JPWO2013080973A1 - Qsd1 gene controlling plant seed dormancy and use thereof - Google Patents

Abstract

We succeeded in identifying the Qsd1 gene that controls the dormancy of barley seeds by positional cloning. Furthermore, in these genes, a single nucleotide polymorphism (SNP) that correlates with the seed dormancy is identified, the weak seed dormancy type gene is dominant, and an individual whose gene is heterozygous is weak seed dormancy. We also succeeded in elucidating that it has a phenotype. Furthermore, we succeeded in identifying the corresponding wheat Qsd1 gene based on the sequence information of the barley Qsd1 gene. And it discovered that it was possible to produce the plant by which the degree of seed dormancy of a plant was determined efficiently and the seed dormancy was modified using the identified gene.

Description

The present invention relates to the Qsd1 gene that governs the seed dormancy of plants, the determination of the degree of seed dormancy of plants using the gene, and the production of plants with altered dormancy.

  Seed dormancy is one of the environmentally adaptive traits of wild plants, and is particularly important for wild plants in dry regions such as the Middle East, where they do not germinate under poor summer conditions. On the other hand, cultivated plants usually have low dormancy due to strong agricultural selection that shortens the period from harvesting to sowing. Quality degradation. Furthermore, if the dormancy is too deep in brewing barley, it will not germinate uniformly, which will affect the production of malt. Thus, dormancy of seeds is extremely important from the viewpoint of crop evolution and industry. In addition, the homology of the genome has confirmed that a common gene with the seed dormancy gene of barley is also present in wheat (Non-patent Document 1). If the dormancy gene of barley is identified, more germination It is expected to be applicable to the control of dormancy in severely damaged wheat.

Four species of seed dormancy QTLs derived from wild barley isolated in hybrid progenies by crossing between cultivated barley “Haruna Nijo” and wild barley “H602” have been identified so far (Non-Patent Document 2), one of which is Qsd1 It is. These QTLs sit on a high-density linkage map based on EST markers (Non-patent Document 3). A marker linked to Qsd1 is known (Patent Document 1).

However, due to its difficulty, the identification of the Qsd1 gene has not yet been successful.

Japanese Patent No. 4298538

K. Hori, et al., Breeding Sci. 57: 39-45, 2007 K. Hori, et al., Theor. Appl. Genet. 115: 869-876, 2007 K. Sato, et al., Heredity 103: 110-117, 2009

  This invention is made | formed in view of such a condition, The objective is to identify the novel gene which controls the grade of the seed dormancy in a plant. Another object of the present invention is to provide a method for efficiently determining the degree of seed dormancy of a plant using the identified gene. A further object of the present invention is to provide a method for efficiently producing a plant with altered seed dormancy using the identified gene.

Qsd1 is quantitative in character, and in particular, weakly dormant homozygous individuals and heterozygous individuals cannot be clearly distinguished by phenotype, and link the relationship between phenotype and genotype. Is difficult. Therefore, even if a high-density linkage map or linkage marker is known, it is difficult to narrow down responsible genes by a general positional cloning technique.

Accordingly, the present inventors have for the Qsd1, 25 5-week germination rate of seeds dormancy were barley investigated in ° C., germination rate at which conditions the strength of 0-49% dormancy homo, 50 Genotypes were estimated with ~ 89% as heterogeneous and 90-100% as weakly dormant homozygous, and based on this estimation, attempts were made to narrow down responsible genes. In addition, at that time, among a plurality of QTLs, a large-scale population that segregates only Qsd1 (BC ₃ F ₂ generation 910 individuals and BC ₃ F ₃ generation 4,792 individuals) was used. In addition, since the barley ESTs in the Qsd1 region are extremely homologous to the rice chromosome 9 gene, the barley ESTs corresponding to the genes in the rice genome were arranged in order to confirm recombination. By carrying out such ingenuity, it was finally possible to narrow down the Qsd1 gene candidates to two candidate genes. However, it was not possible to identify which is the Qsd1 gene.

Therefore, in order to identify which of the two narrowed down genes was the Qsd1 gene, the sequences of the two genes were determined and compared. As a result, a plurality of alleles were found. Furthermore, while using a large group of BC ₃ F ₄ generations, it was verified whether or not there was an allele that matched the allele of Qsd1 among these alleles. As a result, we have identified one gene with an allele that perfectly matches the allele of Qsd1 .

That is, the present inventors identified the Qsd1 gene that controls the seed dormancy of barley, identified the single nucleotide polymorphism (SNP) correlated with the seed dormancy, and the weak seed dormancy type gene was dominant. The inventors succeeded in elucidating that individuals having a heterozygous gene have a weak seed dormancy phenotype.

Furthermore, the present inventors also succeeded in identifying the corresponding wheat Qsd1 gene based on the sequence information of the barley Qsd1 gene.

The present inventors can efficiently determine the degree of seed dormancy of a plant and produce a plant with altered seed dormancy by using the identified Qsd1 gene. As a result, the present invention has been completed.

The present invention relates to the Qsd1 gene that governs the seed dormancy of plants, the determination of the degree of seed dormancy of plants using the gene, and the production of plants with modified dormancy, and more specifically, provides the following: Is.

[1] The DNA according to any one of the following (a) to (d), which encodes a protein having an activity to weaken a plant seed dormancy trait.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 2, 8, or 11
(B) DNA containing the coding region of the base sequence described in SEQ ID NO: 1, 3, 7, 9 or 10
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added and / or inserted in the amino acid sequence of SEQ ID NO: 2, 8 or 11
(D) DNA that hybridizes under stringent conditions with DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 3, 7, 9 or 10
[2] The DNA according to any one of the following (a) to (d), which encodes a protein having an activity that enhances a plant seed dormancy trait.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 5
(B) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 4 or 6
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence of SEQ ID NO: 5
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 4 or 6
[3] The DNA according to any one of the following (a) to (c), which has an activity of enhancing a plant seed dormancy trait.
(A) DNA encoding a double-stranded RNA complementary to the transcription product of DNA according to [1]
(B) DNA encoding an antisense RNA complementary to the transcription product of DNA according to [1]
(C) DNA encoding an RNA having ribozyme activity that specifically cleaves the transcript of the DNA according to [1]
[4] A vector comprising the DNA according to any one of [1] to [3].

  [5] A plant cell into which the DNA according to any one of [1] to [3] is introduced.

  [6] A plant comprising the cell according to [5].

  [7] A plant that is a descendant or clone of the plant according to [6].

  [8] The plant propagation material according to [6] or [7].

  [9] A method for producing a plant in which the seed dormancy trait is weakened, comprising the step of introducing the DNA according to [1] into the plant.

  [10] A method for producing a plant with enhanced seed dormancy trait, wherein the expression or function of the DNA according to [1] in the plant is suppressed.

  [11] A method for producing a plant with enhanced seed dormancy trait, comprising the step of introducing the DNA according to [2] or [3] into the plant.

  [12] An agent for weakening a plant seed dormancy trait, comprising the DNA according to [1] or a vector into which the DNA is inserted.

