JPWO2019044952A1 - A method for evaluating the amount of TREC or KREC, the particles used in the method, and their use. - Google Patents

Abstract

Provided are novel particles that can be used as control DNA and the like for evaluating the amount of TREC and / or KREC with higher accuracy, and their use. In one aspect of the present invention, at least one of a TREC (T-cell Receptor Excision Circles) nucleic acid fragment containing a signal joint portion and a KREC (Kappa-deleting Receptor Excision Circles) nucleic acid fragment containing a signal joint portion is a cell. Particles that have been introduced into the intracellular or liposomes.

Description

The present invention relates to a method for evaluating the amount of TREC (T-cell Receptor Excision Circles) or KREC (Kappa-deleting Receptor Excision Circles), particles used in the method, and utilization thereof. More specifically, one aspect of the present invention relates to newborn screening for primary severe combined immunodeficiency disease (SCID) and the like.

Some of the diseases collectively called primary immunodeficiency are functional because they have abnormalities in the neoplasia of T cells and / or B cells, as represented by SCID, for example. There are those who congenitally exhibit the symptom of deficiency of T cells and / or B cells.

For example, SCID congenitally causes a deficiency of functional B cells and NK cells, with a deficiency of functional T cells as the main symptom. Patients are susceptible to bacterial, fungal, and viral infections due to these lymphocyte abnormalities, and have a fatal prognosis unless curative treatment such as hematopoietic stem cell transplantation is performed by the age of 1 at the latest. Has been done. Therefore, a technique capable of determining the onset or possibility of developing a disease at an early stage is desired.

Non-Patent Document 1 describes patients with primary immunodeficiency disease such as SCID by amplifying partial sequences of TREC and KREC by quantitative PCR method and performing absolute quantification on DNA samples extracted from newborn filter paper blood. It describes how to perform newborn screening. TREC is a circular DNA that appears when T cells are regenerated in the thymus and remains inside the cells, and serves as an index for T cell renewal. Similarly, KREC is a circular DNA that appears when B cells are regenerated and remains inside the cell, and is an indicator of B cell renewal.

Stephan Borte, Ulika von Dobeln et. Al., Neonatal screening for severe primary immunodeficiency diseases using high-throughput triplex real-time PCR, BLOOD, 15 MARCH 2012 vol.119 no. 11 p.2552-2555

In the prior art as described in Non-Patent Document 1, it is essential to prepare a calibration curve in order to perform absolute quantification of TREC and / or KREC. For example, in the prior art described in Non-Patent Document 1, a plasmid containing one copy of TREC-KREC-TRAC construct and a plasmid containing one copy of β-actin sequence are used as control DNA for preparing a calibration curve, and the control DNA is used. After preparing the dilution series of, a calibration curve is prepared by applying the quantitative PCR method to these dilution series. In other conventional techniques, an oligo DNA corresponding to a TREC fragment and / or a KREC fragment may be used as a control DNA for preparing a calibration curve.

However, the accuracy of the prepared calibration curve is due to the difficulty of accurate quantification (determination of molecular weight) of the control DNA for preparing the calibration curve, or the dilution error that occurs during serial dilution when preparing the dilution series. There may be sexual problems.

In addition, the process of preparing DNA to be used in the quantitative PCR method differs between the sample and the control DNA for preparing the calibration curve. That is, as described above, in the control DNA, the DNA to be used for the quantitative PCR method is prepared by diluting the purified plasmid (or oligo DNA), but in the sample, the quantitative PCR is performed by extracting the DNA from the filter paper blood. DNA for the method is prepared. Therefore, for example, even if the extraction efficiency of DNA from filter paper blood changes, it does not affect the above control DNA. Therefore, the result of absolute quantification by comparison with the calibration curve prepared using this control DNA is It may change due to fluctuations in the extraction efficiency of DNA from filter paper blood.

In addition, the fact that the preparation process of DNA to be used for the quantitative PCR method differs between the sample and the control DNA for preparing the calibration curve is that the values for the same sample cannot be maintained consistently if the measurement facility is different. It is one of the causes of susceptibility.

One aspect of the present invention is to provide a novel particle that can be used as a control DNA or the like for evaluating the amount of TREC and / or KREC with higher accuracy, and its utilization.

In the present invention, for example, at least one of a TREC (T-cell Receptor Excision Circles) nucleic acid fragment containing a signal joint portion and a KREC (Kappa-deleting Receptor Excision Circles) nucleic acid fragment containing a signal joint portion is intracellular. Alternatively, the particles introduced into the liposome are included as one of the embodiments.
In addition, one nucleic acid construct (however, the total length of TREC and the total length of KREC is not included) containing at least one of the nucleic acid fragment of TREC including the signal joint portion and the nucleic acid fragment of KREC including the signal joint portion. It is included as an aspect.

According to one aspect of the present invention, it is possible to provide a novel particle that can be used as a control DNA or the like for evaluating the amount of TREC and / or KREC with higher accuracy, and its utilization. ..

The calibration curve obtained from the result of performing the quantitative PCR reaction of TREC500 is shown. The calibration curve obtained from the result of performing the quantitative PCR reaction of KREC500 is shown. The state where the Ct value determined by the quantitative PCR reaction of TREC is plotted on the calibration curve of FIG. 1 is shown. The calibration curve according to Example 1 and the calibration curve according to Reference Example 1 are shown.

Hereinafter, embodiments of the present invention will be described in detail.

In addition, in this specification, "A and / or B" is an expression intended as both A and B and A or B.

[1. particle〕
The “particle” in the present embodiment means that the “nucleic acid fragment” described below is introduced into the “particle matrix”. It should be noted that "the nucleic acid fragment has been introduced" means that the process of introducing the particles from outside the mother's body to the inside may be performed at least once. When the mother of the particle is a cell, the nucleic acid fragment is amplified after being introduced into the cell, and the new cell generated as the cell proliferates contains the nucleic acid fragment (a replica of the introduced nucleic acid fragment). The morphology is also included in the concept of "introduced into the mother's body of particles".

(Mother of particles)
The parent of the particle into which the nucleic acid fragment is introduced is a cell or liposome. Liposomes are artificial membrane vesicles composed of phospholipid bilayer membranes. Liposomes behave similarly to cells, and a method for encapsulating nucleic acid fragments has also been established. Therefore, liposomes can be treated in the same manner as cells as a container for storing nucleic acid fragments.

When the particles according to one aspect of the present invention are used as a control for evaluating the amount of TREC or the like, it is preferable that the matrix of the particles does not have intrinsic TREC and KREC. Liposomes originally satisfy this condition. Most of the cells are excluding cells immediately before and after differentiation into T cells (newborn T cells or their progenitor cells) and cells immediately before and after differentiation into B cells (newborn B cells or their progenitor cells). This condition is satisfied from the beginning.

The matrix of particles may be preferably cells over liposomes. In general, 1) cells are proliferative if the culture conditions are adjusted (a clone in which the number of nucleic acid fragments contained in the cell is kept constant is established, and a large amount of this clone is proliferated to obtain homogeneous particles. This is because it has properties such as (easily obtained in large quantities), 2) having an endogenous reference gene (RNaseP, etc.), and 3) being generally more stable than liposomes.

