JPS61268183A - Dna, recombinant dna and microorganism containing same - Google Patents

Abstract

PURPOSE:To provide the titled microorganism containing a specific DNA and a recombinant DNA containing the same and suitable for the expression of specific polypeptide. CONSTITUTION:A heat-resistant beta-galactosidase gene [bgaB] cloned to E.coli plasmid pHG1 or B.subtilis plasmid pHG5, etc., is incised with a restriction enzyme to separate a DNA of formula containing the promoter region originated from a thermophilic bacterium, Bacillus stearothermophilus. The DNA is linked to a vector DNA incised with a restriction enzyme (e.g. a plasmid replicable with a Bacillus such as pUB110) using T4DNA ligase to obtain a recombinant DNA integrated with the above DNA. The recombinant DNA is introduced into a bacterial cell of Bacillus genus in a specific medium by a protoplast transformation method.

Description

Detailed Description of the Invention (Object of the Invention) The present invention provides a DNA containing a promoter region derived from the thermophilic bacterium Bacillus stearothermophilus.

This invention relates to recombinant DNA that has incorporated this DNA and microorganisms that contain them. With the recent development of genetic engineering technology, it has become possible to mass-produce proteins derived from foreign genes using microorganisms.

One of the important factors is to use a strong C2 promoter for the expression of genes related to the production of these proteins by microorganisms.

Conventionally, expression vectors containing strong promoters have been developed in systems using E. coli as a host, such as trp promoter, lac promoter, 1pp promoter,
The pho promoter etc. are used.

On the other hand, bacteria of the genus Pacillus, represented by Bacillus subtilis, are superior hosts compared to Escherichia coli in terms of safety, ability to secrete proteins outside the body, etc., but the development of expression vectors is far behind.

Conventionally, regarding the construction of an expression vector in Bacillus bacteria and its use, plasmid pPL608 (i;
'-y (Gene) Volume 16, Page 199, 19
1981, ].

pGR71 series plasmid [Molecular
Cloning and gene regulation in bacteria (Molecular Cloning a
nd Gene Regulation in Bac
illi), page 311.

Academic Press
s), 1982,].

Peninlinase gene of Pacillus leicheniformis (
A plasmid (Molecular Cloning and Gene Regulation in PA) using the promoter of penP).

p. 159, Academic Press, 1982)
etc., but all of them are downstream of the promoter (: the amount of expression of the inserted foreign gene is still not sufficient).

The present inventors succeeded in introducing the heat-stable β-galactosidase gene (bga B) of Bacillus stearothermophilus into Bacillus subtilis via a vector using C. genetic recombination technology. It has been found that Bacillus subtilis produces as much as 6-10% of heat-stable β-galactosidase per cell protein.

The present invention is a research process aimed at developing an expression vector using Pacilus bacteria as a host, utilizing the high expression mechanism of thermostable β-galactosidase in Bacillus subtilis. We discovered that the derived promoter has strong promoter activity,
This is based on the elucidation of its DNA structure.

According to the present invention, it is possible to construct an expression vector in a Pacillus bacterium suitable for expressing a target polypeptide.

(Structure of the Invention) The present invention relates to a DNA represented by the formula [I] containing a promoter derived from the thermophilic bacterium Pacillus stearothermophilus, a recombinant DNA incorporating the DNA, and a microorganism containing them (=related). be.

5' GGCCTATATATTTGGTTGTTT
TTAA3' CCGGATATATAAACCAA
CAAAAATTTTTAAAAAAATATATATTTT
ATTTAGTAAAATTTTTTATATATAAAA
TAAATCATAAAATATTGTTGTTGACA
AATACTAATTTATAACAACAACTGT
TTATGATTA, TTTTAACTTAAT'l'
TATAATTAAAACTAAAATTGAATTAA
ATATTAATTTG The bga B gene isolated from Bacillus stearothermophilus was isolated from Escherichia coli plasmids pH01, -G2 (Japanese Patent Application No. 171077/1983) or Bacillus subtilis plasmid G5 (Japanese Patent Application No. 59/20296).
No. 5).

Isolation of DNA containing the bga B promoter region from this bga f3 gene was carried out using plasmids pH01 and pH0.
This can be done by cleaving C2 or pH05 with a restriction enzyme.

Preparation of recombinant DNA incorporating that DNA.

This can be carried out by ligating the isolated DNA and vector DNA cut with a restriction enzyme using T4 DNA ligase.

The vector DNA used here is pUB110°1)E194. pC194, pBD9. pTP4.
pPL603. Plasmids that can be replicated in Pacillus bacteria such as plasmids are preferred.

