JPWO2016063991A1 - Beauty method and evaluation method for improving skin condition caused by suppression or enhancement of stratum corneum peeling - Google Patents

Abstract

Cosmetic method for improving skin condition caused by enhancement / suppression of stratum corneum detachment using a novel endogenous inhibitor that inhibits mesotrypsin activity, evaluation method for suppression / enhancement of stratum corneum detachment, and stratum corneum Provided is a screening method for a peeling accelerator and a stratum corneum peeling inhibitor. Based on the finding that serpin B12 functions as an endogenous trypsin inhibitor that inhibits the activity of mesotrypsin, known as the starting protease for stratum corneum detachment.

Description

  The present invention is based on the new knowledge that the expression of serpin B12 is closely involved in exfoliation of the stratum corneum. The present invention relates to a method for evaluating suppression / enhancement and a screening method for a stratum corneum peeling accelerator / a stratum corneum peeling inhibitor.

  The outermost layer of the epidermis, the stratum corneum (SC), consists of keratinized cells (keratinocytes) and a continuous extracellular lipid layer, forming a physiochemical barrier to effectively protect the body from environmental disasters. Protect. SCs are created continuously through terminal differentiation of keratinocytes. At the same time, cell shedding (detachment) occurs and the SC is maintained at a constant thickness. With normal detachment, individual keratinocytes or small aggregates detach from the skin surface. This process is undetectable in healthy people, but in some pathological conditions there is an imbalance between SC creation and ablation.

  Lundstrom and Egelrud report that chymotrypsin-like serine protease exists in SC and is involved in detachment (Non-patent Document 1). This enzyme was purified from human foot SC as a stratum corneum chymotrypsin enzyme, and a cDNA encoding the stratum corneum chymotrypsin enzyme was isolated from a human keratinocyte cDNA library (Non-patent document 2; Non-patent document). 3). The present inventor has shown that not only chymotrypsin enzyme but also trypsin-like serine protease is involved in the SC exfoliation process other than the sole. Recent studies reveal that the human tissue kallikrein gene family encoding 15 serine proteases (called kallikreins 1-15 (KLK1-15)) is located as a cluster on chromosome 19q13.4. (Non-patent document 4; Non-patent document 5). Many of these serine proteases are widely expressed in human tissues, including skin. Among these kallikrein family members, it has been reported that kallikrein 7 (KLK7, hK7) and kallikrein 5 (KLK5, hK5) are involved in stratum corneum detachment (Non-patent document 6 and Non-patent document 7). Kallikrein 8 (KLK8, hK8) is a serine protease active in the human epidermis and has been reported to be involved in the proteolytic cascade in the skin barrier (Non-patent Document 8).

  On the other hand, three different types of trypsinogen are present in human pancreatic juice. These trypsinogens are called cationic trypsinogen, anionic trypsinogen, and mesotrypsinogen based on their equipotential points. According to recent studies, these trypsinogens are encoded by different genes PRSS1, PRSS2, and PRSS3 (Non-patent Document 9). Trypsinogen 1 which is a PRSS1 gene product and trypsinogen 2 which is a PRSS2 gene product are major digestive pancreatic proteases. PRSS3 is a mesotrypsinogen gene and at least two splicing variants are generated (trypsinogen 3 and 4). All of these trypsinogens have the very highly conserved enteropeptidase-activated putative cleavage site sequence DDDDK-I present in pancreatic trypsinogen from various species (Light and Janska, 1989). . Trypsinogen is expressed not only in the pancreas but also in other tissues, including epithelial cells of various tissues and the human brain. Interestingly, mesotrypsin differs from the other two trypsins in substrate specificity and inhibitor sensitivity. Mesotrypsin does not cleave protein substrates very much. Its most characteristic property is resistance to natural trypsin inhibitor α1-trypsin inhibitor, pancreatic secretory trypsin inhibitor (Kazal type), soybean trypsin inhibitor (Kunitz type) and the like. These findings suggest a possible involvement of trypsin in various physiological responses in addition to intestinal digestion.

  The inventor performed cDNA cloning of the trypsinogen gene from a human keratinocyte cDNA library, resulting in the isolation of two splicing isoforms of the mesotrypsinogen gene PRSS3, one of which is identical to trypsinogen 4 (brain trypsinogen), and The other was different only in the exon encoding the N-terminal region and was named trypsinogen 5 (Non-patent Document 10).

  Both isoforms have the activation sequence DDDDK-I. DDDDK-I is hardly cleaved by trypsin itself because of the presence of mainly negatively charged residues at the cleavage site. In contrast, enteropeptidase is highly specific for the DDDDK-I sequence (Non-patent Document 11). For example, the catalytic efficiency of enteropeptidase for bovine trypsinogen is 34,000 times that for bovine trypsin. Thus, enteropeptidase is the only enzyme that physiologically converts trypsinogen to trypsin. It has also been found that enteropeptidase is present exclusively in the granular layer of the epidermis. The expression and location of these trypsinogens and their activating enzyme enteropeptidase is consistent with the view that mesotrypsin is involved in terminal differentiation of keratinocytes.

  Many phenomena are associated with proteolytic action during terminal differentiation. In the outermost granule cells, the nucleus and all organelles disappear, the molecular weight of keratin decreases, and profilagrin is processed into filaggrin. Recent studies have shown that the serine protease inhibitor, lympho-epicerial-casal-type 5 inhibitor (LEKTI) is important for stratum corneum detachment. A mutant SPINK5 of the LEKTI gene has been identified as a defective gene in patients with severe congenital ichthyosis-like erythroderma known as Netherton syndrome. Major stratum corneum peeling protease is strongly inhibited by LEKTI (Non-patent Document 12). SPINK5-deficient mice show hyperproliferation of epidermal proteases and symptoms similar to Netherton syndrome through excessive degradation of desmoglen-1. Multiple epidermal kallikreins may be involved in stratum corneum detachment through desmoglen 1 cleavage, and they are regulated by LEKTI.

  The stratum corneum detachment occurs when KLK acts on a desmosome exhibiting the function of cell adhesion and decomposes it. When LEKTI suppresses the action of KLK, stratum corneum detachment is also suppressed. To date, the existence of endogenous inhibitors that inhibit the activity of mesotrypsin is not known.

Arch. Dermatol. Res. 282: 234-7 (1990) J. Invest. Dermatol. 101: 200-4 (1993). Arch. Dermatol. Res. 283: 108-12 (1991). J. Biol. Chem. 275: 37397-406 (2000) J. Biol. Chem. 382: 5-14 (2001) Gene 254: 119-28 (2000) J. Invest. Dermatol. 122: 1235-44 (2004). J. Biol. Chem. 286: 687-706 (2011) Protein Pept. Lett. 12: 457-64 (2005) J. Invest. Dermatology, 130: 944-952 (2010) Trends. Biochem. Sci. 14: 110-2 (1989) J. Biol. Chem. 386: 1173-84 (2005). J. Biol. Chem. 276: 49320-49330 (2001)

  Until now, the existence of endogenous inhibitors that inhibit the activity of mesotrypsin was not known at all. An object of the present invention is to use a novel endogenous inhibitor that inhibits the activity of mesotrypsin, a cosmetic method for improving the skin condition resulting from enhancement / suppression of stratum corneum peeling, and suppression / enhancement of stratum corneum peeling It is to provide an evaluation method and a screening method for a stratum corneum peeling accelerator and a stratum corneum peeling inhibitor.