Considering the use of blood samples for the evaluation of TREC and KREC and the cell similarity to T cells or B cells immediately after neoplasia, the cells used as the mother of particles are blood cells or immune systems. It may be preferable that the cells are. Examples of blood line cells and immune system cells include B cell lines such as Jeko-1 cells, Razi cells, and Ramos cells; T cell lines such as Jurkat cells, MALT-4 cells, TG40 cells, and U-937 cells. Immortalized cell lines such as KU812-F cells and RBL-2H3 cells; Granulized cell lines such as HMC-1 cells, Ku812 cells and RBL cells; Lymmortalized cell lines such as MCL-5 cells and MALT-4 cells Immortalized cell line such as NB-4 cell, THP-1 cell; Macrophage cell line such as 416B cell, MOLM-14 cell, THP-1 cell; Leukocyte cell line such as BJAB cell, CML cell, Daudi cell Immortalized cell lines such as A20 cells, BC-3 cells, CA46 cells, HCT116 cells, ST-486 cells; Immortalized cell lines such as ESB cells and TCLB cells; Leukemia cells such as HL-60 cells and K562 cells Cell lines; etc. Among these, leukemia cell line, lymphoblastoma cell line, lymphoma cell line, and leukocyte cell line may be more preferable, and leukemia cell line and leukocyte cell line may be further preferable.

(Nucleic acid fragment)
The nucleic acid fragment introduced into the matrix of the particle is at least one of the TREC nucleic acid fragment containing the signal joint moiety and the KREC nucleic acid fragment containing the signal joint moiety. The cyclic TREC itself and the cyclic KREC itself are not included in the category of nucleic acid fragments. When both of these nucleic acid fragments are introduced into the matrix of the same particle, it is preferable from the viewpoint that it can be used for both evaluation of KREC and TREC. The Nucleic acid fragment of TREC and the nucleic acid fragment of KREC may be introduced into the base of the particles as separate nucleic acid constructs, or may be introduced into the base of the particles as one nucleic acid construct in which both are linked. Here, the nucleic acid construct refers to the above-mentioned nucleic acid fragment itself or a structure composed of nucleic acid containing the nucleic acid fragment as a part (for example, a plasmid in which the nucleic acid fragment is inserted).

The above-mentioned signal joint portion refers to a ring coupling portion in each of TREC and KREC. In TREC, it is also called a δRec-ΨJα signal joint, and in KREC, it is also called an intron RSS-κde signal joint.

In a preferred embodiment of the nucleic acid fragment, the TREC fragment contains the signal joint portion and / or the KREC fragment contains the signal joint portion, instead of the fragment including the full length of the TREC and the fragment containing the full length of the KREC. is there. In a preferred embodiment, the signal joint portion is not divided and contained at both ends of the nucleic acid fragment, but is contained as a continuous continuous region.

The size of the nucleic acid fragment is not particularly limited, but considering the size necessary and sufficient for gene amplification described later, the lower limit thereof is preferably 200 bp or more, more preferably 300 bp or more, and more preferably 400 bp or more. More preferred. The upper limit of the size of the nucleic acid fragment is preferably 600 bp or less, more preferably 550 bp or less, and further preferably 530 bp or less. In one example, the size of the nucleic acid fragment is in the range of 400 bp or more and 600 bp or less, 450 bp or more and 550 bp or less, or 470 bp or more and 530 bp or less.

When gene amplification is performed on a region containing a signal joint portion, the position of the signal joint portion contained in the nucleic acid fragment is preferably a relatively central portion of the nucleic acid fragment. For example, the distance from both ends of the nucleic acid fragment to the signal joint portion is preferably 50 bp or more, more preferably 80 bp or more, and further preferably 100 bp or more. When the position of the signal joint portion included in the nucleic acid fragment is a relatively central portion of the nucleic acid fragment and the size of the nucleic acid fragment is within the above range (particularly within the range of 400 bp or more and 600 bp or less). The gene amplification and detection of the nucleic acid fragment can be performed by using substantially all the existing primer / probe sets for TREC detection / KREC detection as they are. That is, this nucleic acid fragment is evaluated for both existing measurement systems and newly designed measurement systems (for example, examination of amplification efficiency using a primer / probe set, amplification specificity, etc.). ) And can be used as a standard sample described later.

In the wild type, the signal joint portion contained in the nucleic acid fragment contains a region having individual differences due to genetic variation due to insertion or deletion of a base or the like. In a particularly preferred embodiment of the nucleic acid fragment, this interpersonal region has a signal joint portion removed (corresponding to SEQ ID NOs: 1 and 2). As a result, a nucleic acid fragment can be prepared according to a unified standard, and when this nucleic acid fragment is amplified using the same primer set, in theory, the same amplified fragment is always obtained, which is different from that of existing measurement systems. However, it can be particularly preferably used as a standard sample or the like, which will be described later, for a newly designed measurement system.

Although not particularly limited, a preferred embodiment of the nucleic acid fragment is a double-stranded DNA fragment. The nucleic acid fragment may be introduced into the matrix of the particles, for example, as a nucleic acid construct inserted into a vector such as a plasmid.

From the viewpoint of facilitating accurate quantification of TREC and KREC, it is preferable that the nucleic acid fragment is one in which the replication of particles in the mother body is restricted. When the nucleic acid fragment is inserted into a vector such as a plasmid, the copy number of the plasmid can be limited according to the combination of the plasmid and the mother (host cell) of the particles.

From the viewpoint of facilitating accurate quantification of TREC and KREC, it is preferable that the nucleic acid fragments are contained in a predetermined number (for example, only one copy) in the mother body of the particles. In addition, as described above, if the nucleic acid fragment has restricted replication of the particles in the mother's body, it is more preferable because the number of nucleic acid fragments contained in the mother's body of the particles is unlikely to change over time. ..

From the viewpoint of facilitating accurate quantification of TREC and KREC, it is preferable that the nucleic acid fragment is one in which transcription does not occur in the mother body of the particles. When a nucleic acid fragment is inserted into a vector such as a plasmid, transcription of the nucleic acid fragment can be prevented unless, for example, a promoter or enhancer involved in the expression control of the nucleic acid fragment is provided. However, this vector may have a drug resistance gene or the like inserted so as to be transcribed and translated.

A particularly preferable example of a TREC nucleic acid fragment containing a signal joint portion is 1) a nucleic acid fragment showing a base sequence in SEQ ID NO: 1 and 2) a portion of a nucleic acid fragment showing a base sequence in SEQ ID NO: 1 of 400 bp or more and 450 bp. Nucleic acid fragment having a size of 470 bp or more, 3) Nucleic acid sequence identity of 90% or more, more preferably 95% or more, 96% or more, 97% or more, 98 with the nucleic acid fragment of 1) or 2) described above. % Or more, or 99% or more of nucleic acid fragments, and the like.

A particularly preferable example of a nucleic acid fragment of KREC containing a signal joint portion is 1) a nucleic acid fragment showing a base sequence in SEQ ID NO: 2 and 2) a portion of a nucleic acid fragment showing a base sequence in SEQ ID NO: 2 of 400 bp or more and 450 bp. Nucleic acid fragment having a size of 470 bp or more, 3) Nucleic acid sequence identity of 90% or more, more preferably 95% or more, 96% or more, 97% or more, 98 with the nucleic acid fragment of 1) or 2) described above. % Or more, or 99% or more of nucleic acid fragments, and the like.

In the existing measurement system, the amplification sequence of both TREC and KREC is different for each report. The optimum amplification sequence differs depending on the device or method used, and when designing the primer and probe sequences, it is necessary to evaluate the amplification efficiency and specificity of the amplification sequence designed using genomic DNA including the full-length sequence. there were. Furthermore, since absolute quantification is the mainstream in actual determination, it is necessary to prepare oligo DNA or plasmid DNA (control DNA) incorporating the oligo DNA for each specified amplification sequence. By using the nucleic acid fragment according to one embodiment of the present invention, the problems of these existing measurement systems can be solved.