  [13] A drug for enhancing the seed dormancy trait of a plant, comprising the DNA of [2] or [3] or a vector into which the DNA is inserted.

  [14] A method for determining the degree of seed dormancy in a plant, comprising analyzing the base sequence of the DNA according to [1] or [2] in a test plant and comparing it with a base sequence of a control And how to.

[15] A method for breeding a plant having a weak seed dormancy trait,
(A) a step of crossing a plant variety of a weak seed dormancy trait with any plant variety,
(B) a step of determining the degree of seed dormancy in the individual obtained by mating in step (a) by the method according to [14], and (c) a variety determined to have weak seed dormancy Selecting the method.

[16] A method for breeding a plant having a strong seed dormancy trait,
(A) a step of crossing a plant variety having a strong seed dormancy trait with any plant variety,
(B) a step of determining the degree of seed dormancy in the individual obtained by mating in step (a) by the method according to [14], and (c) a variety determined to have strong seed dormancy Selecting the method.

  In the present invention, “seed dormancy” means a property that does not germinate even under conditions suitable for seed germination. In the present invention, the term “weak seed dormancy trait” means that the dormancy is maintained for a short period after the seed has matured and a high germination rate is exhibited under assay conditions suitable for germination. Further, in the present invention, the “strong seed dormancy trait” means that the period during which the dormancy is maintained after the seed has matured is long, and shows a low germination rate under test conditions suitable for germination. The germination rate, which is an index of dormancy strength, can be tested by the method described in Example (1).

According to the present invention, a novel gene Qsd1 that controls plant seed dormancy was identified, and the position and structure of the gene on the chromosome were elucidated. This provided a method for determining the degree of seed dormancy of plants targeting the Qsd1 gene, and a method for breeding plants with modified seed dormancy using the determination method. Furthermore, a method for producing a plant with altered dormancy using the Qsd1 gene was provided. The determination of the degree of seed dormancy of plants according to the present invention and the production and breeding of plants with modified dormancy pay attention to the Qsd1 gene that governs the degree of seed dormancy, so the method using a linked marker is used. Compared with high accuracy. For this reason, it is possible to determine the degree of seed dormancy of plants and to produce and breed plants with altered dormancy, specifically and efficiently.

It is a graph which shows the germination rate (dormantability) in 910 individuals of BC ₃ F ₂ population of Haruna Nijo × H602. The germination rate was investigated after dormancy awakening for 5 weeks. P1 represents a value in H602, and P2 represents a value in Haruna Nijo. It is a figure which shows the homologous position on the rice genome of dormant QTL (5H-1). It is a figure which shows the correspondence of the high-density linkage map of Haruna Nijo xH602 and the gene on the rice chromosome 9. EST indicates a barley EST-derived marker, and the number in parentheses indicates the number of recombinant individuals between adjacent markers. It is a diagram illustrating the recombination of the QTL vicinity of BC ₃ F ₃ 4,792 individuals. QTL typing shows that B is “H602” (strong dormancy), A is “Haruna Nijo” (weak dormancy), and H is heterozygous. In addition, I is a recombinant detection marker, II is a sequence of genes on rice chromosome 9 (showing that 20 genes are present on the genome between 1 and 22), and III is a DH93 individual. The map distance (cM) from the short arm end of the 5H chromosome of the prepared genetic map, and IV represents a barley EST-derived marker highly homologous to the rice gene. It is a figure which shows the position of gene recombination in gene 1 and gene 2. It is a figure which shows the nucleotide polymorphism in the gene 1 and the gene 2 of Haruna Nijo × H602. It is a figure which shows the allele of strong dormancy type (sd) and weak dormancy type (wd) in Qsd1 of each parent strain | stump | stock of nine groups analyzed. It is a figure which shows SNP in the parents of 9 groups analyzed. It is the alignment figure of the amino acid sequence of the protein which the gene 2 of Haruna Nijo and H602 codes. It is a graph which shows the comparison of the transcript amount of the gene 1 (top) and the gene 2 (bottom) according to organ. It is a photograph which shows the result of the in situ hybridization of the gene 2 in the 19th day after the flowering of a wild barley (dormant type). It is an alignment figure of the barley full length sequence NIASHv3013O02 and the wheat full length sequence RFL_Contig4246. FIG. 13 is a continuation of FIG. 12. FIG. 14 is a continuation of FIG. 13.

<Weak seed dormancy type DNA, strong seed dormancy type DNA>
The present invention provides a DNA encoding a protein having an activity of weakening a plant seed dormancy trait (hereinafter referred to as “weak seed dormancy type DNA”). The base sequence of Qsd1 cDNA derived from Haruna Nijo, which is a weak seed dormant variety of barley, identified by the present inventors, is SEQ ID NO: 1, and the amino acid sequence of the protein encoded by the DNA is SEQ ID NO: 2. Show. In addition, the base sequence of Qsd1 genomic DNA derived from Haruna Nijo is shown in SEQ ID NO: 3.

Further, the base sequence of Qsd1 cDNA derived from RFL_Contig4246 in Chinese Spring, which is a weak seed dormant variety of wheat, identified by the present inventors, is SEQ ID NO: 7, and the amino acid sequence encoded by the DNA is SEQ ID NO: : Shown in 8. In addition, the base sequence of contig6-derived Qsd1 genomic DNA in Chinese Spring is SEQ ID NO: 9, and the base sequence of Qsd1 cDNA extracted from contig6-derived Qsd1 genomic DNA is SEQ ID NO: 10, and the amino acid sequence encoded by these DNAs. Is shown in SEQ ID NO: 11.

  One embodiment of the weak seed dormant DNA of the present invention is a DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 2, 8, or 11 (typically, SEQ ID NOs: 1, 3, 7, DNA containing the coding region of the base sequence described in 9 or 10.

In the current state of the art, when a person skilled in the art obtains the base sequence information of weak seed dormant DNA in a specific weak seed dormant plant variety (for example, barley Haruna Nijo, wheat Chinese Spring) It is possible to obtain a DNA having a weak seed dormancy type, though the base sequence is altered and the encoded amino acid sequence is different. Also in nature, it is possible that the amino acid sequence of the encoded protein is mutated due to the mutation of the base sequence. Therefore, in the present invention, one or more amino acids are substituted, deleted, added and / or inserted in the amino acid sequence (SEQ ID NO: 2, 8, 11) of the Qsd1 protein in Haruna Nijo of barley or Chinese Spring of wheat. And a DNA encoding a protein having an activity that weakens the seed dormancy trait of a plant. The term “plurality” as used herein refers to the number of amino acid modifications within a range in which the modified Qsd1 protein maintains the activity of weakening the plant seed dormancy trait, and is usually within 50 amino acids, preferably within 30 amino acids, Preferably, it is within 10 amino acids (eg, within 5 amino acids, within 3 amino acids, 2 amino acids).