  As a result of sincerity studies, the present inventor has obtained a surprising finding that serpin B12 functions as an endogenous trypsin inhibitor that inhibits the activity of mesotrypsin known as a starting protease for stratum corneum detachment.

Accordingly, this application encompasses the following inventions:
[1] A cosmetic method for improving the skin condition resulting from increased horny layer peeling by enhancing the expression of serpin B12 in the horny layer of a subject.
[2] The enhanced expression of the serpin B12 promotes the core promoter activity in the −1 bp to −150 bp region of the serpin B12 promoter region and / or the silencer activity in the −150 bp to −600 bp region of the serpin B12 promoter region. 2. The method according to 1, which results from inhibition.
[3] A cosmetic method for improving the skin condition resulting from the suppression of stratum corneum peeling by suppressing the expression of serpin B12 in the stratum corneum of the subject.
[4] The suppression of the expression of the serpin B12 suppresses the core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or the silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region. 4. The method according to 3, which is brought about by promotion.
[5] The stratum corneum peeling is characterized by measuring the expression level of serpin B12 in a stratum corneum sample collected from the skin of a subject, and using the increase in the expression level of serpin B12 as an index for suppressing stratum corneum peeling. Evaluation method of suppression.
[6] The method according to 5, wherein the expression level of mesotrypsin in the stratum corneum sample is further measured, and a decrease in the expression level of mesotrypsin is used as an index for suppressing stratum corneum peeling.
[7] measuring the core promoter activity in the region of −1 bp to −150 bp of the serpin B12 promoter region and / or the silencer activity in the region of −150 bp to −600 bp of the serpin B12 promoter region, and increasing the core promoter activity; The method according to 5 or 6, wherein the decrease in the silencer activity is used as an index for suppressing stratum corneum peeling.
[8] The method according to any one of 5 to 7, wherein the suppression of stratum corneum peeling results from skin aging.
[9] The method according to any one of 5 to 7, wherein the suppression of stratum corneum peeling results from a skin disease selected from common ichthyosis or warts.
[10] The stratum corneum detachment is characterized in that the expression level of serpin B12 in a stratum corneum sample collected from the skin of a subject is measured, and the decrease in the expression amount of serpin B12 is used as an index of enhancement of stratum corneum separation Evaluation method of enhancement.
[11] The method according to 10, wherein the mesotrypsin expression level in the stratum corneum sample is measured, and an increase in the mesotrypsin expression level is used as an index of enhancement of stratum corneum detachment.
[12] measuring the core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or the silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region, and reducing the core promoter activity; The method according to 10 or 11, wherein the increase in the silencer activity is used as an index of the enhancement of stratum corneum detachment.
[13] The enhanced stratum corneum peeling results from a skin condition or skin disease selected from sunburn, dry skin, atopic dermatitis, psoriasis, Netherton syndrome or congenital ichthyosis-like erythroderma 10-12 The method in any one of.
[14] A method for screening a stratum corneum peeling promoter, wherein when a candidate drug is applied to a cultured cell, a drug that inhibits the expression of serpin B12 in the cell is selected as a stratum corneum peeling promoter. Method.
[15] The method according to 14, wherein an agent that enhances the expression of mesotrypsin in the cell is selected as a stratum corneum peeling promoter.
[16] An exfoliation of a drug that inhibits the core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or a drug that promotes the silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region 16. The method according to 14 or 15, characterized in that it is selected as an accelerator.
[17] The method according to any one of 14 to 16, wherein the stratum corneum peeling accelerator is used for prevention or improvement of skin aging.
[18] The method according to any one of 14 to 16, wherein the stratum corneum peeling promoter is used for prevention or treatment of a skin disease selected from ichthyosis vulgaris or warts.
[19] A screening method for a stratum corneum peeling inhibitor, wherein when a candidate drug is applied to a cultured cell, a drug that enhances the expression of serpin B12 in the cell is selected as a stratum corneum peeling inhibitor. Method.
[20] The method according to 19, wherein an agent that inhibits the expression of mesotrypsin in the cell is selected as a stratum corneum peeling inhibitor.
[21] Corneal detachment of a drug that promotes the core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or a drug that inhibits the silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region 21. The method according to 19 or 20, wherein the method is selected as an inhibitor.
[22] The stratum corneum peeling inhibitor is used for the prevention, improvement, or treatment of a skin condition or skin disease selected from sunburn, dry skin, atopic dermatitis, psoriasis, Netherton syndrome or congenital ichthyosis-like erythroderma. The method according to any of 19 to 21, which is used.
[23] The method according to any one of 14 to 21, wherein the cultured cells are epidermal keratinocytes.
[24] A medical method for treating a skin disease caused by suppression of stratum corneum peeling by enhancing the expression of serpin B12 in the stratum corneum of a subject.
[25] A medical method for treating a skin disease caused by enhancement of stratum corneum detachment by suppressing the expression of serpin B12 in the stratum corneum of a subject.
[26] A pharmaceutical composition for treating a skin disease caused by suppression of stratum corneum detachment, comprising a serpin B12 expression enhancer.
[27] A pharmaceutical composition for treating a skin disease caused by enhancement of stratum corneum detachment, comprising suppressing the expression of serpin B12.

  According to the present invention, a novel and useful cosmetic method for improving skin condition resulting from enhancement / suppression of stratum corneum peeling, evaluation method for suppression / promotion of stratum corneum peeling, and stratum corneum peeling accelerator / corneal layer peeling suppression An agent screening method can be provided. Thereby, stratum corneum peeling can be controlled and it can contribute to the prevention, improvement, or treatment of the skin state or skin disease resulting from suppression and enhancement of stratum corneum peeling.

The stratum corneum peeling mechanism based on the expression of serpin B12 is shown. Serpin B12, a novel trypsin inhibitor, inhibits the activity of mesotrypsin, the starting protease for stratum corneum peeling, and the activity of KLK5 / 7/8, the stratum corneum peeling enzyme, and is involved in stratum corneum peeling. It is a graph which shows the correlation of serpin B12 (absorbance) of a stratum corneum extract, and mesotrypsin inhibitory activity. It is a graph which shows the inhibitory activity with respect to KLK8 of serpin B12. It is a graph which shows the inhibitory activity with respect to KLK5 / 7 of serpin B12. It is a tissue staining photograph showing the expression of mesotrypsin and serpin B12 in skin tissue with thin stratum corneum (eyelid, abdomen) and skin tissue with thick stratum corneum (sputum). It is a photograph which shows the influence of serpin B12 which acts on differentiation (keratinization) of a keratinocyte. It is a photograph which shows the influence in the expression level of the serpin B12 which acts on differentiation (keratinization) of a keratinocyte. It is a tissue-staining photograph which shows that the expression of mesotrypsin is increasing in the lesion part extract | collected from the patient with atopic dermatitis. It is a graph which shows the serpin B12 expression enhancement activity of each chemical | medical agent. It is a graph which shows the serpin B12 expression inhibitory activity of each chemical | medical agent. Each region in the serpin B12 promoter region (-1500 bp (-1 bp to -1500 bp), -1200 bp (-1 bp to -1200 bp), -900 bp (-1 bp to -900 bp), -600 bp (-1 bp to -600 bp),- It is a graph which shows the transcriptional activity in 300 bp (-1 bp--300 bp), -150 bp (-1 bp--150 bp)). It is a graph which shows the transcriptional activity by deletion of the region of -1 bp to -150 bp in the serpin B12 promoter region. It is a graph which shows the transcriptional activity by deletion of the region of -300 bp to -600 bp in the serpin B12 promoter region.

