JPH11346798A - Determination of nucleic acid and detection of bacteria producing vero toxin - Google Patents

Abstract

PROBLEM TO BE SOLVED: To exactly and rapidly measure nucleic acids, for example, detection of the presence of vero toxin-producing bacteria, by amplifying the nucleic acid in the sample by using a fluorescent labelled primer and measuring the fluorescence polarization value of the specimen during or after amplification. SOLUTION: The nucleic acid in the sample is amplified by a gene amplification method and the amount of the nucleic acid in the amplification products is determined by the fluorescence polarization. In this case, a fluorescent labeled primer with at least one of FITC(fluorescein isothiccyanate) and/or fluorescein is used in an initial concentration of 1-200 nM to amplify the nucleic acid by the PCR technique with 25 or more time cycles and the fluorescence polarization value of the specimen is measured during or after the amplification whereby the nucleic acid useful for detection of Vero toxin-producing bacteria can be exactly and rapidly measured in good reproducibility.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a method for measuring a nucleic acid in a sample, and more particularly to a method for rapidly measuring a product obtained by amplifying a nucleic acid by a gene amplification (PCR) method using a fluorescence polarization method. Relates to a method for rapidly detecting the presence or absence of Vero toxin-producing bacteria by the method.

[0002]

2. Description of the Related Art In recent years, there has been an increasing need to measure a nucleic acid which is the main body of a gene, and a measurement method using a radioactive label or an enzyme label has been studied using a conventional immunoassay method as a model, and has been partially put into practical use. I have. Most of the conventional nucleic acid measurement methods represented by these methods are configured as heterogeneous measurement systems. That is, after mixing the sample containing the nucleic acid to be measured and the reagent (measuring reagent) used for the measurement and reacting, the unreacted measuring substance or the measuring reagent is separated from those that have already reacted, and then generated due to the label. This is a method of measuring a signal to be transmitted. The above separation operation is usually called B / F separation. Examples of such a B / F separation method include a method using a DNA reagent immobilized on a reaction container or a film, a method using magnetic fine particles, and a method using electrophoresis. Alternatively, a long operation is required.

As a measurement method that does not require such B / F separation, a fluorescence polarization method applicable to a homogeneous measurement system is known. This method has been conventionally known as a simple and rapid method for measuring a drug or the like in a sample, but is also considered to be applicable as a method for measuring a nucleic acid (Japanese Patent Laid-Open No. 5-123196). Gazettes). In order to measure a nucleic acid by the method, a fluorescent substance is labeled on a nucleic acid having a base sequence complementary to the base sequence of the nucleic acid to be detected, and this is used as a reagent. Here, the above reagent is called a fluorescent labeling reagent (labeled probe). Usually, a single-stranded nucleic acid is used as the reagent.

An example of a process for measuring a nucleic acid by the fluorescence polarization method is described below. First, a fluorescent labeling reagent is added to a sample to be measured. When a nucleic acid containing a target base sequence is present in the sample, a site having the target base sequence and a sequence complementary to each other are associated and bound to each other at a certain reaction time of the reagent. This reaction is called hybridization. Here, it is assumed that the nucleic acid in the sample is in a single-stranded state due to treatment with temperature or chemicals. Upon hybridization, when the fluorescent labeling reagent binds to the target nucleic acid, the apparent molecular weight (or effective volume) of the reagent increases from before binding. Generally, the molecular motion in a solution is slower as the molecular weight is larger. Therefore, when the degree of fluorescence polarization before and after the reaction is monitored, the value after binding by hybridization becomes larger than before binding. This is because hybridization with the target nucleic acid increases the apparent molecular weight of the fluorescent labeling reagent. If the amount of the fluorescent labeling reagent is fixed, the degree of this change corresponds to the amount of the target nucleic acid. Therefore, by the change in the degree of fluorescence polarization before and after the reaction,
The amount of the target nucleic acid can be measured.

[0005] Normally, the degree of fluorescence polarization is determined by setting a polarization element on both the excitation side and the fluorescence side, rotating the polarization element on the fluorescence side, and measuring fluorescence having a polarization plane parallel and perpendicular to the polarization plane of the excitation light. Thus, one measurement can be completed in a short time of 1 minute or less. As described above, the fluorescence polarization method does not require a B / F separation operation,
It can be applied to a quick and simple nucleic acid measurement method.
However, the measurement sensitivity of the method basically depends on the detection sensitivity of a fluorescent labeling substance (label), and therefore, it is difficult to say that the sensitivity is high. On the other hand, for example, when measuring the nucleic acid of microorganisms in a sample from a patient or food, the amount is often very small, and it may be difficult to measure it sensitively by the fluorescence polarization method.