Furthermore, in the current state of the art, if a person skilled in the art obtains weak seed dormant DNA from a specific weak seed dormant plant variety (for example, barley Haruna Nijo, wheat Chinese Spring), By using the base sequence information of weak seed dormant DNA, other barley varieties (eg Harbin Nijo, Russia6, cross A), other wheat varieties (eg spring love), other plant varieties (eg It is possible to obtain DNA encoding a homologous gene, which is also a weak seed dormancy type, from a wheat series such as rye. Accordingly, the present invention relates to DNA that hybridizes under stringent conditions with Qsd1 DNA (SEQ ID NO: 1 or 3) in Haruna Nijo of Barley or Qsd1 DNA (SEQ ID NO: 7, 9, or 10) in Chinese Chinese Spring. It also includes DNA encoding a protein having an activity of weakening the plant seed dormancy trait.

  Whether the mutant DNA or homologous DNA thus obtained encodes a protein having an activity that weakens the plant seed dormancy trait is determined by, for example, strong seed dormancy by introducing these DNAs by genetic recombination technology or crossing. It can be determined by collecting seeds from the cultivar of the mold, performing the germination test described in this example, and examining whether the germination rate is increased. If the germination rate is high, it is evaluated that it has an activity to weaken the seed dormancy trait of the plant.

The present invention also provides a DNA encoding a protein having an activity to enhance the seed dormancy traits of plants (hereinafter referred to as “strong seed dormancy type DNA”). The base sequence of Qsd1 cDNA derived from H602, which is a barley strong seed dormant variety identified by the present inventors, is shown in SEQ ID NO: 4, and the amino acid sequence of the protein encoded by the DNA is shown in SEQ ID NO: 5. In addition, the nucleotide sequence of H602-derived Qsd1 genomic DNA is shown in SEQ ID NO: 6. One embodiment of the strong seed dormant DNA of the present invention is a DNA encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5 (typically, the base sequence code set forth in SEQ ID NO: 4 or 6). DNA containing the region).

As shown in this Example, the amino acid sequence of the Qsd1 protein derived from barley H602 (SEQ ID NO: 5) is the amino acid sequence of the Qsd1 protein derived from Haruna Nijo, a weak seed dormant variety (SEQ ID NO: 2). ), An amino acid substitution (F → L) occurs at position 214 (see FIGS. 8 and 9). For this reason, it is considered that the function of the original Qsd1 protein is suppressed, and thereby the individual has a strong seed dormancy character. In the current state of the art, those skilled in the art can maintain the strong seed dormancy traits of the encoded protein in the Qsd1 DNA base sequence of a specific strong seed dormant plant variety (eg, barley H602). It is possible to make such modifications. Also in nature, it is possible that the amino acid sequence of the encoded protein is mutated due to the mutation of the base sequence. Therefore, the present invention comprises a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added and / or inserted in the amino acid sequence of the Qsd1 protein (SEQ ID NO: 5) in barley H602, It also contains DNA encoding a protein having an activity that enhances the seed dormancy traits of rice. Here, the term “plurality” refers to the number of amino acid modifications within a range in which the modified Qsd1 protein has an activity to enhance the seed dormancy trait of the plant. If the Qsd1 protein in the plant does not exhibit its original function, it is considered that it becomes a strong seed dormancy trait. Therefore, the number of amino acid modifications is essentially not limited. The modification is, for example, within 100 amino acids (50 amino acids, 30 amino acids, 10 amino acids, 5 amino acids, 3 amino acids, 2 amino acids).

Furthermore, in the current state of the art, if a person skilled in the art obtains Qsd1 DNA from a specific strong seed dormant plant variety (for example, H602 of barley), using the base sequence information of the DNA, Strong seed dormancy from other barley varieties (eg, HES4, I767, T602, T615, I626, I765, Kiishi Port 3) and other plant varieties (eg, wheat, rye and other Written (Triticeae) plants) DNA encoding a homologous gene can be obtained. Therefore, the present invention is a DNA that hybridizes under stringent conditions with Qsd1 DNA (SEQ ID NO: 4 or 6) in barley H602, and encodes a protein having an activity that enhances the plant seed dormancy trait Contains DNA.

Whether the mutant DNA or homologous DNA obtained in this way encodes a protein having an activity that enhances the seed dormancy trait of the plant is, for example, recombining the Qsd1 gene of the weak seed dormancy variety with the DNA, It can be determined by creating a plant that holds the DNA homologously, collecting seeds from the plant, performing the germination test described in this example, and testing whether the germination rate is low. it can. If the germination rate is low, it is evaluated that the plant has an activity to enhance the seed dormancy trait of the plant.

  The weak seed dormancy type DNA of the present invention is an agent for weakening a plant seed dormancy trait in the sense that introduction thereof can weaken the plant seed dormancy trait, The strong seed dormancy type DNA of the present invention is a drug for enhancing the seed dormancy of a plant in the sense that its introduction can enhance the plant seed dormancy trait.

  In addition, artificial mutations introduced into DNA to produce the above-mentioned mutant DNA are, for example, site-directed mutagenesis method (Kramer, W. & Fritz, HJ., Methods Enzymol). 154: 350-367, 1987).

  Moreover, as a method for isolating the above-mentioned homologous gene, for example, hybridization technology (Southern, EM, Journal of Molecular Biology, 98: 503, 1975) or polymerase chain reaction (PCR) technology (Saiki, RK, et al. Science, 230: 1350-1354, 1985, Saiki, RK et al. Science, 239: 487-491, 1988). In order to isolate DNA encoding a homologous gene, a hybridization reaction is usually carried out under stringent conditions. Examples of stringent hybridization conditions include 6M urea, 0.4% SDS, 0.5xSSC conditions, or equivalent stringency hybridization conditions. Isolation of DNA with higher homology can be expected by using conditions with higher stringency, for example, 6M urea, 0.4% SDS, and 0.1xSSC. The isolated DNA is at least 50% or more, more preferably 70% or more, more preferably 90% or more (for example, 95%, 96%, 97%, 98%, 99%) at the nucleic acid level or amino acid sequence level. And the like). Sequence homology can be determined using BLASTN (nucleic acid level) and BLASTX (amino acid level) programs (Altschul et al. J. Mol. Biol., 215: 403-410, 1990). The program is based on the algorithm BLAST by Karlin and Altschul (Proc. Natl. Acad. Sci. USA, 87: 2264-2268, 1990, Proc. Natl. Acad. Sci. USA, 90: 5873-5877, 1993). Yes. When analyzing a base sequence by BLASTN, parameters are set to score = 100 and wordlength = 12, for example. When analyzing an amino acid sequence by BLASTX, parameters are set to, for example, score = 50 and wordlength = 3. When the amino acid sequence is analyzed using the Gapped BLAST program, it can be performed as described in Altschul et al. (Nucleic Acids Res. 25: 3389-3402, 1997). When using BLAST and Gapped BLAST programs, the default parameters of each program are used. Specific methods of these analysis methods are known.