  Serpin B12 is discovered by the high throughput genomic sequence and is known as a trypsin inhibitor belonging to the serpin superfamily. Serpin B12 is reported to be expressed in various organs such as brain, bone marrow, lymph node, heart, lung, liver, pancreas, testis, ovary or intestinal tract, and inhibits activities such as trypsin and plasmin (non-patented). Reference 13). However, little is known about the specific action of Serpin B12 in vivo.

  In the course of studying the involvement of epidermal mesotrypsin in stratum corneum detachment, the present inventor obtained a surprising finding that serpin B12 functions as an endogenous inhibitor of mesotrypsin. Mesotrypsin has an isoelectric point intermediate between cationic trypsinogen and anionic trypsinogen. Unlike these two trypsins, mesotrypsin has low degradability to high molecular weight proteins, so that endogenous mesotrypsin can be controlled so far. Inhibitors were thought to be absent. Furthermore, the present inventors have found that serpin B12 binds to KLK5 / 7/8, which is a stratum corneum peeling enzyme, and inhibits these activities. The new stratum corneum peeling mechanism discovered this time is shown in FIG. As can be seen from FIG. 1, when the expression of serpin B12 in the stratum corneum is increased, the activities of mesotrypsin and KLK5 / 7/8 are inhibited, so that stratum corneum peeling is suppressed. On the other hand, if the expression of serpin B12 in the stratum corneum is suppressed, the activity of mesotrypsin and KLK5 / 7/8 is not inhibited, so that stratum corneum detachment is promoted.

  Accordingly, in one aspect of the present invention, a cosmetic method for improving the skin condition resulting from increased horny layer peeling by enhancing the expression of serpin B12 in the horny layer of the subject, and serpin in the horny layer of the subject. By suppressing the expression of B12, a cosmetic method for improving the skin condition resulting from suppression of stratum corneum peeling is provided.

  Examples of the skin condition resulting from increased stratum corneum peeling include skin that has been acutely inflamed such as sunburn and rough skin. Examples of skin conditions resulting from suppression of stratum corneum peeling include skin aging caused by chronic inflammation induced by environmental changes such as aging, ultraviolet rays, and drying.

  Similarly, by enhancing the expression of serpin B12 in the stratum corneum of the subject, a medical method for treating a skin disease caused by increased stratum corneum peeling, and suppressing the expression of serpin B12 in the stratum corneum of the subject Provides a medical method for treating skin diseases resulting from suppression of stratum corneum detachment.

  Examples of skin diseases caused by increased exfoliation of the stratum corneum include atopic dermatitis, psoriasis, Netherton syndrome and congenital ichthyosis-like erythroderma. For example, ichthyosis vulgaris, warts and the like.

  Furthermore, the present inventor has predicted that the upstream region (−1 bp to −1500 bp) of the transcription start site in the serpin B12 gene (NM — 080474.2) [see National Center for Biotechnology Information (NCBI)] as the promoter region. When the expression control region in the region was examined, a core promoter was present in the -1 bp to -150 bp region, a silencer was present in the region of -150 bp to -600 bp, and in particular, from -150 bp to -300 bp. The region was found to have a strong silencer function. Therefore, promotion of core promoter activity in the region of -1 bp to -150 bp of the serpin B12 promoter region and / or inhibition of silencer activity in the region of -150 bp to -600 bp of the serpin B12 promoter region, particularly in the region of -150 bp to -300 bp. By this, it becomes possible to enhance the expression of serpin B12. On the other hand, inhibition of core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or promotion of silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region, particularly in the -150 bp to -300 bp region. This makes it possible to suppress the expression of serpin B12. In the present application, “core promoter activity” means an activity for controlling initiation of gene transcription, and “silencer activity” means an activity for suppressing gene transcription. These findings regarding the expression control region of human serpin B12 can be applied to the improvement of the skin condition resulting from the suppression / enhancement of stratum corneum detachment and the treatment of skin diseases resulting from the suppression / enhancement of stratum corneum detachment. Contribute.

  In another aspect of the present invention, the expression level of serpin B12 in a stratum corneum sample collected from the skin of a subject is measured, and the increase in the expression level of serpin B12 is used as an index for suppressing stratum corneum peeling. The method for evaluating suppression of stratum corneum peeling, and the expression level of serpin B12 in a stratum corneum sample collected from the skin of the subject are measured, and the decrease in the expression level of serpin B12 is used as an index of enhancement of stratum corneum peeling. The method for evaluating the enhancement of stratum corneum peeling is provided.

  The stratum corneum sample can be collected by an arbitrary method. For example, the stratum corneum such as wrinkles may be shaved with a file and collected as a stratum corneum powder. Moreover, it can also extract | collect by a tape stripping from a viewpoint of simplicity. Tape stripping is a method of collecting a stratum corneum sample by applying a piece of adhesive tape to the skin surface layer, peeling it off, and attaching the skin stratum corneum to the peeled adhesive tape. If the tape stripping method is used, it is possible to measure the expression of the serpin B12 only by taking one tape of the stratum corneum, and it is possible to evaluate the stratum corneum thickening using the serpin B12 as an index. The preferred method of tape stripping is to first clean the surface of the skin with, for example, ethanol to remove sebum, dirt, etc., and lightly place a piece of adhesive tape cut to an appropriate size (eg 2 × 5 cm) on the skin surface, This is done by applying a uniform force to the entire tape and pressing it flat, and then peeling off the adhesive tape with a uniform force. The adhesive tape may be a commercially available cellophane tape or the like. For example, Scotch Superstrength Mailing Tape (manufactured by 3M), cellophane tape (Cellotape (registered trademark); Nichiban Co., Ltd.) or the like can be used. Serpin B12 in the skin stratum corneum adhering to the adhesive tape can be obtained by removing the tape piece from an appropriate extract such as Tris-buffer (pH 8.0) (0.1 M Tris-HCl, 0.14 M NaCl, 0.1% Tween). It can be isolated and extracted from the tape by dipping in -20) and extracting the stratum corneum.

  In a preferred embodiment of the present invention, the expression of serpin B12 preferably uses an antibody specific for serpin B12, and is a well-known method in the art, for example, an immunostaining method using a fluorescent substance, a dye, an enzyme, etc., Western blotting It can be carried out by various methods such as ELISA, immunoassay, for example, ELISA and RIA. The antibody specific for serpin B12 used in the ELISA may be a monoclonal antibody or a polyclonal antibody. Methods for producing monoclonal antibodies and polyclonal antibodies are well known to those skilled in the art. For example, see Lunstrum et al., J Biol. Chem. 1986, 261: 9042-9048; Hurle et al. J Cell Science 1994, 107: 2623-2634. In the method according to the present invention, the sandwich immunoassay method is particularly preferable.