Therefore, in order to measure nucleic acids of these microorganisms and cells with high sensitivity, PCR (for example, Erlic
h, HA, Gelfand, DH and Saiki, RK (1988) S
Microbial genes (nucleic acids) by gene amplification methods such as pecific DNA amplification. (See Nature 331, 461-462.)
It is easy to imagine that it would be better to amplify the amount of γ and measure it by the fluorescence polarization method.

[0007]

However, according to an experiment in which deoxyribonucleic acid (DNA) was measured, a normal PCR operation (for example, Erlich, H. et al.) Was performed on a measurement sample.
A., Gelfand, DH andSaiki, RK (1988) Specific
DNA amplification.Nature 331, Nature 331 (1988) 4
61-462), and when the DNA in the product is directly measured by the fluorescence polarization method, problems such as insufficient detection sensitivity and low reproducibility of the results may be observed. Therefore, the present invention overcomes the drawbacks of the prior art, and in the measurement of nucleic acid in a sample, a product obtained by amplifying a nucleic acid by a gene amplification method using a fluorescence polarization method with good reproducibility, accurately and quickly. And a method for rapidly detecting the presence or absence of a Vero toxin-producing bacterium such as O-157 using the method.

[0008]

That is, the present invention is as follows. (1) In a nucleic acid measurement method in which a nucleic acid in a sample is amplified by a gene amplification method and the amount of the nucleic acid in the amplification product is measured by a fluorescence polarization method, at least one kind of fluorescently labeled primer is used at an initial concentration of 1 to 200 nM. A method for measuring a nucleic acid, comprising performing gene amplification by using the method and measuring the degree of fluorescence polarization of the sample during or after gene amplification. (2) The method for measuring a nucleic acid according to the above (1), wherein the fluorescent label is FITC (fluorescein isothiocyanate) or fluorescein. (3) The method for measuring a nucleic acid according to (1), wherein the number of cycles in the gene amplification method is 25 or more.

(4) A method for detecting a Vero toxin-producing bacterium using any one of the methods (1) to (3). (5) As a fluorescent-labeled primer, SEQ ID NO: 1 in the sequence listing
(4) The method for detecting a Vero toxin-producing bacterium according to the above (4), which uses a sequence having a fluorescent label at the end of the sequence (6) The method for detecting a Vero toxin-producing bacterium according to the above (4) or (5), wherein a primer shown in SEQ ID NO: 2 in the sequence listing is used as a primer other than the fluorescently labeled primer.

Most nucleic acid amplification products obtained by the ordinary PCR method are complete double strands. On the other hand, the fluorescent labeling reagent used in the fluorescence polarization method is basically a relatively short single strand. It is. When a longer double-stranded nucleic acid in a sample is denatured by heat treatment or the like to form a single-stranded nucleic acid, and then the hybridization between the fluorescent labeling reagent and the single-stranded nucleic acid having a base sequence complementary thereto is attempted. It is considered that the single-stranded nucleic acid on the side having no base sequence complementary to the fluorescent labeling reagent competes with the fluorescent labeling reagent, making hybridization difficult in terms of energy. As described above, in the nucleic acid measurement method using the fluorescence polarization method, the nucleic acid can be measured with good reproducibility and high sensitivity by simply combining the generally known gene amplification method such as PCR and the fluorescence polarization method. Could not be expected.

However, as in the present invention, at the time of gene amplification, by using at least one kind of fluorescently labeled primer at an initial concentration of 1 to 200 nM, the double-stranded nucleic acid is denatured by heat treatment or the like to form a single strand as described above. In addition, the step of hybridizing the single-stranded nucleic acid with a fluorescent labeling reagent is not required, and therefore, the problem that the hybridization becomes difficult in terms of energy as in the prior art does not occur. In addition, the elimination of the above-mentioned operation steps simplifies the operation and shortens the measurement time.

Further, after the fluorescently labeled primer anneals to the complementary sequence portion of the target nucleic acid, the nucleic acid strand is extended by a polymerase to form a double-stranded nucleic acid. Has a higher molecular weight than before annealing, and the increase in the molecular weight changes the degree of fluorescence polarization, thereby improving the sensitivity of nucleic acid measurement. In the present invention, in order to reliably measure a nucleic acid, an intensive experiment has been repeated to find an effective concentration of the fluorescently labeled primer to be used.