The recombinant DNA obtained by the above method was introduced into Pacilus bacteria using the protoplast transformation method [Molecular & General Genetics
and General Genetics), No. 16
Volume 8.

111, 1979) C2.

The method for selecting a strain having recombinant DNA (i.e., vector DNA incorporating DNA containing the bgaB gene promoter) is as follows: Preparation of the recombinant DNA (C): Although it varies depending on the restriction enzyme used and the type of vector DNA, For example, if Eco RI and Pst I are used as restriction enzymes and pPL603 is used as a vector, this bga
B Promoter C: Since the downstream cat-86 gene is expressed, DM3 agar medium containing chloramphenicol and kanamycin C: Can be selected as a viable colony.

Naori M3 agar medium is prepared by separately mixing the following 8 solutions after sterilization.

1) 4chi agar 200-2)
IM sodium succinate (pH 7,3) 50
011t13)5 ticazamino acid 100
-4) 10% yeast extract 50-3.5
Dipotassium phosphate+. . d5) 1.5 potassium typhosphate 6) 20 tyglucose 251L17)
IMMgcZ,
20y8) 2C Bovine serum albumin 5dNext, recombinant D was obtained from the recombinant DNA strain obtained by the above method.
Alkaline extraction method of NA [Nucleic Acid Research
) Vol. 7, p. 1513, 1979] (2), and the incorporation of the DNA was determined by the dideoxy method [5science, Vol. 214, p. 1205.

In 1981, the base sequence was determined and confirmed.

Next, 9 Examples will be shown to explain the present invention in detail.

In addition, in the following two examples, bg was used as the DNA donor.
a Escherichia coli carrying plasmid pH02 in which the B gene has been cloned! J 294-43 (p.
H02) (Feikoken Bibori No. 7233), vector DN
pPL603 (Journal of Bacteriology) as A.
146, p. 1162, 1981] was used as a host microorganism, Pacillus subtilis RM1.
25 (Molecular and General Genetics Vol. 152.

p. 65, 1977) [This microorganism was produced by The Ohio State University.

Pasir Genetic Fist Stock Sen 9-(Bac
illus Genetic 5tock Cente
r) (: Pasillus subtilis IA 253, and is available to anyone).

Example 1. (D containing the bga B gene promoter
Isolation of NA) Escherichia coli 294-43 (pH 02) was
Medium (Na, HPO45, 8ji/l, KH2PO
23l/l.

NaCL 59/l, NH4cz 1 i/L, C
aC/411m+5;'/'4Mg5Oa 95'It
9/4 Fect31,6iy/4 Casamino acid 51
1/l, glucose4. y/z) 1501111
The absorbance at 600 nm of the culture solution at 37°C was 0.6-
After culturing until it reaches 1.0, 200μI/! Chloramphenicol (Kl) was added and the culture was continued overnight. After collecting and washing the bacterial cells, 25 mM T containing 21 v/d Norizotame was added.
ris-HCL (pH 8,0), 50mM g/
I/Nia-, C, 10mM EDTA, 15M (: Suspend and leave at 0°C for 30 minutes, then add 0.2N NaOH.

ILsSDS (lauryl sulfate f-)! J Kum) 30
ml was added to lyse the bacteria, and the mixture was left at 0°C for 5 minutes. Then 3M
Add 22.5 ml of sodium acetate (4.8 liters),
After standing at 0°C for 1 hour, centrifugation (8,00 rpm,
20 minutes) to obtain a superior groove. Add 2.5 times the amount of ethanol to supernatant C to precipitate the DNA, then add 5 liters of 1QmM
Tris-HCL (pH 7,5), 1 mM
It was dissolved in EDTA (hereinafter referred to as TE buffer). This DNA solution was subjected to dicum bromide-sesicum chloride equilibrium density gradient centrifugation to obtain a pH02 plasmid of 500 μs.

DNA containing the pO motor of the bga B gene (10
To isolate the 7 bp (D Hae [1-Alu (fragment)), 200 U of H
add indl[ and 1200(7)C1aI, 10
mM Tris-HCt (pH 18,0), 1
0mM MgCt, 50mM NaCt, 1mM di? ,
After treatment at 37° C. for 4 hours in 320μ of the reaction solution (7).

4% polyacrylamide gel electrophoresis (two fractions,
975 bl) was recovered.

(13 μl 975 bp) (ind Ill-C1a I fragment 1
3μ, 9+2 pairs, add 36U Hae[l, 1
0 mM Tris-HCt (pH 7,5).

After treatment at 37° C. for 3 hours in 50 g of a reaction solution containing 10 mM Mgct2, 50 mM Nact, and 1 mM diteothreitol, Hae[l was inactivated by heating at 70° C. for 10 minutes.

