KR0177304B1 - Method for producing species specific protein antigen of Helicobacter pylori from recombinant E. coli - Google Patents

Abstract

The present invention relates to a method for producing a Species-Specific Protein Antigen (SSA), which is an antigenic determinant site protein of Helicobacter pylori (H. pylori) using E. coli, in the form of a fusion protein, Ub-SSA fusion protein expression vector containing a fusion gene in which histidine and ubiquitin gene are linked to the SSA gene of Helicobacter pylori is cultured under conditions suitable for the expression of the fusion protein, and the recombinant protein expressing the fusion protein Ub-SSA fusion protein of the present invention comprising a step of pulverizing E. coli cells in a buffer solution containing a guanidine salt and subjecting the supernatant obtained by centrifugation to histidine-binding affinity affinity chromatography, the H. pylori infection Ub-SSA fusion protein, which can be useful for diagnosis and vaccine development, can be mass-produced at a high yield .

Description

Method for producing species specific protein antigen of Helicobacter pylori from recombinant E. coli

FIG. 1 shows the process of cloning a species specific protein antigen (SSA) gene into the E. coli expression vector pETHUB-SSA of the present invention.

FIG. 2 shows the result of western blotting of a cell suspension obtained by culturing Escherichia coli transformed with the expression vector pETHUB-SSA of the present invention by denaturing polyacrylamide gel electrophoresis followed by ubiquitin single antibody .

FIG. 3 is a graph showing the results of denaturing polyacrylamide gel electrophoresis of cell precipitates obtained by culturing Escherichia coli transformed with the expression vector pETHUB-SSA of the present invention, before and after induction of expression by IPTG.

The present invention relates to a method for producing Species-Specific Protein Antigen (SSA), which is an antigenic determinant site protein of Helicobacter pylori (hereinafter, referred to as H. pylori) using E. coli Ubiquitin (hereinafter referred to as "Ub"), which is an antigen of Helicobacter pylori, which is reported as a cause of stomach and duodenal ulcers, and more specifically, -SSA) to be useful for the diagnosis of H. pylori infection and vaccine development.

H. pylori is a microaerobic gram-negative spiral bacterium isolated first by Warren and Marshall in patients with duodenal ulcers (Warren and Marshall, Lancet, 1, 1273-1275 (1983)), . H. pylori is a parasitic microorganism that is found in the stomach mucosa of patients with various stomach and duodenal diseases once it starts to live. It is a fundamental cause of gastritis and stomach and duodenal ulcer due to recent reports (Parsonnet, et al., New Eng. J. Med., ≪ RTI ID = 0.0 > 325, 1127-1131 (1991); The Urogust Study Group, Lancet, 341, 1359-1362 (1993)).

In 1994, the consensus conference held by the National Institute of Health (USA) defined stomach and duodenal ulcer as a disease caused by H.pylori and eradication of H.pylori by using antibiotics instead of conventional stomach regulator therapy (NIH, NIH concensus development conference, Helicobacter pylori in peptic ulcer disease (1994)).

The H. pylori colonization rate was measured by gastroscopy, radioactive isotope labeled urea breath test, and serological tests on normal subjects without gastrointestinal symptoms. As a result, 10 to 20% (Berkowicz J and Lee A, Lancet 2, 680-681 (1987)), Goodwin CS, et al., J , Jones DM, et al., J. Clin. Clin. Microbiol., 24, 716-720 (1986); Infect. Dis. 155, 488-494 (1987); von Wulffen H., et al. Pathol., 37, 1002-1006 (1984)). On the other hand, in low-income countries and developing countries, higher mortality rates have been reported in younger age groups (Graham DY, et al., Scand. J. Gastroenterol., 23, 9-13 (1988), Meraud F., et al., J. Clin ), 27, 1870-1873 (1989)), and in Korea, about 80-90% of the 20 to 30 generations were infected with H. pylori infection in the backward countries (Jung Hyun Chae et al. , 20, 47-56 (1988)); Baek Seung-Cheol et al., Journal of Microbiology, 25 (6), 455-462 (1990)).

