JP2002119291A - Method for assaying nucleic acid, nucleic acid probe therefor, and method for analyzing data obtained by the method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for assaying a nucleic acid using a nucleic acid probe labelled by a fluorochrome, the real-time quantitative PCR method utilizing the method, and a method for analyzing data obtained by the PCR method in a short time and accurately. SOLUTION: A new method for assaying a nucleic acid comprising the steps of hybridizing the nucleic acid probe consisting of nucleic acid probe labelled by a fluorochrome, 2-O-methyloligonucleotide, chimeric oligonucleotide, and oligonucleotide mediated by them to a target nucleic acid, and so on or assaying a decrease in the fluorescence of the fluorochrome before and after the hybridization, the real-time quantitative PCR method using the method, and a method for analyzing data having a process in which a fluorescence intensity value in the annealing reaction is corrected by that of the denaturation reaction when the data obtained by the PCR method are analyzed, are provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for measuring the concentration of a target nucleic acid, a nucleic acid probe for the method, and a method for analyzing data obtained by the method.
More specifically, the present invention relates to various methods for measuring the concentration of various nucleic acids using a nucleic acid probe labeled with a fluorescent dye, and it is said that when a nucleic acid probe labeled with a fluorescent dye is hybridized to a target nucleic acid, the emission of the fluorescent dye decreases. It is a novel method for measuring the concentration of various nucleic acids based on the principle, that is, by measuring the amount of decrease in the emission of a fluorescent dye before and after hybridization, nucleic acid probes and devices used therein, and one of those measuring methods. The present invention relates to a method for analyzing data obtained by a PCR method, an analyzing apparatus provided with means for executing each of the analyzing methods, and a computer-readable recording medium which records each procedure of the analyzing method as a program.

[0002]

2. Description of the Related Art Conventionally, various methods for measuring a nucleic acid concentration using a nucleic acid probe labeled with a fluorescent dye are known. The method includes the following. (1) Dot blotting method In this method, after a target nucleic acid and a nucleic acid probe labeled with a fluorescent dye are hybridized on a membrane, unreacted nucleic acid probes are washed away, and a nucleic acid probe hybridized with the target nucleic acid is labeled. This is for measuring the fluorescence intensity of only the fluorescent dye molecules.

(2) Intercalator method (Glazer et.
al., Nature 359: 959,1992) This method measures the amount of increase in luminescence because a certain fluorescent dye called an intercalator emits strong light when it gets stuck in the duplex of nucleic acid. Is the way. As the fluorescent dye, for example, ethidium bromide (Experimental Medicine, Vol. 15, No. 7, pp. 46-51, 1997)
Year, Yodosha), SYBR R Green (I)
^TM System; pamphlet issued by Roche Diagnostics Co., Ltd. on April 5, 1999).

(3) FRET (fluorescence energy transfe)
r) (Mergney et al., Nucleic Acid Re
s., 22: 920-928, 1994.) This method consists of hybridizing two nucleic acid probes to a target nucleic acid. Each of the two nucleic acid probes is labeled with a different fluorescent dye. One fluorescent dye of the two probes can transmit energy to the fluorescent dye of the other probe to emit light through the FRET phenomenon. The two probes are designed so that the fluorescent dyes face each other and hybridize 1 to 9 bases apart. Thus, when the two nucleic acid probes hybridize to the target nucleic acid, the latter fluorescent dye emits light, and the intensity of the light emission is proportional to the amount of replication of the target nucleic acid.

(4) Molecular beacon method (Tyagi et al.,
(Nature Biotech., 14: 303-308, 1996.) The nucleic acid probe used in this method has one end labeled with a reporter dye and the other end labeled with a quencher dye. Since both ends are complementary to each other in the nucleotide sequence, the nucleotide sequence is designed so that the entire probe forms a hairpin stem. When suspended in liquid due to its structure, the emission of the reporter dye is suppressed by the quencher dye due to Forster resonance energy. However, when hybridized to the target nucleic acid, the hairpin structure is broken, and the distance between the reporter dye and the quencher dye is increased, so that transfer of Forster resonance energy does not occur. Therefore, the reporter dye emits light.

(5) Davis method (Davis et al., N
ucleic acids Res. 24: 702-706, 1996) Davis created a probe in which a fluorescent dye was attached to the 3 'end of an oligonucleotide via a spacer having 18 carbon atoms. This was applied to flow cytometry. It was reported that a 10-fold higher fluorescence intensity was obtained when hybridized than when a fluorescent dye was directly bonded to the 3 ′ end. These methods include various nucleic acid measurement methods, FISH method (fluorescent in situhybridizati
on assays), PCR method, LCR method (ligase chain r
eaction), SD method (strand displacement assays),
Competitive hybridization
dization), and has achieved remarkable development.

[0007] These methods are currently generally used. However, after performing a hybridization reaction between a nucleic acid probe labeled with a fluorescent dye and a target nucleic acid, it is necessary to wash the unhybridized nucleic acid probe from the reaction system. There is an undesirable procedure. Obviously, omitting such a procedure results in a reduction in measurement time, simplicity of measurement, and accuracy of measurement. Therefore, development of a nucleic acid measurement method that does not have such a procedure has been desired.

[0008]

SUMMARY OF THE INVENTION In view of the above circumstances, an object of the present invention is to provide a method for measuring the concentration of a target nucleic acid using a nucleic acid probe labeled with a fluorescent dye in a shorter time.
An object of the present invention is to provide a method that can more simply and accurately measure the concentration of a target nucleic acid.

[0009]

Means for Solving the Problems In order to solve the above problems, the present inventors have repeatedly studied a method for measuring the concentration of a nucleic acid using a nucleic acid probe. As a result, when a nucleic acid probe labeled with a fluorescent dye hybridizes to a target nucleic acid, there is a phenomenon (fluorescence quenching phenomenon) in which the emission of the fluorescent dye decreases (fluorescence quenching phenomenon). In particular, it has been found that the degree of the reduction depends on the type or base sequence of the base to which the fluorescent dye is bound. The present invention has been completed based on such findings.

That is, the present invention provides: 1) a nucleic acid measuring method using a nucleic acid probe labeled with a fluorescent dye, wherein when the nucleic acid probe hybridizes to a target nucleic acid, the fluorescent dye reduces its emission. A method for measuring the concentration of a target nucleic acid, wherein the nucleic acid probe is hybridized to a target nucleic acid, and the amount of decrease in luminescence of the fluorescent dye before and after hybridization is measured.

2) When a nucleic acid probe labeled with a fluorescent dye hybridizes to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces the emission thereof, and
The probe is labeled at the end with the fluorescent dye, and when the nucleic acid probe hybridizes to the target nucleic acid at the end, the probe is separated from the terminal base by 1 to 3 bases from the terminal nucleic acid hybridized to the probe. A nucleic acid labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, wherein the nucleotide sequence of the probe is designed such that at least one G (guanine) is present in the nucleotide sequence of the target nucleic acid. Probes, also

3) The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of the target nucleic acid according to 2), wherein the nucleic acid probe is labeled with a fluorescent dye at the 3 ′ end; The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of the target nucleic acid according to the above 2), wherein the nucleic acid probe is labeled with a fluorescent dye.

5) When a nucleic acid probe labeled with a fluorescent dye hybridizes to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces the emission thereof, and
The probe is labeled at its end with the fluorescent dye, and when the nucleic acid probe hybridizes to the target nucleic acid, the probe-nucleic acid hybrid complex has at least one G at the end when the nucleic acid probe hybridizes to the target nucleic acid. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, wherein the base sequence of the probe is designed to form a pair of (guanine) and C (cytosine);

6) A nucleic acid labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to 5) above, wherein the 3 ′ terminal base of the nucleic acid probe is G or C and the 3 ′ terminal is labeled with a fluorescent dye. 7) The nucleic acid probe is labeled with a fluorescent dye for measuring the concentration of the target nucleic acid according to the above 5), wherein the 5 ′ terminal base of the nucleic acid probe is G or C and the 5 ′ terminal is labeled with a fluorescent dye. Nucleic acid probes,

8) The nucleic acid probe wherein the 3′-carbon hydroxyl group of 3′-terminal ribose or deoxyribose or the 3′- or 2′-carbon hydroxyl group of 3′-ribose is phosphorylated. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to 7),

9) The oligonucleotide of a nucleic acid probe for nucleic acid measurement is labeled with the fluorescent dye for measuring the concentration of a target nucleic acid according to any one of 1) to 8) above, wherein the oligonucleotide is a chemically modified nucleic acid. And 10) chemically modified nucleic acid is a 2'- O -methyl oligonucleotide, 2'- O -ethyl oligonucleotide, 2'- O -butyl oligonucleotide or 2'- O -benzyl oligo. 9. The nucleic acid probe labeled with the fluorescent dye for measuring the concentration of the target nucleic acid according to 9) above, which is a nucleotide; and 11) the chimeric oligonucleotide comprising a ribonucleotide and a deoxyribonucleotide, wherein the oligonucleotide of the nucleic acid probe for measuring nucleic acid is Totide (chimeric oligonucl)
a nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to any one of 2) to 8) above,

12) The chimeric oligonucleotide is
2'- O -methyl oligoribonucleotide, 2'- O -ethyl oligonucleotide, 2'- O -butyl oligonucleotide, 2'-
The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to the above item 11), which intervenes an O- alkylene oligonucleotide or a 2′- O -benzyl oligonucleotide; 8) a method for measuring the concentration of a target nucleic acid, comprising: hybridizing the nucleic acid probe for nucleic acid measurement according to any one of the above items to a target nucleic acid, and measuring the amount of decrease in emission of a fluorescent dye before and after hybridization. Also,

14) The nucleic acid probe for nucleic acid measurement according to any one of 9) to 12) above is hybridized to a target nucleic acid, and the amount of decrease in the emission of a fluorescent dye before and after hybridization is measured. 15) The method according to 14), wherein after subjecting the target nucleic acid to heat treatment under conditions suitable for sufficiently destroying its higher-order structure, the nucleic acid probe is hybridized with the target nucleic acid. A method for measuring the concentration of a target nucleic acid. 16) adding the helper probe to the hybridization reaction system for carrying out the hybridization reaction before the hybridization reaction;
The method for measuring the concentration of a target nucleic acid according to 5),

17) The nucleotide sequence of the helper probe is (5 ′) TCCTTTGAGT TCCCGGCCGG A (3 ′) or / and (5 ′) CCC
TGGTCGT AAGGGCCATG ATGACTTGAC GT (3 ')
The method for measuring the concentration of a target nucleic acid according to 6), and 18) the method for measuring the concentration of a target nucleic acid according to any one of the above 15) to 17), wherein the heat treatment conditions are 80 to 100 ° C. for 1 to 15 minutes. 19) The method for measuring the concentration of a target nucleic acid according to any one of 13) to 18), wherein the target nucleic acid is RNA, and 20) a kit for measuring the concentration of a target nucleic acid, wherein 2) 13. A kit for measuring the concentration of a target nucleic acid, which contains or accompanies the nucleic acid probe according to any one of to 12), and 21) the above 20) which contains or accompanies a helper probe.
A kit for measuring the concentration of a target nucleic acid according to

22) A method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid, wherein the nucleic acid probe according to any one of the above 2) to 12) is hybridized to the target nucleic acid. And measuring the amount of change in fluorescence intensity.
And 23) a method for analyzing or measuring a mutation, or 23) a measurement kit for analyzing or measuring a polymorphism or / and mutation of a target nucleic acid, which contains the nucleic acid probe according to any one of 2) to 12) above or A kit for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, which is characterized by being incidental,

24) The kit for analyzing or measuring the polymorphism and / or mutation of the target nucleic acid according to the above 23) which contains or accompanies a helper probe to be added to the hybridization reaction system; In the method for analyzing the data obtained by the method described in the above, the fluorescence intensity value of the reaction system when the target nucleic acid is hybridized with a nucleic acid probe labeled with a fluorescent dye, the reaction system when not hybridized A data analysis method for a method for analyzing or measuring a polymorphism or / and mutation of a target nucleic acid, characterized by having a process of correcting by a fluorescence intensity value of

26) A polymorphism and / or mutation of a target nucleic acid, which comprises means for performing the data analysis method described in 25) above, wherein the polymorphism and / or mutation of the target nucleic acid is characterized. And / or a measuring device for analyzing or measuring mutation, and 27) a computer-readable recording medium which records a procedure for causing a computer to execute the correction process described in 25) above as a program,

28) When the nucleic acid probe according to any one of the above items 2) to 12) or two different fluorescent dyes in one molecule and are not hybridized to the target nucleic acid, Quenched or luminescent by the interaction of two fluorescent dyes, but another nucleic acid probe having a structure designed to emit or quench when hybridized to the target nucleic acid is bound to the surface of the solid support, and A device for measuring the concentration of one or more nucleic acids, characterized in that the concentration of the target nucleic acid can be measured by hybridizing the nucleic acids,

29) In the device for nucleic acid measurement described in 28) above, a device for measuring the concentration of one or more nucleic acids in which nucleic acid probes are arrayed and bound in an array on the surface of a solid support, respectively. Chip) and 30) for each nucleic acid probe bound to the surface of the solid support, at least one temperature sensor and a heater are provided on the opposite surface, and the temperature is set so that the nucleic acid probe binding region has an optimal temperature condition. A device for measuring the concentration of one or more nucleic acids according to 28) or 29), respectively, which can be adjusted; and 31) solid support of the nucleic acid probe at the end not labeled with a fluorescent dye 31. A device for measuring the concentration of one or more nucleic acids according to any one of the above 28) to 30) bound to a body surface. , In addition,

32) A method for measuring the concentration of a target nucleic acid, comprising measuring the target nucleic acid using the nucleic acid measuring device according to any one of the above 28) to 30). 33) The above 1) , 13) to 19), or the nucleic acid measuring method according to 32), wherein the target nucleic acid is derived from a microorganism or an animal obtained by pure separation. 34) any one of the above 1) or 13) to 19), wherein the target nucleic acid is a nucleic acid contained in a cell of a complex microbial system or a symbiotic microbial system or in a homogenate of the cell. Or the method for measuring the concentration of a target nucleic acid according to 32),

35) In the PCR method, the above 2) to
3), 5), 6) or a reaction system in which a reaction is carried out using the nucleic acid probe according to any one of the above 8) to 12), and the probe is decomposed and removed by a polymerase during a nucleic acid extension reaction; or Measure the fluorescence intensity value of the reaction system when the nucleic acid denaturation reaction or the reaction system where the nucleic acid denaturation reaction is completed and the fluorescence intensity value of the reaction system when the target nucleic acid or amplified target nucleic acid is hybridized with the nucleic acid probe. A method for measuring the concentration of a target nucleic acid amplified by PCR, which comprises calculating a reduction rate of the fluorescence intensity value,

36) In the PCR method, a reaction is performed using the nucleic acid probe described in 4) or 7) above as a primer, and the fluorescence intensity value of a reaction system in which the probe and the target nucleic acid or amplified target nucleic acid are not hybridized is determined. Measuring the fluorescence intensity value of the reaction system when the nucleic acid probe is hybridized with the target nucleic acid or the amplified target nucleic acid, and calculating the former fluorescence intensity reduction ratio;
A method for measuring the concentration of a target nucleic acid amplified by CR; 37) a method for measuring the concentration of a target amplified nucleic acid in the PCR method according to 35) or 36) above, wherein the PCR method is a real-time quantitative PCR method;

38) The method for analyzing data obtained by the nucleic acid measurement method according to any one of the above 1), 13) to 19) or any one of the above 32) to 37), The fluorescence intensity value of the reaction system after the nucleic acid has been hybridized with the nucleic acid probe labeled with a fluorescent dye is determined by the fluorescence intensity value of the reaction system obtained after the probe-nucleic acid hybrid complex thus formed is dissociated. Data analysis method for measuring the concentration of the target nucleic acid, characterized by correcting,

39) The method for analyzing data obtained by the real-time quantitative PCR method described in 37) above, wherein the amplified nucleic acid in each cycle is combined with a fluorescent dye or the amplified nucleic acid is labeled with a fluorescent dye. The fluorescence intensity value of the reaction system after hybridization with the nucleic acid probe thus obtained is determined by the fluorescent dye-nucleic acid complex formed in each cycle or the probe thus formed.
A data analysis for a real-time quantitative PCR method, comprising an arithmetic processing step for correcting with a fluorescence intensity value of a reaction system obtained after dissociation of a nucleic acid hybrid complex (hereinafter, referred to as a correction arithmetic processing step). Way, also

40) The data analysis method for the real-time quantitative PCR method according to 39), wherein the correction calculation process according to 39) is based on the following [Equation 1] or [Equation 2]. F _n = f _{hyb, n} / f _{den, n} [Equation 1] f _n = f _{den, n} / f _{hyb, n} [Equation 2] [where, f _n : [Equation 1] or [Equation 2] F _{hyb, n} : after the amplified nucleic acid binds to the fluorescent dye or in the nth cycle, the amplified nucleic acid hybridizes with the nucleic acid probe labeled with the fluorescent dye _{Fden, n} : the fluorescence intensity of the reaction system after dissociation of the formed fluorescent dye-nucleic acid complex or formed probe-nucleic acid hybrid complex in the nth cycle value〕,
Also,

41) Analyzing the data obtained by the real-time quantitative PCR method described in 37) above.
In the method described above, the correction calculation processing value calculated by [Equation 1] or [Equation 2] in each cycle is substituted into the following [Equation 3] or [Equation 4], and the fluorescence change between each sample in each cycle. calculating the rate or fluorescence change rate, data analysis method for real-time quantitative PCR method characterized by comparing them _{also,, F n = f n /} f a [equation 3] F _n = f _a / f _n [Equation 4] [where, F _n : the fluorescence change rate or the fluorescence change rate calculated by [Equation 3] or [Equation 4] in the nth cycle, f _n : [Equation 1] or [Equation 2] Correction operation processing value f _a : _a correction operation processing value according to [Equation 1] or [Equation 2], which has an arbitrary number of cycles before a change in f _n is observed],