The DNA encoding the Qsd1 protein of the present invention is not particularly limited in its form, and includes cDNA, genomic DNA, and chemically synthesized DNA. Preparation of genomic DNA and cDNA can be performed by those skilled in the art using conventional means. For genomic DNA, for example, genomic DNA is extracted from a plant, a genomic library (a vector such as a plasmid, phage, cosmid, BAC, PAC, etc. can be used), expanded, and Qsd1 gene (for example, Prepared by performing colony hybridization or plaque hybridization using a probe prepared on the basis of the nucleotide sequence of the DNA of SEQ ID NO: 1,3,4,6,7,9,10) It is possible. It is also possible to prepare a primer specific to the Qsd1 gene and perform PCR using this primer. In addition, for example, cDNA is synthesized based on mRNA extracted from a plant, inserted into a vector such as λZAP to create a cDNA library, developed, and colony hybridization in the same manner as described above. Alternatively, it can be prepared by performing plaque hybridization or by performing PCR.

<DNA used to suppress weak seed dormancy-type Qsd1 gene expression in plants>
The present invention also provides DNA used to suppress the expression of weak seed dormancy type Qsd1 gene in plants. By introducing these DNAs, it is possible to strengthen the plant seed dormancy trait. In this sense, the DNA used to suppress the expression of the weak seed dormancy type Qsd1 gene in the plant is a drug for enhancing the plant seed dormancy trait. Here, “suppression of Qsd1 gene expression” includes both suppression of gene transcription and suppression of protein translation. Further, “suppression of expression” includes not only complete cessation of expression but also decrease of expression. Moreover, there are no particular limitations on the plant into which these DNAs are introduced, but a wheat series (Triticeae) plant such as barley, wheat, and rye is preferred, and barley and wheat are particularly preferred.

One embodiment of the DNA used to suppress the expression of the weak seed dormant Qsd1 gene in plants is a dsRNA (double stranded RNA) complementary to the above-mentioned transcript of the weak seed dormant DNA of the present invention. It is DNA to encode. A phenomenon called RNAi (RNA interference), in which the expression of the introduced foreign gene and target endogenous gene is both suppressed by introducing dsRNA having the same or similar sequence to the target gene into the cell. Can cause. When dsRNA of about 40 to several hundred base pairs is introduced into a cell, an RNase III-like nuclease called Dicer having a helicase domain is converted to about 21 to 23 base pairs from the 3 ′ end in the presence of ATP. Each one is cut out to generate siRNA (short interference RNA). A specific protein binds to this siRNA to form a nuclease complex (RISC: RNA-induced silencing complex). This complex recognizes and binds to the same sequence as siRNA, and cleaves the transcript (mRNA) of the target gene at the center of the siRNA by RNaseIII-like enzyme activity. In addition to this pathway, the antisense strand of siRNA binds to mRNA and acts as a primer for RNA-dependent RNA polymerase (RsRP) to synthesize dsRNA. There is also a possibility that this dsRNA becomes Dicer's substrate again to generate new siRNA and amplify the action.

  The DNA encoding the dsRNA of the present invention includes an antisense DNA encoding an antisense RNA for any region of a target gene transcription product (mRNA), and a sense DNA encoding a sense RNA for any region of the mRNA And antisense RNA and sense RNA can be expressed from the antisense DNA and the sense DNA, respectively. Moreover, dsRNA can be produced from these antisense RNA and sense RNA.

  In the case where the dsRNA expression system of the present invention is held in a vector or the like, there are a case where antisense RNA and sense RNA are expressed from the same vector, and a case where antisense RNA and sense RNA are expressed from different vectors, respectively. is there. The antisense RNA and sense RNA are expressed from the same vector. For example, an antisense RNA expression cassette in which a promoter capable of expressing a short RNA such as polIII is linked upstream of the antisense DNA and the sense DNA. And sense RNA expression cassettes are constructed, and these cassettes are inserted into the vector in the same direction or in the opposite direction.

  It is also possible to construct an expression system in which antisense DNA and sense DNA are arranged in opposite directions so as to face each other on different strands. In this configuration, one double-stranded DNA (siRNA-encoding DNA) in which an antisense RNA coding strand and a sense RNA coding strand are paired is provided, and antisense RNA and sense RNA are separated from each strand on both sides. A promoter is provided oppositely so that it can be expressed. In this case, in order to avoid adding extra sequences downstream of the sense RNA and antisense RNA, a terminator is added to the 3 'end of each strand (antisense RNA coding strand, sense RNA coding strand). It is preferable to provide. As this terminator, a sequence in which four or more A (adenine) bases are continued can be used. Further, in this palindromic style expression system, the two promoter types are preferably different.

  In addition, as a configuration for expressing antisense RNA and sense RNA from different vectors, for example, antisense RNA expression in which a promoter capable of expressing a short RNA such as polIII is linked upstream of antisense DNA and sense DNA, respectively. A cassette and a sense RNA expression cassette are constructed, and these cassettes are held in different vectors.

The dsRNA used in the present invention is preferably siRNA. “SiRNA” means a double-stranded RNA consisting of short strands in a range that is not toxic in cells. The chain length is not particularly limited as long as the expression of the target Qsd1 gene can be suppressed and it does not show toxicity. The dsRNA has a chain length of, for example, 15 to 49 base pairs, preferably 15 to 35 base pairs, and more preferably 21 to 30 base pairs.

  As the DNA encoding the dsRNA of the present invention, an appropriate sequence (preferably an intron sequence) is inserted between inverted repeats of the target sequence, and a double-stranded RNA having a hairpin structure (self-complementary 'hairpin' RNA (hpRNA )) (Smith, NA, et al. Nature, 407: 319, 2000, Wesley, SV et al. Plant J. 27: 581, 2001, Piccin, A. et al. Nucleic Acids Res. 29 : E55, 2001) can also be used.

The DNA encoding the dsRNA of the present invention need not be completely identical to the base sequence of the target Qsd1 gene, but is at least 70% or more, preferably 80% or more, more preferably 90% or more (for example, 95%, 96%, 97%, 98%, 99% or more). Sequence identity can be determined by the technique described above (BLAST program).

  The part of the double-stranded RNA in which the RNAs in dsRNA are paired is not limited to a perfect pair, but mismatch (corresponding base is not complementary), bulge (no base corresponding to one strand) ) Or the like may include an unpaired portion. In the present invention, both bulges and mismatches may be included in the double-stranded RNA region where RNAs in dsRNA pair with each other.

Another embodiment of the DNA used for suppressing the expression of the weak seed dormancy type Qsd1 gene in the plant is a DNA encoding an antisense RNA complementary to the above-mentioned transcript of the weak seed dormancy type DNA of the present invention ( Antisense DNA). Antisense DNA suppresses target gene expression by inhibiting transcription initiation by triplex formation, suppressing transcription by hybridization with a site where an open loop structure is locally created by RNA polymerase, Inhibition of transcription by hybridization with certain RNA, suppression of splicing by hybridization at the junction of intron and exon, suppression of splicing by hybridization with spliceosome formation site, suppression of transition from nucleus to cytoplasm by hybridization with mRNA , Splicing suppression by hybridization with capping site and poly (A) addition site, translation initiation suppression by hybridization with translation initiation factor binding site, translation suppression by hybridization with ribosome binding site near initiation codon, translation of mRNA Area or poly Outgrowth inhibitory peptide chains by the formation of a hybrid with over arm binding sites, and the like gene silencing and the like by hybridization with interaction site between a nucleic acid and protein. They inhibit transcription, splicing, or translation processes and suppress target gene expression (Hirashima and Inoue, "Neurochemistry Experiment Course 2, Nucleic Acid IV Gene Replication and Expression", edited by the Japanese Biochemical Society, Tokyo Kagaku Dojin , pp.319-347, 1993). The antisense DNA used in the present invention may suppress the expression of the target Qsd1 gene by any of the actions described above. In one embodiment, if an antisense sequence complementary to the untranslated region near the 5 ′ end of the mRNA of the target gene is designed, it will be effective for inhibiting translation of the gene. However, sequences complementary to the coding region or the 3 ′ untranslated region can also be used. As described above, a DNA containing an antisense sequence of a non-translated region as well as a translated region of a gene is also included in the antisense DNA used in the present invention. The antisense DNA to be used is linked downstream of a suitable promoter, and preferably a sequence containing a transcription termination signal is linked on the 3 ′ side.