SSA, one of the antigens of H. pylori, was found in H. pylori and its molecular weight was 26 kDa. SSA was found to be a specific antigens of H. pylori, as the polyclonal antibodies raised in rabbits using H. pylori purified SSA reacted only in H.pylori among the various species of Helicobacter. Therefore, detection methods using SSA as an antigen include various detection methods, for example, a method of biopsy gastrectomy after endoscopy, a method of histologically identifying the presence of bacteria, a method of detecting the activity of urease enzyme in tissue after biopsy, It may be more specific and useful than methods such as culturing bacteria and measuring the activity of urease enzyme indirectly by taking urea labeled with radioactive isotope.

Purification of SSA involves culturing H. pylori, disrupting the cells, taking the supernatant and performing a series of procedures such as ammonium sulfate fractionation, gel filtration column chromatography, reversed phase chromatography and anion exchange chromatography ( SSA purified by the above process is a protein having a hydrophobicity of 39.2% and a pH of 5.9 to 6.0, and from this, There are no reports of SSA expression using E. coli as a genetic engineering method, but there has been no report on the method of purifying SSA. Expression of SSA from H. pylori causes various problems. It is difficult to cultivate large amount of culture because it is difficult to cultivate with aerobic bacteria and it is also necessary to be careful in handling because there is a possibility of infection.

The inventors of the present invention have been studying a method for efficiently mass-producing and purifying SSA protein while improving the above-mentioned problems. The inventors of the present invention have found that when the His-Ub-SSA fusion protein is linked to the SSA gene by histidine and ubiquitin gene, Method, and succeeded in purifying it, thereby completing the present invention.

It is an object of the present invention to provide a gene encoding a fusion protein of H. pylori SSA that can be expressed from Escherichia coli, an expression vector containing the fusion protein, and a transformant transformed with the expression vector.

Another object of the present invention is to provide a method for producing SSA of H. pylori in the form of a fusion protein.

According to the above object, the present invention provides a fusion gene in which a histidine and a ubiquitin gene are linked to a Helicobacter pylori (H. pylori) Species-Specific Protein Antigen (SSA) gene, histidine - Ubiquitin-specific protein antigen (His-Ub-SSA) fusion protein expression vector and Escherichia coli transformed with said expression vector.

According to another aspect of the present invention, there is provided a method for producing a fusion protein, comprising culturing E. coli transformed with an expression vector comprising the histidine-ubiquitin-specific protein antigen (His-Ub-SSA) fusion gene under conditions suitable for expression of the fusion protein, Ub-SSA fusion protein comprising a step of pulverizing recycled E. coli cells expressing the protein in a buffer solution containing a guanidine salt, and subjecting the supernatant obtained by centrifuging to histidine-binding affinity affinity chromatography .

Hereinafter, the present invention will be described in more detail.

The ubiquitin used in the fusion protein of the present invention is a protein having a molecular weight of 8,500 daltons consisting of 76 amino acids and is present in all eukaryotic cells but not in prokaryotic cells such as E. coli. When the ubiquitin is expressed in the form of a fusion protein by linking the protein to the ubiquitin, the ubiquitin increases the expression of the protein and protects the protein from the protease (Sabin E. Al et al., Biotechnology, 7, 705-709 (1989)). Ubiquitin can also be used for purification by confirming its expression by using an anti-ubiquitin antibody.

According to the invention

To prepare SSA as a fusion protein with histidine and ubiquitin, a nucleic acid (DNA) was first extracted from H. pylori (ATCC 43504) and the nucleotide sequence information of SSA (O'toole, PW, et al., J. Bacteriol. , 173, 505-513 (1991)), a primer for polymerase chain reaction (PCR) corresponding to the 5'-end and the 3'-end of SSA gene encoding SSA protein is synthesized. These primers include a nucleotide sequence that overlaps with the 3'-end of the ubiquitin gene synthesized in the present invention at the 5'-end, and a stop codon and a restriction enzyme recognizing site are inserted into the corresponding primer, The protein is synthesized from the start codon of ubiquitin to which 8 histidine is added, thereby completing the protein synthesis at the artificially inserted end codon, and at the same time, cloning into an E. coli expression vector is facilitated.