42) Analyzing the data obtained by the real-time quantitative PCR method described in 37) above.
(A) using the fluorescence change rate or the data of the fluorescence change rate calculated by [Equation 3] or [Equation 4],
The process of performing arithmetic processing according to [Equation 5], [Equation 6] or [Equation 7], log _b (F _n ), ln (F _n ) [Equation 5] log _b {(1-F _n ) × A}, ln {(1-F _n ) × A} [Equation 6] log _b {(F _n -1) × A}, ln {(F _n -1) × A} [Equation 7] [where A, b: Arbitrary numerical values, _Fn : the fluorescence change rate or the fluorescence change rate in the n-th cycle calculated by [Equation 3] or [Equation 4], and (b) the processing value of (a) reaches a certain value. (C) an arithmetic process for calculating the relational expression between the number of cycles in a nucleic acid sample of known concentration and the copy number of the target nucleic acid at the start of the reaction; and (d) a target at the start of PCR for an unknown sample. Real-time quantification, comprising an arithmetic processing step for determining the copy number of a nucleic acid Data Analysis Methods for PCR methods also,

43) Regarding the target nucleic acid 2) to 12)
PCR is performed using the nucleic acid probe according to any one of the above, and the melting curve of the target nucleic acid is analyzed to determine the T of each amplified nucleic acid.
a method for analyzing a melting curve of a target nucleic acid, wherein the melting point of the target nucleic acid is determined; 44) performing PCR on the target nucleic acid using the nucleic acid probe described in 4) or 7) above as a primer;
Analyzing the melting curve of the target nucleic acid to determine the Tm value of each amplified nucleic acid by analyzing the melting curve of the target nucleic acid,

45) The data analysis method for a real-time quantitative PCR method according to any one of the above items 39) to 42), wherein the nucleic acid amplified by the PCR method is completely denatured from a low temperature. Until then, the process of gradually increasing the temperature, the process of measuring the fluorescence intensity at predetermined time intervals in this process, the process of displaying the measurement results on the display as a function of time and drawing the melting curve of the nucleic acid on the display, Differentiated melting curve (-d
F / dT, F: fluorescence intensity, T: time) obtaining process, displaying the differentiated value as a differential value on a display,
A data analysis method for a real-time quantitative PCR method, characterized by comprising a step of obtaining an inflection point from the differential value; and 46) a step of analyzing data by the data analysis method described in 39) above. A step of analyzing data by the data analysis method described in 40), a step of analyzing data by the data analysis method of 41), a step of analyzing data by the data analysis method of 42), 45 A) real-time quantitative PCR measurement and / or analysis apparatus, each having means for performing a process of analyzing data by the data analysis method described in

47) The process of analyzing data by the data analysis method described in 39), the process of analyzing data by the data analysis method described in 40), and the analysis of data by the data analysis method described in 41). Computer-readable program storing a program for causing a computer to execute the step of performing data, the step of analyzing data by the data analysis method described in 42), and the step of analyzing data by the data analysis method described in 45). Recording media,

48) In the nucleic acid determination method, the above 39)
42) any one of the above, or the method for quantifying a nucleic acid, which comprises using the data analysis method for a real-time quantitative PCR method according to the above 45); ), A method for quantifying nucleic acid, characterized by using the apparatus described in 47), wherein the method for quantifying nucleic acid comprises using the computer-readable recording medium according to 47). ,I will provide a.

[0037]

Next, the present invention will be described in more detail with reference to preferred embodiments. The first feature of the present invention is that
In a method for measuring the concentration of a target nucleic acid using a nucleic acid probe labeled with a fluorescent dye, the method comprises measuring the amount of decrease in the emission of the fluorescent dye before and after hybridization that occurs when the nucleic acid probe hybridizes to the target nucleic acid. is there. In the present invention, a probe-nucleic acid hybrid complex refers to a complex (complex) in which a nucleic acid probe labeled with the fluorescent dye of the present invention is hybridized with a target nucleic acid. For the sake of simplicity, hereinafter, it is abbreviated as a nucleic acid hybrid complex. The fluorescent dye-nucleic acid complex refers to a complex in which a fluorescent dye is bound to a target nucleic acid. For example, a double-stranded nucleic acid with an intercalator bound thereto can be mentioned. In the present invention, DNA, RNA, cDNA, mRNA, r
RNA, XTPs, dXTPs, NTPs, dNTP
s, nucleic acid probe, helper nucleic acid probe (or nucleic acid helper probe, or simply helper probe), hybridization, hybridization, intercalator, primer, annealing, extension reaction, heat denaturation reaction, nucleic acid melting curve, PCR, RT-PCR, RNA-pr
imed PCR, Stretch PCR, inverse PCR, PCR using Alu sequence, multiplex PCR, PCR using mixed primers, PCR method using PNA, hybridization assay method, FIS
H (fluorescent in situ hybridization assays) method,
PCR method (polymerase chain assays), LCR method (ligase chain reaction), SD method (strand displac
ement assays), competitive hybridization methods (c
ompetitive hybridization), DNA chips, nucleic acid detection (gene detection) devices, SNPs (snips: single nucleotide substitution polymorphisms), complex microbial systems, etc. are now commonly used in molecular biology, genetic engineering, microbial engineering, etc. It has the same meaning as the term commonly used.

In the present invention, measuring the concentration of a target nucleic acid means that one or more nucleic acids in a measuring system are used.
It refers to quantifying the concentration, quantitatively detecting, simply detecting, or analyzing polymorphisms / mutations. In the case of multiple types of nucleic acids, quantitative detection of multiple types of nucleic acids at the same time, simple detection of multiple types of nucleic acids at the same time, or simultaneous analysis of polymorphisms / mutations of multiple types of nucleic acids, etc. Naturally, it is within the technical scope of the present invention. What are various D devices for measuring target nucleic acid concentration?
Refers to an NA chip. Specific examples include various DNA chips. In the present invention, any type of DNA chip may be used as long as the nucleic acid probe of the present invention can be applied. A method for measuring the concentration of a target nucleic acid using a nucleic acid probe labeled with a fluorescent dye (hereinafter simply referred to as the nucleic acid probe of the present invention or the probe of the present invention) (hereinafter simply referred to as a nucleic acid measuring method for simplicity) ) Means hybridization method, FISH method
(fluorescent in situ hybridizationassays), PCR
Method (polymerase chain assays), LCR method (ligase
chain reaction), SD method (strand displacement ass)
ays), competitive hybridization method (competitiv
This refers to measuring the concentration of a target nucleic acid by a method such as e hybridization.

Conventionally, in these methods, after a nucleic acid probe labeled with a fluorescent dye is added, the unreacted fluorescent dye of the nucleic acid probe which has not hybridized to the target nucleic acid is removed from the measurement system by washing or the like. Then, a fluorescent dye labeled on the nucleic acid probe hybridized to the target nucleic acid is emitted directly from the probe or by applying an indirect means to the probe (for example, by acting an enzyme) to emit light. Then, the light emission amount is measured. The present invention is characterized in that a target nucleic acid is measured without performing such a complicated operation in these methods.

In the present invention, the target nucleic acid means a nucleic acid or a gene whose concentration is to be measured. With or without purification. Also, the magnitude of the concentration does not matter. Various nucleic acids may be mixed. For example, a specific nucleic acid for measuring the concentration in a complex microbial system (mixed system of RNA or gene DNA of multiple microorganisms) or a symbiotic microbial system (mixed system of RNA or gene DNA of multiple animals and plants and / or multiple microorganisms) It is. If the target nucleic acid needs to be purified, it can be performed by a conventionally known method. For example, the purification can be performed using a commercially available purification kit or the like. Specific examples of the above nucleic acids include DNA, RN
A, PNA, oligodeoxyribonucleotide (oligod
eoxyribonucleotides), oligoribonucleotides (oligo
ribonucleotides) and the like, and chemically modified nucleic acids of the aforementioned nucleic acids. 2'- O- as chemically modified nucleic acid
Methyl (Me) RNA and the like can be exemplified.

In the present invention, a fluorescent dye generally used for labeling a nucleic acid probe and used for measurement and detection of a nucleic acid can be conveniently used. Preferably, the fluorescent dye labeled on the probe reduces its emission. For example, fluorescein (fluore
scein) or derivatives thereof {for example, fluorescein isothiocyanate (FI)
TC) or its derivatives, such as Alexa 488, Alexa532, cy
3, cy5, EDANS (5- (2'-aminoethyl) amino-1-naphthal
ene sulfonic acid)｝, rhodamine (rhodamine) 6G
(R6G) or a derivative thereof (eg, tetramethylrhodamine (TMR), tetramethylrhodamine isothiocyanate (tetramethylrhodamine i)
sothiocyanate) (TMRITC), x-rhodamin
e), Texas red, BODIPY FL
(Trade name; Molecular Probes, USA), BODIPY FL / C3 (trade name; Molecular Probes, USA),
BODIPY FL / C6 (trade name; manufactured by Molecular Probes, USA), BODIPY (BOD)
IPY) 5-FAM (trade name; Molecular Probe (Molecul)
ar Probes, USA), BODIPY TMR (trade name; Molecular Probes, USA), or a derivative thereof (eg, BODIY)
PY) TR (trade name; Molecular Probe)
Probes, Inc., USA), BODIPY R6G (trade name; Molecular Probes, USA), BODIPY 564 (trade name, Molecular Probes, USA) ),
BODIPY 581 (trade name; manufactured by Molecular Probes, USA). Among them, FITC, EDANS, 6-joe, TM
R, Alexa 488, Alexa 532, BODIPY FL / C3
(Trade name: Molecular Probe
s), BODIPY FL / C6 (trade name; Molecular Probes, USA) and the like, and FITC, TMR, 6
-jeo, BODIPY FL / C3 (trade name; Molecular Probes, USA), BODIPY FL / C6 (trade name; Molecular Probes, USA) Can be mentioned as more preferable.

The nucleic acid probe of the present invention to be hybridized to a target nucleic acid may be composed of oligodeoxyribonucleotides or oligoribonucleotides. Alternatively, a chimeric oligonucleodite containing both of them may be used. These oligonucleotides may be chemically modified. The chemically modified oligonucleotide may be interposed in the chimeric oligonucleotide chain.

The modified sites of the chemically modified oligonucleotide include a terminal hydroxyl group or a terminal phosphate group at the terminal of the oligonucleotide, an internucleoside phosphate site, a carbon at the 5-position of the pyrimidine ring, and a nucleoside sugar (ribose). Or deoxyribose) site. Preferably, a ribose or deoxyribose site can be mentioned. Specifically, 2'- O-
Alkyl oligoribonucleotide (2'- O- alkyloligoribo
Nucleotides) (hereinafter, 2'- O -. the abbreviated to 2-O-), 2
-O-alkylene oligoribonucleotide (2-o-alkyleneo
ligoribonucleotides) and 2-O-benzyloligoribonucleotides. In the oligonucleotide, the OH group at the 2′-position carbon of one or more riboses at any position of the oligoribonucleotide is modified (by an ether bond) with an alkyl group, an alkylene group, or a benzyl group. In the present invention, preferably, among the 2-O-alkyl oligoribonucleotides, 2-O-methyl oligoribonucleotide, 2-O-ethyl oligoribonucleotide, 2-O-butyl oligoribonucleotide, O-benzyl oligoribonucleotide, among the 2-O-alkylene oligoribonucleotides, 2-O-ethylene oligoribonucleotide, and 2-O-benzyl oligoribonucleotide,
Particularly preferably, 2-O-methyl oligoribonucleotide (hereinafter simply referred to as 2-O-Me oligoribonucleotide).
Is used. By applying such a chemical modification to the oligonucleotide, the affinity for the target nucleic acid is increased, and the hybridization efficiency of the nucleic acid probe of the present invention is improved. When the hybridization efficiency increases, the rate of decrease in the fluorescence intensity of the fluorescent dye of the nucleic acid probe of the present invention further increases, so that the measurement of the concentration of the target nucleic acid further improves. In the present invention, the term “oligonucleotide” means oligodeoxyribonucleotide or oligoribonucleotide or both, and is generically referred to. 2-O-alkyl oligoribonucleotides, 2-O-alkylene oligoribonucleotides and 2-O-benzyl oligoribonucleotides can be prepared by known methods (Nucleic Acids Research, Vol. 26, 2224).
~ 2229, 1998). Also,
GENSET (Ltd.) (France) has commissioned synthesis, so it can be easily obtained. The present inventors commissioned the company to synthesize the compound and conducted experiments to complete the present invention.

Incidentally, 2-O-methyl oligoribonucleotide (hereinafter simply referred to as 2-O-Me oligoribonucleotide)
The nucleic acid probe of the present invention in which a modified RNA such as
When used for measurement of NA, particularly rRNA, preferable results can be obtained. When measuring RNA using the nucleic acid probe of the present invention, an RNA solution as a sample is subjected to 80 to 100 ° C., preferably 9 ° C. before hybridization with the probe.
Heat treatment at 0 to 100 ° C., optimally 93 to 97 ° C. for 1 to 15 minutes, preferably 2 to 10 minutes, optimally 3 to 7 minutes, disrupts the higher order structure of RNA by hybridization. It is suitable for improving efficiency.

Further, in order to further increase the efficiency of hybridization of the nucleic acid probe of the present invention to a hybridization sequence region, a helper probe is used.
It is preferred to add e) to the hybridization reaction solution. In this case, the oligonucleotide of the helper probe may be an oligodeoxyribonucleotide or an oligoribonucleotide, or may be an oligonucleotide subjected to the same chemical modification as described above. Examples of the oligonucleotides include (5 ′) TCCTTTGAGT TCCCGGCCGG A (3 ′) as a forward type, and (5 ′) CCCTGGTCGT AAGGGCCATG ATGACTTGAC GT (5 ′) as a backward type or a reverse ward type. 3 ')
Having a base sequence of Preferred examples of oligonucleotides that have been chemically modified include 2-O-alkyl oligoribonucleotides, particularly 2-O-Me oligoribonucleotides. When the nucleic acid probe of the present invention has a base chain of 35 bases or less, the use of a helper probe is particularly effective. When using the nucleic acid probe of the present invention having a length of more than 35 base chains, it may be sufficient to simply heat denature the target RNA. As described above, when the nucleic acid probe of the present invention is hybridized to RNA, the hybridization efficiency is increased.
The fluorescence intensity decreases in accordance with the amount of
RNA can be measured up to 50 pM. Thus, the present invention is also a measurement kit for measuring the concentration of a target nucleic acid, which contains or accompanies the helper probe in a measurement kit for measuring the concentration of a target nucleic acid, which contains or accompanies the nucleic acid probe of the present invention.

In the measurement of RNA by a conventional hybridization method using a nucleic acid probe, an oligodeoxyribonucleotide or oligoribonucleotide has been used as a nucleic acid probe. RNA itself has a strong conformation, so the probe and target RN
The efficiency of hybridization with A was poor, and the quantitativeness was poor. For this reason, the conventional method has the complexity of denaturing the RNA, fixing it to a membrane, and then performing a hybridization reaction. On the contrary,
Since the method of the present invention uses a ribose moiety-modified nucleic acid probe having a high affinity for a specific structural part of RNA, the hybridization reaction can be performed at a higher temperature than the conventional method. Therefore, the above-mentioned adverse effects of the higher-order structure of RNA can be overcome only by using a heat denaturation treatment and a helper probe as a pretreatment. Thereby, in the method of the present invention, the hybridization efficiency becomes substantially 100%, and the quantification is improved. In addition, it becomes much simpler than the conventional method.

The number of bases of the probe of the present invention is 5 to 50, preferably 10 to 25, particularly preferably 15 to 20.
It is. If it exceeds 50, the permeability of the cell membrane becomes poor when used in the FISH method, which narrows the applicable range of the present invention. If it is less than 5, non-specific hybridization is likely to occur, resulting in a large measurement error.

The nucleotide sequence of the probe is not particularly limited as long as it specifically hybridizes to the target nucleic acid. Preferably, when a nucleic acid probe labeled with a fluorescent dye hybridizes to a target nucleic acid, (1) the base sequence of the target nucleic acid is separated by 1 to 3 bases from the terminal base of the target nucleic acid hybridized to the probe, and (2) a base sequence for which the base sequence of the probe is designed so that (guanine) is present in at least one base; (Guanine) and C
It is preferable that the base sequence of the probe be designed so as to form a (cytosine) pair.

The oligonucleotide of the nucleic acid probe of the present invention can be produced by a general method for producing an oligonucleotide. For example, chemical synthesis methods, plasmid vectors,
It can be produced by a microbial method using a phage vector or the like (Tetrahedron letters, 22, 1859-1862, 1981).
Year; Nucleic acids Research, Vol. 14, pp. 6227-6245, 1
986). It is preferable to use a commercially available nucleic acid synthesizer (for example, ABI394 (manufactured by Perkin Elmer, USA)).

For labeling the oligonucleotide with a fluorescent dye, a desired one of conventionally known labeling methods can be used (Nature Biotechnology, Vol. 14, 303-3).
08, 1996; Applied and Environmental Microbiol
ogy, 63, 1143-1147, 1997; Nucleic acids
Research, 24, 4532-4535, 1996). For example, when a fluorescent dye molecule is bound to the 5 'end, first, for example,-(CH ₂ ) _n -SH is introduced as a spacer into the phosphate group at the 5' end according to a conventional method. These inductants are commercially available and may be purchased commercially (Medland Certified Reagent Company, Inc.
and Certified Reagent Company)). In this case, n is 3 to 8, preferably 6. A labeled oligonucleotide can be synthesized by binding a fluorescent dye having SH group reactivity or a derivative thereof to the spacer. The thus synthesized oligonucleotide labeled with a fluorescent dye can be purified by reverse phase chromatography or the like to obtain the nucleic acid probe of the present invention.

Also, a fluorescent dye can be bound to the 3 'end of the oligonucleotide. In this case, for example,-(CH ₂ ) _n -NH ₂ is introduced as a spacer into the OH group at the 3′-position C of ribose or deoxyribose. Since these transfectants are also commercially available in the same manner as described above, commercial products may be purchased (Midland Certified Reagent Co., Ltd.).
mpany)). Further, by introducing a phosphate group, the phosphate group O
For example,-(CH ₂ ) _n -SH is introduced into the H group as a specifier. In these cases, n is 3-8, preferably 4-7. A labeled oligonucleotide can be synthesized by binding a fluorescent dye or a derivative thereof reactive with an amino group or SH group to this spacer. The thus synthesized oligonucleotide labeled with a fluorescent dye can be purified by reverse phase chromatography or the like to obtain the nucleic acid probe of the present invention. When introducing this amino group, kit reagents (for example, Uni-link aminomodif
ier (CLONTECH, USA), Fluo Reporter Kit F-6082, F-6083, F-6084, F-1
0220 (Molecular probe (Molecular probe)
Probes), USA)). Then, a fluorescent dye molecule can be bound to the oligoribonucleotide according to a conventional method. It is also possible to introduce a fluorescent dye molecule into the probe nucleic acid chain (AN
ALYTICAL BIOCHEMISTRY 225, pp. 32-38 (1998)).