(How to make particles)
As a method for producing particles, for example, the above-mentioned nucleic acid fragment (which may be in the form of a nucleic acid construct containing the nucleic acid fragment) is introduced into the mother body of the particle. The method for introducing the nucleic acid fragment into the mother of the particle may be appropriately selected from, for example, a gene transfer method such as an electroporation method, a microinjection method, a lithium acetate method, a calcium phosphate method, a lipofection method, and a particle gun method. Electroporation is more preferred.

After performing the operation of introducing the nucleic acid fragment into the mother body of the particle, if necessary, the success or failure of the nucleic acid fragment introduction (for example, the drug resistance gene possessed by the vector into which the nucleic acid fragment is inserted is used) and the introduction is performed. You may check the copy number of the nucleic acid fragment.

The produced particles can be stored according to the cell or liposome storage method. The particles are stored in a container, for example, suspended in a suitable liquid (physiological saline, liquid medium, etc.) according to the type of particles. When the particles are stored for a long period of time, for example, freeze-drying may be performed.

[2. Evaluation of the amount of TREC and / or KREC using particles]
(Standard sample)
The above-mentioned particles can be used, for example, as a reference sample (standard sample) when evaluating the amount of TREC and / or KREC in a blood sample. The standard sample can be used, for example, as a sample for preparing a calibration curve, a sample for negative control, a sample for presenting a reference value (threshold value), or the like.

The above-mentioned particles are different from the nucleic acid fragments themselves, and can be counted using, for example, an optical microscope system. Therefore, based on the relationship between the number of nucleic acid fragments contained in the particles (when the mother of the particles is a liposome, the efficiency of encapsulation of the nucleic acid fragments in the liposomes) and the number of particles contained in the system, the system It becomes easier to control the total number of nucleic acid fragments contained in. Therefore, the following problems 1) and 2) that occur when the plasmid or oligo DNA itself is used as the control DNA can be reduced. 1) Difficulty in accurate quantification (determination of molecular weight) of control DNA, 2) Problems with accuracy of calibration curve due to dilution error caused during serial dilution when preparing a dilution series.

One form of the standard sample (liquid sample) is a liquid containing the above-mentioned particles at a predetermined concentration (number of particles / volume of liquid). The standard sample may be a set of liquids containing the above-mentioned particles at different predetermined concentrations (number of particles / volume of liquid). The liquid used for preparing the standard sample is not particularly limited and may be, for example, physiological saline, PBS, etc., but from the viewpoint of imitating a blood sample, the liquid contains at least one of erythrocytes and plasma. It is preferable that both are contained, and it is more preferable that both are contained. For example, a red blood cell solution obtained by mixing a concentrated red blood cell solution and plasma is preferable as a liquid for mixing particles. From the viewpoint of imitating a blood sample, the liquid has a viscosity equivalent to that of blood (for example, about 0.8 to 1.2 times, more preferably 0.9 to 1.1 times that of blood). It may be preferable to adjust the viscosity to about twice.

Another form of the standard sample is one in which the above liquid sample is impregnated into a fibrous body. The fiber body is not particularly limited as long as it is an aggregate of fibers that can be impregnated with a liquid, and examples thereof include paper such as filter paper; woven cloth; non-woven fabric; the filter paper is preferable, and the filter paper is used for blood collection. Filter paper is more preferred. The method of impregnating the liquid sample into the fiber body is not particularly limited, and examples thereof include a method of collecting the liquid sample with a pipette or the like and spotting the liquid sample on the fiber body. The fibrous body impregnated with the liquid sample can be dried and stored.

In the above other forms of the standard sample, the fibrous body may have a plurality of spots impregnated with the liquid sample. The plurality of spots may be impregnated with a liquid sample containing particles at the same concentration, but preferably include those impregnated with a liquid sample containing particles at different concentrations. A standard sample having a plurality of spots in which a liquid sample containing particles at predetermined concentrations different from each other is impregnated into a fibrous body is suitable as a sample for preparing a calibration curve.

As the form of the standard sample, the optimum one may be selected according to the form of the sample to be evaluated in the amount of TREC and / or KREC. For example, when the sample is a blood sample (one that has not been impregnated into the fibrous body), a liquid sample may be adopted as the standard sample. If the sample is one in which blood is impregnated into the fibrous body, a sample prepared by impregnating the liquid sample into the fibrous body (preferably the same type of fibrous body as in the case of the sample) can be adopted as the standard sample. Good. When the sample is obtained by impregnating blood into a filter paper (preferably a blood collection filter paper), a liquid sample may be impregnated into a filter paper (preferably a blood collection filter paper) as a standard sample. .. Since the morphology of the standard sample and the morphology of the sample are similar, DNA can be extracted and the extracted DNA can be amplified based on a common method, so that the obtained results can be easily and accurately compared. It becomes. Therefore, the consistency of the values can be maintained not only when the same sample is measured multiple times at the same facility but also when the same sample is measured at different facilities.

(Sample and its preparation method)
The sample to be evaluated for the amount of TREC and / or KREC is not particularly limited as long as it contains at least one of TREC and KREC, but is preferably a blood sample, and a sample obtained by impregnating blood into a fibrous body. It is more preferable that the blood sample is a filter paper (particularly, a filter paper for blood collection). The origin of the sample is human or a mammal other than human, preferably human, and more preferably a newborn. The "newborn baby" refers to a baby within 30 days of age. As the fiber body, the same fiber as that described in the above (standard sample) column can be appropriately used. For newborns who are particularly required to assess the amount of TREC and / or KREC, it is particularly preferred to use filter paper (particularly, blood collection filter paper) blood samples.

Hereinafter, a method for preparing a filter paper (filter paper for blood collection) blood sample, which is a preferable embodiment of the sample, from a newborn baby will be described. Examples of the method for preparing a filter paper blood sample include a method in which a small amount of blood is collected from a newborn baby, the blood is spotted on the filter paper, and the blood is dried at room temperature. Specifically, there is a method in which the heel of a newborn baby is slightly scratched with a needle or the like, and blood is impregnated directly into the filter paper from the capillaries.

(Method for quantifying TREC and / or KREC)
= Sample for preparing calibration curve =
As the sample for preparing the calibration curve, among the above-mentioned standard samples, for example, 1) a set of liquid samples containing particles at different predetermined concentrations, or 2) particles are contained at different predetermined concentrations. Examples thereof include a fibrous body having a plurality of spots impregnated with a liquid sample. The "liquid sample containing particles at predetermined concentrations different from each other" refers to, for example, a sample corresponding to a predetermined-fold dilution series containing particles at a concentration required for preparing a calibration curve.

= Negative control and positive control =
The positive control is a liquid containing a certain concentration of the base of the particles used for producing the particles (the one in which the nucleic acid fragment of TREC and the nucleic acid fragment of KREC are not introduced), or the liquid is impregnated into the fiber body. It will be. The "liquid" and "fiber" are as described in the above (standard sample) column. The maternal concentration of particles is preferably 5000 (maternal particles) / μl, which is equal to the lower limit of the white blood cell count of healthy 0-month-old babies. On positive controls, TREC and KREC are not detected.

The negative control is, for example, in the above-mentioned positive control, a part of the mother body of the particle is replaced with a particle containing a nucleic acid fragment of TREC and / or a nucleic acid fragment of KREC (particle of the present invention). That is, the negative control corresponds to one form of the standard sample described above.

As for the form of the positive control, the optimum form may be selected according to the form of the sample to be evaluated for the amount of TREC and / or KREC as in the standard sample. For example, when the sample is a blood sample (one that has not been impregnated into the fibrous body), the liquid form may be adopted as a positive control. If the sample is one in which blood is impregnated into the fibrous body, as a positive control, one in which the liquid is impregnated into the fibrous body (preferably the same type of fibrous body as in the case of the sample) may be adopted. .. When the sample is one in which blood is impregnated in a filter paper (preferably a blood collection filter paper), a sample in which a liquid is impregnated in a filter paper (preferably a blood collection filter paper) may be adopted as a positive control.