By using the primer and using H. pylori DNA as a template, PCR is performed to amplify the gene of the desired site, and the amplified gene is bound to artificially synthesized histidine and ubiquitin gene (His-Ub-SSA). The His-Ub-SSA fusion protein expression vector is prepared by mass-amplifying the His-Ub-SSA gene by PCR, digesting the amplified gene with a restriction enzyme, and inserting the obtained gene fragment into an appropriate E. coli expression vector. E. coli is transformed with the above recombinant vector and then cultured under conditions suitable for expression of the present gene. UB-SSA expression can be confirmed by Western blotting analysis using ubiquitin monoclonal antibody after polyacrylamide gel electrophoresis.

Escherichia coli transformed with an expression vector containing a recombinant His-Ub-SSA gene was shake-cultured in Luria medium containing ampicillin, transferred to M9 culture medium and shake-cultured, and the growth rate of the bacteria was adjusted to 650 nm When the absorbance is about 0.3, IPTG (isopropyl-β-D-thiogalactopyranoside) is added to induce the expression of His-Ub-SSA. The culture solution was centrifuged to precipitate E. coli cells. To prevent hydrolytic activity of proteins, guanidine salt, a chaotropic reagent, was added to the precipitated cells, and the cells were disrupted with an ultrasonic mill, followed by shaking and centrifugation . The supernatant is taken out and bound to a histidine-binding resin affinity column previously equilibrated with a 50 mM Tris buffer solution, and the remaining impurities remaining in a free state are washed away with the buffer solution. Subsequently, the column is washed with a buffer solution containing urea to convert it to a buffer solution having a low chaotropic activity, and then washed with a buffer solution containing 15 mM imidazole in the same buffer solution to remove the bound contaminating protein. The His-Ub-SSA fusion protein bound to the column was sufficiently eluted with buffer solution containing 0.4 M imidazole in the same buffer solution, and each portion was subjected to SDS-polyacrylamide gel electrophoresis to obtain the His-Ub-SSA fusion protein portion Ub-SSA fusion protein with high purity can be obtained.

Hereinafter, the present invention will be described in more detail based on the following examples. However, the following examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

[Example 1]

[Amplification of SSA gene from H. pylori DNA]

[Step 1]

Total DNA was extracted from H. pylori (ATCC 43504) according to the method of Schleif RF, et al., Practical Methods in Molecular Biology, p98 Springer, New York (1981). In other words, H. pylori strain was inoculated into Brucella broth (Difco Cat No. 0495-01-1) supplemented with 5% fetal bovine serum, and then anaerobic jar (Difco Cat No. 1951- 30-1) in the presence of 5% O ₂ and 10% CO ₂ at 37 ° C for 4 to 5 days. The cell precipitate was dissolved in a GES solution (60% guanidium thiocyanate, 0.1 M EDTA, 0.5% sarcosyl) and extracted with an equal volume of phenol (chloroform solution, followed by precipitation of the entire DNA with isopropanol. Of a TE buffer solution (10 mM Tris-HCl, 1 mM EDTA, pH 7.5).

[Step 2]

The following primers were synthesized from the known sequence information of the SSA gene (O'toole, P. W., et al., J. Bacteriol., 173, 505-513 (1991)):

The primer PSSAT2: 5'-CTTGGTGTTGAGACTCCGCGGTGGTATGTTAGTTACAAAACTTGC-3 '(the 25th nucleotide at the 5'-end has the same base sequence as the 25th nucleotide at the 3'-end of the ubiquitin gene and the 20th nucleotide at the 5'- It is designed to have the same base sequence as the dog nucleic acid)

Primer PSSABAML: 5'-AAAAAGGATCCGTCGACTAAATGGAATTTTCTTTAAG-3 '(which has two end codons to terminate SSA decoding and also has restriction sites SalI and BamHI recognition sites).