Although the nucleic acid probe of the present invention can be prepared as described above, a preferred form of the probe is one in which a fluorescent dye is labeled at the 3 ′ or 5 ′ end, and the base at the labeled end is a base. G or C.
When the 5 'end is labeled and the 3' end is unlabeled, the 3 'terminal ribose or deoxyribose at the 3' position carbon OH group is a phosphate group or the like, and the 3 'terminal ribose 2' position carbon is May be modified with a phosphate group or the like without any limitation.

The nucleic acid probe of the present invention can be suitably used not only for nucleic acid measurement but also for a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid. In particular, target nucleic acid concentration measurement device DNA
A more convenient device for measuring the concentration of a target nucleic acid is provided by applying it to a chip (protein nucleic acid enzyme, 43, 2004-2011, 1998). Also, a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid using the device is an extremely convenient method. That is, in the hybridization with the nucleic acid probe of the present invention, the fluorescence intensity changes depending on whether or not a GC pair is formed. Then, the nucleic acid probe of the present invention is hybridized to the target nucleic acid, and the luminescence intensity is measured.
rphism) and / or mutation can be analyzed or measured. Specific methods are described in Examples 14 and 15.
It was noted in. In this case, the target nucleic acid may be an amplified product amplified by one of various nucleic acid amplification methods,
It may be an extracted one. The target nucleic acid may be of any type. However, a guanine base or cytosine base may be present in the chain or at the terminal. If no guanine base or cytosine base is present in the chain or at the end, the fluorescence intensity does not decrease. Therefore, according to the method of the present invention, G → A, G ← A,
Mutation or substitution of C → T, C ← T, G → C, G ← C, that is, single nucleotide polymorphism (single nucleotide polymorphism)
(SNP)) and other polymorphisms can be analyzed or measured. At present, polymorphism analysis is currently performed by determining the base sequence of a target nucleic acid using the Maxam-Gilbert method and the dideoxy method.

The nucleic acid probe of the present invention is contained in a measurement kit for analyzing or measuring the polymorphism and mutation of the target nucleic acid, whereby the polymorphism and / or mutation of the target nucleic acid is obtained. mutati
on) can be suitably used as a measurement kit for analyzing or measuring on).

Polymorphism of the target nucleic acid of the present invention
And / or when analyzing data obtained by a method for analyzing or measuring mutation, the fluorescence intensity value of the reaction system when the target nucleic acid hybridizes with the nucleic acid probe of the present invention, By providing a process for correcting the fluorescence intensity value of the reaction system when the soybean is not soyed, the processed data becomes highly reliable. Therefore, the present invention relates to polymorphism of a target nucleic acid.
And / or provide a data analysis method for a method of analyzing or measuring mutation.

A feature of the present invention is that a reaction when a target nucleic acid hybridizes with a nucleic acid probe of the present invention in a measuring device for analyzing or measuring polymorphism and / or mutation of a target nucleic acid. Means for correcting the fluorescence intensity value of the system based on the fluorescence intensity value of the reaction system when the above-mentioned one is not hybridized, wherein polymorphism and / or mutation of the target nucleic acid is provided. ) Is a measuring device for analyzing or measuring the above.

A feature of the present invention is that when analyzing data obtained by a method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid, the target nucleic acid is a nucleic acid probe of the present invention. A computer that records, as a program, a procedure for causing a computer to execute a process of correcting the fluorescence intensity value of the reaction system when hybridized with the fluorescence intensity value of the reaction system when the above-mentioned one is not hybridized. It is a readable recording medium.

The nucleic acid probe of the present invention may be fixed on the surface of a solid (support layer), for example, on the surface of a glass slide. In this case, it is preferable that the end not labeled with the fluorescent dye is fixed. This format is now called a DNA chip. Monitoring of gene expression, determination of base sequence, mutation analysis (mu
tation analysis), single nucleotide polymorphism (single nucleotide p
olymorphism (SNP))
alysis). Of course, it can also be used as a device (chip) for nucleic acid measurement.

For binding the nucleic acid probe of the present invention to, for example, the surface of a slide glass, a slide glass coated with a polycation such as polylysine, polyethyleneimine or polyalkylamine, a slide glass into which an aldehyde group has been introduced, or an amino group can be used. First, the introduced slide glass is prepared. Then, i) reacting a phosphate group of the probe with the slide glass coated with the polycation, ii)
An aldehyde group-introduced glass slide is reacted with an amino group-introduced probe. Iii) An amino group-introduced glass slide is subjected to PDC (pyridinium dichroma).
ate) introduction, and reaction with a probe introduced with an amino group or an aldehyde group, etc. (Fodor, PA, et.
al., Science, 251, 767-773 (1991); Schena, M., et al., P.
roc.Natl.Acad.Sci., USA, 93,10614-10619 (1996); McG
al, G., et al., Proc.Natl.Acad.Sci., USA, 93,13555-1
3560 (1996); Blanchard, AP, et al., Biosens. Bioelectro.
n., 11, 687-690 (1996)).

A device in which the nucleic acid probes of the present invention are arrayed and bound on a solid surface in an array makes nucleic acid measurement more convenient. In this case, by making a device in which many nucleic acid probes of the present invention having different base sequences are individually bound on the same solid surface, multiple types of target nucleic acids can be measured at the same time. In this device, for each probe, at least one temperature sensor and a heater are provided on the surface opposite to the surface to which the solid nucleic acid probe of the present invention is bound,
Preferably, the solid region to which the probe is attached is designed so that the temperature can be adjusted so as to be at an optimum temperature condition.

In this device, a probe other than the nucleic acid probe of the present invention, for example, two different fluorescent dyes in one molecule, and when not hybridized to the target nucleic acid, the two fluorescent dyes A nucleic acid probe that is quenched or emits light due to the interaction, but has a structure designed to emit or quench light when hybridized to a target nucleic acid, that is, the aforementioned molecular beacon (Tyagi et al.)
al., Nature Biotech., 14: 303-308, 1996). Therefore, such a device is also included in the technical scope of the present invention.

The basic operation of the measuring method using the device of the present invention is as follows.
A solution containing a target nucleic acid such as A, cDNA, rRNA or the like is simply placed and hybridized. As a result, the amount of fluorescence changes in accordance with the amount of the target nucleic acid, and the target nucleic acid can be measured from the amount of change in the fluorescence. In addition, by binding a large number of nucleic acid probes of the present invention having different base sequences to one solid surface, the concentration of many target nucleic acids can be measured at once. Therefore, it can be used for the measurement of a target nucleic acid in exactly the same application as a DNA chip.
A chip. Under optimal reaction conditions, nucleic acids other than the target nucleic acid do not change the amount of fluorescence emitted, so that there is no need to wash unreacted nucleic acids. Further, by controlling the temperature of each nucleic acid probe of the present invention with a micro heater, it is possible to control the reaction conditions to the optimum for each probe, so that accurate measurement of the concentration becomes possible. In addition, the dissociation curve between the nucleic acid probe of the present invention and the target nucleic acid can be analyzed by continuously changing the temperature with a micro heater and measuring the amount of fluorescence during that time. From the difference in the dissociation curves, it is possible to determine the properties of the hybridized nucleic acid,
NP can be detected.

A conventional device for measuring the concentration of a target nucleic acid is as follows.
A nucleic acid probe not modified with a fluorescent dye is bound (fixed) to a solid surface, and a target nucleic acid labeled with a fluorescent dye is hybridized with the solid surface. The fluorescence intensity of the fluorescent dye was measured. To label a target nucleic acid with a fluorescent dye, for example, when targeting a specific mRNA, the following steps are taken: (1) m extracted from cells
Extract all RNA. (2) Then, using reverse transcriptase, cDNA is synthesized while incorporating a nucleoside modified with a fluorescent dye. Such an operation is not required in the present invention.

Although a large number of various probes are spotted on the device, the optimal hybridization conditions, such as temperature, for nucleic acids that hybridize to each probe are different. Therefore, the hybridization reaction, the probe,
It is necessary to perform the washing operation under optimal conditions. However, since it is physically impossible, hybridization is carried out at the same temperature for all probes, and washing is carried out at the same temperature with the same washing liquid. Therefore, the nucleic acid expected to be hybridized has a drawback that it does not hybridize, and even if it hybridizes, it is easily washed away because the hybridization is not strong. Due to such reasons, the quantification of nucleic acids was low. The present invention does not have such a disadvantage because this washing operation is not required. Further, by providing a micro heater at the bottom of the spot and controlling the hybridization temperature, a hybridization reaction can be performed at an optimum temperature for each probe of the present invention. Therefore, in the present invention, the quantitativeness is significantly improved.

In the present invention, the use of the above-described nucleic acid probe or device of the present invention makes it possible to measure the concentration of a target nucleic acid in a short time, simply and specifically. The measurement method is described below. In the measurement method of the present invention, first, the nucleic acid probe of the present invention is added to a measurement system and hybridized to a target nucleic acid. The method can be performed by a commonly known method (Analytical Biochemistr
y, 183, 231-244, 1989; Nature Biotechnol
ogy, 14, 303-308, 1996; Applied and Envi
ronmental Microbiology, 63, 1143-1147, 1997
Year). For example, the hybridization conditions are such that the salt concentration is 0 to 2 molar, preferably 0.1 to 1.0 molar, and the pH is 6 to 8, preferably 6.5 to 7.5.

The reaction temperature is preferably within the range of Tm ± 10 ° C. of the nucleic acid hybrid complex obtained by hybridizing the nucleic acid probe of the present invention to a specific site of the target nucleic acid. By doing so, non-specific hybridization can be prevented. Tm-10
When the temperature is lower than 0 ° C, non-specific hybridization occurs. When the temperature exceeds Tm + 10 ° C, no hybridization occurs. The Tm value can be determined in the same manner as in the experiment necessary for designing the nucleic acid probe of the present invention. That is, an oligonucleotide (having a base sequence complementary to the nucleic acid probe) that hybridizes with the nucleic acid probe of the present invention is chemically synthesized using the above-described nucleic acid synthesizer or the like, and the Tm value of the nucleic acid hybrid complex with the nucleic acid probe is obtained. Is measured in the usual way.

The reaction time is 1 second to 180 minutes, preferably 5 seconds to 90 minutes. When the time is shorter than 1 second, the number of unreacted nucleic acid probes of the present invention in hybridization increases. Further, it is meaningless if the reaction time is too long. The reaction time is greatly affected by the nucleic acid species, that is, the length of the nucleic acid or the base sequence. As described above, the nucleic acid probe of the present invention is hybridized to the target nucleic acid. Then, before and after the hybridization, the amount of emission of the fluorescent dye is measured by a fluorometer, and the amount of decrease in emission is calculated. Since the magnitude of the decrease is proportional to the concentration of the target nucleic acid, the concentration of the target nucleic acid can be determined.

Concentration of target nucleic acid in reaction solution: 0.1 to 1
Preferably it is 0.0 nM. The concentration of the nucleic acid probe of the present invention in the reaction solution is preferably 1.0 to 25.0 nM. When preparing a calibration curve, it is desirable to use the nucleic acid probe of the present invention at a ratio of 1.0 to 2.5 with respect to the target nucleic acid.

In practice, when measuring an unknown concentration of a target nucleic acid in a sample, a calibration curve is first prepared under the above conditions. Then, a plurality of concentrations of the corresponding nucleic acid probes of the present invention are added to the sample, and the decrease in the fluorescence intensity value is measured. Then, the probe concentration corresponding to the largest one of the measured decrease values of the fluorescence intensity is set as a preferable probe concentration. The quantitative value of the target nucleic acid is determined from the calibration curve based on the decrease value of the fluorescence intensity measured with the probe having the preferable concentration.

Although the principle of the nucleic acid measurement method of the present invention is as described above, the present invention relates to various nucleic acid measurement methods such as F
It can be applied to ISH method, PCR method, LCR method, SD method, competitive hybridization method, TAS method, and the like.

An example will be described below. a) When applied to the FISH method That is, the present invention provides a method of mixing microorganisms of various types or a microorganism system in which one or more types of microorganisms are mixed with cells derived from animals or plants and cannot be isolated from each other. The present invention can be suitably applied to nucleic acid measurement of intracellular or homogenate of cells in complex microbial systems and symbiotic microbial systems). The microorganism here is a microorganism generally referred to, and is not particularly limited. For example, eukaryotic microorganisms, prokaryotic microorganisms, and others, mycoplasmas, viruses, rickets, and the like can be mentioned. And the target nucleic acid in this system is
In these microbial systems, for example, a nucleic acid having a base sequence having specificity for cells of a strain to be examined how it is active. For example, 5Sr of a specific strain
Specific sequence of RNA, 16S rRNA or 23S rRNA or their gene DNA.

The nucleic acid probe of the present invention is added to a complex microbial system or a symbiotic microbial system, and 5S rRNA of a specific strain,
By measuring the amount of SrRNA or 23S rRNA or their gene DNA, the amount of the specific strain in the system can be measured. In addition, a method of adding the nucleic acid probe to a homogenate of a complex microbial system or a symbiotic microbial system, measuring the amount of decrease in luminescence of a fluorescent dye before and after hybridization, and measuring the abundance of a specific strain is also disclosed in the present invention. Within the target range.

The above measuring method is, for example, as follows. That is, before adding the nucleic acid probe of the present invention, the temperature, salt concentration and pH of the complex microorganism system or symbiotic microorganism system are adjusted to the above-mentioned conditions. Particular strains in a composite microbial system or symbiotic microorganisms system 10 ⁷ to 10 ¹² / m as the number of cells
l, preferably 10 ⁹ to 10 ¹⁰ cells / ml. It can be carried out by dilution or concentration by centrifugation or the like. When the number of cells is less than 10 ⁷ cells / ml, the fluorescence intensity is weak and the measurement error increases. 10
^{When the} number exceeds ¹² cells / ml, the fluorescence intensity of the complex microbial system or the symbiotic microbial system is too strong, so that the abundance of the specific microorganism cannot be quantitatively measured.

The concentration of the nucleic acid probe of the present invention to be added is
It depends on the cell number of a particular strain in a complex or commensal microbial system. 0.1 for 1 × 10 ⁸ cells / ml
１10.0 nM concentration, preferably 0.5 to 5 nM concentration,
More preferably, the concentration is 1.0 nM. When the concentration is less than 0.1 nM, the data does not accurately reflect the abundance of the specific microorganism. However, the optimal amount of the nucleic acid probe of the present invention cannot be determined unconditionally because it depends on the amount of the target nucleic acid in the cell.

Next, in the present invention, the nucleic acid probe and 5S rRNA, 16S rRNA or 23S rRNA of a specific strain are used.
The reaction temperature at the time of hybridization to rRNA or its gene DNA is the same as that described above. Also,
The reaction time is the same as the above conditions. Under the above conditions, the nucleic acid probe of the present invention is
A, 16S rRNA or 23S rRNA is hybridized to the gene DNA thereof, and the amount of decrease in emission of the fluorescent dye of the complex microorganism or the symbiotic microorganism before and after hybridization is measured.

The amount of decrease in luminescence of the fluorescent dye measured as described above is proportional to the amount of the specific strain present in the complex microorganism system or the symbiotic microorganism system. It is 5S rRNA, 1
This is because the amount of 6S rRNA or 23S rRNA or their gene DNA is proportional to the amount of the specific strain.

In the present invention, components other than microorganisms in the complex microbial system or the symbiotic microbial system are not limited as long as they do not inhibit hybridization of the nucleic acid probe of the present invention with 5S rRNA, 16S rRNA or 23S rRNA of a specific strain or their gene DNA. Also, as long as it does not inhibit the emission of the fluorescent dye of the nucleic acid probe of the present invention,
There is no particular limitation. For example, KH ₂ PO ₄ , K ₂ HPO ₄ , NaH ₂ P
O ₄ , Na ₂ HPO _{4 and} other phosphates, ammonium sulfate, nitrate, inorganic nitrogens such as urea, various salts of metal ions such as magnesium, sodium, potassium, calcium ions, manganese, zinc, iron, cobalt ions, etc. Sulfates of trace metal ions,
Various salts such as hydrochloride and carbonate, and vitamins and the like may be appropriately contained. If the above inhibition is observed, cells may be separated from a cell line in which a plurality of microorganisms are mixed by an operation such as centrifugation, and then suspended again in a buffer system or the like.

As the above buffer, various buffers such as a phosphate buffer, a carbonate buffer, a Tris / HCl buffer, a Tris / glycine buffer, a citrate buffer, and a Goodt buffer can also be used. . The concentration of the buffer is a concentration that does not inhibit the hybridization, the FRET phenomenon, and the emission of the fluorescent dye. The concentration depends on the type of buffer. The pH of the buffer is 4-12, preferably 5-9.

B) When applied to the PCR method Any method can be applied as long as it is a PCR method. The case where the method is applied to a real-time quantitative PCR method is described below. That is, in the real-time quantitative PCR method, the PCR using the specific nucleic acid probe of the present invention is performed.
And the decrease in the emission of the fluorescent dye before and after the reaction is measured in real time. The PCR of the present invention means PCR by various methods. For example, RT-PC
R, RNA-primed PCR, Stretch PCR, reverse PC
It also includes PCR using R and Alu sequences, multiplex PCR, PCR using mixed primers, PCR using PNA, and the like. The term “quantitative” means the quantitative measurement of the degree of detection in addition to the original quantitative measurement, as described above.

As described above, the target nucleic acid refers to a nucleic acid whose amount is to be measured. With or without purification. Also, the magnitude of the concentration does not matter. Various nucleic acids may be mixed. For example, it is a specific nucleic acid to be amplified in a complex microorganism system (mixed system of RNA or gene DNA of multiple microorganisms) or a symbiotic microorganism system (mixed system of RNA or gene DNA of multiple animals and plants and / or multiple microorganisms).
If the target nucleic acid needs to be purified, it can be performed by a conventionally known method. For example, the purification can be performed using a commercially available purification kit or the like.