Alternatively, it can be determined by extracting RNA from a stratum corneum sample and measuring the amount of mRNA encoding serpin B12. Extraction of mRNA and measurement of the amount thereof are also well known in the art. For example, RNA is quantified by quantitative polymerase chain reaction (PCR), for example, real-time polymerase chain reaction (RT-PCR). Selection of appropriate primers for RT-PCR can be carried out by methods well known to those skilled in the art.
For RT-PCR analysis of the serpin B12 gene, for example, the following primers can be used.
Forward primer: CTGGGTTTGAATGTCAATCCCC (SEQ ID NO: 1)
Reverse primer: CACCGTGTTTCATGGTCAA (SEQ ID NO: 2)

  In the measurement described above, when the expression level of serpin B12 in the stratum corneum sample collected from the skin of the subject is significantly high or the expression level of mesotrypsin is significantly low compared to the control value, It can be evaluated that it is suppressed. On the other hand, when the expression level of serpin B12 in the stratum corneum sample collected from the skin of the subject is significantly low or the expression level of mesotrypsin is significantly high compared to the control value, the stratum corneum detachment is enhanced. Can be evaluated. For example, if the expression level of serpin B12 in a stratum corneum sample is 30% or more, preferably 50% or more, more preferably 70% or more, and most preferably 90% or more compared to the control value, “the stratum corneum peeling is suppressed. It is good to judge that. On the other hand, for example, when the expression level of serpin B12 in the stratum corneum sample is 30% or more, preferably 50% or more, more preferably 70% or more, and most preferably 90% or more compared to the control value, It may be determined that it has been enhanced. The control value is not particularly limited as long as it indicates the expression level of serpin B12 in a healthy stratum corneum. For example, a corner at a corresponding site collected from a healthy person having a good statistically significant number of skin conditions. It may be an average value of the expression level of serpin B12 in the layer sample.

  In the evaluation method for suppressing stratum corneum peeling, the expression level of mesotrypsin in the stratum corneum sample can be further measured, and the decrease in the expression level can be used as an index for suppressing stratum corneum peeling. On the other hand, in the method for evaluating the enhancement of stratum corneum peeling, the expression level of mesotrypsin in the stratum corneum sample can be measured, and the increase in the expression level can be used as an index of the enhancement of stratum corneum peeling.

  In the evaluation method of the suppression of stratum corneum peeling, the core promoter activity in the region of -1 bp to -150 bp of the serpin B12 promoter region and / or the region of -150 bp to -600 bp of the serpin B12 promoter region, particularly -150 bp to- The silencer activity in the region of 300 bp can be measured, and the increase in the core promoter activity and / or the decrease in the silencer activity can be used as an index for suppressing stratum corneum detachment. On the other hand, in the method for evaluating the enhancement of stratum corneum detachment, the core promoter activity in the region of −1 bp to −150 bp of the serpin B12 promoter region and / or the region of −150 bp to −600 bp of the serpin B12 promoter region, particularly −150 bp. Silencer activity in a region of ˜−300 bp can be measured, and the decrease in the core promoter activity and / or the increase in the silencer activity can be used as an indicator of increased stratum corneum detachment. A method for cloning a transcription regulatory region, a method for preparing a plasmid, and a method for measuring transcription control activity are well known in the art. The regulatory control activity can be measured by, for example, a luciferase assay, and the same technique as in Example 11 below can be used.

  By evaluating the suppression / enhancement of stratum corneum detachment in the test subject, it is possible to diagnose the skin condition resulting from the suppression / enhancement of the above-mentioned stratum corneum detachment and the skin disease resulting from the suppression / enhancement of stratum corneum detachment. .

  In still another aspect, the present invention provides a screening method for a stratum corneum peeling promoter, wherein when a candidate drug is applied to a cultured cell, a drug that inhibits the expression of serpin B12 in the cell is used as the stratum corneum peeling promoter. A method characterized by selection, and a screening method for a stratum corneum peeling inhibitor, wherein when a candidate drug is applied to a cultured cell, a drug that enhances the expression of serpin B12 in the cell is used as a stratum corneum peeling inhibitor A method characterized by selecting is provided.

  Serpin B12 is expressed by dissolving a candidate drug in water or a medium (for example, EpiLife (registered trademark) medium), adding it to a screening system containing cultured cells, and using a method well known in the art as described above. It can be determined by measuring the expression level of serpin B12 in the cultured cells. The cultured cells are skin cells, typically epidermal cells, and particularly preferably keratinocytes. The cultured cells may be derived from humans or other animals such as rats, mice, rabbits and the like.

Although the amount of candidate drug to be added cannot be generally specified, the concentration is about 1 ng / ml to about 1 mg / ml, preferably about 10 ng / ml to 100 μg / ml, more preferably about 100 ng / ml to 10 μg / ml. . The addition of the candidate drug is preferably performed in the presence of calcium chloride and / or S100A8 or S100A8 / A9. Culture conditions are not particularly limited, but incubation is preferably performed under 5% CO ₂ , typically at 30 to 37 ° C. for 1 to 14 hours, preferably at 34 to 37 ° C. for 2 to 7 hours.

  In the above measurement, for example, when the expression of serpin B12 in cultured cells is 30% or more, preferably 50% or more, more preferably 70% or more, and most preferably 90% or more compared to the control value, It may be determined as “agent”. On the other hand, for example, when the expression of serpin B12 in cultured cells is increased by 30% or more, preferably 50% or more, more preferably 70% or more, and most preferably 90% or more compared to the control value, “corneal layer peeling inhibitor” Judgment may be made. The control value is not particularly limited as long as it indicates the expression level of serpin B12 in a healthy stratum corneum. For example, a culture at a corresponding site collected from a healthy person having a good statistically significant number of skin conditions. It may be the average value of the expression level of serpin B12 in the cell.

  In the screening method for the stratum corneum peeling promoter, an agent that enhances the expression of mesotrypsin in the cells may be selected as a stratum corneum peeling promoter, and in the screening method for the stratum corneum peeling inhibitor, An agent that inhibits the expression of mesotrypsin in the cells may be selected as a stratum corneum peeling inhibitor.

  Furthermore, in the screening method for the stratum corneum peeling promoter, an agent that inhibits core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or a -150 bp to -600 bp region of the serpin B12 promoter region In particular, a drug that promotes silencer activity in the region of −150 bp to −300 bp may be selected as a stratum corneum peeling promoter, and in the screening method for a stratum corneum peeling inhibitor, a serpin B12 promoter region of −1 bp to Delamination of agents that promote core promoter activity in the -150 bp region and / or agents that inhibit silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region, particularly in the -150 bp to -300 bp region It may be selected as a control agent.

  The stratum corneum peeling accelerator and the stratum corneum peeling inhibitor obtained by the screening method of the present invention are caused by the improvement of the skin condition resulting from the suppression and enhancement of the above-mentioned stratum corneum peeling and the suppression and enhancement of the stratum corneum peeling. It can be used for the treatment of skin diseases.

  Next, the present invention will be described in more detail with reference to examples. In addition, this invention is not limited by this.