[0013]

BEST MODE FOR CARRYING OUT THE INVENTION The nucleic acid referred to in the present invention generally means DNA (deoxyribonucleic acid) or RNA (ribonucleic acid).
Is shown. As the fluorescent label used in the present invention, fluorescein, fluorescein isothiocyanate (F
ITC), tetramethylrhodamine isothiocyanate and the like. As a method of binding a fluorescent substance to a nucleic acid, for example, there is a covalent bond such as a thiocarbamide bond. For example, oligo DNA is synthesized by the phosphoramidite method and labeled with a fluorescent label such as fluorescein.

The fluorescently labeled primer used in the present invention can specifically detect a specific gene if it has about 20 to 30 bases (for example, Eur. J. Clin. Mi.
crobiol. Infect, Dis., 10 (1991) 1048-1055; Ne
i, M. and Li, WH Proc. Natl. Acad. Sci. USA. 76
(1979), 5269-5273). Examples of the nucleic acid in the sample in the present invention include nucleic acids such as bacteria and viruses in measurement samples such as serum, urine and various culture solutions, or tissue cells and their free nucleic acids.

The measurement sensitivity of the fluorescence polarization method in the present invention is:
It depends on the initial concentration of the fluorescently labeled primer during gene amplification. If the initial concentration of the fluorescently labeled (FITC) primer is too high, the fraction of the free fluorescently labeled primer becomes extremely high at equilibrium due to the relationship with the initial concentration of the target DNA, and the relative increase in the degree of fluorescence polarization is too small. Cannot measure. On the other hand, if the initial concentration of the fluorescently labeled primer is too low, the sensitivity in the measurement of the degree of fluorescence polarization will be low, making the measurement impossible. Therefore, the initial concentration of this fluorescently labeled primer is
The range is 1 to 200 nM. This will be proved by the examples described later.

The measurement sensitivity of the fluorescence polarization method in the present invention also depends on the number of PCR cycles. If the initial concentration of the fluorescently labeled primer is constant, the ratio of extended fluorescently labeled primer to free molecule increases with the number of PCR cycles. As a result, the relative increase in fluorescence anisotropy after PCR amplification also increases with the number of PCR cycles. In the present invention, sufficient sensitivity can be obtained if the number of PCR cycles is 25 or more. However, if the number is increased more than necessary, only the required time is increased, and if speeding up of the measurement is also considered, about 25 cycles are most preferable. This will be proved by the examples described later.

The principle of the fluorescence polarization measurement method will be briefly described below. Light emitted from a light source is filtered by a filter to an excitation wavelength of a fluorescent substance contained in a reagent, and is converted into linearly polarized light by a polarizing plate. The polarized light of the excitation wavelength is projected on a cell containing a measurement substance (sample), and excites a fluorescent substance in the sample. The excited fluorescent substance emits a fluorescent light having a wavelength corresponding to the substance. At this time, the fluorescent light causes dispersion of the polarization plane in accordance with the intensity of the Brownian motion. The fluorescence passes through a filter that transmits that wavelength, passes through a polarizer, and is converted to an electrical signal by a photodetector. By rotating the polarizer, the polarized light component Ia of the same direction as the excitation polarized light and the polarized light component I
Find b. Using these values, the following degree of fluorescence polarization P of the measurement substance is obtained.

[0018]

(Equation 1)

Ia indicates a polarization component having the same direction as the excitation polarization. Ib indicates a polarization component perpendicular to Ia. In this case, the stronger the Brownian motion of the fluorescent substance or the substance that binds the fluorescent substance, the more the polarization component I in the direction perpendicular to the excitation polarization.
b is large and at the same time the polarization component Ia parallel to it is small, so that P is small. In the present invention, by comparing the measured value of the degree of fluorescence polarization of the solution containing the fluorescent labeled primer and the nucleic acid to be measured before gene amplification with the measured value of the degree of fluorescence polarization after gene amplification, the presence or absence of the nucleic acid or The quantity can be measured more precisely.