Conventionally known quantitative PCR methods include dATP,
In the presence of Mg ions using dGTP, dCTP, dTTP or dUTP, target nucleic acid (DNA or RNA), Taq polymerase, primer, and a nucleic acid probe or intercalator labeled with a fluorescent dye,
The target nucleic acid is amplified while the temperature is repeatedly reduced and increased, and the increase in the emission of the fluorescent dye in the amplification process is monitored in real time (Experimental Medicine, Vol. 15, No. 7, No. 4,
6-51, 1997, Youtosha).

The quantitative PCR method of the present invention is characterized by amplifying a target nucleic acid using the nucleic acid probe of the present invention, and measuring the amount of decrease in the emission of a fluorescent dye in the amplification process. In the quantitative PCR of the present invention, a preferable nucleic acid probe of the present invention has a base number of 5 to 5.
50, preferably 10 to 25, particularly preferably 1
Any of 5 to 20 that hybridizes with the amplification product of the target nucleic acid during the PCR cycle may be used. Also, forward type, reverse (rev
erse) type.

For example, the following can be mentioned. (1) The terminal, preferably the terminal, of the nucleic acid probe is labeled with the fluorescent dye of the present invention, and when the nucleic acid probe hybridizes to the target nucleic acid, the terminal or terminal labeled with the fluorescent dye of the probe. The base sequence of the probe is designed such that at least one G (guanine) is present in the base sequence of the target nucleic acid at a distance of 1 to 3 bases from the terminal base of the target nucleic acid hybridized with the above. (2) In the above (1), the nucleic acid probe is labeled with a fluorescent dye at the 3 ′ end.

(3) In the above (1), the nucleic acid probe is labeled at the 5 'end with a fluorescent dye. (4) When the nucleic acid probe has hybridized to the target nucleic acid, at least one G (guanine) and C
The base sequence of the probe is designed so as to form a (cytosine) pair. (5) In the above (4), the 3 ′ terminal base of the nucleic acid probe is G or C, and the 3 ′ terminal is labeled with a fluorescent dye. (6) In the above (4), the 5 ′ terminal base of the nucleic acid probe is G or C, and the 5 ′ terminal is labeled with a fluorescent dye. (7) The nucleic acid probe according to any one of (1) to (6), wherein the 3′-terminal hydroxyl group of ribose or deoxyribose at the 3′-terminal or the 3′-terminal or 2′-carbon hydroxyl group of 3′-terminal ribose is present. Phosphorylated. (8) The oligonucleotides of the nucleic acid probes (1) to (6) are chemically modified.

In the case of the above (6), if the 3 ′ or 5 ′ end cannot be designed to be G or C from the base sequence of the target nucleic acid, the 5 ′ of the oligonucleotide which is a primer designed from the base sequence of the target nucleic acid. At the end, 5'-
Even if guanylic acid or guanosine or 5'-cytidylic acid or cytidine is added, the object of the present invention can be suitably achieved. Even when 5'-guanylic acid or 5'-cytidylic acid is added to the 3 'end, the object of the present invention can be suitably achieved. Therefore, in the present invention, a nucleic acid probe designed such that the base at the 3 ′ or 5 ′ end is G or C is
In addition to the probe designed from the base sequence of the target nucleic acid, a probe obtained by adding 5'-guanylic acid or guanosine or 5'-cytidylic acid or cytidine to the 5 'end of the probe, and 5' of the probe It is defined to include a probe obtained by adding 5′-guanylic acid or 5′-cytidylic acid to the terminal.

In particular, the nucleic acid probe of the present invention (7) is designed so as not to be used as a primer. Real-time quantitative PCR using FRET phenomenon
PCR is performed using one nucleic acid probe of the present invention instead of two probes (labeled with a fluorescent dye) used in the method. The probe is added to the PCR reaction system, and PCR is performed. During the nucleic acid extension reaction, the probe hybridized to the target nucleic acid or the amplified target nucleic acid is decomposed by the polymerase and decomposed and removed from the nucleic acid hybrid complex. At this time, the fluorescence intensity value of the reaction system or the reaction system in which the nucleic acid denaturation reaction is completed is measured. Also, the fluorescence of a reaction system in which the target nucleic acid or the amplified target nucleic acid is hybridized with the probe (a reaction system during an annealing reaction or a nucleic acid extension reaction until the probe is removed from the nucleic acid hybrid complex by a polymerase). Measure the intensity value. Then, the amplified nucleic acid is measured by calculating the reduction rate of the fluorescence intensity value from the former. Fluorescence when the probe is completely dissociated from the target nucleic acid or amplified target nucleic acid by a nucleic acid denaturation reaction or when degraded and removed from the nucleic acid hybrid complex of the probe and the target nucleic acid or amplified target nucleic acid by polymerase during nucleic acid extension The intensity values are large.
However, a nucleic acid hybrid complex of the probe and the target nucleic acid or the amplified target nucleic acid by a polymerase during an annealing reaction or a nucleic acid extension reaction in which the annealing reaction has been completed or the probe is sufficiently hybridized to the target nucleic acid or the amplified target nucleic acid The fluorescence intensity value of the reaction system until it is decomposed and removed from is smaller than the former. The decrease in the fluorescence intensity value is proportional to the amount of the amplified nucleic acid.

In this case, when the probe hybridizes to the target nucleic acid, the T
m is in the range of ± 15 ° C., preferably ± 5 ° C. of the Tm value of the nucleic acid hybrid complex of the primer,
It is desirable that the nucleotide sequence of the probe (7) be designed. The Tm value of the probe is the Tm value of the primer −5 ° C.
In particular, when the temperature is lower than −15 ° C., since the probe does not hybridize, the emission of the fluorescent dye does not decrease. Conversely, if the Tm value of the primer exceeds + 5 ° C., especially + 15 ° C., the probe hybridizes to nucleic acids other than the target nucleic acid, and thus loses the specificity of the probe.

Probes other than the above (7), particularly the probe (6), are added to the PCR reaction system as primers. A PCR method using a primer labeled with a fluorescent dye has not yet been known except for the present invention. PCR
As the reaction proceeds, the amplified nucleic acid is secondarily labeled with a fluorescent dye useful for practicing the present invention. Thus, the fluorescence intensity value of the reaction system in which the nucleic acid denaturation reaction is completed is large, but the fluorescence intensity of the reaction system is lower than that of the former in the case of annealing reaction completion or in the reaction system at the time of nucleic acid extension reaction. I do.

The PCR reaction can be performed under the same reaction conditions as in the ordinary PCR method. Thus, the target nucleic acid can be amplified in a reaction system having a low Mg ion concentration (1-2 mM). Of course, the present invention can also be carried out in a reaction system in the presence of a high concentration (2 to 4 mM) of Mg ions used in conventionally known quantitative PCR.

In the PCR method of the present invention, the Tm value can be determined by performing the PCR of the present invention and analyzing the melting curve of the nucleic acid of the amplified product. This method is a novel nucleic acid melting curve analysis method. In the present method, the nucleic acid probe used in the PCR method of the present invention or the nucleic acid probe of the present invention used as a primer can be suitably used. In this case, the nucleotide sequence of the nucleic acid probe of the present invention is represented by S
By making the sequence complementary to the region containing NP (snip; single nucleotide substitution polymorphism), after the PCR is completed, the dissociation curve of the nucleic acid is analyzed from the nucleic acid probe of the present invention. SNP can be detected. If a nucleotide sequence complementary to a sequence containing an SNP is used as the sequence of the nucleic acid probe of the present invention, the Tm value obtained from the dissociation curve between the probe sequence and the sequence containing the SNP is the dissociation curve between the probe sequence and the sequence not containing the SNP. Higher than the Tm value obtained from

The second feature of the present invention is the invention of a method for analyzing data obtained by the above-mentioned real-time quantitative PCR method. The real-time quantitative PCR method is currently a computer that can program a reaction device for performing PCR, a device for detecting the emission of a fluorescent dye, a user interface, that is, a data analysis method, and record the program. Medium (Also known as Sequence D
etection Software System) and control them,
It is a device that consists of a computer that analyzes data and is measured in real time. Thus, the measurement according to the invention is also performed with such a device.

First, real-time quantitative PCR
The analysis device will be described first. The device used in the present invention may be any device as long as it can monitor PCR in real time. For example, ABI PRISM
^TM 7700 Sequence Detection System
ystem SDS 7700) (Perkin Elmer Applied Biosytems, Inc.
USA)) and LightCycler ^™ system (Roche Diagnostics, Germany).

The above-mentioned PCR reaction apparatus is an apparatus for repeatedly performing a thermal denaturation reaction, an annealing reaction, and a nucleic acid extension reaction of a target nucleic acid (for example, at a temperature of 95 ° C., 60 ° C., 72 ° C.).
Can be repeated. ). The detection system includes an argon laser for fluorescence excitation, a spectrograph, and a CCD camera. Further, each procedure of the data analysis method is programmed, and a computer-readable recording medium recording the program is installed and used in a computer, controls the above system via the computer, and is output from the detection system. It records a program for analyzing and processing data.

The data analysis program recorded on the computer-readable recording medium is used to measure the fluorescence intensity for each cycle, and to measure the measured fluorescence intensity as a function of the cycle, that is, PCR amplification.
The process of displaying on a computer display as a plot, the number of PCR cycles (thre
(shold cycle number: Ct), a step of preparing a calibration curve for obtaining the copy number of the sample nucleic acid from the Ct value, and a step of printing data and plot values of each step. If the PCR is progressing exponentially, the PCR
A linear relationship holds between the log value of the copy number of the target nucleic acid at the start and Ct. Therefore, by preparing a calibration curve using a known number of copies of the target nucleic acid and detecting the Ct of the sample containing the unknown number of copies of the target nucleic acid, the copy number of the target nucleic acid at the start of PCR can be calculated.

The PCR-related invention such as the data analysis method described above is a method for analyzing data obtained by the above-described real-time quantitative PCR method. Each feature is described below. The first feature is that, in a method for analyzing data obtained by a real-time quantitative PCR method, when the amplified nucleic acid in each cycle binds to a fluorescent dye, or the amplified nucleic acid hybridizes with the nucleic acid probe of the present invention. The fluorescence intensity value of the reaction system at the time, the fluorescent dye and nucleic acid bound in each cycle, namely, a fluorescent dye-nucleic acid complex, or the nucleic acid probe of the present invention and the target nucleic acid hybridized, that is, nucleic acid This is an arithmetic processing step of correcting the fluorescence intensity value of the reaction system when the hybrid complex is dissociated, that is, a correction arithmetic processing step.

The “reaction system when the amplified target nucleic acid binds to a fluorescent dye or when the amplified target nucleic acid hybridizes with the nucleic acid probe of the present invention” is specifically exemplified by a reaction system in each cycle of PCR. 40-85
And a reaction system at the time of nucleic acid extension reaction or annealing having a reaction temperature of 50 ° C, preferably 50 to 80 ° C. And, it means a reaction system in which the reaction is completed. The actual temperature depends on the length of the amplified nucleic acid. Further, "the reaction system when the fluorescent dye-nucleic acid complex or the nucleic acid hybrid complex is dissociated"
A reaction system for heat denaturation of nucleic acid in each cycle of PCR, specifically, a reaction temperature of 90 to 100 ° C., preferably 94 to 100 ° C.
At a temperature of 96 ° C., a system in which the reaction is completed can be exemplified.

The correction calculation process in the correction calculation process may be any as long as it conforms to the object of the present invention. Specifically, the following [Formula 1] or [Formula 2] Can be exemplified. f _n = f _{hyb, n} / f _{den, n} [Formula 1] f _n = f _{den, n} / f _{hyb, n} [Formula 2] [where, f _n : calculated by [Formula 1] or [Formula 2] F _{hyb, n} : the reaction system when the amplified nucleic acid binds to the fluorescent dye or when the amplified nucleic acid hybridizes with the nucleic acid probe of the present invention in the nth cycle _{Fden, n} : the fluorescence intensity value of the reaction system when the above-described fluorescent dye-nucleic acid complex or nucleic acid hybrid complex is dissociated in the nth cycle] It includes a sub-step of displaying the corrected arithmetic processing value obtained in the processing on a computer display and / or similarly displaying and / or printing the value in the form of a graph as a function of the number of cycles.

The second feature is that the correction operation processing value obtained by [Equation 1] or [Equation 2] in each cycle is substituted into the following [Equation 3] or [Equation 4], and the fluorescence change ratio between each sample or This is a data analysis method that calculates the rate of change in fluorescence and compares them.

F _n = f _n / f _a [Equation 3] F _n = f _a / f _n [Equation 4] [where, F _n : calculated by [Equation 3] or [Equation 4] in the nth cycle. Calculated fluorescence change rate or fluorescence change rate, f _n : correction calculation processing value by [Equation 1] or [Equation 2] in the nth cycle f _a : correction calculation processing value by [Equation 1] or [Equation 2] but those of the previous number of any cycle the change in f _n is observed, usually, for example, those of 10 to 40 cycles, preferably those of 15 to 30 cycles, more preferably 20 to 30 cycles Is adopted. In this process, the calculated value obtained in the above process is displayed and / or printed on a computer display, or the comparison value or the value is similarly displayed and / or graphed as a function of the number of cycles. Alternatively, the sub-step includes a printing sub-step, but the above-described sub-step may or may not be applied to the correction operation processing value obtained by [Equation 1] or [Equation 2].

The third feature is that (3.1) [Expression 5], [Expression 6] or [Expression 6] using the fluorescence change rate or the data of the fluorescence change rate calculated by [Equation 3] or [Equation 4]. The process of performing arithmetic processing according to [Equation 7], log _b (F _n ), ln (F _n ) [Equation 5] log _b {(1-F _n ) × A}, ln {(1-F _n ) × A} [Equation 6] log _b {(F _n -1) × A}, ln {(F _n -1) × A} [Equation 7]

[Wherein A and b: arbitrary numerical values, preferably integer values, more preferably natural numbers. When A = 100 and b = 10, {(F _n −1) × A} is expressed as a percentage (%). F _n : Fluorescence change rate or fluorescence change rate in n cycles calculated by [Equation 3] or [Equation 4], (3.2) Cycle in which the calculated value of (3.1) has reached a certain value (3.3) an arithmetic process for calculating the relational expression between the number of cycles in a nucleic acid sample of a known concentration and the number of copies of the target nucleic acid at the start of the reaction; (3.4) the start of PCR in an unknown sample A calculation process for determining the copy number of the target nucleic acid at the time. And (3.1) →
A process consisting of (3.2) → (3.3) → (3.4) is preferred.

The steps (3.1) to (3.3) are as follows:
Including a sub-step of displaying the calculated values obtained in each process on a computer display and / or displaying and / or printing the values as a function of each cycle number in the same manner as described above in the form of a graph. Is also good. Since the operation processing value obtained in the process (3.4) needs to be printed at least, the process includes a sub-step of printing. The operation processing value obtained in (3.4) may be further displayed on a display of a computer.
In addition, the correction calculation processing value according to [Equation 1] or [Equation 2] and the calculation processing value according to [Equation 3] or [Equation 4] are displayed on a computer display in the form of a graph as a function of the number of cycles. Since they may or may not be printed, their display and / or printing sub-steps may be added as needed.

The data analysis method described above is particularly effective when the real-time quantitative PCR method is used to measure a decrease in the emission of a fluorescent dye. A specific example is the above-described real-time quantitative PCR method of the present invention.

The fourth feature is real-time quantitative PCR.
Is a real-time quantitative PCR measurement and / or analysis device having an arithmetic and storage means for executing the data analysis method for the real-time quantitative PCR method of the present invention.

The fifth feature is that real-time quantitative PCR
The respective steps of the data analysis method for analyzing PCR using the analysis device of the present invention are programmed, and the computer executes the respective steps of the data analysis method of the present invention on a computer-readable recording medium on which the program is recorded. Is a computer-readable recording medium that records a program that can be executed.

A sixth feature is that, in the method for measuring nucleic acids, the data analysis method, measurement and / or analysis apparatus of the present invention,
This is a novel nucleic acid measurement method using a recording medium.

The seventh feature is a method for analyzing the melting curve of a nucleic acid of the present invention, that is, a method for analyzing data obtained by a method for obtaining a Tm value of a nucleic acid by performing a PCR method of the present invention. is there. That is, for the nucleic acid amplified by the PCR method of the present invention, a step of gradually increasing the temperature from a low temperature until the nucleic acid is completely denatured (for example, 50 ° C.)
To 95 ° C.) in this process, measuring the fluorescence intensity at short time intervals (eg, intervals corresponding to a temperature rise of 0.2 ° C. to 0.5 ° C.). , Ie, the process of displaying the melting curve of the nucleic acid, the process of differentiating this melting curve to obtain a differential value (−dF / dT, F: fluorescence intensity, T: time), and using the value as a differential value. This is an analysis method consisting of a process of displaying on the display and a process of finding an inflection point from its differential value. In the present invention, the fluorescence intensity increases as the temperature increases. In the present invention, at the time of the nucleic acid extension reaction in each cycle, preferably, by adding to the above-mentioned process, a process of performing a calculation process of dividing the fluorescence intensity value at the end of the PCR reaction using the fluorescence intensity value at the time of the thermal denaturation reaction, More favorable results are obtained.

An apparatus for measuring and / or analyzing real-time quantitative PCR of the present invention obtained by adding a method for analyzing a melting curve of a nucleic acid of the present invention to the data analysis method of the novel PCR method of the present invention. It is within the technical scope of the present invention.

Further, one of the features of the present invention is a computer-readable recording medium on which a program for causing a computer to execute each step of the method for analyzing a melting curve of a nucleic acid of the present invention is recorded. In addition, the melting curve of the nucleic acid of the present invention is analyzed on a computer-readable recording medium that stores a program that enables a computer to execute each procedure of the data analysis method of the PCR method of the present invention. A computer-readable recording medium in which a program that enables a computer to execute each procedure of the method is additionally recorded.