1. Extraction of stratum corneum The scissors were shaved with a beauty tool WIDE SCRATCH (Prime Co., Ltd.) by the method of the product manual, and the shaved stratum corneum was collected.

2. Preparation of stratum corneum extract The collected stratum corneum was weighed and then added with a lysis buffer (0.1 M Tris-HCl (pH 8.0) +0.14 M NaCl + 0.1% Tween 20). The mixture was homogenized on ice using a ten block type homogenizer (Cat. No. 357428, WHEATON) until it became all liquid. The protein amount used DC protein assay kit (Bio-Rad).

3. Purification Step 1: Desalting Treatment Purification was performed under low temperature conditions (4 ° C.) using an AKTAprime (GE Healthcare) system. The desalting column used for the desalting treatment was Hipprep 26/10 Desalting (GE Healthcare) and was performed under the conditions of the product manual. Tris-HCl (pH 8.0) was used as an elution buffer.
Step 2: Anion exchange For purification, the system of AKTAprime (GE Healthcare) was used under low temperature conditions (4 ° C). For anion exchange, purification using an anion exchange column Hiprep 16/10 Q XL (GE Healthcare) was performed. The work was performed under the conditions of the product manual. Tris-HCl (pH 8.0) + NaCl was used as an elution buffer, and the elution was performed with the NaCl concentration varied from 0 mM to 500 mM.
Step 3: Hydroxyapatite Purification was performed under low temperature conditions (4 ° C.) using a Pharmacia LKB controller LCC-501 Plus (Pharmacia) system. Using a hydroxyapatite column CHT2-I (Bio-Rad), it was performed under the conditions of the product manual. A phosphate buffer (pH 6.8) was used as an elution buffer, and elution was performed with a concentration change of 0 mM to 500 mM.
Step 4: Strong Cation Exchange Purification was performed at low temperature conditions (4 ° C.) using a Pharmacia LKB controller LCC-501 Plus (Pharmacia) system. Using Mono S 5/50 GL (GE Healthcare), it was performed under the conditions of the product manual. As an elution buffer, phosphate buffer (pH 6.0) + NaCl was used, and elution was performed with a concentration change of 0 mM to 1000 mM.
Step 5: Difference in isoelectric point For purification, a system of Pharmacia LKB controller LCC-501 Plus (Pharmacia) was used under low temperature conditions (4 ° C). Using Mono P 5/50 GL (GE Healthcare), it was performed under the conditions of the product manual. As the buffer, 0.025M Bis-Tris, pH 6.3, HCl was used as a starting buffer, and Polybuffer 74, pH 4.0, HCl was used for elution.
Step 6: Gel Filtration Purification was performed under low temperature conditions (4 ° C.) using a Pharmacia LKB controller LCC-501 Plus (Pharmacia) system. Using Mono P 5/50 GL (GE Healthcare), it was performed under the conditions of the product manual. PBS (DULBECCO'S phosphate buffer ED SALINE (Sigma)) was used as an elution buffer.

4). Measurement of inhibition of mesotrypsin activity Serine protease buffer (0.1 M Tris-HCl (pH 8.0), 0.1% Tween 20) was used as a buffer for activity measurement. Recombinant-PRSS3 (Cat. No. 3714-SE-010, R & D systems) was used for measuring the activity of mesotrypsin. As an enzyme substrate, Boc-Gln-Ala-Arg-MCA (Cat. No. 3135-V), Peptide Institute) was used. The substrate reaction was quantified by measurement with 2030 Multilabel Reader ARVO X3 (Perkin Elmer).

5. Identification of novel trypsin inhibitor The mesotrypsin inhibitory fraction derived from the stratum corneum extract was collected and subjected to the following tests.
(1) CBB staining The mesotrypsin inhibition fraction derived from the stratum corneum extract was subjected to SDS-PAGE using 5-20% e-PAGEEL (Cat. No. E-T520L, ATTO), and then only the gel. Was placed in a container, washed with MilliQ water for 5 minutes × 3 times, and stained with CBB Stain One Super (Cat. No. 11642-31, nacalai quest).
(2) Western blot analysis Samples obtained by purification were subjected to SDS-PAGE using 5-20% e-PAGEEL (Cat. No. E-T520L, ATTO), and then iBlot Gel Transfer system (Invitrogen). ) Or a semi-dry method and transferred to a PVDF membrane. The transfer membrane was washed with PBS for 5 minutes × 2 times, and then blocked with an immunoblock (Cat. No. KN001A, DS Pharma Biomedical Co., Ltd.) for about 1 hour. After blocking, washing with PBST was performed twice for 10 minutes, and washing with PBS was performed for 10 minutes × 1 time. The primary antibody was added onto the transfer membrane and allowed to react at room temperature for 1 hour or at 4 ° C. overnight. The antibody of serpin B12 is anti-SERPINB12 polyantibody (S-15) (Cat. No. sc-85145, Santa Cruz) [concentration: 1/1000], anti-SERPINB12 monoantibody (H3-1B) (C3-1). No. sc-32234, Santa Cruz) [concentration: 1/1000] was used. After the primary antibody reaction, wash with PBST for 10 minutes × 2 times and PBS wash for 10 minutes × 1 time. Add the secondary antibody onto the transfer membrane and react at room temperature for 1 hour or at 4 ° C. overnight. It was. After the secondary antibody reaction, washing with PBST was carried out for 10 minutes × 2 times and washing with PBS was carried out for 10 minutes × 1 time. ECL Prime Western Blotting Detection Reagent (Cat. No. RPN2232, GE Healthcare) was transferred onto the transfer membrane. In addition to the above, baking was performed on FUJI MEDICAL X-RAY FILM (Cat. No. 47410 07547, Fuji Film Co., Ltd.).
(3) LC-MS / MS analysis (i) Trypsin digestion of protein mixture Each dialyzed protein mixture was suspended in 20 μl of 0.1% RapiGest (Waters Co., Milford, Mass.) / 50 mM ammonium carbonate solution. . After vortexing, reduction and alkylation treatment and enzymatic digestion with L-1-tosylamide-2-phenylethylchloromethylketone treated trypsin (TPCK trypsin) were performed according to a conventional method. After digestion, trifluoroacetic acid was added to a final concentration of 0.5% in order to stop the digestion reaction and inactivate the surfactant (RapiGest).
(Ii) Protein Identification by Liquid Chromatography / Electrospray Ionization Tandem Mass Spectrometry Protein identification in the enzyme digested protein mixture was performed by the previously reported LC / MS / MS method. As a rough outline, the mixture was subjected to a fused silica trap column (100 μm inner diameter × 1 cm length, JupiterProteo C14, 10 μm, 10 μm, Pumen, 10 μm, Pumen Proteo C14, 10 μm, Pm) Torrance, CA). The trap column was desalted by flowing a gradient initial buffer (0.1% formic acid, 5% acetonitrile / distilled water) for 30 minutes, and then a fused silica analytical column (100 μm inner diameter × 12 cm length) by switching the two-way valve. , JupiterProteo C14, 4 μm, Phenomenex). Peptides in the enzyme digest were separated with a 90 minute organic solvent gradient (5-75% acetonitrile). The column flow rate was adjusted to 300 to 400 nl / min by adjusting the length (50 to 200 mm) of the split resistance capillary (50 μm inner diameter). Peptides eluted from the column were introduced by direct electrospray ionization into a hybrid tandem mass spectrometer (LTQ-Orbitrap, Thermo Fisher Scientific, Waltham, Mass.). The mass spectrometer was operated in an automatic data heterogeneous MS / MS parallel measurement mode. After obtaining a high-resolution survey scan spectrum (resolution 60,000) with an electric field FT mass spectrometer (Orbitrap), an MS / MS spectrum with five strong peaks as precursor ions is automatically used as an ion trap mass spectrometer. (LTQ). The acquired MS / MS spectrum was subjected to a database search using a SEQUEST algorithm (Thermo Fisher Scientific) running on Bioworks software, and protein identification was performed from the degree of coincidence with the sequence. A non-redundant human protein database (NCBI, 2010) was used as a sequence database for protein identification. In order to minimize the false identification of proteins, strict search criteria were used (Sf score 0.85, peptide probability 0.001, number of top matches: 1, ppm number of lipids: 10 ppm, minimum number of lipids. 1, enzyme specificity: half-tryptic or fully tryptic peptides only).