In the present invention, the fluorescent-labeled primer is used for specifically binding to the complementary sequence portion of the nucleic acid to be measured, and similarly, has the property of specifically binding to the nucleic acid. Substances such as PNA
(Peptide nucleic acid, PerSeptive Biosystems, U.
It is also possible in principle to label a fluorescent substance on (SA) or the like and use this as an alternative to a fluorescently labeled primer. However, although the fluorescence polarization method is sometimes referred to as a fluorescence depolarization method, it may be considered to mean the same method in practice. The same applies to the degree of fluorescence polarization, the degree of depolarization of fluorescence, and the fluorescence anisotropy used as indices.

[0021]

EXAMPLES Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these Examples. In this example, in the summer of 1996, an attempt was made to use it for rapid measurement of pathogenic Escherichia coli (Vero toxin-producing bacteria) centering on O-157, which became a major social problem.

As a sample, Escherichia coli O157: H obtained from the Institute for Microbial Diseases of Osaka University (Osaka, Japan) was used.
Seven strains were used. The O157: H7 strain was cultured overnight on a 1.5 liter scale. Cells were collected by centrifugation. The cells were converted to sodium dodecyl sulfate (SD
S) and disrupted by protease K. Genomic DNA
Was purified by phenol extraction and ethanol precipitation.
Heat treatment was performed at 00 ° C. to obtain single-stranded DNA.

Oligonucleotide primers 1 and 2 used in the method of the present invention were used as Z. Lin et al. As a verotoxin type 2 (VT2) gene derived from E. coli O157: H7.
l. Microbial. Immunol. 37 (1993) 451-459. T. Karas
Synthesized based on the nucleotide sequence published in awa, T. Inouo, S. The sequence of the primer 1 is SEQ ID No. 1 in the sequence listing, and the sequence of the primer 2 is SEQ ID No. 2 in the same listing.
As a verotoxin type 2 (VT2) gene, Z. Lin
And the like are shown in SEQ ID NO: 3 in the same table. Primers 1 and 2
188-2 of the sequence shown in SEQ ID NO: 3 in the sequence listing, respectively.
08bp and 424-443bp. The 5 ′ end of the primer 1 was labeled with FITC (fluoroscein isothiocyanate) to obtain FITC primer 1.

The denatured single-stranded DNA sample was subjected to a PCR reaction using primer 1, FITC primer 1 and primer 2. This PCR was performed using the following reaction solution. 2.0 mM MgCl ₂ ;
10 mM Tris-HCl (pH 8.3); 50 mM KC
1; 20 ng of template DNA; 0.2 mM (each) dAT
P, dGTP, dCTP and dTTP; 0.2 μM primer 2; 100 μl aqueous solution containing 2.5 U of ExTaq DNA polymerase (Takara Shuzo)
The concentrations of the primer 1 and FITC primer 1 were changed according to the purpose of the experiment.

The conditions of the PCR method are shown below. 1. Equipment used PERKIN ELMER GeneAmp PCR System 9600, MicroAmp Rea
ction Tube (0.2ml) 2. PCR reaction cycle The DNA to be amplified was made single-stranded by heat denaturation at 94 ° C. for 1 minute, and the following operations (1) to (4) were repeated, followed by ice cooling (4 ° C.). Single-strand formation by heat denaturation; 94 ° C., 1 minute, annealing of primer to DNA to be amplified; 63
Elongation of DNA with Taq polymerase for 1 minute at 72 ° C .;
Was extended to 72 ° C. for 5 minutes. The number of cycles was changed according to the purpose of the experiment.

The degree of polarization of the sample before and after the PCR reaction was measured and compared. The measurement of the degree of fluorescence polarization was performed at 25 ° C. using a 500 μl sample in a cuvette having a path length of 3 mm. Excitation wavelength was 470 nm and emission was monitored at 520 nm. The fluorescence anisotropy r follows the definition of the following equation.

[0027]

(Equation 2)

Example 1 In order to establish optimum conditions for the method of the present invention, an appropriate value of the initial concentration of the fluorescent-labeled primer when measuring the fluorescence anisotropy r was examined. Four different initial concentrations (1 nM, 10 nM, 50 nM and 200 nM)
Using the FITC primer 1 of M), the relationship between the initial concentration of the FITC primer and the fluorescence anisotropy r was observed. PCR
The cycle was 30. The results are shown in FIG. From the results shown in FIG. 1, the initial concentration of the FITC primer was 10 nM.
Was selected as the optimal condition.