The data analysis method, apparatus, and recording medium of the present invention are applicable to various fields such as medicine, forensic science, anthropology, ancient biology, biology, genetic engineering, molecular biology, agriculture, and plant breeding. Available at Also referred to as a complex microbial system, a symbiotic microbial system, a microbial system in which various types of microorganisms are mixed or at least one type of microorganism is mixed with cells derived from other animals or plants and cannot be isolated from each other. It can be suitably used. The microorganism referred to here is a microorganism generally referred to, and is not particularly limited. For example, eukaryotic microorganisms, prokaryotic microorganisms, other mycoplasmas,
Viruses, rickets and the like can be mentioned.

Further, using one or more of the data analysis method, apparatus and recording medium of the present invention, 5S rRNA of a specific strain in a complex microorganism system or a symbiotic microorganism system can be used.
By quantifying the copy number of 16S rRNA or 23S rRNA or their gene DNA, the abundance of a specific strain in the system can be measured. It can be 5S rRNA, 16S rRNA or 23SrR
This is because the copy number of the NA gene DNA is constant depending on the strain. In the present invention, it is possible to measure the abundance of a specific strain by performing the real-time quantitative PCR of the present invention using a complex microbial or symbiotic microbial homogenate. This method is also within the technical scope of the present invention.

[0112]

Next, the present invention will be described more specifically with reference to examples and comparative examples. Example 1 It hybridizes to the nucleobase sequence of 16S rRNA of Escherichia coli , that is, (3 ′) CCGCTCACGC A
A nucleic acid probe having the nucleotide sequence of TC (5 ′) was prepared as follows.

Preparation of nucleic acid probe : (3 ') CCGCTCACGC ATC
The 3'-position OH group of a carbon deoxyribose at the 3 'terminus of the oligodeoxyribonucleotide having the base sequence of (5)', - those linked to (CH _{2) 7} -NH _2, Medorando-Sateifaido - The Resin Company (Mi
dland Certified Reagent Company, USA). In addition, Molecular Probes
Fluo Reporter Kit
F-6082 (BODIPY FL propionic acid succinimidyl este
In addition to r), a kit containing a reagent that binds the compound to an amine derivative of an oligonucleotide) was purchased.
The kit was allowed to act on the purchased oligonucleotide to synthesize a nucleic acid probe labeled with bodypi FL used in this example.

Purification of the synthesized product : The obtained synthesized product was dried to obtain a dried product. 0.5M NaHCO ₃ / Na ₂ CO
_It was dissolved in ₃ buffers (pH 9.0). The lysate is converted to NA
Gel filtration was performed using a P-25 column (manufactured by Pharmacia) to remove unreacted substances. In addition, reverse phase HPLC (B gradient:
15-65% for 25 minutes) under the following conditions. Then, the eluting main peak was collected. The fractionated fraction was freeze-dried to obtain a nucleic acid probe in a yield of 23% from 2 mM of the initial oligonucleotide raw material.

[0115]

Example 2 50 ml of sterilized nutrient broth (NB) (manufactured by Difco) liquid medium (composition: NB, 0.08 g / 10
E. coli JM109 strain was cultured overnight at 37 ° C. in a 200 ml (sterilized) Erlenmeyer flask to which 0 ml) was added. Next, an equivalent amount of 99.7% ethanol was added to the main culture solution. 2 ml of the ethanol-added culture was centrifuged in a 2.0 ml Eppendorf centrifuge tube to obtain bacterial cells. 30 mM phosphate buffer (soda salt)
(PH: 7.2) The cells were washed once with 100 μl. The cells were treated with the above phosphate buffer 10 containing 130 mM NaCl.
Suspended in 0 μl. The suspension was subjected to ultrasonic treatment in ice cooling for 40 minutes (output: 33 w, oscillation frequency: 20 kHz, oscillation method: oscillation for 0.5 seconds, rest for 0.5 seconds) to produce a homogenate.

After the homogenate was centrifuged, the supernatant was collected and transferred to a cell of a fluorometer. It was adjusted to 36 ° C. Then, a solution of the nucleic acid probe previously heated to 36 ° C. was added to a final concentration of 5 nM. 3
Escherichia coli 16S rRNA was hybridized with the nucleic acid probe for 90 minutes while controlling the temperature at 6 ° C. Then, the emission amount of the fluorescent dye was measured with a fluorimeter.

Before the hybridization, the amount of emission of the fluorescent dye was determined by using 130 mM NaCl instead of the above supernatant.
Containing 30 mM phosphate buffer (soda salt) (pH:
The value measured using 7.2) was adopted. The emission amount was measured by changing the ratio of the amount of the nucleic acid probe to the amount of the supernatant (excitation light: 503 nm; measured fluorescence color: 512 nm). The result is shown in FIG. As can be seen from FIG. 1, the emission of the fluorescent dye decreased as the ratio of the supernatant increased. That is, in the present invention, it can be seen that the amount of decrease in the emission of the fluorescent dye increases in proportion to the amount of the target nucleic acid hybridized to the nucleic acid probe.

Example 3 Preparation of nucleic acid probe: 23SrR of E. coli JM109 strain
(5 ') CCCACATCGTTTTGTCTGGG that hybridizes to NA
-(CH ₂ ) ₇ -N
The compound having H ₂ bonded thereto was treated with Medland® as in Example 1.
Certified Residential Company (Midlan
d Certified Reagent Company, USA).
Further, the molecular probe (Molecu
lar Probes) from FluoReporter Kit
porter Kit) F-6082 (BODIPY FL propionic acid succin
kit containing a reagent that binds the compound to the amine derivative of the oligonucleotide in addition to the imidyl ester). The kit was allowed to act on the oligonucleotide to synthesize a nucleic acid probe labeled with bodypy FL. The obtained synthesized product was purified in the same manner as in Example 1 to obtain a nucleic acid probe labeled with Bodepy FL in a yield of 25% from 2 mM of the initial oligonucleotide raw material.

Example 4 Pseudomonaspau virus 421Y strain (Pseudomonaspaucimobi) prepared on the E. coli JM109 strain obtained in Example 2 using the same medium and culture conditions as in Example 2
lis) (current name: Sphingomonas pusubimovils)
(FERM P-5122) was used to determine the OD660 value of Escherichia coli JM1.
A mixed microbial system was prepared by mixing at the same concentration as strain 09. The resulting mixture (the concentration of the bacterial cells of Escherichia coli JM109 strain was determined in Example 2)
(Same as described above), and a homogenate was prepared in the same manner as in Example 2. Using the nucleic acid probe prepared in Example 3, the excitation light was 543 nm, and the measured fluorescent color was 569 n.
As a result of performing the same experiment as in Example 2 except for setting m,
The same result as in Example 2 was obtained.

Example 5 The base selectivity of a target nucleic acid in the fluorescence quenching phenomenon, that is, the base specificity of the present invention was examined. Ten types of target synthetic deoxyribooligonucleotides (30 mer) shown below (p
oly a to poly j) using DNA synthesizer ABI394 (Perkin Elmer)
(USA).

Further, the following probe of the present invention was prepared in which the 5 'end of the deoxyribooligonucleotide corresponding to the above-mentioned synthetic DNA was labeled with bodypy FL. Primer DNA corresponding to the above-mentioned synthetic DNA, in which-(CH ₂ ) ₆ -NH ₂ was bound to the phosphate group at the 5 ′ end, was obtained from Medland Certified Resin Co., Ltd.
dland Certified Reagent Company, USA). In addition, Molecular Probes
Fluo Reporter Kit
F-6082 (BODIPY FL propionic acid succinidyl ester)
In addition, a kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide) was purchased. The kit is allowed to act on the purchased primer DNA and the probe probe a of the present invention labeled with the following bodypy FL
~ D and f ~ h were synthesized. Then, the extent to which the emission of the fluorescent dye decreased when hybridized with the corresponding synthetic deoxyribooligonucleotide was examined under the following conditions, and the specificity of the probe of the present invention was examined.

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

Table 1 shows the results. As can be seen from Table 1, the nucleic acid probe labeled with a fluorescent dye
A (oligodeoxyribonucleotide), when the probe is hybridized to the target DNA at the terminal, the terminal base is 1 to 3
It is preferable that the base sequence of the probe is designed so that G (guanine) is present in the base sequence of the target DNA at least one base or more apart from the base. In addition, when a nucleic acid probe labeled with a fluorescent dye is hybridized to a target DNA, the probe is designed so that a plurality of base pairs of the nucleic acid hybrid complex form at least one pair of G and C at the terminal portion. It can be seen from Table 1 that the base sequence is preferably designed.

Example 6 A target nucleic acid having the following nucleotide sequence and a nucleic acid probe of the present invention were prepared. The influence of the number of G in the target nucleic acid and the number of G in the nucleic acid probe of the present invention was examined in the same manner as in the above example.

[0131]

[0132]

[0133]

[0134]

[0135]

As can be seen from Table 2, it is recognized that the number of G in the target nucleic acid and the number of G in the probe of the present invention do not significantly affect the decrease in fluorescence intensity.

Example 7 A target nucleic acid having the following nucleotide sequence and a nucleic acid probe of the present invention were prepared in the same manner as described above. The nucleic acid probe of the present invention in the present example is obtained by labeling the 5 ′ end of the oligonucleotide with bodypy FL / C6. The effects of the base species in the target nucleic acid and the base species in the nucleic acid probe of the present invention were examined in the same manner as in the above Examples.

[0138]

[0139]

[0140]

As can be seen from Table 3 and the above examples,
(i) The terminal of the probe of the present invention labeled with a fluorescent dye is C
When the target nucleic acid hybridizes, GC
When forming a pair, (ii) when the end of the probe of the present invention labeled with a fluorescent dye is composed of a base other than C,
When at least one G is present at the 3′-terminal side of the target nucleic acid, the rate of decrease in the fluorescence intensity is greater than the base pair of the base at the site labeled with the fluorescent dye and the base of the target nucleic acid.

Example 8 Regarding the type of dye to be labeled on the nucleic acid probe of the present invention,
Investigation was conducted in the same manner as in the above-mentioned Example. The probe of the present invention used was the probe z of Example 7, and the target nucleic acid was the oligonucleotide z of Example 7. Table 4 shows the results. As can be seen from the table, those suitable as the fluorescent dye used in the present invention are FITC, BODIPY FL,
BODIPY FL / C3, 6-joe, TMR and the like can be mentioned.

[0143]

Example 9 (Experiment of effect of heat treatment of target nucleic acid (16S rRNA)) Preparation of nucleic acid probe of the present invention: Escherichia coli JM109 strain 1
(5 ′) CATCCCCACC TTCCT C that specifically hybridizes to the 16S rRNA nucleotide sequence of the KYM-7 strain corresponding to the nucleotide sequence from the 1156th nucleotide to the 1190 nucleotides of the 6S rRNA
It has a base sequence of CGAG TTGACCCCGG CAGTC (3 ′) (35 base pairs), bases 1 to 16 and 25 to 35 are deoxyribonucleotides, and bases 17 to 24 are modified with an OH group at the 2 ′ carbon with a methyl group ( Ribooligonucleotide modified with an ether bond), and the 5 ′ terminal phosphate group
An oligonucleotide in which the H group was modified with-(CH ₂ ) ₇ -NN ₂ and bound was used in the same manner as in Example 1 to obtain a product of Medland Certified Reagent Company (Midland Certified Reagent).
agent Company, USA). A 2-O-Me oligonucleotide used for a 2-O-Me probe (a probe consisting of a 2-O-Me oligonucleotide is simply referred to as a 2-O-Me probe) was synthesized by GENSET (France). Outsourced and obtained. Further, as in Example 1, a Fluoro Reporter Kit F-6082 from Molecular Probes was used.
(BODIPY FL / C6 propionic acid succinimidyleste
In addition to r), a kit containing a reagent that binds the compound to an amine derivative of an oligonucleotide) was purchased.
The kit was allowed to act on the oligonucleotide to synthesize a nucleic acid probe of the present invention labeled with bodypy FL / C6. The obtained synthesized product was purified in the same manner as in Example 1 to obtain a nucleic acid probe of the present invention labeled with bodypi FL / C6 in a yield of 23% from the initial oligonucleotide material of 2 mM.
This probe was designated as a 35 base chain 2-O-Me probe.

5 ′) Oligoribonucleotide having the nucleotide sequence of TCCTTTGAGT TCCCGGCCGG A (3 ′) was synthesized using a DNA synthesizer in the same manner as described above, and forward (forwar)
d) Type helper probe. On the other hand, (5 ') CCCTGGTCG
An oligoribonucleotide having the base sequence of T AAGGGCCATG ATGACTTGAC GT (3 ′) was synthesized using a DNA synthesizer in the same manner as described above to obtain a backward type, ie, a reverse type helper probe.

A 2-base O-Me probe, a forward-type helper probe and a reverse-type helper probe were dissolved in a buffer solution having the following composition to give 25 nM each and heated to 75 ° C. (probe solution) ). The above 16S
After the rRNA was heated at 95 ° C. for 5 minutes, it was added to the above-mentioned probe solution under the following reaction conditions, and the fluorescence measurement instrument Perkin Elmer L was used.
The fluorescence intensity was measured with S-50B. The result is shown in FIG. The control using 16S rRNA not subjected to the heat treatment was used as a control. It can be seen from FIG. 2 that the decrease in the fluorescence intensity is large in the heat-treated experimental plot.
This result indicates that heat treatment of 16S rRNA at 95 ° C. results in stronger hybridization with the probe of the present invention.

Example 10 (Experiment of Contribution to Improvement of Hybridization Efficiency of 2'-O-Me Oligonucleotide and Helper Probe) The following various nucleic acid probes of the present invention and various helper probes which hybridize to the above 16S rRNA. Was prepared in the same manner as in Example 9. In addition, all 2-O-Me oligonucleotides used for the 2-O-Me probe are GE
It was obtained by commissioning synthesis to NSET Co., Ltd. (France). Under the following conditions, the effects of the 2-O-Me probe of the present invention, the effect of the length of the base chain of the probe, and the effect of the helper probe were examined in the experiments shown in FIGS. 3A, 3B, 3C, and 3D below. The system was examined in the same manner as in Example 9. The result is shown in FIG. From the figure, it can be seen that the 2-O-Me probe of the present invention contributes to the hybridization efficiency. Further, when the base chain of the 2-O-Me probe is short, the helper probe is useful for increasing the hybridization efficiency.

1) 35-base chain 2-O-Me probe: the same probe as in Example 9; 2) 35-base chain DNA probe: the same base sequence as the 35-base chain 2-O-Me probe in 1) above Is a probe in which the oligonucleotide is composed of deoxyribose. 3) 17-base chain 2-O-Me probe: has the same base sequence as the 35-base chain 2-O-Me probe in the above 1), but has a 5′-terminal. 4) 17 base strand DNA probe: the same base sequence as the 33 base strand DNA probe of 2) above, but 16 bases from the 3 'end Probe with nucleotides removed for minutes

5) Forward type 2-O-Me helper probe: The 2′-position carbon of ribose at the central 8 bases (9 to 16 bases counted from the 5 ′ end) of the forward type helper probe of Example 9 6) Reverse type 2-O-Me helper probe: The OH group of the above is modified with a methyl group (ether bond). 6) Reverse type 2-O-Me helper probe: The central 8 bases (5 ′) of the reverse type helper probe of Example 9 above.
2 'of ribose (9 to 16 bases counted from the end)
Helper probe in which the OH group at the carbon atom is modified (ether bond) with a methyl group. 7) Forward type DNA helper probe: The base sequence is the same as the base sequence of the forward type helper probe of Example 9, but the oligonucleotide is 8) Reverse-type DNA helper probe: a helper probe having the same nucleotide sequence as that of the reverse-type helper probe of Example 9, but the oligonucleotide is composed of deoxyribonucleotides. Probe, 9) 35 base oligoribonucleotide: (5 ') CATCCCCAC
C TTCCTCCGAG TTGA CCCCGG Oligoribonucleotide having a base sequence of CAGTC (3 ′), 10) 17-base chain oligoribonucleotide: (5 ′) CCTT
An oligoribonucleotide having a base sequence of CCTCCG AGTTGAC (3 ′).

[0150]

[0151]

[0152]

[0153]

[0154]

Example 11 (Preparation of Calibration Curve for RRNA Measurement) The rRNA was heated at 95 ° C. for 5 minutes at various concentrations ranging from 0.1 to 10 nM. Added to the reaction solution under the reaction conditions,
After 0 seconds, the decrease in fluorescence intensity was measured using a Perkin Elmer LS-50B. The result is shown in FIG. The figure shows that the calibration curve shows linearity at 0.1 to 10 nM. The following 35 base chain 2-O-Me probe was used in Example 9
Is the same probe as.

Example 12 (FISH method) Cellulomonas sp.KYM-7 (FERM P-1133)
9) and Agrobacterium sp. KYM-
The following 35- or 36-base oligodeoxyribonucleotide 2-O-Me probe of the present invention, which hybridizes to each rRNA of 8 (FERM P-16806), was prepared in the same manner as described above. The base sequence of each probe is as follows.

KYM-7 Cellulomonas sp. KYM-7 35 Base Oligodeoxyribonucleotide 2-O-
Me probe: (5 ') CATCCCCACC TTCCTC CGAG TTGA CCCCGG
CAGTC (3 ') (The underlined portion is modified with a methyl group.) 36-base oligodeoxyribonucleotide 2-O-Me probe for measuring rRNA of Agrobacterium sp. KYM-8: (5 ') CATCCCCACC TTCCTC TCGG CTTAT CACCG GCAGTC
(3 ') (The underlined portion is modified with a methyl group.)

[0158] Cellulomonas sp. KYM-7 and Agrobacterium sp. KYM-8 were mixed-cultured in a medium having the following medium composition under the following culture conditions, and the culture was collected every culture time.
From them, rRNA was prepared using RNeasy Maxikit (QIAGEN). After heating the rRNA at 95 ° C. for 5 minutes,
The reaction solution was added to the reaction solution previously set in the reaction conditions,
After reacting for 0 seconds, the fluorescence intensity was measured using Perkin Elmer LS-5.
Measured using 0B. The results are shown in FIG. still,
Total rRNA is RiboGreen totalRNA Quant
ification Kit (Company name: molecular probe (mole
(Regular probes), location name: Eugene, Oregon, USA). As can be seen from the figure, rRNA of each strain
Kinetics were consistent with total rRNA kinetics. In addition, the total amount of rRNA of each strain coincided with the total rRNA. This indicates that the method of the present invention is an effective method in the FISH method.