[Step 3]

1 μl of the H. pylori DNA obtained in step 1 was used as a template and 2 μg of the primer PSSAT2 and 2 μg of the primer PSSABAML were added to the reaction tube. Then, 10 μl of 10 × polymerization buffer (500 mM KCl, 100 mM Tris-HCl, pH 9.0, Triton X-100), 10 μl of 2 mM dNTPs (2 mM dGTP, 2 mM dCTP, 2 mM dATP and 2 mM dTTP, respectively), 2.5 units of Taq polymerase and distilled water were added to the reaction mixture to adjust the total volume to 100 μl, (Denaturation step), 40 seconds at 55 占 폚 (immersion step), and 2 minutes at 72 占 폚 (polymerization step). The PCR product thus obtained was separated from 5% acrylamide gel to confirm that about 620 base pairs of DNA was amplified. The DNA fragment was separated and purified from the acrylamide gel under the same conditions (hereinafter referred to as "fragment SSA").

[Example 2]

[Synthesis of ubiquitin gene]

[Step 1]

The following primers were synthesized from the known sequence information of ubiquitin genes (Ozkaynak, et al., EMBO, J., 6, 1429-1439 (1987)):

The primer UBI1: 5'-CCCCATATGCATCATCACCATCATCACCATCATCAAATTTTCGTCAAAACTCTAAGAGGGAAGACTATAACCCTAGAGGTTGAATCTTCCGACACTATTGACAACGTCAA-3 '(which has a restriction enzyme NdeI recognition site (underlined) at the 5'-end and is designed to have 8 histidine codons after the methionine codon as the start codon)

The primer UBI2: 5'-TAGTTGCTTACCAGCAAAATCAATCTCTGCTGATCCGGAGGGATACCTTCTTTATCTTTGAATTTTACTTTTGACGTTGTCAATAGTCTC-3 '(which means that 20 nucleotides at the 5'-end are designed to have the same base sequence as the 20 bases at the 3'-end of the primer UBI3)

The primer UBI3: 5'-ACCACCGCGGAGTCTCAACACCAAGTGAAGAGTAGATTCCTTTTGGATGTTGTAGTCAGACAAGGTTCTACCATCTTCTAGTTGCTTACCAGCAAAAA-3 '(which has a SacII recognition site at the 5'-end (underlined) and 20 nucleotides at the 3'- end have the same base sequence as the 5'- terminal nucleic acid of the primer UBI2 Lt; / RTI >

[Step 2]

To the reaction tube, 3 oligonucleotides synthesized in step 1, namely 2 μg of primer UBI1, 0.02 μg of primer UBI2 and 2 μg of primer UBI3 were added and then 10 μl of 10 times polymerization buffer, 10 μl of 2 mM dNTP, Of Taq polymerase and distilled water were added to make a total volume of 100 PCR. PCR was carried out in the same manner as in step 3 of Example 1. The PCR product thus obtained was separated from 5% polyacrylamide gel to extract and purify about 270 base pairs of DNA (hereinafter, this DNA fragment was referred to as a fragment 'His-Ub') and dissolved in 20 μl of a TE solution .

[Example 3]

[Preparation of SSA gene expression vector]

2 μg of the plasmid pET11c (Novagen Inc., Madison WI 53711, USA) purchased from Novagen was diluted with NEB buffer solution 3 (10 mM Tris-HCl, 10 mM MgCl ₂ , 100 mM NaCl, 1 mM dTT, pH 7.0) with restriction enzymes NdeI and BamHI, , And the fragment was separated into 0.7% agarose gel to isolate and purify a 5.6 kb fragment (hereinafter, this fragment was referred to as 'short PNB').