In order to confirm whether the change in the fluorescence anisotropy was caused only by the increase in the effective hydrodynamic volume, the effect of the change in the physicochemical environment after the PCR on the fluorescence anisotropy was examined. Examined. 0.2 μM primer 1, 0.
2 μM primer 2, FITC-random-oligonucleotide (200 nM, 50 nM, 10 nM, respectively)
PCR-1 and FITC primer 1 (200 nM, 50 nM, 10 nM, respectively), 0.2 μM
PCR-2 using primer 2 was performed under the same conditions as described above. The PCR cycle was 30, and the results are shown in FIG. The sequence of FITC-random-oligonucleotide is shown in SEQ ID NO: 4 in the Sequence Listing. From the results shown in FIG.
Changes in the physicochemical environment after the PCR did not significantly affect the fluorescence anisotropy, and thus it was clarified that detection of DNA using this method did not hinder the detection. FITC
-In the case of random-oligonucleotides, the value of the fluorescence anisotropy did not change after PCR amplification. The value of the fluorescence anisotropy was about 0.02 for the fluorescence-labeled 21 bp DNA oligomer in the concentration range of 1 to 200 nM.

Example 2 In order to establish optimum conditions for the method of the present invention, an appropriate value of the number of PCR cycles was examined.
Using 10 nM FITC primer 1, PCR20,
PCR experiments of 25, 30, 35 and 40 cycles were performed under the same conditions as described above. The results are shown in FIG. As expected, the fluorescence anisotropy r greatly increased with the number of PCR cycles, and at 25 cycles, a change in the fluorescence anisotropy value was obtained which was large enough to detect the target DNA.

Example 3 Using the method of the present invention, E. coli O157: H7 and E. coli JM having no VT2 gene were used.
The presence or absence of detection of 109 strains was confirmed. 10nM FITC
Using primer 1 and under the same conditions as above.
The PCR cycle was 25 and the results are shown in FIG. From the results shown in FIG. 4, FITC primer 1 and primer 2 are specific to O157: H7, while E. coli JM
It was suggested that 109 could not be amplified. Escherichia coli JM1
No change in fluorescence polarization was observed when 09 was used. The method for measuring nucleic acid of the present invention can be performed very quickly, including the steps of purifying nucleic acid from a sample, amplifying nucleic acid, and measuring fluorescence anisotropy, with a required time within 4 hours.

[0032]

According to the measuring method of the present invention, nucleic acids contained in microorganisms, cells and other samples can be measured specifically and quickly, and the examination of microorganisms, clinical diagnosis, and other tests can be performed. Information useful for research can be obtained. In particular, it can be used for rapid and accurate detection of pathogenic Escherichia coli (Vero toxin-producing bacteria) such as O-157, which has become a major social problem since the summer of 1996. For example, 25 cycles of PCR using 10 nM FITC-labeled primers were found to be sufficient for detection of the sterox2 gene of Escherichia coli O157: H7.

[0033]

[Sequence list] SEQ ID NO: 1 Sequence length: 21 Sequence form: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA sequence TAAACCACAC CCCACCGGGC A 21

SEQ ID NO: 2 Sequence length: 21 Sequence form: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence GAACGTTCCA GCGCTGCGAC A 21