Medium composition (g / l): starch, 10.0;
Spartic acid, 0.1; K_TwoHPO_Four, 5.0; KH _TwoPO_Four, 2.0; MgSO_Four
・ 7H_TwoO, 0.2; NaCl, 0.1; (NH_Four)_TwoSO_Four0.1. ・ 100 ml of medium into a 500 ml conical flask
After dispensing, the flask was autoclaved at 120 ° C for 10 minutes.
Sterilized using a boiler. Culture conditions: The above strains were cultured in advance on a slant medium. The
Take one platinum loop of cells from the slant medium,
The medium in a nial flask was inoculated. 30 ° C, 150 rpm
m.

[0160]

Example 13 describes a method for analyzing or measuring a polymorphism and mutation of a target nucleic acid. Example 13 Four types of oligonucleotides having the base sequences shown below were synthesized using the DNA synthesizer of Example 5 described above. In the same manner as in Example 5, a nucleic acid probe of the present invention having the following nucleotide sequence was synthesized. After the probe and each oligonucleotide were hybridized in a solution, it was examined whether single base substitution could be evaluated from the change in fluorescence intensity. The base sequence of the nucleic acid probe of the present invention has a base sequence of 10 when G is present at any 3 ′ end of the target oligonucleotide.
Designed to match 0%. The hybridization temperature was set at 40 ° C. at which 100% of the base-pairs between the probe and the target oligonucleotide could hybridize. The concentration of the probe and the target oligonucleotide, the concentration of the buffer solution, the fluorescence measurement device, the fluorescence measurement conditions, the experimental operation, and the like are the same as those in Example 5.

[0162]

Table 5 shows the results. From the table, the target oligonucleotide No. In Nos. 1 to 3, no change in the fluorescence intensity was observed, but the target oligonucleotide N
o. In No. 4, an 84% reduction was observed.

[0164]

In the present invention, data obtained by a method for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid (for example, the above target oligonucleotide Nos. 1 to 4) (for example, data of columns A and B in Table 5) In the method of analyzing the fluorescence intensity value of the reaction system when the target nucleic acid hybridizes with the nucleic acid probe of the present invention (the above nucleic acid probe), the fluorescence intensity value of the reaction system when the target nucleic acid does not hybridize The correction operation processing refers to the calculation of (AB) / B in Table 3. From the above results, when the target nucleic acid is double-stranded, G → A, G ← A, C → T, C ← T,
It became clear that substitution of G → C and G ← C can be detected.

Embodiment 14 FIG. 6 shows an example of a DNA chip model of the present invention. First, a modified probe prepared by introducing an amino group into the OH group at the 3'-position carbon of the 3'-terminal ribose of 3'TTTTTTTTGGGGGGGGC5'BODIPY FL / C6 which is the probe of the present invention prepared in Example 13, and A surface-treated slide glass was prepared by treating the surface of the slide glass with a silane coupling agent having an epoxy group as a reactive group. The solution containing the modified probe was spotted on the surface-treated slide glass using a DNA chip preparation device GMS ^™ 417ARRAYER (TAKARA). Then, the modified probe bound to the glass surface at the 3 'end. The slide glass was placed in a closed container for about 4 hours to complete the reaction. Then, the slide glass was alternately soaked twice in a 0.2% SDS solution and water for about one minute. Further, a boron solution (water 300)
1.0 g of NaBH ₄ dissolved in ml. ) For about 5 minutes. Soak in water at 95 ° C for 2 minutes, then quickly add 0.2% SD
The reagent was washed away by immersing it twice in the S solution and water alternately for about 1 minute each. Dry at room temperature. Thus, the DN of the present invention
A chip was prepared.

Further, by providing a minute temperature sensor and a heater as shown in the figure at positions corresponding to the respective spots of the modified probe on the lower surface of the glass, high performance could be imparted to the DNA chip of the present invention. A case where a target nucleic acid is measured using this DNA chip will be described. When the target nucleic acid is not hybridized to the probe, or when the probe does not form a GC pair at the fluorescent dye-labeled end even when hybridized, or 1 to 3 bases from the terminal base portion where the probe and the target nucleic acid are hybridized Away,
When at least one G (guanine) or cytosine (C) does not exist in the base sequence of the target nucleic acid, the fluorescence intensity does not change. However, conversely, when a target nucleic acid is hybridized to the probe, or when a GC pair is formed at the fluorescent dye-labeled end even when hybridized, or when the probe and the target nucleic acid are hybridized. When at least one G (guanine) or cytosine (C) exists in the base sequence of the target nucleic acid at a distance of one to three bases from the terminal base, the fluorescence intensity decreases. This fluorescence intensity can be measured using a DNA chip analyzer GMS ^™ 418 Array Scanner (TAKARA).

Example 15: Detection experiment of single nucleotide polymorphism (SNPs) using the DNA chip of the present invention I) Preparation of target nucleic acid: (5 ') AAACGATGTG GGAAGGCCCA GACA
G CCAGG ATGTTGGCTT AGAAGCAGCC (3 ') oligodeoxyribonucleotide having the nucleotide sequence of a DNA synthesizer ABI394
(Perkin Elmer, USA) to obtain a target nucleic acid. II) Preparation of nucleic acid probe: 15 from 5 ′ end of target nucleic acid
The following six oligodeoxyribonucleotides having a base sequence that hybridizes to the base sequence (underlined part) were synthesized using a DNA synthesizer ABI394 (Perkin Elmer,
(USA). And 3'-Amino-Modifier
The 3'-OH group of the 3'-terminal deoxyribose was aminated using C7 CPG (Glen Research, catalog number 20-2957). Further, the phosphate group at the 5 'end was labeled with BODIPY FL in the same manner as in Example 5.

1) Probe 100 (100% match): (5 ′) CCTTCCCACA
TCGTTT (3 '), 2) Probe-T (1 base mismatch): (5') CCTTCCCAT
A TCGTTT (3 '), 3) Probe-A (1 base mismatch): (5') CCTTCCCAA
A TCGTTT (3 '), 4) Probe-G (1 base mismatch): (5') CCTTCCCAG
A TCGTTT (3 '), 5) Probe-TG (2 base mismatch): (5') CCTTCCCTG
A TCGTTT (3 '), 6) Probe-TGT (3 base mismatch): (5') CCTTCCCT
GT TCGTTT (3 '),

III) Preparation of DNA Chip All DNA probes were dissolved in sterile distilled water and
An M concentration solution was obtained. DNA microarrayer device (DNA microarrayer No.439702, 32-pin type,
And a manual chip arrayer comprising DNA slide index No. 439701. slide glass (Blacksilylated s) for DNA chips using greiner
The probe solution was spotted on a lides (greiner). After the completion of the spot, the reaction was performed for 10 minutes, and the probe was immobilized on a slide glass. Thereafter, the plate was washed with a 50 mM TE buffer (pH: 7.2). Each probe solution was spotted by four spots. FIG. 6 shows a schematic diagram of the DNA chip of the present invention. When the probe of the present invention immobilized on a slide glass does not hybridize to the target nucleic acid, BODIPY
FL is colored, but when hybridized, the color is less than when non-hybridized. That is, it decreases. The slide glass is heated by a microheater (in the present invention, the slide glass was heated using a transparent heating plate for a microscope (MP-10MH-PG, Kitasato Supply Co., Ltd.) as shown below).

IV) Detection and Measurement of SNPs DN prepared by preparing a 100 μM target nucleic acid solution {using 50 mM TE buffer (pH: 7.2)} as described above
Placed on A chip. It was covered with a cover glass, and the cover glass was sealed with nail polish so that the target nucleic acid did not leak. FIG. 7 shows an outline of devices for detection and measurement.
First, a transparent heating plate for microscope (MP-10MH-PG, Kitasato Supply Co., Ltd.) was placed on a sample stage of an Olympus upright microscope (AX80 type). The DN of the present invention prepared above on the plate
The A chip was placed, and the temperature was changed from 95 ° C. to 33 ° C. in steps of 3 ° C., and reacted for 30 minutes. The change in fluorescence intensity during the reaction process of each spot was measured in an image capture format using a cooled CCD camera (C5810, Hamamatsu Photonics). The captured image is converted to an image analysis device (image analysis software (TPlab s
The spectrum was analyzed with a personal computer (NEC) in which SignalAnalytics, Verginia) was installed, the brightness of each spot was calculated, and the relationship between temperature and brightness was obtained.

FIG. 8 shows the experimental results. From the figure, it can be seen that the fluorescence intensity is reduced for all the probes. Therefore, the dissociation curve between the probe of the present invention and the target nucleic acid can be easily monitored by the method of the present invention.
In addition, since the difference between the Tm value of the probe 100 that matches 100% with the target nucleic acid and the probe that mismatches by one base is 10 ° C. or more, both can be easily identified from the dissociation curve. That is, it is understood that the analysis of SNPs can be easily performed by using the DNA chip of the present invention.

Hereinafter, the PCR of the present invention is described in Examples 16 to 19.
The method is described. Example 16 A 16S rRNA gene in E. coli genomic DNA was used as a target nucleic acid for amplification of the nucleic acid (BODIPY FL /
A primer (a nucleic acid probe of the present invention) labeled with C6) was prepared.

Preparation of Primer 1 (Eu800R: reverse type): An oligodeoxyribonucleotide having the nucleotide sequence of (5 ′) CATCGTTTAC GGCGTGGAC (3 ′) was converted to a DNA synthesizer ABI394.
(Perkin Elmer, USA), and the oligodeoxyribonucleotide was treated with a phosphatase to treat the phosphate group at the 5 'end of the oligodeoxyribonucleotide, to give a cytosine. the bound oligonucleotide _{2) 9} -NH _2, were purchased from the Midland-Sateifaido-Rejindo Company, Inc. (USA). In addition, from Molecular Probes, Inc., FluoReporter Kits F-6082 (Succinimidyl propionate of Bodepy FL / C6 (BODIPY FLpropionic a
In addition to cid succinimidyl ester), a kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide was purchased. The kit is allowed to act on the purchased oligonucleotide to obtain the bodepy FL / C6 of the present invention.
Was synthesized.

Purification of the synthesized product: The obtained synthesized product was dried to obtain a dried product. Add it to a 0.5M Na ₂ CO ₃ / NaHCO ₃ buffer (pH
9.0). The lysate was subjected to gel filtration using a NAP-25 column (manufactured by Pharmacia) to remove unreacted substances. Further, reverse phase HPLC (B gradient: 15 to 65%, 2
5 minutes) under the following conditions. Then, the eluting main peak was collected. The fractionated fraction was lyophilized to give the primer 1 of the present invention to the first oligonucleotide material 2
Obtained in 50% yield over mM.

[0176]

Example 17 Preparation of Primer 2 (Eu500R / forward: forward type): Fluorescent dye (BODIPY FL / C6) at the 5 ′ end of oligodeoxyribonucleotide having the base sequence of (5 ′) CCAGCAGCCG CGGTAATAC (3 ′) The primer 2 labeled with
It was prepared in the same manner as in a yield of 50%.

Example 18 Using a test tube containing 5 ml of sterilized nutrient broth (NB) (manufactured by Difco) liquid medium (composition: NB, 0.08 g / 100 ml), E. coli JM109 strain was cultured at 37 ° C. overnight. The cells were cultured with shaking. 1.5 ml of the culture was centrifuged in a 1.5 ml centrifuge tube to obtain cells. From these cells, DNeasy Tissue
Genomic DNA was extracted using Kit (QIAGEN, Germany). The extraction followed the protocol of this kit. As a result, a 17 ng / μl DNA solution was obtained.

Example 19 Using the above-described genomic DNA of E. coli, primer 1 and / or primer 2, the LightCycler ^™ system (Ligh
PCR reaction was carried out in the usual manner using a tCycler ^™ System). The operation followed the procedure manual of the relevant system equipment. In the above system, PCR is performed according to the present invention instead of the nucleic acid probe (two probes utilizing the FRET phenomenon) and the normal primer (a normal primer not labeled with a fluorescent dye) described in the procedure manual. The procedure was performed according to the procedure except that the primers 1 and / or 2 were used.

The PCR was performed in a hybridization solution of the following components. The target nucleic acid Escherichia coli 16S rDNA was used at the concentration of the experimental section shown in the description column of FIG.
Similarly, an experiment was performed using a combination of the primers 1 and / or 2 in the experimental section shown in the description column of FIG.

The above Taq solution is a mixture of the following reagents.

The Taq solution and the Taq DNA polymerase solution were obtained from DN of Roche Diagnostics, Inc.
A master hybridization probe (DNA Mast
er Hybridization Probes) kit. Especially Ta
q DNA polymerase solution is 10 × conc. (red cap)
Was used 10 times diluted. Taq Start is a Taq DNA product sold by Clonetech (USA).
It is an antibody for polymerase, and the activity of Taq DNA polymerase can be suppressed up to 70 ° C by adding it to the reaction solution. That is, a hot start can be performed.

[0183] The measurement was performed using a LightCycler ^™ system.
At that time, among the detectors F1 to F3 in the system, F
One detector was used, the gain of the detector was fixed at 10, and the excitation intensity was fixed at 75.

The results are shown in FIGS. From FIGS. 9 and 10, it can be seen that the cycle number at the time when the decrease in the emission of the fluorescent dye is observed is proportional to the copy number of Escherichia coli 16S rDNA of the target nucleic acid. In the figure, the amount of decrease in the emission of the fluorescent dye is expressed as the decrease in the fluorescence intensity. FIG. 11 shows E. coli 16S as a function of cycle number.
3 shows a calibration curve of 16S rDNA of E. coli expressing rDNA copy number. The correlation coefficient was 0.9973, showing a very good correlation. As can be seen from the above results, the use of the quantitative PCR method of the present invention makes it possible to measure the initial copy number of a target nucleic acid. That is, the concentration of the target nucleic acid can be measured.

Example 20 In Example 19, PCR was carried out using the probe of the present invention as a primer. In this example, the probe of the present invention was replaced with the two probes using the FRET phenomenon used in the conventional method. The PCR of the present invention was performed under the following conditions. a) Target nucleic acid: 16S-rDNA of E. coli b) Primers used: Forward primer E8F: (5 ') AGAGTTTGAT CCTGGC
TCAG (3 ') ・ Reverse primer E1492R: (5') GGTTACCTTG TTACG
ACTT (3 ') c) Probe used: BODIPY FL- (5') CGGGCGGTGT GTAC
(3 ') d) PCR measurement equipment used: LightCycler ^™ system e) PCR conditions: Denaturation reaction: 95 ° C, 10 seconds (first time only, 60 times)
Annealing reaction: 50 ° C, 5 seconds Nucleic acid extension reaction: 72 ° C, 70 seconds Total number of cycles: 70 cycles

[0186]

The results are shown in FIG. From the figure, it can be seen that the cycle number at which the decrease in the emission of the fluorescent dye is observed is proportional to the copy number of Escherichia coli 16S rDNA of the target nucleic acid. As can be seen from the above results, the use of the quantitative PCR method of the present invention makes it possible to measure the initial copy number of a target nucleic acid. That is, the target nucleic acid can be measured.

Next, the following examples describe the data analysis method of the present invention for analyzing data obtained by using the above-described quantitative PCR method of the present invention. Example 21 Human genomic DNA (human β-globin (TaKa
Ra catalog product number 9060) (TaKaRa Corporation)
(Hereinafter, referred to as human genomic DNA) as a target nucleic acid, a primer labeled with Bodepy FL / C6 for amplification of the nucleic acid was prepared.

Preparation of primer KM38 + C (reverse type):
(5 ') CTGGTCTCCT TAAACCTGTC An oligodeoxyribonucleotide having a base sequence of TTG (3') was converted to a DNA synthesizer ABI3.
94 (manufactured by Perkin Elmer, USA), and the phosphate group at the 5 'end of the oligodeoxyribonucleotide was treated with phosphatase to give cytosine. The 5'-carbon OH group of cytosine was replaced with-( CH ₂ ) ₉ -NH ₂ was purchased from Midland Certified Raised Company. In addition, a reporter kit (FluoReporter Kit) F-6082 from Molecular Probes, Inc.
(Kit containing a reagent for binding the compound to an amine derivative of an oligonucleotide in addition to BODIPY FL propionic acid succinimidylesters) was purchased. The kit is allowed to act on the purchased oligonucleotide, and the primer KM38 + labeled with the bodepy FL / C6 of the present invention is used.
C was synthesized.

Purification of synthesized product: The obtained synthesized product was dried to obtain a dried product. 0.5M Na ₂ CO ₃ / NaHCO ₃ buffer (pH 9.0)
Was dissolved. The lysate was subjected to gel filtration using a NAP-25 column (Pharmacia) to remove unreacted substances. Further, reverse phase HPLC (B gradient: 15 to 65% for 25 minutes) was performed under the following conditions. Then, the eluting main peak was collected. The fractionated fraction is freeze-dried and the primer of the present invention KM38 + C
Was obtained in 50% yield from the initial oligonucleotide starting material 2 mM.

[0191]

Example 21 Preparation of Primer KM29 (Forward Type): (5 ′) GGTTGGCC
An oligodeoxyribonucleotide having the base sequence of AA TCTACTCCCA GG (3 ′) was synthesized in the same manner as in Example 18.

Comparative Experimental Example 1 In this comparative experimental example, data having no arithmetic processing step (the processing of equation (1)) for dividing the fluorescence intensity value during the nucleic acid extension reaction using the fluorescence intensity value during the thermal denaturation reaction was used. It relates to the use of analysis software. Using the above-mentioned human genomic DNA, primer KM38 + C and primer KM29, a PCR reaction was performed using a LightCycler ^™ system, and the fluorescence intensity in each cycle was measured. In addition, P of this comparative example
CR is a novel real-time quantitative PCR method that uses a primer labeled with a fluorescent dye described above and measures the decrease, not the increase, of fluorescence emission. Data analysis was performed using the software of the system. In the PCR of this comparative experimental example, instead of the nucleic acid probe (two probes utilizing the FRET phenomenon) and a normal primer (a normal primer not labeled with a fluorescent dye) described in the procedure, the present invention was used. Primer KM38
Except for using + C and KM29, the procedure was performed according to the procedure manual of the apparatus.