The negative control and the positive control may be impregnated as separate spots on the same fiber body, and the negative control, the positive control, and the sample for preparing a calibration curve are all placed on the same fiber body. It may be in a form soaked as separate spots.

= DNA extraction and quantification =
The DNA is extracted by a method according to the sample for preparing the calibration curve, the positive control, the negative control, and the form of the sample (whether it is a liquid form or a form impregnated into a fibrous body). For example, in the case of a sample in the form of being impregnated into a fiber body such as filter paper, the DNA eluate is punched out from the fiber body with a punch of a certain size, washed with the punched pieces, and extracted with DNA. obtain. The diameter of the punch is preferably about 3 mm, but it may be larger or smaller than this. It is preferable that the sample for preparing the calibration curve, the positive control, the negative control, and the sample have the same morphology, and DNA is extracted from all the samples based on the same method in order to perform more accurate quantification. ..

Then, at least one or preferably both of TREC and KREC contained in the obtained DNA eluate is amplified by the gene amplification method, and the amplified fragment is quantified. The gene amplification method is preferably a quantitative PCR method.

When performing a quantitative PCR method, the primer set may be determined based on the sequence of nucleic acid fragments of TREC and / or KREC introduced into the matrix of the particles. The lengths of the forward primer and the reverse primer constituting the primer set are, for example, 15 bases or more, preferably 15 bases or more and 50 bases or less, and more preferably 17 bases or more and 35. It is within the range of base length or less, more preferably 17 base length or more and 30 base length or less, and particularly preferably 17 base length or more and 25 base length or less. The forward primer and the reverse primer may be designed so that the amplified fragment obtained as a result of PCR contains a signal joint portion and has a size of about 80 bp to 500 bp, about 80 bp to 200 bp, or about 100 bp to 150 bp. It may be preferable.

The quantity ratio of the forward primer and the reverse primer contained in the primer set (substantially synonymous with the molar ratio) is not particularly limited, but the concentration of the forward primer is preferably in the range of 0.7 to 1.3 times the concentration of the reverse primer. It is preferably in the range of 0.9 to 1.1 times, more preferably.

This primer set can be synthesized according to a conventional method. Moreover, the reaction conditions of PCR using this primer set are not particularly limited. The temperature of the denaturation step is set, for example, in the range of 93 ° C. to 96 ° C., preferably in the range of 94 ° C. to 95 ° C. The temperature of the annealing step is set, for example, in the range of 58 ° C. to 69 ° C., preferably in the range of 59 ° C. to 63 ° C. The temperature of the stretching step is set, for example, in the range of 60 ° C. to 79 ° C., preferably in the range of 65 ° C. to 75 ° C. The reaction time of the denaturation step is set, for example, in the range of 8 seconds to 25 seconds, preferably in the range of 8 seconds to 20 seconds. The reaction time of the annealing step is set, for example, in the range of 25 seconds to 1 minute, preferably in the range of 28 seconds to 35 seconds. The reaction time of the extension step is set, for example, in the range of 1 second to 20 seconds, preferably 1 second to 10 seconds. The number of cycles is set, for example, within the range of 20 to 100 cycles, preferably within the range of 30 to 85 cycles, and more preferably within the range of 35 to 65 cycles.

The probe used for quantification of the PCR-amplified fragment (usually a fluorescently labeled nucleic acid probe) may be designed so as to be hybridizable with the PCR-amplified fragment, but the nucleic acid portion is preferably 15 bases or more in length. Is in the range of 15 bases or more and 50 bases or less, and more preferably 17 bases or more and 35 bases or less.

Further, the nucleotides constituting each of the above-mentioned primers and probes may contain artificial nucleic acids such as PNA (peptide nucleic acid) and / or LNA (locked nucleic acid) in addition to DNA.

The quantification of TREC and / or KREC after the PCR reaction may be carried out according to a general quantitative PCR method. In a specific example, first, it is confirmed from the results of the PCR reactions obtained from the positive control and the negative control that the quantitative PCR reaction was properly performed. Then, the Ct value of the PCR reaction obtained from the sample for preparing the calibration curve is plotted on the coordinates with each cell concentration on the horizontal axis to prepare the calibration curve. Using the prepared calibration curve as a reference, the total amount of TREC and / or KREC contained in the sample (or the concentration conversion value in blood) can be determined.

In addition to the above-mentioned absolute quantification mode, a mode in which the amount of TREC and / or KREC contained in the sample is relatively quantified is also within the scope of the present invention. For example, as a standard sample, one or more samples containing the above-mentioned particles at a predetermined concentration (number of particles / volume of liquid) are prepared. Then, as in the case of absolute quantification, a DNA eluate is obtained from the standard sample and the sample, gene amplification is performed based on the quantitative PCR method, and the obtained amplified fragment is quantified. Next, the Ct values of the PCR reaction (or the converted values obtained from them) are compared with each other to determine whether or not the amount of TREC and / or KREC contained in the sample is larger than the amount in the standard sample. .. That is, the standard sample is used as a sample for presenting a reference value (threshold value).

(Use of quantitative results of TREC and / or KREC)
Quantitative results of TREC and / or KREC in the sample indicate whether or not there is a possibility of abnormal T cell and / or B cell neoplasia in the human or non-human mammal from which this sample is derived. It can be used as an index. For example, in a concentration-based comparison, if the quantification result of TREC in the sample is lower than the predetermined reference value (threshold value), it is determined that there is a possibility that T cell neogenesis is abnormal. To do. Similarly, in a concentration-based comparison, if the quantification result of KREC in the sample is lower than the predetermined reference value (threshold value), it is possible that B cell neogenesis is abnormal. judge. Here, the predetermined reference value (threshold value) is, for example, a value of 70 copies (TREC) / ul (blood) or less, a value of 50 copies (TREC) / ul (blood) or less, and 40 copies (TREC) / ul ( Blood) or less, or 10 copies (TREC) / ul (blood) or less. The predetermined reference value (threshold value) is, for example, a value of 70 copies (KREC) / ul (blood) or less, a value of 50 copies (KREC) / ul (blood) or less, and a value of 40 copies (KREC) / ul (blood) or less. Value of 10 copies (KREC) / ul (blood) or less.

In one aspect of the invention, if humans or non-human mammals may have abnormal T cell and / or B cell neogenesis, these humans and / or B cells are T cells and / or B cells. It can be determined that the patient has or may have primary immunodeficiency with a neoplastic abnormality. The primary immunodeficiency associated with abnormal T cell and / or B cell neoplasia is, for example, severe combined immunodeficiency such as adenosine deaminase deficiency, X-linked SCID, JAK3 deficiency, and RAG deficiency. Diseases (SCID); antibody production deficiencies such as X-linked agammaglobulinemia; other primary immunodeficiencies such as DiGeorge syndrome; etc., among which SCID is a disease requiring early treatment. , Preferred as a target for neonatal screening.

In addition, the individual who suffers from or may be affected by the above-mentioned primary immunodeficiency is a doctor (when the individual is a human) or a veterinarian (when the individual is a mammal) as necessary. After being diagnosed with, treatment may be given according to the type of primary immunodeficiency. For example, in the case of SCID, hematopoietic stem cell transplantation at an early stage (before the age of 1 year at the latest), and in the case of X-linked agammaglobulinemia, administration of an immunoglobulin preparation and the like are appropriate treatment methods at present.