EC0RI linker-pGGAA'I'Tcc (manufactured by Takara Shuzo) whose 5' end was phosphorylated with T4 polynucleotide kinase (250 pmo) was added, and 66 mM Tr
is-Hct (pH 7,5), 10mM Mg
Ctz, 10mM 9f male L/I)/
I/, 125U of T4 DNA in 100μ of 1mM ATP reaction solution! The reaction was carried out using J gauze C2 at 15°C for 16 hours.

Heat at 65°C for 20 minutes to create T4DNA! After inactivating J gauze, 4 μt of IMNaCz was added to reaction solution 104.
μ in medium, 60U Eco Ri and 48U (D Al
u ■Te Processed at 37°C for 4 hours.

Heat at 70°C for 10 minutes to combine EcoRl and AluI.
After inactivating this pGC
Add 200 pmol of TGCAGC (manufactured by Takara Shuzo) and add 6
6mM Tris-HCt (pkl 7.5),
Add 150 U of T4 DNA ligase (150 U of
The reaction was carried out for 16 hours.

After heating at 65°C for 20 minutes to inactivate T4 DNA ligase, 210μ of the reaction solution was added with 20μt of IMNact.
was treated with 60 U of Pstl at 37° C. for 3 hours.

This DNA solution was fractionated by 5 polyacrylamide gel electrophoresis C2, and 119bp EcoRl-Ps
The tl fragment was collected. (1.5 μg).

Example 2. (Preparation and cutting of vector DNA) DNA of pPL603 having kanamycin resistance was prepared as follows (
Prepared by stirring.

A known Bacillus subtilis, Pacilus subtilis IE31, carrying pPL 603 as a plasmid [Ohio State University, Bacillus Genetic Science Department 9-(
Bacillus 0enetic 5tock Ce
(obtained from Nter)] was mixed with L medium (1 g tryptone, 0.5 t4 yeast extract, 10.5% Na C +
Glue: 7-su 0.2%, pH 7.0) The absorbance of the culture solution at 5QQ nm was 2-3 (=
After culturing with shaking until the bacterial cells were collected and washed, 25 mM Tris-HCt (p
H8,0).

50mM g/l/:7-su, 10mM EDTA50
WtJ! i:l-suspended.

Leave at 37°C for 30 minutes. 0.2M NaOH, 1l
SD 8100m/ was added to lyse the bacteria, and the mixture was left at 0°C for 5 minutes.

Then, 75ml of 3M sodium acetate (pH 4,8) was added.

After standing at 0°C for 1 hour, centrifugation (8,00 rpm,
20 minutes) to obtain a supernatant. After adding 2.5 times the volume of ethanol to the supernatant (2) to precipitate the DNA, it was dissolved in 5d TE buffer.
Cesium chloride equilibrium density gradient centrifugation, pPL 6
50 μg of 03 plasmid DNA was obtained.

pPL 6032 to cut the vector DNA
．． 2μg (2 vs. IOU of EcoRl and 5U of Pst
Add l.

50 mM Tris-H (1 (pH 7,5),
10mM MgC4, 100mM NaCL, l
Add 25μ of the reaction solution of mM dithiothreitol at 37°C.
The reaction was carried out for 2 hours. Heat at 70℃ for 10 minutes to make it Eco
RI and Pstl were inactivated.

Example 3. (Legation of DNA fragment containing bga B promoter and vector DNA) 0.5 μ9 of the DNA fragment obtained in Example 1 and 0.51 t/i of the vector DNA obtained in Example 2 were combined at 55 mM T.
ris-Hct (pH 7,5), 10mM MgCz
,, 10mM Sif,t/Cv i)-,11/
, 1 mM ATP (7) 50 U of T4 DNA in 35 pL of reaction solution! The reaction was carried out using J gauze at 15°C for 16 hours.

An outline of the steps up to this point is shown in Figure 1C.

Example 4. (Transformation of Bacillus subtilis with recombinant DNA) Penassay Banrus subtilis, cRM125
broth (meat extract 0.15%, yeast extract 0.1
5%, Pepto 10.5%, G/I/Course 0.1%
, NactO, 3%, dipotassium phosphate 0
．． 37%, 1 potassium phosphate 0.13L.

pi(7,0) At 37°C in 20g, the absorbance of the 570 plane is 0.8-1. Culture with shaking until OC2 is reached and collect bacteria. SMMP solution containing 2 w/ld lysozyme (2x 8MM solution and 4x Penassay br
A solution of two equal amounts of oth) 2.5 mA! Prepare protoplasts by suspending and gently shaking at 37°C for 2 hours.