Antisense DNA is a phosphorothioate method (Stein, Nucleic Acids) based on the sequence information of the weak seed dormant DNA of the present invention (for example, DNA comprising the base sequence described in SEQ ID NO: 1, 7 or 10). Res., 16: 3209-3221, 1988). The prepared DNA can be introduced into plants by a known method described later. The sequence of the antisense DNA is preferably complementary to the endogenous weak seed dormant Qsd1 gene transcript of the plant, but is not completely complementary as long as it can effectively inhibit gene expression. May be. The transcribed RNA preferably has a complementarity of 90% or more (eg, 95%, 96%, 97%, 98%, 99% or more) to the transcript of the target gene. In order to effectively inhibit the expression of the target gene, the length of the antisense DNA is at least 15 bases or more, preferably 100 bases or more, more preferably 500 bases or more. Usually, the length of the antisense DNA used is shorter than 5 kb, preferably shorter than 2.5 kb.

Another embodiment of the DNA used to suppress the expression of the weak seed dormant Qsd1 gene in plants encodes an RNA having a ribozyme activity that specifically cleaves the transcript of the weak seed dormant DNA of the present invention. DNA. Some ribozymes have a group I intron type or a size of 400 nucleotides or more like M1RNA contained in RNaseP, but some have an active domain of about 40 nucleotides called hammerhead type or hairpin type ( Makoto Koizumi and Eiko Otsuka, Protein Nucleic Acid Enzymes, 35: 2191, 1990).

  For example, the self-cleaving domain of hammerhead ribozyme cleaves 3 ′ of C15 of G13U14C15, but it is important for U14 to form a base pair with A at position 9, and the base at position 15 is In addition to C, it has been shown to be cleaved by A or U (Koizumi et. Al., FEBS Lett. 228: 225, 1988). If the ribozyme substrate binding site is designed to be complementary to the RNA sequence near the target site, it is possible to create a restriction enzyme-like RNA-cleaving ribozyme that recognizes the UC, UU, or UA sequence in the target RNA. (Koizumi et. 1989).

Hairpin ribozymes are also useful for the purposes of the present invention. Hairpin ribozymes are found, for example, in the minus strand of satellite RNA of tobacco ring spot virus (Buzayan, Nature 323: 349, 1986). It has been shown that this ribozyme can also be designed to cause target-specific RNA cleavage (Kikuchi and Sasaki, Nucleic Acids Res. 19: 6751, 1992, Hiroshi Kikuchi, Chemistry and Biology 30: 112, 1992). A ribozyme designed to cleave the target is linked to a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence so that it is transcribed in plant cells. Such structural units can be arranged in tandem so that multiple sites in the target gene can be cleaved to further increase the effect (Yuyama et al., Biochem. Biophys. Res. Commun. 186: 1271, 1992 ). Using such a ribozyme, the transcription product of the target Qsd1 gene can be specifically cleaved to suppress the expression of the gene.

<Vector, transformed plant cell, transformed plant body>
The present invention also includes a vector containing the DNA of the present invention (weak seed dormancy type DNA, strong seed dormancy type DNA, DNA for suppressing the expression of the Qsd1 gene), the DNA of the present invention or the same. Provided are a plant cell into which a vector is introduced, a plant body containing the cell, a plant body which is a descendant or clone of the plant body, and a propagation material of these plant bodies.

  The vector of the present invention is not particularly limited as long as it can express the inserted gene in plant cells. The vector of the present invention may contain a promoter for constitutively or inducibly expressing the DNA of the present invention. Examples of promoters for constant expression include cauliflower mosaic virus 35S promoter, rice actin promoter, maize ubiquitin promoter, and the like. In addition, promoters for inducible expression are known to be expressed by external factors such as infection and invasion of filamentous fungi, bacteria and viruses, low temperature, high temperature, drying, UV irradiation, and spraying of specific compounds. The promoter etc. which are mentioned are mentioned. Examples of such promoters include rice chitinase gene promoters expressed by infection and invasion of filamentous fungi, bacteria and viruses, promoters of tobacco PR protein genes, rice lip19 gene promoters induced by low temperatures, Induced rice hsp80 and hsp72 gene promoters, Arabidopsis thaliana rab16 gene promoter induced by drying, Parsley chalcone synthase gene promoter induced by UV irradiation, corn induced under anaerobic conditions Examples include the promoter of alcohol dehydrogenase gene. The rice chitinase gene promoter and tobacco PR protein gene promoter are also induced by specific compounds such as salicylic acid, and rab16 is also induced by spraying the plant hormone abscisic acid.

  The plant from which the plant cell into which the vector of the present invention is introduced is derived is not particularly limited, but wheat series (Triticeae) plants such as barley, wheat and rye are preferred, and barley and wheat are particularly preferred. The plant cells of the present invention include cultured cells as well as cells in the plant body. Also included are various forms of plant cells, such as suspension culture cells, protoplasts, leaf sections, callus, immature embryos, pollen and the like. For introduction of a vector into a plant cell, various methods known to those skilled in the art such as polyethylene glycol method, electroporation (electroporation), Agrobacterium-mediated method, and particle gun method can be used.

  Regeneration of plant bodies from transformed plant cells can be performed by methods known to those skilled in the art depending on the type of plant cells. For example, methods for producing a transgenic plant for barley include Tingay et al. (Tingay S. et al. Plant J. 11: 1369-1376, 1997), Murray et al. (Murray F et al. Plant Cell Report 22: 397). -402, 2004), and Travalla et al. (Travalla S et al. Plant Cell Report 23: 780-789, 2005). In addition, as a technique for producing a transformed plant body in wheat, for example, a method for introducing a gene into a wheat seed immature embryo using a particle gun to regenerate the plant body (Japanese Patent Laid-Open No. 2008-212048) was described. A method can be mentioned. For other plants, a known method for regenerating a plant can be used.

  Once a transformed plant into which the flowering DNA of the present invention has been introduced into the genome is obtained, offspring can be obtained from the plant by sexual reproduction or asexual reproduction. It is also possible to obtain a propagation material (for example, seeds, cuttings, strains, callus, protoplasts, etc.) from the plant, its progeny or clones, and mass-produce the plant based on them. The present invention includes a plant cell into which the DNA of the present invention is introduced, a plant containing the cell, a progeny and clone of the plant, and a propagation material for the plant, its progeny and clone.