[3. TREC and / or KREC Quantitative Kit]
The quantification kit according to one embodiment of the present invention comprises 1) the above-mentioned particles or 2) the above-mentioned standard sample. This quantification kit preferably contains 3) primers for gene amplification of TREC nucleic acid fragments contained in particles (particularly PCR primer sets), and 4) primers for gene amplification of KREC nucleic acid fragments contained in particles (particularly PCR primer sets). In particular, it comprises at least one selected from the group consisting of a PCR primer set), 5) a probe for a TREC nucleic acid fragment contained in a particle, and 6) a probe for a KREC nucleic acid fragment contained in a particle. 5) and 6) can also be probes for the amplified fragments obtained using 3) and 4), respectively. Therefore, it is preferable that 3) and 5) are included in the kit and 4) and 6) are included in the kit.

Furthermore, if necessary, 7) fibrous bodies for impregnating and collecting blood, 8) punches for punching the fibrous bodies, 9) various reagents and instruments used for gene amplification such as PCR (polymerase, PCR buffer, each dNTP). , Pipet, etc.), 10) Various reagents and instruments for preparing samples containing DNA for gene amplification (test tubes, buffers, etc.), 11) Various reagents and instruments for analyzing gene amplification fragments (electrometry) At least one of gel material, pipette, etc.), 12) kit instruction manual, 13) primer for gene amplification of the endogenous reference gene contained in the mother of the above-mentioned particles, and 14) probe for the reference gene, etc. It may be equipped with one.

This quantification kit is used for quantification of TREC and / or KREC in a sample. This quantification kit, for example, indicates that the human or non-human mammal from which this sample is derived suffers from or may suffer from primary immunodeficiency with T cell and / or B cell neoplasia. It is used to judge whether or not. This quantitative kit is used, for example, for newborn screening to see if a human newborn has or may have SCID.
[4. Summary]
As is clear from the above, the present invention includes, for example, the following.
1) At least one of the TREC (T-cell Receptor Excision Circles) nucleic acid fragment containing the signal joint portion and the KREC (Kappa-deleting Receptor Excision Circles) nucleic acid fragment containing the signal joint portion is intracellular or liposome. Introduced particles.
2) The particle according to 1), wherein the nucleic acid fragment of TREC containing the signal joint portion and the nucleic acid fragment of KREC containing the signal joint portion are introduced.
3) The particle according to 1) or 2), wherein all of the nucleic acid fragments are in the range of 400 bp or more and 600 bp or less, and at least 80 bp or more are separated from both ends of the nucleic acid fragment to the signal joint portion.
4) The particle according to any one of 1) to 3), wherein the nucleic acid fragment is introduced into the cell.
5) The particles according to 4), wherein the cells do not have endogenous TREC and KREC.
6) The particle according to any one of 1) to 5), wherein a predetermined number of the above nucleic acid fragments are contained.
7) A standard in which the particles according to any one of 1) to 6) above are contained in a predetermined concentration (number of particles / volume of liquid), or the liquid is impregnated into a fiber body. sample.
8) The standard sample according to 7), wherein the liquid contains at least one of erythrocytes and plasma.
9) The standard sample according to 7) or 8), which has a plurality of spots in which the liquid is impregnated into the fibrous body, and the concentrations of the particles differ between the spots.
10) A kit comprising the particles according to any one of 1) to 6) above or the standard sample according to any one of 7) to 9).
11) Select from the group consisting of a primer for gene amplification of the TREC nucleic acid fragment, a primer for gene amplification of the KREC nucleic acid fragment, a probe for the TREC nucleic acid fragment, and a probe for the KREC nucleic acid fragment. 10) The kit according to 10), comprising at least one of the following.
12) A method of evaluating at least one of TREC and KREC contained in a blood sample using a gene amplification method, wherein the standard sample according to any one of 7) to 9) is prepared as a control sample or a calibration curve. Method used as a sample for.
13) The method according to 12), wherein the blood sample is a newborn filter paper blood sample.
14) Evaluate the likelihood that the newborn is suffering from severe combined immunodeficiency disease (SCID) based on the results of evaluating at least one of TREC and KREC by the method described in 13) above, 13 ).
15) A nucleic acid construct containing at least one of a TREC nucleic acid fragment containing a signal joint portion and a KREC nucleic acid fragment containing a signal joint portion (however, the full length of TREC and the full length of KREC are not included).

An embodiment of the present invention will be described below.

[Example 1]
<Manufacturing of K562-TREC, K562-KREC, K562-TREC-KREC>
1. 1. Sequence amplification and plasmid preparation 1-1. Sequence identification of TREC500 and KREC500 TREC (T) was obtained by extracting genomic samples from the blood of 6 humans (0 years old to adults) using the QIAGEN DNeasy blood and tissue kit or the QIAmp DNA Blood mini kit and using the PCR method. A DNA fragment containing δRec-ΨJα, which is the binding part of -cell Receptor Excision Circles), and its peripheral site was obtained. The base sequence of the obtained DNA fragment was analyzed using a DNA sequencer. Specifically, about 300 bp upstream and downstream primers from δRec-ΨJα were designed from the database, about 550 bp was amplified using these, and the sequence was confirmed by the Sanger sequence. The base sequences of these DNA fragments were compared using ATGC sequence assembly software (Genetics), and the parts that differed between individuals due to genetic variation due to insertion / deletion of bases were removed. The sequence was identified. Further, a total of about 500 bp of the base sequence up to about 250 bp from the center of the common sequence of the binding portion was identified, and the TREC500 sequence was obtained. The TREC500 sequence is shown in SEQ ID NO: 1. Hereinafter, the DNA represented by the TREC500 sequence may be referred to as TREC500.

KREC (Kappa-deleting Receptor Excision Circles) by extracting genomic samples from the blood of 6 humans (0 years old to adults) using the QIAGEN DNeasy blood and tissue kit or the QIAmp DNA Blood mini kit and using the PCR method. A DNA fragment containing the intron RSS-κde signal joint and its peripheral sites was obtained. The base sequence of the obtained DNA fragment was analyzed using a DNA sequencer. Specifically, about 300 bp upstream and downstream primers were designed from the database from the intron RSS-κde signal joint, about 550 bp was amplified using these, and the sequence was confirmed by the Sanger sequence. The base sequences of these DNA fragments were compared using ATGC sequence assembly software (Genetics), and the parts that differed between individuals due to genetic variation due to insertion / deletion of bases were removed. The sequence was identified. Furthermore, a total of about 500 bp of the nucleotide sequence up to about 250 bp from the center of the common sequence of the binding portion was identified and used as the KREC500 sequence. The nucleotide sequence information of the KREC500 sequence is shown in SEQ ID NO: 2. Hereinafter, the DNA represented by the KREC500 sequence may be referred to as KREC500.

1-2. Preparation of plasmid OligoDNA of TREC500 sequence and KREC500 sequence was synthesized using a DNA synthesizer. Each oligo DNA was integrated into a different pCR2.1 vector (Invitrogen) by TA cloning, and the obtained plasmids were designated as pCR-TREC500 and pCR-KREC500, respectively. Next, a DNA fragment containing TREC500 and a DNA fragment containing KREC500 were excised from these plasmids by the restriction enzyme EcoRI and inserted into the EcoRI recognition site of multiple cloning sites of different pcDNA3.1 plasmids (Invitrogen). did. Furthermore, the CMV promoter sequence of the pcDNA3.1 plasmid was deleted with BglII and BamHI so that transcription of the inserted DNA fragment did not occur, and the obtained plasmids were designated as pTREC500 and pKREC500, respectively.

Furthermore, in pTREC500, a plasmid pTREC-KREC containing both TREC500 and KREC500 was prepared by incorporating a DNA fragment containing KREC500 into the NotI recognition site of the multicloning site of the pcDNA3.1 plasmid. The DNA fragment containing KREC500 was prepared by excising from pCR-KREC500 using restriction enzymes BamHI and NotI.