The PCR was performed in a hybridization solution of the following components. The experiment was performed on human genomic DNA at the concentrations shown in the brief description column of FIG. Final concentration of MgCl ₂ is 2
mM.

The Taq solution is a mixed solution of reagents.

Incidentally, the Taq solution and the Taq DNA polymerase solution are DNS sold by Roche Diagnostics, Inc.
A master hybridization probe (DNA Mast
er Hybridization Probes) kit. Particularly, the Taq DNA polymerase solution was used by diluting 10 × conc. (Red cap) 10-fold. In addition, Taq Start is a Taq product sold by Clonetech (USA).
This is an antibody for q DNA polymerase. By adding it to the reaction solution, the activity of Taq DNA polymerase can be suppressed up to 70 ° C. That is, a hot start can be performed.

The reaction conditions are as follows. The measurement was performed using a LightCycler ^™ system.
At that time, among the detectors F1 to F3 in the system, F
One detector was used, the gain of the detector was fixed at 10, and the excitation intensity was fixed at 75.

The PCR was performed as described above, and the fluorescence intensity in each cycle was measured. The result is shown in FIG. That is, the fluorescence intensity of each copy number of the human genomic DNA at the time of the denaturation reaction and the nucleic acid extension reaction of each cycle was measured and printed. In any cycle, the fluorescence intensity value is constant during the denaturation reaction, but during the nucleic acid extension reaction, it is observed that the fluorescence intensity decreases from around the 25th cycle. So the reduction is human genomic DNA
It can be seen that this occurs in the order of increasing copy numbers.

As shown in FIG. 13, the fluorescence intensity value at the initial cycle number was not uniform for each copy number of human genomic DNA. Therefore, the following steps (b) to (j) were added to the data analysis method used in this comparative example. (B) The process of converting the fluorescence intensity value of each cycle with the fluorescence intensity value of the 10th cycle as 1, that is, the process of calculating by the following [Equation 8], C _n = F _n (72) / F ₁₀ ( 72) [Expression 8] where C _n = converted value of the fluorescence intensity value in each cycle, F _n (72) = the fluorescence intensity value at 72 ° C. in each cycle,
F ₁₀ (72) = the fluorescence intensity value after the extension reaction at 72 ° C. at the 10th cycle. (C) displaying and / or printing each converted value obtained in the step (b) on a display as a function of the number of cycles;

(D) calculating the change rate (decrease rate, extinction rate) of the fluorescence intensity from the converted value of each cycle obtained in the process (b) by the following [Equation 9], [Equation 9] F _dn = log _{10 −100} −C _n × 100)｝ F _dn = 2log ₁₀ ｛1−C _n ｝ where, F _dn = fluorescence intensity change rate (decrease rate, extinction rate), C
_n = value obtained by [Equation 8]. (E) displaying and / or printing each converted value obtained in the step (d) on a display as a function of the number of cycles;

(F) comparing the data processed in the step (d) with 0.5 as a threshold, and counting the number of cycles reaching the value; (g) the step (g). f) plotting the value counted in step f) on the X-axis and the copy number before the start of the reaction on the y-axis, and (h) displaying the graph prepared in step (g) on a display. (I) a step of calculating a correlation coefficient or a relational expression of the straight line drawn in the step (h), (j) a correlation coefficient or a relation calculated in the step (i) The process of displaying and / or printing the formula on the display.

Using the data analysis software described above, the data obtained in FIG. 13 was subsequently processed as follows. FIG. 14 is a printout of the data processed in the process (b) (the process (c)). That is, the fluorescence intensity of each cycle is converted with the fluorescence intensity value of the 10th cycle as 1, and the converted value is plotted against the corresponding cycle number. FIG.
Is a printout of the data processed in step (d) (step (e)). That is, the reduction rate (quenching rate) of the fluorescence intensity was calculated from each plot value in FIG. 14, and each calculated value was plotted against each cycle number.

FIG. 16 is a graph obtained by printing the graph created in the step (g) on the data processed in the step (f) (the step (h)). That is, the fluorescence intensity reduction rate = 0.5 is set as a threshold.
And the number of cycles that reached that value was plotted on the X-axis,
It is the graph which plotted the copy number before the reaction start of NA on the Y-axis. The correlation coefficient (R2) of the straight line in this graph was calculated in the process (i) and printed (process (j)).
Was 0.9514. Thus, it was impossible to obtain an accurate copy number with this correlation coefficient.

Example 23 (Experimental example in which data processing was performed using the data analysis method of the present invention) PCR was performed in the same manner as in Comparative experimental example 1. In the data processing, the following process (a) is performed before the process (b) of Comparative Experimental Example 1,
The procedure was performed in the same manner as in Comparative Example 1 except that the steps (b) and (d) were changed as follows. (A) The fluorescence intensity value of the reaction system when the nucleic acid amplified in each cycle is hybridized with the nucleic acid probe of the present invention (labeled with a fluorescent dye) (that is, at the time of nucleic acid extension reaction (72 ° C.) Of the reaction system measured when the nucleic acid hybrid complex (the amplified nucleic acid hybridized with the nucleic acid primer) is dissociated (that is, when the nucleic acid thermal denaturation reaction is completed (9)).
5)), the correction calculation process,
The measured fluorescence intensity value was corrected by the following [Equation 1]. f _n = f _{hyb, n} / f _{den, n} [Equation 1] [where, f _n = correction value of the fluorescence intensity of the cycle, f _{hyb, n} =
Fluorescence intensity value at 72 ° C. in each cycle, f _{den, n} = fluorescence intensity value at 95 ° C. in each cycle] FIG. 17 shows the obtained values plotted against the number of cycles.

(B) An arithmetic processing step of substituting the correction operation processing value in [Equation 1] in each cycle into [Equation 3] and calculating a fluorescence change rate (decrease rate or extinction rate) between samples in each cycle. That is, the following [Equation 1]
0], F _n = f _n / f ₂₅ [Equation 10] [where, F _n = operation processing value of each cycle, f _n = value of each cycle obtained by [Equation 1], f ₂₅ = value obtained by [Equation 1] and the number of cycles is 25]. [Equation 1
0] is obtained when a = 25 in [Equation 3].

(D) The arithmetic processing value of each cycle obtained in the above process (b) is applied to arithmetic processing for obtaining the logarithmic value of the change rate (decrease rate or extinction rate) of the fluorescence intensity according to [Equation 6]. Affixing process, that is, a process of performing an arithmetic process by the following [Expression 11], log ₁₀ {(1-F _n ) × 100} [Expression 11] [where, F _n = value obtained by [Expression 10]] . [Equation 1
1] is a case where b = 10 and A = 100 in [Equation 6].

The above results are shown in FIGS. FIG. 18 is a graph in which the values processed in the processes (a) and (b) are plotted against the number of cycles and printed.
FIG. 19 is a graph in which the values obtained by processing the values obtained in FIG. 18 as in the process (d) are plotted against the number of cycles and printed.

Next, based on the graph of FIG. 19, processing was performed in the steps (f), (g), and (h). That is,
Based on the graph of FIG. 19, log ₁₀
(Fluorescent intensity change rate)
0.1, 0.3, 0.5, 0.7, 0.9 and 1.2 were selected, and the number of cycles that reached that value was plotted on the X-axis and the human genome D
The copy number before the start of the NA reaction was plotted on the Y-axis, and a calibration curve was drawn. The result is shown in FIG. Correlation coefficients (R ² ) obtained by processing these calibration curves in the processes (i) and (j) are 0.998, 0.999, 0. 999
3, 0.9985, 0.9989 and 0.9988. From these correlation coefficients, it was recognized that it is desirable to adopt 0.5 (correlation coefficient 0.9993) as the threshold value. With the calibration curve having this correlation coefficient, it can be seen that the copy number before the start of the reaction can be accurately determined for the nucleic acid sample having the unknown copy number.

Example 24 (Melting curve analysis of nucleic acid and Tm
Example of Value Analysis) For the nucleic acid amplified by the novel PCR method of the present invention, 51) a process of gradually increasing or decreasing the temperature from a low temperature until the nucleic acid is completely denatured (for example, 50 ° C.)
To 95 ° C.), 52) a step of measuring the fluorescence intensity at short time intervals (for example, an interval corresponding to a temperature rise of 0.2 ° C. to 0.5 ° C.) in the step 51), 53) the 52) Displaying the measurement results of the process as a function of time on the display, ie displaying the melting curve of the nucleic acid; 54) first-order differentiating the melting curve of the 53) process; 55) differentiating the 54) process Value (-dF / dT,
F: fluorescence intensity, T: time) on the display; 56) software for analyzing the data of the present invention, comprising the step of obtaining an inflection point from the differential value obtained in 55). Combined with wear. The light cycler having a computer-readable recording medium on which the data analysis software is recorded.
New real-time quantitative P of the present invention using ^TM system
A CR reaction was performed, and a nucleic acid melting curve was analyzed. In the present invention, the fluorescence intensity increases as the temperature increases.

The same PCR as in Example 21 was performed on 1 and 10 copies of the same human genomic DNA as in Example 23.
And 51), 52), 53), 54) and 5
FIG. 21 shows a printout of the data processed in step 5).
It is. FIG. 22 is a diagram of a nucleic acid melting curve obtained by treating the 75th amplification product of 1 copy and 10 copies in the steps 51), 52) and 53) of this example. FIG. 23 shows the result of differentiating this curve in the process of 54) and obtaining the inflection point (Tm value) in the processes of 55) and 56). From FIG. 23, it was found that each amplification product was a different product because the Tm values of the amplification products of 1 copy and 10 copies were different.

[0211]

The present invention has the following effects. 1) The method for measuring the concentration of a target nucleic acid of the present invention, various nucleic acid probes of the present invention, particularly 2-O-alkyl oligonucleotides or 2-O-alkylene oligonucleotides, 2-O-
Nucleic acid probes of the present invention comprising chemically modified oligonucleotides such as benzyl oligonucleotides, nucleic acid probes of the present invention consisting of chimeric oligonucleotides interposed by oligoribonucleotides and oligodeoxyribonucleotides, and those nucleic acid probes of the present invention. When a measurement kit for measuring the concentration of a target nucleic acid, which is contained or incidental, and a nucleic acid chip or a nucleic acid device such as a DNA chip obtained by binding the nucleic acid probe of the present invention, an unreacted nucleic acid probe is measured from the measurement system. Since there is no operation such as removal, the concentration of the target nucleic acid can be measured in a short time and easily. Further, when applied to a complex microbial system or a symbiotic microbial system, the abundance of a specific strain in the system can be measured specifically and in a short time. The present invention also provides a simple method for analyzing or measuring a polymorphism or mutation such as SNP of a target nucleic acid or gene.

2) The quantitative PCR method of the present invention
It has the following effects. a. Since no factor that inhibits the amplification of the target nucleic acid by Taq DNA polymerase is added, quantitative PCR can be performed under the same conditions as those of conventionally known ordinary PCR having specificity. b. In addition, since the specificity of PCR can be kept high, the amplification of the primer dimer is slowed down, so that the quantification limit is reduced by about one order of magnitude as compared with conventionally known quantitative PCR. c. Since there is no need to prepare a complicated nucleic acid probe, the time and cost required for the preparation can be saved. d. The effect of amplifying the target nucleic acid is large, and the amplification process can be monitored in real time.

3) When analyzing data obtained by the real-time quantitative PCR method, a calibration line for obtaining the copy number of a nucleic acid for a nucleic acid sample having an unknown nucleic acid copy number is prepared using the data analysis method of the present invention. Then, the correlation coefficient of the calibration curve is much higher than that obtained by the conventional method. Thus, the use of the data analysis method of the present invention makes it possible to determine the exact copy number of a nucleic acid.

4) The real-time quantitative P of the present invention
Data analysis software according to a method of analyzing data obtained by the CR method, a computer-readable recording medium in which the procedure of the analysis method is recorded as a program, and real-time quantitative PCR using the same
The use of a measurement or analysis device enables automatic creation of a calibration line having a high correlation coefficient.

5) Further, by using the novel nucleic acid melting curve analysis method of the present invention, a highly accurate Tm value of a nucleic acid can be obtained. Furthermore, software for data analysis according to the method, and a computer-readable recording medium recording the procedure of the analysis method as a program,
In addition, when a real-time quantitative PCR measurement or analysis device using the same is used, an accurate Tm value can be obtained.

[Brief description of the drawings]

FIG. 1 shows that the nucleic acid probe obtained in Example 1 is used to count 335 to 358 from the 5 ′ end of 16S rRNA of E. coli.
The figure which shows the fluorescence intensity measurement data at the time of measuring the 3rd nucleic acid base sequence.

FIG. 2: Effect of heat treatment on hybridization of 35 base chain 2-O-Me probe to target nucleic acid Dotted line: After rRNA was heat-treated, target nucleic acid was added. Solid line: unheated rRNA.

FIG. 3 shows the effect of the base number of the base chain of the probe, the helper probe and the methyl group modification of the 2′-carbon OH group of the 5′-end ribose of the probe on the hybridization between the probe and the target nucleic acid 16S rRNA.

FIG. 4 is a calibration curve for measuring rRNA according to the method of the present invention.

FIG. 5: rR of a combined culture system of KYM7 strain and KYM8 strain
Analysis of time course of NA amount by FISH method of the present invention

FIG. 6 is a diagram illustrating a DNA chip of the present invention.

FIG. 7 is a diagram illustrating devices for detecting and measuring SNPs using the DNA chip of the present invention.

FIG. 8 is a view showing an experimental result of SNPs detection measurement using the DNA chip of the present invention.

FIG. 9: Primers 1 and 2 labeled with Bodepy FL / C6
FIG. 5 is a diagram showing the relationship between the number of cycles and the amount of decrease in luminescence of a fluorescent dye. The symbol "-" in the figure is
Indicates the following meaning.

FIG. 10 shows a quantitative PCR method using primers 1 and 2 labeled with bodypy FL / C6: the relationship between the number of cycles and the logarithmic value of the decrease in the emission of the fluorescent dye. The symbol "-" in the figure represents the same meaning as in FIG.

FIG. 11 shows a calibration curve of Escherichia coli 16S rDNA prepared using the quantitative PCR method of the present invention. n: 10 ⁿ

FIG. 12 shows a case where real-time quantitative PCR is performed using one probe of the present invention instead of two probes labeled with a fluorescent dye used in the real-time quantitative PCR method using the FRET phenomenon. It is a figure which shows the change of the reduction rate of fluorescence intensity. The figure below shows the number of cycles (thresholdnumbe
(r: Ct value) was calculated and a calibration curve was created.

FIG. 13 is a graph showing a fluorescence reduction curve obtained by real-time quantitative PCR using a primer labeled with the bodypy FL / C6 of the present invention without performing the correction arithmetic processing of the present invention. ■: target nucleic acid = 10 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C. ●: target nucleic acid = 100 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C. ▲: target nucleic acid = 1000 copies; Reaction system temperature = 72 ° C. ◆: target nucleic acid = 10000 copies; temperature of reaction system for fluorescence intensity measurement = 72 ° C. □: target nucleic acid = 10 copies; temperature of reaction system for fluorescence intensity measurement = 95 ° C. ○: target nucleic acid = 100 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C. Δ: target nucleic acid = 1000 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C. Δ: target nucleic acid = 10000 copies; temperature of reaction system for measuring fluorescence intensity = 95 ° C

FIG. 14 is a diagram showing a fluorescence reduction curve obtained by real-time quantitative PCR in the same manner as in the case of the curve in FIG. 13 except that the value at the 10th cycle of each curve is corrected to 1. ■: Target nucleic acid = 10 copies; fluorescence intensity measurement temperature = 72 ° C. ●: target nucleic acid = 100 copies; fluorescence intensity measurement temperature = 72
° C: Target nucleic acid = 1000 copies; Fluorescence intensity measurement temperature = 7
2 ° C ◆: target nucleic acid = 10000 copies; fluorescence intensity measurement temperature =
72 ° C. 5: Target nucleic acid = 10000 copies; fluorescence intensity measurement temperature =
72 ° C

FIG. 15 shows the plot values of the curves in FIG.
The figure which shows the curve which calculated the fluorescence intensity reduction rate (change rate) of [Formula 9], and plotted the calculated value. ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

FIG. 16 shows human genomic DNA obtained from the data shown in FIG.
FIG. y = human β-globin gene copy number x = cycle number (Ct) R ² = correlation coefficient

17 is a diagram showing a curve obtained by plotting a value obtained by performing a correction operation on the measured value of each cycle in FIG. 13 using [Equation 1] with respect to each cycle number. ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

18 is a diagram showing a curve obtained by plotting a value obtained by performing an arithmetic operation on the operation processing value of each cycle in [Equation 3] in FIG. 17 against the number of cycles. ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

FIG. 19 is a diagram showing a curve obtained by plotting a value obtained by performing an arithmetic processing value of each cycle in FIG. 18 by the equation [Equation 6] with respect to the number of cycles; ■: Target nucleic acid = 10 copies ●: Target nucleic acid = 100 copies ▲: Target nucleic acid = 1000 copies ◆: Target nucleic acid = 10,000 copies

FIG. 20 is a table showing 0.1, 0.3, 0.5, 0.7,.
FIG. 9 is a diagram in which 9 and 1.2 are appropriately selected and a calibration straight line corresponding thereto is drawn. In addition, the correlation coefficient in each calibration curve was shown below. ：: log ₁₀ (fluorescence change rate) = 0.1; correlation coefficient = 0.9
98 1: log ₁₀ (fluorescence change rate) = 0.3; correlation coefficient = 0.9
99 ●: log ₁₀ (fluorescence change rate) = 0.5; correlation coefficient = 0.9
993 Δ: log ₁₀ (fluorescence change rate) = 0.7; correlation coefficient = 0.9
985 □: log ₁₀ (fluorescence change rate) = 0.9; correlation coefficient = 0.9
989 ○: log ₁₀ (fluorescence change rate) = 1.2; correlation coefficient = 0.9
988

FIG. 21 shows 1 and 10 copies of human genomic DNA
FIG. 4 is a diagram showing a fluorescence decrease curve when real-time quantitative PCR was performed using primers labeled with the bodypy FL / C6 of the present invention. However, the correction calculation processing of [Equation 1] was performed. 1: Target nucleic acid = 0 copy 2: Target nucleic acid = 1 copy 3: Target nucleic acid = 10 copies