  The above experiments revealed that there is a very close correlation between serpin B12 expression and mesotrypsin inhibition (FIG. 2). The band observed in the Western blot analysis was about 72 to 74 kD, which did not coincide with 46 kD of serpin B12. This indicates that serpin B12 forms a complex with KLK8 (28 kD). It is a strong suggestion.

6). Serpin B12 KLK (KLK5 / 7/8) Inhibitory Activity Serine protease buffer (0.1 M Tris-HCl (pH 8.0), 0.1% Tween 20) was used as a buffer for activity measurement. Serpin B12 inhibitory activity was measured. KLK8 activity was measured using mesotrypsin (PRSS3) and purified recombinant-KLK8. Similarly, the activity of KLK5 was measured using recombinant-KLK5 (Cat. No. 1108-SE, R & D systems), and the activity of KLK7 was measured using purified recombinant-KLK7. As the enzyme substrate, Boc-Gln-Ala-Arg-MCA (Cat. No. 3135-V, Peptide Institute) was used. The substrate reaction was quantified by measurement with 2030 Multilabel Reader ARVO X3 (Perkin Elmer).
As shown in FIGS. 3 and 4, it was found that serpin B12 inhibits the activity of each KLK (KLK5 / 7/8).

7). Expression of serpin B12 and mesotrypsin in human tissue Rabbit antitrypsin that recognizes mouse anti-serpin B12 antibody (Cat. No. sc-32234, Santa Cruz) and mesotrypsin from skin tissue collected from human eyelids, abdomen, and eyelids Immunostaining with an antibody (Cat. No. 01-19-032000, ATHENS) was performed. As shown in FIG. 5, mesotrypsin was strongly expressed in the eyelids and abdomen with a relatively thin stratum corneum, while serpin B12 expression was hardly detected. On the contrary, in the wrinkle having a relatively thick stratum corneum, strong expression of serpin B12 was observed in the granule layer.

8. Epidermal differentiation action of serpin B12 in a three-dimensional skin model Human keratinocyte primary cultured cells (Normal Human Epidermal Keratinocytes (NHEK)) were cultured in a 75 cm ² petri dish, and pCMV-HA / Serpin B12 (for overexpression of serpin B12) 2 μg / ml) was transfected with FuGENE® HD Transfection Reagent (Cat. No. E2311, Promega), and si-Serpin B12 (Cat. Transfection Reagent (Cat. No. 13778075, invi Transfected with Rogen). The sequence of siRNA is as follows.
Hs_SERPINB1 — 2273 — s: 5′rGrGrArAUrCUrCUrCrCrArArGUrCrCrCrATT
Hs_SERPINB1 — 2273as: 5′UrGrGrGrArCUUrGrGrArGrArGrAUUrCrCTT
After transfection, the cells were cultured for 2 days in the incubator until they became confluent and exposed to air. Then, it culture | cultivated according to the standard protocol of 3D Keratinocyte Starter Kit (Cat.No.PR3D-K-50, CELLnTEC), collect | recovered by the 14th day, and performed tissue analysis by hematoxylin eosin dyeing | staining. As a standard protocol procedure of 3D Keratinocyte Starter Kit (Cat. No. PR3D-K-50, CELLnTEC), specifically, the attached cell insert was placed in a cell culture dish (60 mm), The cells were infiltrated with Progenitor Cell Targeting (PCT) medium CnT-Prime medium (Cat. No. CnT-PR) for various epithelial cells accurately reproducing the niche environment. Thereafter, a suspension of cultured cells obtained by transfecting NHEK with pCMV-HA / Serpin B12 was added to each insert, and CnT-Prime medium was added to the cell culture dish (60 mm). The dishes were placed in a CO ₂ incubator and cultured for 2 days until the cells were confluent. Replace the medium inside and outside the insert with a special medium CnT-Prime 3D Barrier medium (Cat. No. CnT-PR-3D, CELLnTEC) for keratinocyte three-dimensional culture that enables rapid cell differentiation and multi-layering. ₂ Placed in incubator and cultured overnight. As an air exposure operation for multilayering the epidermis layer, all media inside and outside the insert were removed with an aspirator, and a differentiation medium CnT-Prime 3D Barrier medium was added outside the insert. Thereafter, the differentiation medium CnT-Prime 3D Barrier medium was changed every 3 days only outside the insert.
When serpin B12 is enhanced, residual nuclear components are observed in the stratum corneum cells, and the stratum corneum becomes thick. On the other hand, when serpin B12 is suppressed, it is confirmed that the stratum corneum becomes very thin. (FIG. 6).

In addition, the keratinocyte transfection was carried out in the same manner as above except for the addition amount of transfection of serpin B12 (0.5 μg / ml, 1.0 μg / ml or 2.0 μg / ml) and the culture period after transfection (3 days). The concentration dependency of serpin B12 in differentiation (keratinization) was examined.
As a result, it was confirmed that there was a significant correlation between the expression level of serpin B12 and keratinocyte keratinization (FIG. 7). In particular, when 2.0 μg / ml of pCMV-HA / SerpinB12 is used, the stratum corneum becomes very thick and the residual core component is seen in the stratum corneum, while the granule layer is not flattened. Recognize.

9. Expression of mesotrypsin in patients with atopic dermatitis Skin tissue was collected from patients with atopic dermatitis and immunostained with a rabbit antitrypsin antibody (Cat. No. 01-19-032000, ATHENS) that recognizes mesotrypsin Went. As shown in FIG. 8, a portion in which mesotrypsin is strongly expressed is seen in patients with atopic dermatitis.