2. 2. Preparation of transgenic cells 2-1. Gene transfer The gene transfer of pTREC500, pKREC500, and pTREC-KREC into the cell line K562 derived from spinal leukemia by electroporation (Biorad Gene pulsar) was performed.

Three days after gene transfer, each cell group was selected with neomycin. Next, single-cell cloning was performed on the neomachine-resistant cell group, and a clone having TREC500 and / or KREC500 as one copy was selected by the FISH method (fluorescent in situ hybridization).

2-2. Confirmation of copy number For clones selected from each cell group, genomic DNA was extracted using a DNA blood and Tissue kit (QIAGEN). In order to confirm the copy number of TREC500 and KREC500, droplet digital PCR was performed using primers and probes for RNase P and RPP30 (Ribonuclease P / MRP Subunit P30) contained in 2 copies per cell. .. From the results of droplet digital PCR, it was confirmed that the ratio of TREC500 / RPP30 and the ratio of KREC500 / RPP30 were both 0.5 and the ratio of RNaseP / RPP30 was 1 in the selected clones. ..

A cell containing one copy of TREC500 with respect to the cell line K562 prepared as described above is referred to as K562-TREC500. Similarly, a cell containing one copy of KREC500 with respect to the cell line K562 is referred to as K562-KREC500, and a cell containing one copy of TREC500 and KREC500 with respect to the cell line K562 is referred to as K562-TREC-KREC.

<Making filter paper blood>
1. 1. Preparation of filter paper blood for preparing a calibration curve Fresh frozen plasma was mixed with a concentrated red blood cell solution to prepare an red blood cell solution having a hematocrit value of 62%. Next, K562-TREC500, K562-KREC500, and K562-TREC-KREC were added to separate erythrocyte fluids at predetermined cell concentrations (0, 10, 20, 50, 100, 200, 500, 1000, and 10000 cells /). The mixture was mixed so as to have 9 types of μl) to obtain an erythrocyte-cell mixture. 50 μl of the red blood cell-cell mixture was spotted on a filter paper (model number: 09800010, Advantech Toyo Co., Ltd.) and dried at room temperature. A total of nine spots containing each cell at these nine cell concentrations were set as one set to prepare filter paper blood for preparing a calibration curve for each cell.

2. 2. Preparation of Control Filter Paper Blood Considering that the lower limit of the white blood cell count of a 0-month-old infant is 5000 cells / μl, the red blood cell-cell mixture shown in the following (A) and (B) was prepared. The erythrocyte fluid before mixing the cells was prepared by the same method as described in "1. Preparation of filter paper blood for preparing a calibration curve" above.

(A) Positive control A erythrocyte-cell mixture containing only cell line K562 as cells other than erythrocytes at a cell concentration of 5000 cells / μl (TREC and KREC are not detected).

(B) The following three types of erythrocyte-cell mixed solutions were prepared in which the total number of the negative control cell line K562 and the cells derived from the cell line was 5000 cells / μl.
A erythrocyte-cell mixture containing 200 cells / μl of K562-TREC500 and 4800 cells / μl of cell line K562 as cells other than erythrocytes (negative control 1).
Erythrocyte-cell mixture containing 200 cells / μl of K562-KREC500 and 4800 cells / μl of cell line K562 as cells other than erythrocytes (negative control 2).
-A erythrocyte-cell mixture containing 200 cells / μl of K562-TREC-KREC and 4800 cells / μl of cell line K562 as cells other than erythrocytes (negative control 3).

Next, 50 μl of the prepared red blood cell-cell mixture was spotted on a filter paper (model number: 09800010, Advantech Toyo Co., Ltd.) and dried at room temperature. A set of positive control spots and any of the negative control spots 1 to 3 was used as a control filter paper blood for each cell (K562-TREC500, K562-KREC500 or K562-TREC-KREC).

3. 3. Preparation of newborn filter paper blood For 22 newborn babies born at the National Center for Growth Medicine Research Institute, excluding preterm and premature babies, after obtaining the consent of the substitute in writing, slight scratches on the heel with a needle etc. Blood was collected by impregnating the filter paper (model number: 09800010, Toyo Advantech Co., Ltd.) directly from the capillaries. It was dried at room temperature to give newborn filter paper blood to each newborn. Generally, one spot contains about 50 μL of blood.

<Measurement of Ct value and calculation of TREC and KREC concentrations>
For one set of filter paper blood for preparing a calibration curve, one set of control filter paper blood, and newborn filter paper blood, one punch piece was punched out for each spot using a 3.2 mm punch, and each well of a 96-well plate was punched out. I put one in each. A set of filter paper blood for preparing a calibration curve and control filter paper blood was prepared for each plate.

1. 1. Washing 80 μl of purification solution (QIAGEN) was added to each well, and the well plate was centrifuged at 2125 × g for 30 seconds. The well plate was allowed to stand at room temperature for 10 minutes, centrifuged at 25 ° C. and 3500 rpm for 5 minutes, and then the supernatant was discarded as much as possible. 80 μl of purification solution was added to each well, and the well plate was centrifuged at 25 ° C. and 3500 rpm for 30 seconds. The well plate was allowed to stand at room temperature for 10 minutes, centrifuged at 25 ° C. and 3500 rpm for 5 minutes, and then the supernatant was discarded as much as possible. 80 μl of Mili Q water was added to each well, and the well plate was centrifuged at 25 ° C. and 3500 rpm for 30 seconds, and then the supernatant was discarded as much as possible.

2. 2. Elution To each well of the well plate that had undergone the washing step described above, 20 μl of an elution solution (QIAGEN) containing yeast tRNA (invitrogen) at a concentration of 10 μg / ml was added. The well plate was sealed and an elution operation was performed at 99 ° C. for 30 minutes using a thermal cycler. The well plate was cooled to room temperature, stirred with a vortex mixer, and then centrifuged at 25 ° C. and 3500 rpm for 30 seconds. The DNA eluate (20 μl) obtained in each well was transferred to tubes separately.

3. 3. Quantitative PCR reaction Quantitative PCR reaction was performed using LightCycler® 480 II (Roche) using 2 μl (corresponding to Template DNA in Table 1) of 20 μl of each obtained DNA eluate. The composition (per well) of the reaction solution of the quantitative PCR reaction is as shown in Table 1, and the quantitative PCR reaction was performed by a double repeat test (duplicate). The sequences of primers and probes are as follows.

= TREC primer and probe sequences =
TREC Fw primer: CCATGCTGACACCTCTGGT (SEQ ID NO: 3)
-TREC Rv primer: TCGTGAGAACGGGTGAATGAAG (SEQ ID NO: 4)
-TREC probe: 5'-FAM-CACGGTGATGCATAGGCACCTGC-MGB-3'(SEQ ID NO: 5)
= KREC primer and probe sequences =
-KREC Fw primer: TCAGCGCCCCATTACGTCTT (SEQ ID NO: 6) -KREC Rv primer: GTGAGGGACACGCAGCC (SEQ ID NO: 7)
-KREC probe: 5'-FAM-CCAGCTTTACCCTAGAG-MGB-3'(SEQ ID NO: 8)

定量ＰＣＲ反応は、はじめに、初期変性反応を９５℃、５分で１サイクル行った。続いて、変性反応（９５℃、１０秒）、アニーリング反応（６０℃、３０秒）及び、伸長反応（７２℃、１秒）を順に繰り返し４５サイクル行った。得られた増幅曲線から、各ＤＮＡ溶出液のＣｔ値を算出した。なお、コントロールろ紙血から得たＤＮＡ溶出液を用いた定量ＰＣＲ反応の結果から、定量ＰＣＲ反応が適切に行われていることも確認した。

In the quantitative PCR reaction, first, the initial denaturation reaction was carried out at 95 ° C. for 5 minutes for one cycle. Subsequently, the denaturation reaction (95 ° C., 10 seconds), the annealing reaction (60 ° C., 30 seconds), and the extension reaction (72 ° C., 1 second) were repeated in this order for 45 cycles. From the obtained amplification curve, the Ct value of each DNA eluate was calculated. From the results of the quantitative PCR reaction using the DNA eluate obtained from the control filter paper blood, it was also confirmed that the quantitative PCR reaction was appropriately performed.