FIG. 22 is a view showing a melting curve of a nucleic acid when a melting curve analysis of the nucleic acid is performed on the PCR amplification product shown in FIG. 21. 1: Target nucleic acid = 0 copy 2: Target nucleic acid = 1 copy 3: Target nucleic acid = 10 copies

FIG. 23 is a diagram showing a curve indicating a Tm value obtained by differentiating the curve of FIG. 22 (a valley is a Tm value). 2: Target nucleic acid = 1 copy 3: Target nucleic acid = 10 copies

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/53 G01N 37/00 102 5B056 33/566 G06F 17/10 Z 33/58 C12N 15/00 ZNAA 37 / 00 102 F G06F 17/10 G01N 1/28 KJ (72) Inventor Ryuichiro Kurane 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture Independent Administrative Law, National Institute of Advanced Industrial Science and Technology Tsukuba Center (72) Inventor Takahiro Kanekawa 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture Independent Administrative Law, National Institute of Advanced Industrial Science and Technology Tsukuba Center (72) Inventor Yoichi Kamagata 1-1-1, Higashi, Tsukuba City, Ibaraki Prefecture, National Institute of Advanced Industrial Science and Technology Tsukuba Center ( 72) Inventor Masaki Torimura 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture National Institute of Advanced Industrial Science and Technology Tsukuba Inside the center (72) Inventor Shinya Kurata 1-9-8 Higashikanda, Chiyoda-ku, Tokyo Environmental Engineering Co., Ltd. (72) Inventor Kazutaka Yamada 1-9-8 Higashikanda, Chiyoda-ku, Tokyo Environmental engineering (72) Inventor Toyoichi Yokomaku 1-9-8 Higashi Kanda, Chiyoda-ku, Tokyo F-term (reference) 2G045 AA35 AA40 BB20 CB17 CB20 CB21 DA12 DA13 DA14 FA16 FA19 FA29 FA33 FB02 FB06 FB13 FB16 GC15 JA01 JA02 JA04 JA20 2G052 AA35 AA36 AA37 AB20 AD46 DA08 EB11 GA20 GA23 GA30 GA31 HA17 HB07 HB08 HB10 HC03 HC04 HC22 HC44 JA03 JA07 JA09 JA16 4B024 AA11 AA20 CA01 CA09 CA12 HA14 A19 QB QA14 QBQ QQ53 QR08 QR55 QR58 QR62 QR82 QS25 QS34 QX02 5B056 AA04 BB00 HH00

Claims (50)

[Claims] In a nucleic acid measuring method using a nucleic acid probe labeled with a fluorescent dye, when the nucleic acid probe hybridizes to a target nucleic acid, the fluorescent dye is:
A method for measuring the concentration of a target nucleic acid, which is a nucleic acid probe that reduces the emission thereof, wherein the nucleic acid probe is hybridized to a target nucleic acid, and the amount of decrease in emission of a fluorescent dye before and after hybridization is measured. 2. When a nucleic acid probe labeled with a fluorescent dye is hybridized to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces the emission thereof, and the probe has the fluorescent dye at the end thereof. When labeled with a dye and the nucleic acid probe hybridizes to the target nucleic acid at the end, the base sequence of the target nucleic acid is separated from the terminal base by 1 to 3 bases from the terminal nucleic acid hybridized to the probe, and G ( A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, wherein the base sequence of the probe is designed so that at least one base of guanine is present. 3. The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 2, wherein the nucleic acid probe is labeled with a fluorescent dye at the 3 ′ end. 4. The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 2, wherein the nucleic acid probe is labeled at its 5 ′ end with a fluorescent dye. 5. When the nucleic acid probe labeled with a fluorescent dye is hybridized to a target nucleic acid, the fluorescent dye is a nucleic acid probe that reduces the emission thereof, and the probe has the fluorescent dye at the end thereof. When the nucleic acid probe is labeled with a dye and hybridizes to the target nucleic acid, a plurality of base pairs of the probe-nucleic acid hybrid form at least one G (guanine) and C (cytosine) pair at the terminal portion. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid, characterized in that the nucleotide sequence of the probe is designed so that 6. The nucleic acid probe, wherein the 3 ′ terminal base is G or C.
And the 3 ′ end is labeled with a fluorescent dye.
2. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to 1.). 7. The nucleic acid probe according to claim 5, wherein the 5 ′ terminal base is G or C.
And the 5 ′ end is labeled with a fluorescent dye.
2. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to 1.). 8. A nucleic acid probe comprising a 3′-carbon hydroxyl group of 3′-terminal ribose or deoxyribose, or 3 ′
The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 4 or 7, wherein the hydroxyl group at the 3 'or 2' carbon of the terminal ribose is phosphorylated. 9. The oligonucleotide according to claim 1, wherein the oligonucleotide of the nucleic acid probe for nucleic acid measurement is a chemically modified nucleic acid.
9. A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to any one of items 8 to 8. 10. The chemically modified nucleic acid is a 2′- O -methyl oligonucleotide, 2′- O -ethyl oligonucleotide, 2′- O -butyl oligonucleotide, 2′- O -ethylene oligonucleotide, or 2′- O -ethylene oligonucleotide. '- O - benzyl oligonucleotide nucleic acid probe labeled with a fluorescent dye for concentration measurement of the target nucleic acid of claim 9. 11. The oligonucleotide for a nucleic acid probe for nucleic acid measurement, wherein the oligonucleotide comprises a chimeric oligonucleotide containing ribonucleotides and deoxyribonucleotides.
A nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to any one of claims 2 to 8, which is a ligonucleotide). 12. The method according to claim 12, wherein the chimeric oligonucleotide is 2 ′
- O - methyl oligoribonucleotides, 2'-O - ethyl oligonucleotide, 2'-O - butyl oligonucleotide or 2'
The nucleic acid probe labeled with a fluorescent dye for measuring the concentration of a target nucleic acid according to claim 11, which is provided with an O -benzyl oligonucleotide. 13. A nucleic acid probe for nucleic acid measurement according to any one of claims 2 to 8, which is hybridized to a target nucleic acid, and a decrease in the emission of a fluorescent dye before and after hybridization is measured. The method for measuring the concentration of the target nucleic acid. 14. A nucleic acid probe for nucleic acid measurement according to claim 9, wherein the nucleic acid probe is hybridized to a target nucleic acid, and a decrease in the emission of a fluorescent dye before and after hybridization is measured. The method for measuring the concentration of the target nucleic acid to be performed. 15. The method for measuring the concentration of a target nucleic acid according to claim 14, wherein the nucleic acid probe and the target nucleic acid are hybridized after heat treatment of the target nucleic acid under conditions suitable for sufficiently destroying the higher order structure. 16. A helper probe for performing a hybridization reaction is added to a hybridization reaction system before the hybridization reaction.
Or the method for measuring the concentration of a target nucleic acid according to 15. 17. The nucleotide sequence of the helper probe is (5 ′) T
CCTTTGAGT TCCCGGCCGG A (3 ') or / and (5') CCCTGGTCGT
The method for measuring the concentration of a target nucleic acid according to claim 16, which is AAGGGCCATG ATGACTTGAC GT (3 '). 18. Heat treatment conditions are 80 to 100 ° C., 1 to 1
The method for measuring the concentration of a target nucleic acid according to any one of claims 15 to 17, which is 15 minutes. 19. The method according to claim 13, wherein the target nucleic acid is RNA.
19. The method for measuring the concentration of a target nucleic acid according to any one of 18. 20. A kit for measuring the concentration of a target nucleic acid, which comprises or has the nucleic acid probe according to any one of claims 2 to 12 attached thereto. 21. The kit for measuring the concentration of a target nucleic acid according to claim 20, which contains or is accompanied by a helper probe. 22. A method for analyzing or measuring polymorphism and / or mutation of a target nucleic acid, wherein the nucleic acid probe according to any one of claims 2 to 12 is hybridized to the target nucleic acid. A method for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, which comprises measuring a change in fluorescence intensity. 23. A measurement kit for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, wherein
A measurement kit for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, comprising the nucleic acid probe according to any one of the above. 24. The measurement kit for analyzing or measuring a polymorphism and / or mutation of a target nucleic acid according to claim 23, which contains or is accompanied by a helper probe. 25. The method for analyzing data obtained by the method according to claim 22, wherein the fluorescence intensity value of the reaction system when the target nucleic acid is hybridized with a nucleic acid probe labeled with a fluorescent dye is determined by the hybridization method. A data analysis method for a method of analyzing or measuring a polymorphism and / or mutation of a target nucleic acid, comprising a step of performing a correction process based on a fluorescence intensity value of a reaction system when a soybean is not soyed. 26. A target nucleic acid polymorphism, which comprises means for performing the data analysis method according to claim 25, in a measuring device for analyzing or measuring a polymorphism and / or mutation of the target nucleic acid. And / or a measurement device for analyzing or measuring a mutation. 27. A computer-readable recording medium in which a procedure for causing a computer to execute the correction process according to claim 25 is recorded as a program. 28. The nucleic acid probe according to any one of claims 2 to 12, or two different fluorescent dyes in one molecule, and when not hybridized to a target nucleic acid, two A plurality of other nucleic acid probes having a structure designed to emit or quench when hybridized to a target nucleic acid are quenched or emit light by the interaction of a fluorescent dye, and are bound to the surface of the solid support. A device for measuring the concentration of one or more nucleic acids, wherein the concentration of the target nucleic acid can be measured by hybridization. 29. The device for nucleic acid measurement according to claim 28, wherein the nucleic acid probes are arranged and arrayed on the surface of the solid support in an array, and each of them measures the concentration of one or more nucleic acids. Chips). 30. For each nucleic acid probe bound to the surface of the solid support, at least one temperature sensor and a heater are provided on the opposite surface, and the temperature is adjusted so that the nucleic acid probe binding region has an optimal temperature condition. Claim 28
Or a device for measuring the concentration of one or more nucleic acids according to 29. 31. The nucleic acid probe according to claim 28, wherein the nucleic acid probe is bound to the surface of the solid support at an end not labeled with a fluorescent dye.
0. A device for measuring the concentration of one or more nucleic acids according to any one of 0. 32. A method for measuring the concentration of a target nucleic acid, comprising measuring the target nucleic acid using the device for nucleic acid measurement according to claim 28. 33. The method according to any one of claims 1, 13 to 19,
33. The method for measuring the concentration of a target nucleic acid according to claim 32, wherein the target nucleic acid is derived from a microorganism or an animal obtained by pure separation. 34. The target nucleic acid according to any one of claims 1, 13 to 19, or 32, wherein the target nucleic acid is a nucleic acid contained in a cell of a complex microbial system or a symbiotic microbial system or in a homogenate of the cell. A method for measuring the concentration of a target nucleic acid. 35. The PCR method according to claim 2,3,
A reaction system in which a reaction is carried out using the nucleic acid probe according to any one of claims 5, 6, or any one of claims 8 to 12, and the probe is decomposed and removed by a polymerase during a nucleic acid extension reaction, or during a nucleic acid denaturing reaction or during a nucleic acid denaturation reaction. The fluorescence intensity value of the reaction system in which the denaturation reaction is completed and the fluorescence intensity value of the reaction system when the target nucleic acid or amplified target nucleic acid is hybridized with the nucleic acid probe are measured, and the fluorescence intensity value from the former is decreased. A method for measuring the concentration of a target nucleic acid amplified by PCR, comprising calculating a ratio. 36. The PCR method according to claim 4 or 7,
Perform a reaction using the nucleic acid probe described in the primer,
Measure the fluorescence intensity value of the reaction system when the probe and the target nucleic acid or the amplification target nucleic acid are not hybridized and the reaction system when the nucleic acid probe is hybridized with the target nucleic acid or the amplification target nucleic acid, A method for measuring the concentration of a target nucleic acid amplified by PCR, comprising calculating the former rate of decrease in fluorescence intensity value. 37. The PCR method is a real-time quantitative PC.
The method for measuring the concentration of a target amplified nucleic acid in the PCR method according to claim 35 or 36, which is an R method. 38. The method according to any one of claims 1, 13 to 19,
Alternatively, in the method for analyzing data obtained by the nucleic acid measurement method according to any one of claims 32 to 37, the fluorescence intensity of the reaction system after the target nucleic acid hybridizes with a nucleic acid probe labeled with a fluorescent dye. A data analysis method for a method for measuring a concentration of a target nucleic acid, wherein the value is corrected by a fluorescence intensity value of a reaction system obtained after dissociation of a probe-nucleic acid hybrid complex thus formed. 39. The method for analyzing data obtained by the real-time quantitative PCR method according to claim 37, wherein the amplified nucleic acid in each cycle is combined with a fluorescent dye, or the amplified nucleic acid is labeled with a fluorescent dye. The fluorescence intensity value of the reaction system after hybridization with the nucleic acid probe thus obtained is determined by the fluorescent dye-nucleic acid complex formed in each cycle or the probe thus formed.
Data analysis for a real-time quantitative PCR method, comprising an arithmetic processing step for correcting with a fluorescence intensity value of a reaction system obtained after dissociation of a nucleic acid hybrid complex (hereinafter referred to as a correction arithmetic processing step). Method. 40. The data analysis method for a real-time quantitative PCR method according to claim 39, wherein the correction operation processing step according to claim 39 is based on the following [Equation 1] or [Equation 2]. f _n = f _{hyb, n} / f _{den, n} [Formula 1] f _n = f _{den, n} / f _{hyb, n} [Formula 2] [where, f _n : calculated by [Formula 1] or [Formula 2] F _{hyb, n} : after the amplified nucleic acid binds to the fluorescent dye or after the amplified nucleic acid hybridizes with the nucleic acid probe labeled with the fluorescent dye in the nth cycle Fluorescence intensity value of the reaction system, f _{den, n} : fluorescence intensity value of the reaction system after dissociation of the formed fluorescent dye-nucleic acid complex or formed probe-nucleic acid hybrid complex in the nth cycle] 41. The method according to claim 40, wherein the data obtained by the real-time quantitative PCR method according to claim 37 is analyzed, wherein the correction operation calculated by [Equation 1] or [Equation 2] in each cycle. A real-time quantitative PCR method characterized by substituting the processing value into the following [Equation 3] or [Equation 4], calculating a fluorescence change ratio or a fluorescence change ratio between samples in each cycle, and comparing the calculated values. Data analysis method for F _n = f _n / f _a [Equation 3] F _n = f _a / f _n [Equation 4] wherein, F _n: the n th cycle, calculated by [Equation 3] or [Equation 4] Fluorescence change rate or fluorescence change rate, f _n: correction processing value by [equation 1] or [equation 2] f _a: correction processing value by [equation 1] or [equation 2], the change in f _n is observed Any number of cycles before 42. The method according to claim 41, wherein the data obtained by the real-time quantitative PCR method according to claim 37 is analyzed. 1) The change in fluorescence calculated by [Equation 3] or [Equation 4]. Using the data of the ratio or the rate of change in fluorescence, a process of performing an arithmetic processing by [Equation 5], [Equation 6] or [Equation 7], log _b (F _n ), ln (F _n ) [Equation 5] log _b ｛ (1-F _n ) × A｝, ln ｛(1-F _n ) × A｝ [Formula 6] log _b ｛(F _n -1) × A｝, ln ｛(F _n -1) × A｝ [ [Formula 7] [where, A and b: arbitrary numerical values, _Fn : the ratio of change in fluorescence or the ratio of change in fluorescence in the nth cycle calculated by [Formula 3] or [Formula 4]], 2) the above 1) An arithmetic processing step for calculating the number of cycles in which the arithmetic processing value has reached a certain value; And 4) an arithmetic processing step of calculating the relational expression between the cycle number of the nucleic acid sample and the copy number of the target nucleic acid at the start of the reaction, and 4) an arithmetic processing step of calculating the copy number of the target nucleic acid at the start of the PCR in the unknown sample. A data analysis method for a real-time quantitative PCR method characterized. 43. Performing PCR on the target nucleic acid using the nucleic acid probe according to any one of claims 2 to 12,
A method for analyzing a melting curve of a target nucleic acid, wherein the melting curve of a target nucleic acid is analyzed to determine a Tm value of each amplified nucleic acid. 44. The target nucleic acid is subjected to PCR using the nucleic acid probe according to claim 4 or 7 as a primer, and the melting curve of the target nucleic acid is analyzed to determine the T of each amplified nucleic acid.
A method for analyzing a melting curve of a target nucleic acid, which comprises calculating an m value. 45. The data analysis method for a real-time quantitative PCR method according to any one of claims 39 to 42, wherein the nucleic acid amplified by the PCR method is cooled from a low temperature until the nucleic acid is completely denatured. A process of gradually increasing the temperature, a process of measuring the fluorescence intensity at predetermined time intervals in this process, a process of displaying the measurement result on the display as a function of time and drawing a melting curve of the nucleic acid on the display, The value obtained by differentiating the curve (−dF /
dT, F: fluorescence intensity, T: time), a process of displaying the differentiated value as a differential value on a display, and a process of obtaining an inflection point from the differential value. Data analysis method for PCR method. 46. A data analyzing method according to claim 39, a data analyzing method according to claim 40, and a data analyzing method according to claim 41. A real-time processing means for performing a step of performing data analysis, a step of analyzing data by the data analysis method according to claim 42, and a step of analyzing data by the data analysis method according to claim 45. An apparatus for measuring and / or analyzing quantitative PCR. 47. A data analysis method according to claim 39, a data analysis method according to claim 40, and a data analysis method according to claim 41. A computer-readable program that records, as a program, a procedure for causing a computer to execute a step of performing data, a step of analyzing data by the data analysis method according to claim 42, and a step of analyzing data by the data analysis method according to claim 45. Possible recording medium. 48. The method for quantifying a nucleic acid according to claim 39, wherein
42. Real-time quantitative P according to any one of items 42 and 45
A method for quantifying a nucleic acid, comprising utilizing a data analysis method for a CR method. 49. A method for quantifying a nucleic acid, wherein the method according to claim 46 is used in a method for quantifying a nucleic acid. 50. A method for quantifying a nucleic acid, comprising using the computer-readable recording medium according to claim 47.