<Method for producing plant with modified seed dormancy traits>
The present invention also provides a method for producing a plant having a modified seed dormancy trait. The plant for modifying the seed dormancy trait according to the method of the present invention is not particularly limited, but wheat series (Triticeae) plants such as barley, wheat and rye are preferred, and barley and wheat are particularly preferred.

  One embodiment of the method of the present invention is a method for producing a plant having a weakened seed dormancy trait, comprising the step of introducing the weak seed dormancy type DNA of the present invention into a plant. In the present invention, “weakening” the seed dormancy traits of plants not only weakens the seed dormancy traits of varieties having strong seed dormancy traits, but also already has certain weak seed dormancy traits. It also includes further reducing the seed dormancy of varieties having

In another embodiment of the method of the present invention, the plant has a seed dormancy trait comprising a step of suppressing the expression or function of the weak seed dormancy type DNA (weak seed dormancy type Qsd1 gene) of the present invention. It is an enhanced plant production method. In the present invention, “increasing” a seed dormancy trait of a plant not only enhances the seed dormancy trait of a variety having a weak seed dormancy trait, but also already has a certain strong seed dormancy trait. It is intended to include further increasing the seed dormancy of varieties having

  Suppression of the expression or function of the weak seed dormancy type DNA of the present invention in a plant can be carried out by introducing the strong seed dormancy type DNA of the present invention into the plant. Since the strong seed dormancy trait in plants is dominated by a single recessive gene, in order to impart a strong seed dormancy trait to a plant, both of the Qsd1 alleles in an individual are usually strongly seed dormant DNA. It is necessary to. Thereby, only strong seed dormancy type DNA is expressed in an individual, and the plant seed dormancy trait can be strengthened. Introduction of the strong seed dormant DNA of the present invention into a plant chromosome can be performed by, for example, mating or homologous recombination. Instead of introducing strong seed dormancy type DNA, a specific DNA sequence may be introduced into weak seed dormancy type DNA on the plant chromosome to destroy its function.

In addition, suppression of the expression or function of the weak seed dormancy type DNA of the present invention in a plant can be achieved by using DNA for suppressing the expression of the Qsd1 gene of the present invention in the plant (for example, DNA encoding dsRNA, antisense DNA, It can be carried out by introducing a DNA encoding an RNA having ribozyme activity. As a result, a weak seed dormancy type translation product is no longer produced from weak seed dormancy type DNA in the individual, so that the plant seed dormancy type trait can be strengthened.

  In order to suppress the expression or function of the weak seed dormant DNA of the present invention in plants, for example, it binds to a drug that suppresses the expression of weak seed dormant DNA or a weak seed dormant DNA translation product, and its function is reduced. The use of a suppressive drug is also considered.

<Method for determining the degree of seed dormancy in plants>
The present invention also provides a method for determining the degree of seed dormancy of a plant. The plant for determining the degree of seed dormancy by the method of the present invention is not particularly limited, but wheat series (Triticeae) plants such as barley, wheat and rye are preferred, and barley and wheat are particularly preferred.

One embodiment of the determination method of the present invention is a method characterized by analyzing the base sequence of the Qsd1 gene in a plant and comparing it with a base sequence of a control.

In analyzing the base sequence of the Qsd1 gene, an amplification product obtained by amplifying the Qsd1 gene by PCR can be used. In case of carrying out the PCR, primers used are not limited as long as it can specifically amplify the Qsd1 gene, Qsd1 gene sequence information (e.g., SEQ ID NO: 1,3,4,6,7, 9,10) can be designed as appropriate. A specific base sequence of the Qsd1 gene can be amplified by appropriately combining designed primers.

"Control nucleotide sequence" as compared to the nucleotide sequence of Qsd1 gene in the test plants are typically nucleotide sequence of Qsd1 gene in the weak dormancy type variety or strong dormancy type cultivars. The determined Qsd1 gene base sequence and the base sequence in the weak seed dormant type cultivar (eg, SEQ ID NO: 1, 3, 7, 9, 10) or the base sequence in the strong seed dormant type cultivar (eg, SEQ ID NO: 4 6), it is possible to evaluate whether the Qsd1 gene in the test plant is a strong seed dormant type or a weak seed dormant type. For example, as shown in this Example, the amino acid sequence of the Qsd1 protein derived from H602, which is a strong seed dormant variety of barley (SEQ ID NO: 5), is Qsd1 derived from Haruna Nijo, a weak seed dormant variety. Compared to the amino acid sequence of the protein (SEQ ID NO: 2), an amino acid substitution (F → L) occurs at position 214 (see FIGS. 8 and 9). The 214th amino acid is a preferable index for such evaluation.

In addition, in the Qsd1 gene, weak seed dormant DNA is dominant, so if there is a mutation that loses the function of the protein encoded by the test DNA, it is highly likely that it is a strong seed dormant type. Determined.

Whether the base sequence of the Qsd1 gene in the test plant is different from the base sequence of the control can be indirectly analyzed by various methods other than the determination of the direct base sequence described above. Examples of such methods include RFLP method using restriction fragment length polymorphism / RFLP, PCR-RFLP method, PCR-SSCP (single-strand conformation polymorphism, single chain higher order structure) Polymorphism) method, denaturant gradient gel electrophoresis (DGGE) method, allele specific oligonucleotide (ASO) hybridization method, and ribonuclease A mismatch cleavage method.

  In the determination method of the present invention, DNA from a test plant can be prepared using a conventional method, for example, the CTAB method. For the preparation of DNA, for example, plant seeds, seedlings, and grown plants can be used. The base sequence can be determined by a conventional method such as the dideoxy method or the Maxam-Gilbert method. In determining the base sequence, a commercially available sequence kit and sequencer can be used.

<Method of breeding plants with altered seed dormancy traits>
The present invention also provides a method for breeding a plant having a modified seed dormancy trait. The plant to be bred by the method of the present invention is not particularly limited, but wheat series (Triticeae) plants such as barley, wheat and rye are preferred, and barley and wheat are particularly preferred.

  One aspect of the breeding method of the present invention is a method of breeding a plant having a strong seed dormancy trait, and (a) a step of crossing a plant variety having a strong seed dormancy trait with any plant variety, ( b) a step of determining the degree of seed dormancy in the individual obtained by the mating by the determination method of the present invention, and (c) selecting a variety determined to have strong seed dormancy.

  Examples of “arbitrary plant varieties” to be crossed with plant varieties with strong seed dormancy traits include, for example, varieties with weak seed dormancy traits, varieties with weak seed dormancy traits, and strong seed dormancy traits Examples include, but are not limited to, individuals obtained by crossing with cultivars.

  Another aspect of the breeding method of the present invention is a method of breeding a plant having a weak seed dormancy trait, and (a) a step of crossing a plant variety having a weak seed dormancy trait with any plant variety , (B) determining the degree of seed dormancy in the individual obtained by mating by the determination method of the present invention, and (c) selecting a variety determined to have weak seed dormancy. Including.