4. Calculation of TREC and KREC Concentrations For each of TREC and KREC, Ct values corresponding to those having a cell concentration of 10 to 1000 cells / μl of filter paper blood for preparing a calibration curve were plotted on the coordinates to prepare a calibration curve. The respective calibration curves are shown in FIGS. 1 and 2. FIG. 1 shows a calibration curve obtained from the results of quantitative PCR reaction of TREC500 with respect to the DNA eluate obtained from the filter paper blood containing K562-TREC500 and the filter paper blood containing K562-TREC-KREC. FIG. 2 shows a calibration curve obtained from the results of a quantitative PCR reaction of KREC500 on a DNA eluate obtained from a filter paper blood containing K562-KREC500 and a filter paper blood containing K562-TREC-KREC. Is shown. In FIGS. 1 and 2, the vertical axis represents the Ct value, and the horizontal axis represents the cell concentration (pieces / ul) of the red blood cell-cell mixture used for preparing the filter paper blood for preparing the calibration curve, and is contained in the mixture. It is synonymous with the TREC concentration or KREC concentration (number of copies / ul) of. The horizontal axis is shown on a logarithmic scale. The formula of the calibration curve of FIG. 1 is represented by y = −1.238 ln (X) + 41.85, and the formula of the calibration curve of FIG. 2 is represented by y = −1.211 ln (X) + 37.186. .. From FIGS. 1 and 2, it was found that the calibration curve created in this example was a stable linear shape.

FIG. 3 shows a state in which the Ct values determined by the quantitative PCR reaction of TREC are plotted on the calibration line of FIG. 1 for the DNA eluate obtained from 22 neonatal filter paper bloods (samples). The definitions of the vertical axis and the horizontal axis are the same as those in FIG. From FIG. 3, the plots of the screening negative (TREC detection) samples of 18 out of 22 subjects are shown by triangles, but all of them are arranged on the calibration curve, and the stability of the calibration curve can be seen from this. At this time, the four samples were positive for screening (TREC was not detected), and no Ct value was obtained because there was no amplification by PCR, and the plot is not shown. In addition, among the screening negative samples in the figure, plots with extremely low Ct values (indicated by black triangles) are samples of patients suffering from transient lymphopenia.

Further, the TREC concentration and the KREC concentration of the neonatal filter paper blood were calculated from the Ct values determined by the quantitative PCR reaction of the DNA eluate obtained from the control filter paper blood by the following formula. Since the 3.2 mm punch piece of filter paper blood contains about 3 μl of blood and 20 μl of DNA eluate is obtained from this blood, the following formula (1) is obtained.
・ TREC concentration of newborn filter paper blood (copy / μl)
= TREC concentration (copy / μl) x 20/3 corresponding to the determined Ct value on the calibration line ・ KREC concentration (copy / μl) of neonatal filter paper blood
= KREC concentration (copy / μl) x 20/3 corresponding to the determined Ct value on the calibration line
[Reference Example 1]
1. 1. Preparation of DNA eluate from newborn specimens According to the description in "3. Preparation of newborn filter paper blood" in the <Preparation of filter paper blood> column of Example 1, the National Center for Child Health and Development Hospital, excluding premature babies and premature babies. Newborn filter paper blood was prepared from 103 newborn babies born. Then, according to the description of "1. Washing" and "2. Elution" in the <Measurement of Ct value and calculation of TREC and KREC concentration> column of Example 1, the DNA eluate obtained in each well of the well plate ( 20 μl) were transferred to tubes separately.

2. 2. Preparation of standard dilution series for calibration curve As a calibration curve plasmid for TREC, a plasmid (TREC plasmid) prepared by inserting the sequence amplified by the TREC primer used in Example 1 into pCR2.1 from healthy human genomic DNA was prepared. Using. In addition, as a calibration curve plasmid for ACTB (β-actin), a plasmid (ACTB plasmid) prepared by inserting a sequence amplified by an ACTB primer (described later) into pCR2.1 was used. As the concentration of each of the calibration curves for the plasmid becomes 22ng / μl (5 × 10 ⁹ copies / [mu] l), was prepared stock solution of plasmid standard curve for. Then, using the EASY dilution (Takara Bio Inc.) as a solvent, For ACTB to prepare a 10-fold dilution series up to 5 × 10 ⁰ copies / [mu] l, TREC for the 10-fold dilution of up to 5 × 10 ² copies / [mu] l Series were further made 2-fold diluted series from 5 × 10 ² copies / μl to 7.82 copies / μl.

3. 3. Quantitative PCR reaction The composition of the reaction solution for the quantitative PCR reaction for TREC (per well) is as shown in Table 1 in Example 1, and the composition of the reaction solution for the quantitative PCR reaction for ACTB (per well) is as follows. It is as shown in Table 2. As the Template DNA in Tables 1 and 2, the above 1. The DNA eluate obtained in the above 2. (2 μl for TREC detection and 2 μl for ACTB detection were obtained from the same DNA eluate). The standard dilution series for the calibration curve for TREC and the standard dilution series for the calibration curve for ACTB obtained in the above were used. Standard dilution series for a standard curve for ACTB was used 6 concentration of ^{5 × 10 5, 5 × 10} 4, 5 × 10 3, 5 × 10 2, 5 × 10 1, 5 × 10 0 copies / [mu] l. The standard dilution series for calibration lines for TREC are 5 × 10 ⁵ , 5 × 10 ⁴ , 5 × 10 ³ , 5 × 10 ² copies / μl 10-fold dilution series and 5 × 10 ² copies / μl to 7. A total of 10 concentrations with 2-fold dilution series up to 82 copies / μl were used. Further, as a negative control without template (Non-template control (NTC)), the template DNA in Tables 1 and 2 was replaced with EASY dilution. The quantitative PCR reaction was performed in a duplicate test.

= ACTB primer and probe sequences =
ACTB Fw Primer: ATTTCCCCTCTCAGGCATGGA (SEQ ID NO: 9)
ACTB Rv Primer: CGTCACATTCATGATGGAGTTG (SEQ ID NO: 10)
ACTB probe: 5'-HEX-GTGGCATCCACGAAAACTA-MGB-3'(SEQ ID NO: 11)

定量ＰＣＲ反応のその他の反応条件は、実施例１の＜Ｃｔ値の測定とＴＲＥＣ及びＫＲＥＣ濃度の算出＞欄の「３．定量ＰＣＲ反応」に記載の通りである。

Other reaction conditions of the quantitative PCR reaction are as described in "3. Quantitative PCR reaction" in the <Measurement of Ct value and calculation of TREC and KREC concentrations> column of Example 1.

4. Calculation of TREC concentration For ACTB, which is an elution control, a calibration curve was prepared from each copy number and Ct value of the standard dilution series for the calibration curve. From the prepared calibration curve, the copy number of ACTB in each DNA eluate was calculated. It was confirmed that no DNA elution failure occurred on condition that the copy number was 5000 copies / μl or more.