Centrifuge the protoplasts (4,00 Orpm, 15
After washing with 8MMP solution, centrifugation was performed again.

2'R1 SMNP solution (suspend twice.

In addition, 8MM solution is 0.5M i/! Sugar, 20mM maleic acid (pH 6,5), 20mM MgCZ,
This is a mixture of YoGJ7'Z611.

35μt of DNA solution obtained in Example 3 and 8MM at double concentration
This protoplast suspension was mixed with 35 μt of solution at 0.51+7. and 1.5d of 40 tiboethylene glycol solution (in 10017 (: 40.!i' of polyethylene glycol 6000, containing 50 parts of 8MM solution at twice the concentration), and after standing for 2 minutes, add 5+j of SMMP solution. In addition, the protoplasts were collected by centrifugation. The protoplasts were suspended in 1-SMMP solution (2), cultured with shaking at 30°C for 1.5 hours, and then incubated with kanamycin (1xtg/d) and chloramphenicol (10
μg/d) was applied to an agar medium for DM3 regeneration. When cultured at 37°C for 2 days, Bacillus subtilis retaining the recombinant DNA can be obtained as a colony resistant to both kanamycin and chloramphenicol antibiotics.

The novel Bacillus subtilis thus obtained was named Pacillus subtilis RM125 (pTF 6 ).

In addition, this Bacillus subtilis RM125 (pTF6
) has the same mycological properties as ordinary Bacillus subtilis, except that it exhibits resistance to kanamycin and chloramphenicol.

Example 5. (Structural analysis of recombinant plasmids) Bacillus
A recombinant plasmid from S. subtilis RM 125 (pTF 6 ) was prepared by the method described in Example 2.

1) Add 62μg of TF≦2 EcoR15U and pst (5U).

50 mM 'l'ris-HCt (pH 7,5),
10mM Mgct*, 100mM NaCt
, 50μ of 1mM diteothreitol reaction solution was added to
The sizes of the two types of DNA fragments generated after treatment at 7°C for 2 hours were measured by 5-tuply polyacrylamide gel electrophoresis and 1% agarose gel electrophoresis, and they were 4600 bp and 11 bp.
It was 9 bp.

Second, as a result of determining the base sequence of this 119 bp DNA fragment by the dideoxy method, it has a structure in which an Eco RI linker and a Pstl linker are connected to the end of the Hae 1ll-Alu I fragment (107 bp including the bgaB promoter). This was confirmed.

(Effects of the Invention) It will be explained from Test Example C2 that the DNA containing the bga B promoter of the present invention has high expression efficiency in Pacillus bacteria C2.

Test example [ca expressed by bga B promoter
Comparison of t-→6 gene product (chloramphenicol acetyltransferase) production] Pacillus subtilis RM 125 (pTF 6)
37 in Penassay broth 5Qm containing 5 μg/cochloramphenicol and 1% glucose.
℃, gestation culture for 20 hours, and after bacterial collection, 0.1 M Tri
s-HCl (pH 7,8) 5 RIC: Suspend. After ultrasonication, centrifugation (15000 rpm, 15
The supernatant obtained was used as a cell extract.

The chloramphenicol acetyltransferase (hereinafter referred to as CAT) activity of this cell extract was measured using a shirt (W).
V, Shaw) method
Methods in Engymo
43, p. 737, 1975), it was 17 U/■ protein.

Pasirus Zoo If-9S R carrying pPL 603
Cell extract obtained by culturing M125 in a similar manner (7)
CAT activity) 9 proteins in 10.052 U/1.

By introducing the bga B promoter, CAT production increased approximately 300 times (second result).

[Brief explanation of drawings]

FIG. 1 shows a flowchart of the method for producing recombinant DNApTF6 of the present invention. In the figure, E Id, BcoRl. C is C1al, H is Hindll, P is Pstl,
B is BamHl. Bg indicates the restriction site of Bgl It, respectively. Tc represents a tetrathiicline resistance gene, Km represents a kanamain resistance gene, and cat-86 represents a chloramphenicol resistance gene.

Claims (3)

[Claims] (1) DNA represented by formula [I] containing a promoter region derived from thermophilic bacteria Bacillus and Stearothermophilus. ▲There are mathematical formulas, chemical formulas, tables, etc.▼・・・〔I〕 (2) Recombinant D incorporating the DNA represented by formula [I]
N.A. ▲There are mathematical formulas, chemical formulas, tables, etc.▼・・・〔I〕 (3) Recombinant D incorporating the DNA represented by formula [I]
Microorganisms containing NA. ▲There are mathematical formulas, chemical formulas, tables, etc.▼・・・〔I〕