On the other hand, the 25 'bases of the 5'-end of the SSA gene and the 3'-end of the fragment His-Ub obtained in Example 2 were overlapped with each other, and they were combined by PCR as follows. 10 ng of fragment SSA, 10 ng of fragment His-Ub, 2 μg of primer UBI1 and 2 μg of primer PSSABAML were added to the reaction tube and then 10 μl of 10-fold polymerization buffer, 10 μl of 2 mM dNTP, 2.5 units of Taq polymerase and distilled water PCR was carried out in the same manner as in step 3 of Example 1 so as to have a volume of 100 μl. The PCR products thus obtained were completely digested with restriction enzymes NdeI and BamHI under the conditions of NEB buffer solution 3, and then they were extracted with phenol / chloroform and dissolved in 20 μl of TE solution. This is referred to as 'the fragment His-Ub-SSA-N / B'. To the junction reaction tube, 100 ng of the fragment His-UB-SSA-N / B obtained above, 100 ng of the fragment PNB, 2 μl of the 10-fold conjugation reaction solution, 10 units of T4 ligase and distilled water were added to the reaction tube to give a total volume of 20 μl And allowed to react at 16 占 폚 for 12 hours. After the reaction, Escherichia coli HB101 (ATCC 33694) competent cells were transformed to obtain an expression vector pETHUB-SSA containing the fragment His-UB-SSA.

FIG. 1 shows the process of cloning the SSA gene into the E. coli expression vector pETHUB-SSA.

The transformed E. coli BL21 (DE3) pLYS.S (pETHUB SSA) was deposited on Jan. 9, 1996, as the deposit number KCTC 0226BP in the genetic bank of the Institute of Bioscience and Biotechnology .

[Example 4]

[Induction of SSA gene expression from E. coli]

The expression vector pETHUB-SSA obtained in Example 3 was transformed into the expression host E. coli BL21 / (DE3) / pLys (Novagen Inc., Madison W 153711, U.S.A.).

The transformed E. coli host was shake-cultured for 12 hours in a Luria batch containing 6 μg / ml of ampicillin and 34 μg / ml of chloramphenicol (6% overnight extract, 0.5% yeast extract, 1% Then, 1 ml of the solution was transferred to a ruria medium containing 100 ml of ampicillin and chloramphenicol, and incubated at 37 ° C for about 4 hours with shaking. When the absorbance of the bacteria reached about 0.3 at 650 nm, IPTG (Isopropyl-β-D -thiogalcatopyranoside) was added to a final concentration of 0.5 mM. Immediately before and 1, 3, 5, and 7 hours after addition of IPTG, 10 ml each was taken and centrifuged at 10,000 × G for 15 minutes to collect cell precipitates. The collected cell precipitate was subjected to 10% SDS-polyacrylamide gel electrophoresis according to the method of Laemmli et al., Nature 227, 680 (1970), and then the protein was coagulated with Coomassie Brilliant blue R250 Lt; / RTI >

Western blotting is then performed using the ubiquitin monoclonal antibody with the protein separated on the gel. First, the proteins separated on the gel were separated on a nitrocellulose membrane (Bid-Rad Lab., Pore size 0.22 탆) according to Tobin's method (Towbin, et al., Proc. Natl. Acad. Sci. USA 76, 4750 , CA, USA) and the membrane was placed in PSB containing 0.5 Tween 20 (10 mM phosphate, pH 7.0, 0.15 M sodium chloride) and shaken for 2 hours at room temperature with shaking. The ubiquitin single antibody was then diluted 1000 fold with PBS containing 0.5% gelatin and 0.0.5% Tween 20 and reacted with shaking at room temperature for 1 hour. Subsequently, an anti-human immunoglobulin G (Bio-Rad Lab, anti-human IgG-HRP, 0.01 mg, CA USA) labeled with horseradish peroxidase was diluted with PBS containing 0.2% And then washed with PBS containing 0.2% Tween 20 for 4 times for 5 minutes, followed by washing twice with 50 mM Tris buffer solution (pH 7.0). This membrane was developed by adding 50 mM Tris buffer solution containing 400 μg / ml of 4-chloro-1-naphthol and 0.03% hydrogen peroxide.

FIG. 2 shows the results of denaturing polyacrylamide gel electrophoresis (A) of the cell precipitate obtained by culturing Escherichia coli transformed with the expression vector pETHUB-SSA and Western blotting using a ubiquitin single antibody after electrophoresis The result (B) is shown.