  Examples of “arbitrary plant varieties” to be crossed with plant varieties with weak seed dormancy traits include, for example, varieties with strong seed dormancy traits, varieties with strong seed dormancy traits, and weak seed dormancy traits Examples include, but are not limited to, individuals obtained by crossing with cultivars.

  By using the breeding method of the present invention, it becomes possible to select a plant having a modified seed dormancy character at the seed or seedling stage, and it is possible to grow a variety having a modified seed dormancy character in a short period of time. It becomes possible to carry out between.

  EXAMPLES Hereinafter, although an Example demonstrates this invention further in detail, this invention is not restrict | limited to an Example.

(1) Determination of dormancy-barley-
Seeds that reached physiological ripening (green color on the neck and cocoon faded) were harvested, dried for 2 days at 30 ° C. and 10% relative humidity, degranulated, and stored frozen at −20 ° C.

  The stored seeds were awakened by dormancy at 25 ° C., then sown in petri dishes to absorb water, and sprouting was induced at 25 ° C. Then, the dormancy was evaluated by the germination rate (rooting rate) on the fourth day after sowing.

  In the experiment (2) below, the germination rate of seeds that had been dormant and awakened at 25 ° C. for 5 weeks was investigated, and the germination rate was 0-49% for strongly dormant homo, 50-89% hetero, 90-100 The genotype was estimated as% dormant homozygosity. If necessary, the germination rate of seeds that had been dormant and awakened for 10 weeks at 25 ° C. was investigated (FIG. 1).

  Since heterozygous individuals had a weak seed dormancy phenotype, it was considered that the weak seed dormancy type gene is dominant and encodes a functional protein.

-Wheat-
Seeds that have reached physiological ripening on the 60th day after flowering are harvested, then sown in a petri dish, induced to germinate at 20 ° C, and the dormancy is evaluated by the germination rate on the 7th day after sowing. be able to. The germination rate can be estimated as 0-39% strongly dormant homo, 40-59% hetero, 60-100% weak dormant homo (Nakamura S. et al., Plant Cell. 2011) Sep; 23 (9): 3215-29. See Figure 5A and its experimental method).

(2) Identification of barley Qsd1 gene Four seeds of seed dormancy QTLs derived from wild barley isolated from hybrid progenies by crossing of cultivated barley “Haruna Nijo” and wild barley “H602” have been identified so far. Already sits on a high-density linkage map with EST markers (Non-Patent Documents 2 and 3). Among these QTLs, a large segregation group that segregates only Qsd1 was bred, and EST markers that were closely linked and co-segregated with Qsd1 were selected by 910 BC ₃ F ₂ generations. Furthermore, 4,792 individuals of the next generation BC ₃ F ₃ generation were obtained, and the recombinant type in them was identified. Since the barley ESTs in the Qsd1 region are extremely homologous to the gene of rice chromosome 9 (FIG. 2), the barley ESTs corresponding to the genes on the rice genome were arranged in order (FIG. 3) to confirm recombination. As a result, a marker EST4 that co-separates with the QTL genotype estimated from the result of determination of dormancy was obtained (FIG. 4). Using this EST marker, BAC clones of “Haruna Nijo” (D. Saisho et al., Breed. Sci. 57: 29-38, 2007) and “H602” were selected and their nucleotide sequences were analyzed. . This sequence information is included on the full-length sequence of Haruna Nijo (K. Sato et al., DNA Research 16: 81-89, 2009, T. Matsumoto, et al., Plant Physiol. 156: 20-28, 2011). Positioning, gene prediction was performed using the Rice Genome Automated Annotation System (RiceGAAS). As a result, two candidate genes were estimated.

Furthermore, as a result of obtaining a large-scale population of BC ₃ F ₄ generation and using it, the progeny of the genotype was tested. As a result, the mutation involved in seed dormancy was at the 868th base from the 5 ′ side of gene 1 and gene 2. It was suggested that it exists in 9467 bases extending from the 5 ′ side to the 3394th base (FIG. 5). Gene 1 and gene 2 had their 3 ′ ends facing each other in the intergenic region, and the distance between the 3 ′ ends was 345 bases excluding PolyA tail. Assuming that each full-length sequence used for gene prediction was transcribed, it is unlikely that both genes share a transcription region, and the 5 'regulatory region controls seed dormancy. There is no possibility.

When the gene sequences of Haruna Nijo and wild barley were translated into amino acids, gene 1 showed two SNPs in exons but no amino acid substitutions. On the other hand, gene 2 had four SNPs with amino acid substitutions, and was present on the putative domain (FIGS. 6 and 9). This fact suggests that the true identity of the Qsd1 gene involved in seed dormancy is gene 2, and that SNP with nonsynonymous substitution is a mutation that governs this trait.

  In addition, although annotations were investigated for two genes, no description directly related to seed dormancy was found for either gene.

Next, we analyzed dormancy (d) and non-dormancy (nd) alleles of 9 populations (Non-patent Document 2) where Qsd1 was identified by analyzing seed dormancy of barley (Fig. 7). Comparison with the base of the SNP of gene 2. As a result, the allele of the non-synonymous SNP located at the most 5 ′ end of gene 2 and the allele of Qsd1 were completely matched, so it was determined that this SNP controls dormancy (FIG. 8).

  Furthermore, as a result of confirming the expression levels of gene 1 and gene 2 in seeds, young leaves, adult leaves, radicles, and adult roots for the above 9 groups of parents, expression other than seeds was hardly observed in gene 2, The expression level was also extremely high (FIG. 10). Furthermore, as a result of confirming the tissue localization of the gene product in the ripening wild barley by in situ hybridization, the gene 2 product was expressed throughout the seed embryo (FIG. 11).

(3) Identification of wheat Qsd1 gene (i) Acquisition of homologous gene sequence of wheat Acquired homologous gene of normal wheat (Triticum aestivum, 2n = 6x = 42) to the full-length sequence of barley seed dormancy gene Qsd1 Therefore, the full length cDNA data of wheat is obtained by introducing the full length sequence NIASHv3013O02 of barley Qsd1 into TriFLDB: Triticeae Full-Length CDS DataBase ver.2.0 (http://trifldb.psc.riken.jp/ver.2.0/). Blast search was performed to obtain a wheat full-length sequence (RFL_Contig4246, GenBank: AK333743.1) with extremely high homology (evalue = 0). The nucleotide sequence of RFL_Contig4246 is shown in SEQ ID NO: 12. This sequence is derived from the wheat variety Chinese Spring.