10. Screening for Serpin B12 Expression Modulating Agents Quantitative PCR was performed using the following primer sets to measure the expression of serpin B12 in keratinocytes before and after the addition of each drug.
Forward primer: CTGGGTTTGAATGTCAATCCCC (SEQ ID NO: 1)
Reverse primer: CACCGTGTTTCATGGTCAA (SEQ ID NO: 2)
The obtained values were corrected and compared based on the expression level of G3PDH (forward primer: GGTGAAGGTCGGAGTCAACGGATTTGGTCG (SEQ ID NO: 3), reverse primer: ATTTGGAACATGTATAACCATGTTAGTGAGG (SEQ ID NO: 4)).
For the cDNA used, keratinocytes were cultured in a serum-free medium, and after confluence, 1.5 mM calcium was added, and further cultured for 2 days. Then, the following drugs were added and cultured for 24 hours, followed by treatment with Isogen (Nippon Gene). The mRNA was prepared by the usual method. Specifically, 100 μl of chloroform was added and shaken up and down until chloroform and Isogen were mixed. After leaving still at room temperature for 2-3 minutes, it centrifuged at 4 degreeC and 12000g for 15 minutes. The supernatant was transferred to a new tube and 250 μl of isopropanol was added. Shake up and down and mix for 10 minutes at room temperature. After centrifugation at 12,000 g for 15 minutes at 4 ° C., the supernatant was removed, and 1 ml of 70% ethanol was added to the precipitate and shaken up and down to remove the precipitate. After centrifugation at 12,000 g for 5 minutes at 4 ° C., the supernatant was discarded and ethanol was completely removed. After drying the precipitate for about 10 minutes, the precipitate was dissolved with an appropriate amount of water. Using 1 μg of RNA, reverse transcription was performed by a conventional method and subjected to PCR.
Each drug was dissolved in DMSO to a concentration of 10 mg / ml, and then diluted with PBS or a medium to a final concentration of 10 μg / ml.
The results are shown in FIGS.

11. Identification of transcriptional regulatory region of human serpin B12 Using Human Genomic DNA (Cat. No. G3041) [PROMEGA] as a template, targeting about 1500 bp upstream (-1 bp to -1500 bp) of the transcription start site of serpin B12 gene Cloning was performed. As a region, -1500 bp (-1 bp to -1500 bp), -1200 bp (-1 bp to -1200 bp), -900 bp (-1 bp to -900 bp), -600 bp (-1 bp to -600 bp), -300 bp (-1 bp to-) 300 bp) and −150 bp (−1 bp to −150 bp) were amplified by polymerase chain reaction (PCR) using the primers of SEQ ID NOs: 5 to 11 below.
-1500 bp forward primer: TTGGTACTACTAGATTGGGTGGGAAG (SEQ ID NO: 5)
-1200 bp forward primer: TTTGGTACCCTTCCTCTCTCTCTCCTG (SEQ ID NO: 6)
-900 bp forward primer: TTGGGTACCGGGTGAGAATGTTAACAAGG (SEQ ID NO: 7)
-600 bp forward primer: TTTGGTACCAGGGTCTTTGCAGATGTG (SEQ ID NO: 8)
-300 bp forward primer: TTTGGTACCCTGGGAGAATAAAACTCCCTGC (SEQ ID NO: 9)
-150 bp forward primer: TGGGGGTACCTAGTTTTCCAGTTCTTAATAGC (SEQ ID NO: 10)
Common reverse primer: GCGGCTAGCTGTAAAAACTTATAACGATC (SEQ ID NO: 11)
For the PCR reaction, PrimeSTAR (R) Max DNA Polymerase (Cat. No. R045A, TAKARA) was used. A sequence cleaved by restriction enzymes KpnI and NheI is added to them, and incorporated into a firefly luciferase reporter vector pGL4.12 [luc2CP] (Cat. No. E6671, PROMEGA) by a ligation reaction, and then competent cells are incorporated. Transformation with plasmid. Ligation High (Cat. No. LGK-101, TOYOBO) was used for the ligation reaction, and One Shot (R) OmniMAX ^™ 2 T1R Chemically Competent E. coli (Cat. No. C8540-03, Invitrog) was used as the competent cell. ) Was used. Thereafter, the target plasmid was purified from the transformant. For purification of the plasmid, QIAprep Spin Miniprep Kit (Cat. No. 27106, QIAGEN) and EndoFree Plasmid Maxi Kit (Cat. No. 12362, QIAGEN) were used. Using the purified plasmid, human keratinocyte primary culture cells (Normal Human Epidermal Keratinocytes (NHEK)) were transfected with FuGENE (R) HD Transfection Reagent (Cat. No. E2311, Promega). After transfection, the cells were cultured for 48 hours in an incubator. Thereafter, the transcriptional regulatory region of serpin B12 was determined by conducting a luciferase assay using Dual-Luciferase® Reporter Assay System (Cat. No. E1980, Promega). PGL4.74 [hRluc / TK] (Cat. No. E6921, Promega) was used as a standard for the luciferase assay.
The results are shown in FIG.

-1500 bp (-1 bp to -1500 bp), -1200 bp (-1 bp to -1200 bp), -900 bp (-1 bp to -900 bp), -600 bp (-1 bp to -600 bp), created for identification of the transcriptional regulatory region, Using the pGL4.12 plasmid containing a region of -300 bp (-1 bp to -300 bp) as a template, site-directed mutagenesis was performed in order to delete the -1 bp to -150 bp region (Δ-1 bp to -150 bp). Amplification was carried out by the reaction method (PCR) using the primers of SEQ ID NOs: 12 to 13 below.
Forward primer for -1 bp to -150 bp deletion: AATGACCTGTCTAGCCTCGAGGATATC (SEQ ID NO: 12)
Reverse primer for -1 bp to -150 bp deletion: AGGCTAGCAGGGTCATTATCATCCCTG (SEQ ID NO: 13)
PrimeSTAR® Mutagenesis Basal Kit (Cat. No. R046A, TAKARA) was used for the site-directed mutagenesis polymerase chain reaction. Thereafter, competent cells were transformed with the plasmid. One Shot (R) OmniMAX ^™ 2 T1R Chemically Competent E. coli (Cat. No. C8540-03, Invitrogen) was used as the competent cell. Thereafter, the target plasmid was purified from the transformant. For purification of the plasmid, QIAprep Spin Miniprep Kit (Cat. No. 27106, QIAGEN) and EndoFree Plasmid Maxi Kit (Cat. No. 12362, QIAGEN) were used. Using the purified plasmid, human keratinocyte primary culture cells (Normal Human Epidermal Keratinocytes (NHEK)) were transfected with FuGENE (R) HD Transfection Reagent (Cat. No. E2311, Promega). After transfection, the cells were cultured for 48 hours in an incubator. Thereafter, the transcriptional regulatory region of serpin B12 was determined by conducting a luciferase assay using Dual-Luciferase® Reporter Assay System (Cat. No. E1980, Promega). PGL4.74 [hRluc / TK] (Cat. No. E6921, Promega) was used as a standard for the luciferase assay.
As shown in FIG. 12, transcriptional activity was hardly observed due to the deletion of the -1 bp to -150 bp region, indicating that the -1 bp to -150 bp region functions as a core promoter.