In columns 2a and 2b, the m column shows the standard protein molecular weight, the first column shows the cell extract just before adding IPTG, the second column shows IPTG after 1 hour of incubation And the third column shows the cell extract obtained by adding IPTG and culturing for 3 hours. The fourth column shows the cell extract obtained by adding IPTG and culturing for 5 hours. Heat shows the cell extract obtained by culturing for 7 hours after adding IPTG.

[Example 5]

[Purification of His-Ub-SSA]

[Step 1] Culture of Escherichia coli cells

The recombinant strain (E. coli BL21 (DE3) pLYS.S) transformed with the expression vector pETHUB-SSA containing the recombinant His-Ub-SSA fusion gene was shaken for 12 hours in Luria medium containing ampicillin After the culture, 5 ml of the suspension was transferred to 1 L of M9 culture medium and cultured at 37 DEG C for about 3 to 4 hours with shaking. When the growth rate of the bacteria was 650 nm and the absorbance was about 0.3, IPTG was added to a final concentration of 0.5 mM to induce the expression of recombinant His-Ub-SSA. Approximately 5 hours after the addition of IPTG, cell culture was terminated and E. coli cell suspensions were collected by centrifugation at 3,500 rpm for 30 minutes using a centrifuge (Beckman, JB6, Rotor: JS4.2, USA).

[Step 2] Cell lysis and purification of His-Ub-SSA fusion protein

(HEAT SYSTEMAS-ULTRASONICS, INC., W225, USA) was added to 1.5 g of Escherichia coli cells expressing the His-Ub-SSA fusion protein and 10 mL of 6 M guanidine salt and 500 mM Tris buffer solution The cells were treated with ultrasound at 50% power for about 1 minute, shaken for 30 minutes, and centrifuged again at 12,000 rpm for 20 minutes using a centrifuge. The precipitate was discarded and the supernatant solution was passed through a histidine binding resin (Novagen, USA) affinity column (1.8 ml bed) pre-equilibrated with the buffer solution to bind His-Ub-SSA to the column, Was removed with the equilibrium buffer solution. The column was washed with urea buffer (8 M urea, 50 mM Tris, 0.2 M NaCl (pH 8.0)) to change the state of the chaotropic activity to a low state, and the contaminating protein was completely washed with a buffer solution containing 15 ml of imidazole in the urea buffer solution Respectively. Ub-SSA fusion protein bound to the column was analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis with urea buffer solution containing 0.4 M imidazole concentration, and His-Pb-SSA High-purity His-Ub-SSA fusion protein was obtained by collecting only the fusion protein moiety.

FIG. 3 is a comparison of the cell pellets obtained by culturing Escherichia coli transformed with the expression vector pETHUB-SSA before and after induction of IPTG expression as a result of denaturing polyacrylamide gel electrophoresis.

In FIG. 3, the m column shows the standard protein molecular weight, the first column shows the cell extract just before adding IPTG, the second column shows the cell extract obtained after adding IPTG, Column 3 is purified His-Ub-SSA.

Claims (6)

Species-Specific Protein Antigen (SSA) gene of Helicobacter pylori (H. pylori) is a fusion gene in which histidine and ubiquitin gene are linked. A histidine-ubiquitin-specific protein antigen (His-Ub-SSA) fusion protein expression vector comprising the fusion gene of claim 1. 3. The method according to claim 2, wherein the expression vector pETHUB-SSA. An E. coli transformed with the expression vector of claim 2. 5. The microorganism of claim 4, which is Escherichia coli BL21 (DE3) pLYS.S (pET HUB SSA). Culturing the Escherichia coli of claim 4 under conditions suitable for the expression of the fusion protein, pulverizing the recombinant E. coli cells expressing the fusion protein in a buffer solution containing the guanidine salt, and subjecting the supernatant obtained by centrifugation to histidine binding affinity chromatography Lt; RTI ID = 0.0 > His-Ub-SSA < / RTI > fusion protein.