by sodium dodecyl sulfate (SDS) -Polyacrylamide gel electrophoresis, and His-Ub- Ure-A fusion protein was obtained by collecting only the Urea fusion protein portion.

Claims (6)

헬리코박터 필로리(Helicobacter pylori : H. pylori)의 우레아제 A 유전자에 히스티딘과 유비퀴틴 유전자가 연결된 융합유전자.A fusion gene in which histidine and ubiquitin genes are linked to the urease A gene of Helicobacter pylori (H. pylori). 제1항의 융합유전자를 포함하는 히스티딘-유비퀴틴-우레아제 A(His-Ub-Ure A) 융합단백질 발현벡터.A histidine-ubiquitin-urease A (His-Ub-Ure A) fusion protein expression vector comprising the fusion gene of claim 1. 제2항에 있어서, 발현벡터 pETHUB-UREA.3. The method according to claim 2, wherein the expression vector pETHUB-UREA. 제2항의 발현벡터로 형질전환된 대장균.An E. coli transformed with the expression vector of claim 2. 제4항에 있어서, 대장균 BL21(DE3) pLYS.S(pET HUB UREA).The method according to claim 4, wherein Escherichia coli BL21 (DE3) pLYS.S (pET HUB UREA). 제4항의 대장균을 융합단백질의 발현에 적합한 조건에서 배양하고, 융합단백질이 발현된 재조합 대장균 세포를 구아니딘 염이 포함된 완충용액에서 분쇄하고, 원심분리한 상등액을 히스티딘 결합수지 친화성 크로마토그래피하는 단계를 포함하는 His-Ub-Ure A 융합단백질의 제조방법.Culturing the Escherichia coli of claim 4 under conditions suitable for the expression of the fusion protein, pulverizing the recombinant E. coli cells expressing the fusion protein in a buffer solution containing the guanidine salt, and subjecting the supernatant obtained by centrifugation to histidine binding affinity chromatography Lt; RTI ID = 0.0 > His-Ub-Ure A < / RTI > fusion protein.
KR1019960020904A 1996-06-12 1996-06-12 Production method of urease agent of Helicobacter pylori from recombinant E. coli KR0177312B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1019960020904A KR0177312B1 (en) 1996-06-12 1996-06-12 Production method of urease agent of Helicobacter pylori from recombinant E. coli

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1019960020904A KR0177312B1 (en) 1996-06-12 1996-06-12 Production method of urease agent of Helicobacter pylori from recombinant E. coli

Publications (2)

Publication Number Publication Date
KR980002257A KR980002257A (en) 1998-03-30
KR0177312B1 true KR0177312B1 (en) 1999-04-01

Family

ID=19461514

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1019960020904A KR0177312B1 (en) 1996-06-12 1996-06-12 Production method of urease agent of Helicobacter pylori from recombinant E. coli

Country Status (1)

Country Link
KR (1) KR0177312B1 (en)

Also Published As

Publication number Publication date
KR980002257A (en) 1998-03-30

Similar Documents

Publication Publication Date Title
ES2214479T3 (en) NUCLEOTIDE SEQUENCES CODING FOR A PROTEIN WITH UREASIC ACTIVITY.
Gilbert et al. Protein Hpn: cloning and characterization of a histidine-rich metal-binding polypeptide in Helicobacter pylori and Helicobacter mustelae
EP0232229B1 (en) Cloning and expression of Bordetella pertussis toxin-encoding DNA
US7038012B1 (en) Enrichment process for H. pylori neutrophil activating protein (NAP) utilizing metal chelate chromatography
JP3955317B2 (en) Immune composition against Helicobacter infection, polypeptide used in the composition, and nucleic acid sequence encoding the polypeptide
JPH09500538A (en) High level expression, purification and regeneration of Neisseria meningitidis outer membrane group B porin protein
CN113637056B (en) Kit for identifying brucella bovis and other brucella bovis
ES2302329T3 (en) NUCLEIC SEQUENCES FROM THE GENOMA OF SALMONELLA TYPHI AND USES OF THE SAME, ESPECIALLY FOR THE IN VITRO DIAGNOSIS OF THE PRESENCE OF BACTERIA OF THE GENRE SALMONELLA IN FOOD PRODUCTS.
Pilehchian et al. Fusion of Clostridium perfringens type D and B epsilon and beta toxin genes and it’s cloning in E. coli
Foley et al. Iss from a virulent avian Escherichia coli
JP2887238B2 (en) Polypeptide
Mallavia et al. The genetics of Coxiella burnetii: etiologic agent of Q fever and chronic endocarditis
KR0177313B1 (en) Method for producing urease B of Helicobacter pylori from recombinant E. coli
KR0177312B1 (en) Production method of urease agent of Helicobacter pylori from recombinant E. coli
WO1998017804A2 (en) A HELICOBACTER ANTIGEN (η-GLUTAMYLTRANSFERASE) AND SEQUENCES ENCODING THE SAME
KR0177304B1 (en) Method for producing species specific protein antigen of Helicobacter pylori from recombinant E. coli
KR100210508B1 (en) Process for the preparation of vacuolating cytotoxin of helicobacter pyroli in e.coli
Agüero et al. Cloning, expression and characterization of the 36 KDal Salmonella typhi porin gene in Escherichia coli
CN110437328B (en) Porcine interferon alpha mutant YNS and preparation method and application thereof
Bakhteyari et al. Cloning and expression of Com1 and OmpH genes of Coxiella burnetii in Periplasmic Compartment of Escherichia coli with the Aim of recombinant subunit vaccine production
CN101948865B (en) Dual-promoter inducible secretable shuttle plasmid and construction method thereof
US20070141698A1 (en) Microbial protein expression system utilizing plant viral coat protein
US5837502A (en) Helicobacter pylori haemagglutinin protease protein, nucleic acid encoding therefor and antibodies specific thereto
Nguyen et al. Environmentally Responsible Bioengineering for Spore Surface Expression of Helicobacter pylori Antigen.
KR0140264B1 (en) Method for the production of the recombinant ub-a545 as a specific antigen of helicobacter pylori

Legal Events

Date Code Title Description
A201 Request for examination
E701 Decision to grant or registration of patent right
GRNT Written decision to grant
FPAY Annual fee payment

Payment date: 20060915

Year of fee payment: 9

LAPS Lapse due to unpaid annual fee