The template of pGL4.12 plasmid containing -1500 bp (-1 bp to -1500 bp), -1200 bp (-1 bp to -1200 bp), -900 bp (-1 bp to -900 bp) prepared for identification of the transcription regulatory region As follows, in order to delete the -300 bp to -600 bp region (Δ-300 bp to -600 bp), site-directed mutagenesis was amplified by polymerase chain reaction (PCR) using the primers of SEQ ID NOs: 14 to 15 below. .
-300 bp to -600 bp deletion forward primer: TGGAAATTGGGAGAATAAACTCCTG (SEQ ID NO: 14)
Reverse primer for -300 bp to -600 bp deletion: TCTCCCAATTTCCAAACAAGGTCAT (SEQ ID NO: 15)
PrimeSTAR (R) Mutagenesis Basal Kit (Cat. No. R046A, TAKARA) was used for the site-directed mutagenesis polymerase chain reaction.
For cloning the -300 bp to -600 bp region, human genomic DNA (G3041) [PROMEGA] was used as a template and amplified by polymerase chain reaction (PCR) using the primers of SEQ ID NOs: 8 and 16 below.
-600 bp forward primer: TTTGGTACCAGGGTCTTTGCAGATGTG (SEQ ID NO: 8)
-300 bp reverse primer: TTTGCTAGCTGGTTCTGGGGGACAAAC (SEQ ID NO: 16)
For the PCR reaction, PrimeSTAR (R) Max DNA Polymerase (Cat. No. R045A, TAKARA) was used. A sequence cleaved by restriction enzymes KpnI and NheI is added to them, and incorporated into a firefly luciferase reporter vector pGL4.12 [luc2CP] (Cat. No. E6671, PROMEGA) by a ligation reaction, and then competent cells are incorporated. Transformation with plasmid. Ligation High (Cat. No. LGK-101, TOYOBO) was used for the ligation reaction, and One Shot (R) OmniMAX ^™ 2 T1R Chemically Competent E. coli (Cat. No. C8540-03, Invitrog) was used as the competent cell. ) Was used.
Thereafter, the target plasmid was purified from the transformant. For purification of the plasmid, QIAprep Spin Miniprep Kit (Cat. No. 27106, QIAGEN) and EndoFree Plasmid Maxi Kit (Cat. No. 12362, QIAGEN) were used. Using the purified plasmid, human keratinocyte primary culture cells (Normal Human Epidermal Keratinocytes (NHEK)) were transfected with FuGENE (R) HD Transfection Reagent (Cat. No. E2311, Promega). After transfection, the cells were cultured for 48 hours in an incubator. Thereafter, the transcriptional regulatory region of serpin B12 was determined by performing a luciferase assay using Dual-Luciferase® Reporter Assay System (Cat. No. E1980, PROMEGA). PGL4.74 [hRluc / TK] (Cat. No. E6921, PROMEGA) was used as a standard for the luciferase assay.
FIG. 13 shows that the region of −150 bp to −600 bp functions as a silencer. Among these, the region of −300 bp to −600 bp affects the promoter region as a silencer region, but does not have a function as a silencer alone. On the other hand, the region of −150 bp to −300 bp is considered to function as a silencer alone.

Claims (23)

  A cosmetic method for improving the skin condition resulting from increased stratum corneum peeling by enhancing the expression of serpin B12 in the stratum corneum of a subject.   The enhanced expression of the serpin B12 is caused by the promotion of the core promoter activity in the region of −1 bp to −150 bp of the serpin B12 promoter region and / or the inhibition of the silencer activity in the region of −150 bp to −600 bp of the serpin B12 promoter region. The method of claim 1, wherein:   A cosmetic method for improving the skin condition resulting from the suppression of stratum corneum peeling by suppressing the expression of serpin B12 in the stratum corneum of a subject.   The suppression of the expression of the serpin B12 is caused by the inhibition of the core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or the promotion of the silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region. 4. The method of claim 3, wherein:   The expression level of serpin B12 in a stratum corneum sample collected from the skin of a subject is measured, and the increase in the expression level of serpin B12 is used as an index for suppressing stratum corneum peeling. Evaluation method.   6. The method according to claim 5, wherein the expression level of mesotrypsin in the stratum corneum sample is measured, and a decrease in the expression level of mesotrypsin is used as an index for suppressing stratum corneum peeling.   Measuring the core promoter activity in the region of -1 bp to -150 bp of the serpin B12 promoter region and / or the silencer activity in the region of -150 bp to -600 bp of the serpin B12 promoter region, increasing the core promoter activity, and / or The method according to claim 5 or 6, wherein a decrease in silencer activity is used as an index for suppressing stratum corneum peeling.   The method according to claim 5, wherein the suppression of stratum corneum peeling results from skin aging.   The method according to any one of claims 5 to 7, wherein the suppression of stratum corneum peeling results from a skin disease selected from ichthyosis vulgaris or warts.   The expression level of serpin B12 in a stratum corneum sample collected from the skin of a subject is measured, and the decrease in the expression level of serpin B12 is used as an index of the enhancement of stratum corneum peeling. Evaluation method.   The method according to claim 10, further comprising measuring an expression level of mesotrypsin in the stratum corneum sample, and using an increase in the expression level of the mesotrypsin as an index of enhancement of stratum corneum detachment.   Measuring the core promoter activity in the region of -1 bp to -150 bp of the serpin B12 promoter region and / or the silencer activity in the region of -150 bp to -600 bp of the serpin B12 promoter region, and reducing the core promoter activity, and / or The method according to claim 10 or 11, wherein an increase in silencer activity is used as an indicator of enhancement of stratum corneum detachment.   13. The enhanced stratum corneum detachment is due to a skin condition or skin disease selected from sunburn, dry skin, atopic dermatitis, psoriasis, Netherton syndrome or congenital ichthyosis-like erythroderma. The method according to any one of the above.   A method for screening a stratum corneum peeling promoter, wherein when a candidate drug is applied to a cultured cell, a drug that inhibits the expression of serpin B12 in the cell is selected as a stratum corneum peeling promoter.   The method according to claim 14, further comprising selecting an agent that enhances the expression of mesotrypsin in the cell as a stratum corneum peeling promoter.   A drug that inhibits the core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or a drug that promotes the silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region is used as a stratum corneum peeling promoter. The method according to claim 14, wherein the method is selected.   The method according to any one of claims 14 to 16, wherein the stratum corneum peeling accelerator is used for prevention or improvement of skin aging.   The method according to any one of claims 14 to 16, wherein the stratum corneum peeling promoter is used for prevention or treatment of a skin disease selected from ichthyosis vulgaris or warts.   A method for screening for a stratum corneum peeling inhibitor, which comprises selecting a drug that enhances the expression of serpin B12 in a cell as a stratum corneum peeling inhibitor when a candidate drug is applied to cultured cells.   The method according to claim 19, further comprising selecting an agent that inhibits the expression of mesotrypsin in the cell as a stratum corneum peeling inhibitor.   An agent that promotes core promoter activity in the -1 bp to -150 bp region of the serpin B12 promoter region and / or a drug that inhibits silencer activity in the -150 bp to -600 bp region of the serpin B12 promoter region is used as a stratum corneum peeling inhibitor. 21. Method according to claim 19 or 20, characterized in that it is selected.   The stratum corneum peeling inhibitor is used for prevention, amelioration or treatment of a skin condition or skin disease selected from sunburn, dry skin, atopic dermatitis, psoriasis, Netherton syndrome or congenital ichthyosis-like erythroderma. The method according to any one of claims 19 to 21.   The method according to any one of claims 14 to 22, wherein the cultured cells are epidermal keratinocytes.