(Ii) Primer creation Using the software Primer 3, three pairs of primers (Contig4246-1L and Contig4246-1R, Contig4246-2L and Contig4246-2R, Contig4246-2R, Contig4246-3L and the primer for selecting a BAC clone from the sequence of RFL_Contig4246 Contig4246-3R) was created. The primer sequences are as follows.
Contig4246-1_L: GTGACTCTTTGCCCCAACAT (SEQ ID NO: 13)
Contig4246-1_R: CCTGTGGCTTGTGTAGCTGA (SEQ ID NO: 14)
Contig4246-2_L: GAGATTCGCAAAGTGGCTTC (SEQ ID NO: 15)
Contig4246-2_R: GAAGATGCACATCAGCTTCG (SEQ ID NO: 16)
Contig4246-3_L: GACCATAAACCCCAAGGTGA (SEQ ID NO: 17)
Contig4246-3_R: AATGGACGCCGAGTATAACG (SEQ ID NO: 18)
When amplification of Chinese Spring genomic DNA was confirmed by PCR, amplification was not confirmed with the primer pairs of Contig4246-3L and Contig4246-3R. A single PCR product was obtained for the remaining two pairs of primers and used for the subsequent analysis.

(iii) Selection of BAC clones The DNA pool of the Chinese Spring BAC library was PCR-amplified using the above two pairs of primers, and amplification was obtained for each of the 4 clones with each primer pair. Each of these clones was digested with Not I and the insert size was confirmed. As a result, WCS0897G21 (75.6 Kb) was the minimum (75.6 kb), and this clone was used for the subsequent analysis.

(Iv) BAC sequence analysis and gene sequence identification
A shotgun library of WCS0897G21 was created, and about 30 times as much nucleotide sequence was analyzed by the Sanger method. The quality of each sequence was adjusted by Phred / Prap (http://www.phrap.org/phredphrapconsed.html) and assembled to create a contig sequence. When the primer sequences were positioned in these contig sequences, two pairs of primer sequences used for selection were identified in the contig6 genome sequence. Furthermore, the base sequence of the full-length wheat sequence RFL_Contig4246 was included in contig6.

(V) Identification of gene sequence
RFL_Contig4246 and contig6 were aligned by CLUSTALW (http://www.genome.jp/tools/clustalw/), and exons and introns of the gene sequence were estimated. Furthermore, the translation initiation codon and the termination codon were estimated. Furthermore, the amino acid sequence was analyzed by GENETYX10.

The base sequence of Qsd1 cDNA derived from RFL_Contig4246 in Chinese Spring obtained by the above analysis is shown in SEQ ID NO: 7, and the amino acid sequence encoded by the DNA is shown in SEQ ID NO: 8. In addition, the base sequence of contig6-derived Qsd1 genomic DNA in Chinese Spring is SEQ ID NO: 9, and the base sequence of Qsd1 cDNA extracted from contig6-derived Qsd1 genomic DNA is SEQ ID NO: 10, and the amino acid sequence encoded by these DNAs. Is shown in SEQ ID NO: 11.

  In addition, the alignment of barley full length sequence NIASHv3013O02 (SEQ ID NO: 19) and wheat full length sequence RFL_Contig4246 (SEQ ID NO: 12) was analyzed by CLUSTALW. The results are shown in FIGS.

As described above, according to the present invention, a novel gene Qsd1 that governs the degree of seed dormancy of plants is identified, and using the identified Qsd1 gene, determination of the degree of seed dormancy of plants and seed dormancy can be achieved. Production and breeding of modified plants became possible. The determination of the degree of seed dormancy in the present invention is targeted to the gene that controls it, and can be carried out using an individual (for example, seed) in the early stage of growth. For this reason, if the determination method of the present invention is used, it is possible to breed varieties with modified seed dormancy specifically and efficiently.

  Weakly dormant plants produced and bred in this way can ensure sufficient and early germination individuals when dormancy is deep and germination is significantly delayed, or when germination is delayed due to low precipitation in dry areas Useful in terms. Strong seed dormancy plants are useful in that they can prevent seed quality degradation due to ear germination in areas with heavy rainfall. In addition, by controlling the seed dormancy, it is possible to promote uniform germination in the brewing barley, thereby enabling efficient malt production. Therefore, the present invention can greatly contribute to the improvement of the yield of crops and the reduction of economic loss due to the deterioration of quality.

SEQ ID NOs: 13-18
<223> Artificially synthesized primer sequences

Claims (16)

The DNA according to any one of the following (a) to (d), which encodes a protein having an activity of weakening a plant seed dormancy trait.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 2, 8, or 11
(B) DNA containing the coding region of the base sequence described in SEQ ID NO: 1, 3, 7, 9 or 10
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added and / or inserted in the amino acid sequence of SEQ ID NO: 2, 8 or 11
(D) DNA that hybridizes under stringent conditions with DNA comprising the nucleotide sequence set forth in SEQ ID NO: 1, 3, 7, 9 or 10 The DNA according to any one of the following (a) to (d), which encodes a protein having an activity that enhances a plant seed dormancy trait.
(A) DNA encoding a protein comprising the amino acid sequence set forth in SEQ ID NO: 5
(B) DNA containing the coding region of the nucleotide sequence set forth in SEQ ID NO: 4 or 6
(C) DNA encoding a protein comprising an amino acid sequence in which one or more amino acids are substituted, deleted, added, and / or inserted in the amino acid sequence of SEQ ID NO: 5
(D) DNA that hybridizes under stringent conditions with the DNA comprising the nucleotide sequence set forth in SEQ ID NO: 4 or 6 The DNA according to any one of the following (a) to (c), which has an activity of enhancing a plant seed dormancy trait.
(A) DNA encoding a double-stranded RNA complementary to the transcription product of the DNA of claim 1
(B) DNA encoding an antisense RNA complementary to the transcription product of the DNA of claim 1
(C) DNA encoding an RNA having a ribozyme activity that specifically cleaves the transcript of the DNA of claim 1   A vector comprising the DNA according to any one of claims 1 to 3.   A plant cell into which the DNA according to any one of claims 1 to 3 has been introduced.   A plant comprising the cell according to claim 5.   A plant that is a descendant or clone of the plant according to claim 6.   The plant propagation material according to claim 6 or 7.   A method for producing a plant in which the seed dormancy trait is weakened, which comprises the step of introducing the DNA of claim 1 into the plant.   A method for producing a plant with enhanced seed dormancy trait, wherein the expression or function of the DNA according to claim 1 is suppressed in the plant.   A method for producing a plant with enhanced seed dormancy trait, comprising the step of introducing the DNA according to claim 2 or 3 into the plant.   A drug for weakening a plant seed dormancy trait comprising the DNA according to claim 1 or a vector into which the DNA is inserted.   A drug for enhancing the seed dormancy trait of a plant, comprising the DNA according to claim 2 or 3 or a vector into which the DNA has been inserted.   A method for determining the degree of seed dormancy in a plant, comprising analyzing the base sequence of the DNA according to claim 1 or 2 in a test plant and comparing it with a control base sequence. A method of breeding a plant with a weak seed dormancy trait,
(A) a step of crossing a plant variety of a weak seed dormancy trait with any plant variety,
(B) a step of determining the degree of seed dormancy in the individual obtained by mating in step (a) by the method according to claim 14, and (c) a variety determined to have weak seed dormancy Selecting the method. A method of breeding a plant with a strong seed dormancy trait,
(A) a step of crossing a plant variety having a strong seed dormancy trait with any plant variety,
(B) a step of determining the degree of seed dormancy in the individual obtained by mating in step (a) by the method according to claim 14, and (c) a variety determined to have strong seed dormancy Selecting the method.