SEQ ID NO: 3 Sequence length: 1242 Sequence form: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: Genomic DNA Origin Organism: Escherichia coli Strain: O157 H7 SEQ ATGAAGTGTA TATTATTTAA ATGGGTACTG TGCCTGTTAC TGGGTTTTTC TTCGGTATCC 60 TATTCCCGGG AGTTTACGAT AGACTTTTCG ACCCAACAAA GTTATGTCTC TTCGTTAAAT 120 AGTATACGGA CAGAGATATC GACCCCTCTT GAACATATAT CTCAGGGGAC CACATCGGTG 180 TCTGTTATTA ACCACACCCC ACCGGGCAGT TATTTTGCTG TGGATATACG AGGGCTTGAT 240 GTCTATCAGG CGCGTTTTGA CCATCTTCGT CTGATTATTG AGCAAAATAA TTTATATGTG 300 GCCGGGTTCG TTAATACGGC AACAAATACT TTCTACCGTT TTTCAGATTT TACACATATA 360 TCAGTGCCCG GTGTGACAAC GGTTTCCATG ACAACGGACA GCAGTTATAC CACTCTGCAA 420 CGTGTCGCAG CGCTGGAACG TTCCGGAATG CAAATCAGTC GTCACTCACT GGTTTCATCA 480 TATCTGGCGT TAATGGAGTT CAGTGGTAAT ACAATGACCA GAGATGCATC CAGAGCAGTT 540 CTGCGTTTTG TCACTGTCAC AGCAGAAGCC TTACGCTTCA GGCTCGATCGATCATAGAGATCGATCGATCATAGAGATCGATCACGAGATCGATCACGAGATCGATCAGGATCAGGATCACGAGATCGATCGATCGAGATCGATCGAGATCGATCAGGATCGATCGAGATCGATCGATCGATCGATCGATCGATCGATCGATCTCGATCGATCGATCGATCGATCGATCGATCGATCTCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCTCGATCGATCGATCGATCTCTCGA CGTGGACCTC 660 ACTCTGAACT GGGGGCGAAT CAGCAATGTG CTTCCGGAGT ATCGGGGAGA GGATGGTGTC 720 AGAGTGGGGA GAATATCCTT TAATAATATA TCAGCGATAC TGGGGACGTG GGCCGTTATA 780 CTGAATTGCC ATCATCAGGG GGCGCGTTCT GTTCGCGCCG TGAATGAAGA GAGTCAACCA 840 GAATGTCAGA TAACTGGCGA CAGGCCCGTT ATAAAAATAA ACAATACATT ATGGGAAAGT 900 AATACAGCTG CAGCGTTTCT GAACAGAAAG TCACAGTTTT TATATACAAC GGGTAAATAA 960 AGGAGTTAAG CATGAACAAG AGTTTTATGG CGGTTTTATT TGCATTAGCT TCTGTTAATG 1020 CAATGGCGGC GGATTGTGCT AAAGGTAAAA TTGAGTTTTC CAAGTATAAT GAGGATGACA 1080 CATTTACAGT GAAGGTTGAC GGGAAAGAAT ACTGGACCAG TCGCTGGAAT CTGCAACCGT 1140 TACTGCAAAG TGCTCAGTTG ACAGGAATGA CTGTCACAAT CAAATCCAGT ACCTGTGAAT 1200 CAGGCTCCGG ATTTGCTGAA GTGCAGTTTA ATAATGAGCT GA 1242

SEQ ID NO: 4 Sequence length: 21 Sequence form: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence AGGAGCTCAG CATTCACTGT C 21

[Brief description of the drawings]

FIG. 1 is a graph showing the relationship between the initial concentration of a fluorescently labeled primer and the fluorescence anisotropy r in Example 1.

FIG. 2 is a graph showing a relationship between a change in physicochemical environment after PCR and fluorescence anisotropy r in Example 1.

FIG. 3 is a graph showing the relationship between the number of PCR cycles and fluorescence anisotropy r in Example 2.

FIG. 4 is a graph showing the results of detecting verotoxin-producing bacteria and non-producing bacteria according to the method of the present invention in Example 3.

──────────────────────────────────────────────────続 き Continuation of the front page (51) Int.Cl. ⁶ Identification code FI C12R 1:19) (72) Inventor Makoto Tsuruoka 6-11-2 -608, Otsuka Nishi, Asa-minami-ku, Hiroshima-shi, Hiroshima-ken (72) Inventor Yukio Karube 1-3-16 Higashi-Arima, Miyamae-ku, Kawasaki-shi, Kanagawa (72) Inventor Kunihiko Hashimoto 2-2-2, Mishino-cho, Nishi-ku, Hiroshima-shi, Hiroshima Nishikawa Rubber Industries Co., Ltd.

Claims (6)

[Claims] 1. A method for measuring a nucleic acid in which a nucleic acid in a sample is amplified by a gene amplification method, and the amount of the nucleic acid in the amplification product is measured by a fluorescence polarization method. A method for measuring a nucleic acid, comprising performing gene amplification at 200 nM and measuring the fluorescence polarization degree of a sample during or after gene amplification. 2. The method according to claim 1, wherein the fluorescent label is FITC (fluorescein isothiocyanate) or fluorescein. 3. The method according to claim 1, wherein the number of cycles in the gene amplification method is 25 or more. 4. A method for detecting a Vero toxin-producing bacterium using the method according to claim 1. 5. The method for detecting a Vero toxin-producing bacterium according to claim 4, wherein a primer having a fluorescent label at the end of the sequence shown in SEQ ID NO: 1 in the sequence listing is used as the fluorescent-labeled primer. 6. The method for detecting a Vero toxin-producing bacterium according to claim 4, wherein a primer shown in SEQ ID NO: 2 in the sequence listing is used as a primer other than the fluorescent-labeled primer.