Then, for TREC, a calibration curve was prepared from each copy number and Ct value of the standard for the calibration curve, and the TREC concentration (copy / μl) on the calibration curve was calculated for each DNA eluate. In addition, the TREC concentration (copy / μl) of the neonatal filter paper blood was also calculated according to the calculation formula (1) of Example 1.

[Reference example 2]
1. 1. Preparation of DNA Eluate from Newborn Specimen DNA eluate (20 μl) was obtained from neonatal filter paper blood in the same manner as described in the column of “1. Preparation of DNA eluate from newborn specimen” in Reference Example 1. In addition, the same neonatal sample is used in Reference Example 1 and Reference Example 2.

2. 2. Preparation of standard dilution series for calibration curve As a calibration curve plasmid for ACTB (β-actin), a plasmid (ACTB plasmid) prepared by inserting a sequence amplified from healthy human genomic DNA with an ACTB primer (described later) into pCR2.1 was prepared. Using. So that the concentration of the plasmid standard curve for become 22ng / μl (5 × 10 ⁹ copies / [mu] l), was prepared stock solution of plasmid standard curve for. Then, a 10-fold dilution series was prepared using EASY dilution (Takara Bio Inc.) as a solvent.

In addition, LightMix® Modular Kit for creating a calibration curve for TREC.
Using Positive Control (200 copies / μl) attached to TREC (Roche), 6 concentrations (200, 100, 50, 25, 12.5, 6.25 copies / μl) of the 2-fold dilution series were prepared.

3. 3. Quantitative PCR reaction The composition of the reaction solution for the quantitative PCR reaction for TREC (per well) is as shown in Table 3, and the composition of the reaction solution for the quantitative PCR reaction for ACTB (per well) is as shown in Table 4 below. Is. As the template DNA in Tables 3 to 4, the above 1. The DNA eluate obtained in (1 μl for TREC detection and 1 μl for ACTB detection were obtained from the same DNA eluate). The standard dilution series for the calibration curve for TREC and the standard dilution series for the calibration curve for ACTB obtained in the above were used. For the standard dilution series for the calibration curve for TREC, 6 concentrations of 200, 100, 50, 25, 12.5, and 6.25 copies / μl were used. The standard dilution series for the calibration curve for ACTB is 5 × 10 ⁵ , 5 × 10 ⁴ , 5 × 10 ³ , 5 × 10 ² , 5 × 10 ¹ , 5 × 10 ⁰ , 5 × 10 ^-1 copy / μl. 7 concentrations were used. Further, as a templateless negative control (NTC), the template DNA in Tables 3 and 4 was replaced with EASY dilution. The quantitative PCR reaction was performed in a duplicate test.

= TREC primer and probe sequences =
The one provided in the LightMix (registered trademark) Modular Kit TREC was used.

= ACTB primer and probe sequences =
The same combination of ACTB Fw primer, ACTB Rv primer, and ACTB probe as in Reference Example 1 was used.

Then, a quantitative PCR reaction was carried out using ABI7500 (Applied Biosystems). First, the reverse transcription reaction was carried out at 63 ° C. for one cycle, and the initial denaturation reaction was carried out at 95 ° C. for one cycle. Subsequently, the denaturation reaction (95 ° C.), the annealing reaction (60 ° C.), and the extension reaction (72 ° C.) were repeated in this order for 45 cycles. The Ct value of each reaction solution was calculated from the obtained amplification curve.

4. Calculation of TREC Concentration The TREC concentration (copy / μl) of neonatal filter paper blood was calculated by obtaining a calibration curve for this reference example according to the method described in “4. Calculation of TREC concentration” of Reference Example 1.

5. Comparison of the results of Reference Example 1 and Reference Example As a result of measuring the TREC value of the same sample by different methods, the converted value (TREC concentration (copy / μl) of neonatal filter paper blood) is large even if the same sample is used. It was different. Specifically, there was a tendency that the converted value of Reference Example 2 was clearly smaller than the converted value of Reference Example 1. On the other hand, when the Ct values used to obtain this converted value were compared, there was a seemingly contradictory tendency that the Ct value of Reference Example 2 was clearly smaller than the Ct value of Reference Example 1. From here, the difference in the calibration curve in the two methods causes the difference in the converted value. More specifically, when the calibration curves obtained in Reference Examples 1 and 2 are plotted on the same coordinates, Reference Example 2 It was suggested that the calibration curve of Reference Example 1 may be located closer to the origin than Reference Example 1, that is, the rise of the amplification curve obtained in Reference Example 2 may be earlier than that of Reference Example 1.

6. Comparison of Results between Example 1 and Reference Example 1 The calibration curve according to Example 1 and the calibration curve according to Reference Example 1 were compared. The results are shown in FIG. The black circles are the results of Example 1, and the white squares are the results of Reference Example 1. The graph of artificial filter paper blood in the figure is the same as the calibration curve in FIG. 1, but in order to compare with the result of Reference Example 1, the cell concentration (TREC concentration) on the horizontal axis is determined by the following formula for red blood cells. -The value per cell mixture (value in FIG. 1) is converted to the value per artificial filter paper blood (value in FIG. 4, but indicated by the log value).

Artificial filter paper Blood concentration (/ μl) = Red blood cell-cell mixture concentration (/ μl) × 3/20

The present invention can be used to assess the likelihood that a newborn will have severe combined immunodeficiency disease (SCID).

Claims (15)

At least one of the TREC (T-cell Receptor Excision Circles) nucleic acid fragment containing the signal joint portion and the KREC (Kappa-deleting Receptor Excision Circles) nucleic acid fragment containing the signal joint portion is introduced into the cell or liposome. There are particles. The particle according to claim 1, wherein the nucleic acid fragment of TREC including the signal joint portion and the nucleic acid fragment of KREC containing the signal joint portion are introduced. The particle according to claim 1 or 2, wherein all of the nucleic acid fragments are in the range of 400 bp or more and 600 bp or less, and at least 80 bp or more are separated from both ends of the nucleic acid fragment to the signal joint portion. The particle according to any one of claims 1 to 3, wherein the nucleic acid fragment is introduced into the cell. The particle according to claim 4, wherein the cell does not have endogenous TREC and KREC. The particle according to any one of claims 1 to 5, wherein a predetermined number of the nucleic acid fragments are contained. A sample in which the particles according to any one of claims 1 to 6 are contained in a predetermined concentration (number of particles / volume of liquid), or the liquid is impregnated into a fiber body. The sample according to claim 7, wherein the liquid contains at least one of red blood cells and plasma. The sample according to claim 7 or 8, which has a plurality of spots in which the liquid is impregnated into the fiber body, and the concentrations of the particles differ between the spots. A kit comprising the particles according to any one of claims 1 to 6 or the sample according to any one of claims 7 to 9. It is selected from the group consisting of a primer for gene amplification of the nucleic acid fragment of TREC, a primer for gene amplification of the nucleic acid fragment of KREC, a probe for the nucleic acid fragment of TREC, and a probe for the nucleic acid fragment of KREC. The kit of claim 10, comprising at least one. A method for evaluating at least one amount of TREC and KREC contained in a blood sample by using a gene amplification method.
A method in which the sample according to any one of claims 7 to 9 is used as a control sample or a sample for preparing a calibration curve. The method according to claim 12, wherein the blood sample is a filter paper blood sample for a newborn baby. 13. Based on the result of evaluating at least one amount of TREC and KREC by the method according to claim 13, the possibility that the newborn baby has severe combined immunodeficiency disease (SCID) is evaluated. The method described in. A nucleic acid construct containing at least one of a TREC nucleic acid fragment containing a signal joint portion and a KREC nucleic acid fragment containing a signal joint portion (however, the full length of TREC and the full length of KREC are not included).

Images