JPH11332600A - Oligonucleotide for detecting enteropathogenic escherichia colt 0157 and detection using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new oligonucleotide chemically synthesized by using a gene of an O antigenic synthetic region of enteropathogenic Escherichia coli O157 which is a causative bacterium of diseases caused by enterohenorrhagic Escherichia coli and present in a specimen as a target and capable of rapidly and simply detecting the 0157 with a high sensitivity. SOLUTION: This new oligonucleotide comprises an oligonucleotide, etc., chemically synthesized by using a nucleotide sequence encoding an O antigenic synthetic region of enteropathogenic Escherichia coli O157 which is a main causative bacterium of diseases caused by enterohemorrhagic Escherichia coli and present in a specimen as a target so as to be complementary to the nucleotide sequence thereof and containing sequences represented by formulae I to IV or at least >=10 contiguous bases of the corresponding complementary sequence and is useful for a simple and rapid detection method, etc., for the O157 with a high sensitivity in tests on food poisoning and diarrhea. The oligonucleotide is obtained by selecting an O157-specific sequence in the sequence of the enteropathogenic Escherichia coli O157 and chemically synthesizing the oligonucleotide.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to the detection of the O antigen synthesis region gene of pathogenic Escherichia coli O157 in clinical tests, especially in food poisoning tests or diarrhea tests.

[0002]

2. Description of the Related Art Pathogenic Escherichia coli O157 has been recognized not only as a food poisoning symptom typified by hemorrhagic colitis, but also as a causative organism of hemolytic uremic syndrome in children. In testing, the importance of detection of this bacterium is increasing.

[0003] In tests involving pathogenic Escherichia coli O157,
The test material is feces, food, or water (drinking water, river water, etc.) collected from the patient's surrounding environment. In order to detect and identify pathogenic Escherichia coli O157 from these specimens, it is necessary to perform an operation from direct isolation culture, primary confirmation culture test, secondary confirmation culture test to antiserum agglutination test. However, the required time at each stage of these cultures is 18 to 24 hours, respectively, and the total required time is 3 to 4 days, which is a very long time. Therefore, the current method for testing bacteria causing enterohemorrhagic colibacillosis lacks speed and simplicity and cannot be an effective means. On the other hand, as a serotype of pathogenic Escherichia coli causing hemorrhagic colitis, O157: H7 is typical, and it is clear that the serotype accounts for 80% or more of enterohemorrhagic Escherichia coli.

[0004]

DISCLOSURE OF THE INVENTION The present invention detects a gene of the O antigen synthesizing region of pathogenic Escherichia coli O157 by a gene amplification technique in which an oligonucleotide functions as a primer for a nucleic acid synthesis reaction. The object of the present invention is to provide a simple, rapid and highly sensitive test method for pathogenic E. coli, especially enterohemorrhagic E.coli, which causes severe symptoms in tests for diarrhea.

[0005]

According to the present invention, an oligonucleotide is prepared which hybridizes selectively with the O antigen synthesis region gene of pathogenic Escherichia coli O157, and this oligonucleotide is used as a primer for gene amplification.
As a result, among Escherichia coli, O1
It is characterized by selectively detecting only bacteria having 57 serotypes.

[0006] Here, the primer is a pathogenic Escherichia coli O, which is the main causative agent of enterohemorrhagic E. coli present in the specimen.
An oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence encoding the 157 O antigen synthesis region gene, wherein the synthetic nucleotide has the following sequence: (5 ′) d-ATCATTGCGATTGTAGCACC -(3 ') ... (SEQ ID NO: 1; a) (5') d-GTATTTGGAGACATGGGAGC- (3 ') ... (SEQ ID NO: 2; b) (5') d-ACATGAGGAGCATTAACTTCG- (3 ') (SEQ ID NO: 3; c) (5 ′) d-ACTAATGACACGATTCGTTCC- (3 ′) (SEQ ID NO: 4; d) or a corresponding complementary sequence.

[0007] Gene amplification is carried out by Polymer developed by Saiki et al.
ase Chain Reaction method (hereinafter abbreviated as PCR method; Scie
nce 230, 1350 (1985)). In this method, when detecting a specific nucleotide sequence region (in the case of the present invention, the O antigen synthesis region gene of pathogenic Escherichia coli O157), one of both ends of the region has a positive strand and the other has a negative strand. An oligonucleotide capable of recognizing and hybridizing was prepared, and a single-stranded sample nucleic acid was denatured by heat denaturation to function as a primer for a template-dependent nucleotide polymerization reaction.
The single-stranded nucleic acid is again separated into single-stranded, and a similar reaction is caused again. By repeating this series of operations, the copy number of the region between the two primers increases until it can be detected.

The specimen may be a clinical test material such as feces, urine, blood, tissue homogenate, or a food material. In order to use these materials as PCR samples, an operation of releasing nucleic acid components from cells present in the materials is required as pretreatment. However, if the nucleic acid to which the primer can hybridize is present from several molecules to several tens of nucleons or more, the PCR will proceed. A sample solution having a nucleic acid amount can be prepared.

The oligonucleotide used as a primer in the present invention is a nucleotide fragment having a length of 10 bases or more, preferably 15 bases or more in consideration of selectivity, detection sensitivity and reproducibility. either will do. In addition, the primer may or may not be particularly labeled for detection. The amplification region in the nucleotide sequence of the O antigen synthesis region gene of pathogenic Escherichia coli O157 defined by the primer is 50 to 2,000 bases, preferably 100 to 1,000 bases.
What is necessary is just to become a base.

[0010] A heat-resistant DNA polymerase is used in the template-dependent nucleotide polymerization reaction, and the origin of this enzyme may be derived from any species as long as the activity is maintained at a temperature of 90 to 95 ° C. . Heat denaturation temperature is 90 ~
95 ° C, the temperature of the annealing operation for hybridizing the primer is 37-65 ° C, and the polymerization reaction is 50-7.
At 5 ° C., PCR was carried out from 20 to 4
Perform 2 cycles to amplify.

For the detection, the presence of the amplified nucleotide fragment and its length can be confirmed by directly subjecting the reaction solution after PCR to agarose gel electrophoresis. From the result, it can be determined whether or not a nucleotide having a sequence to be recognized by the primer exists in the sample. This determination directly determines the presence or absence of Escherichia coli having the O157 antigen synthesis region gene. Other electrophoresis and chromatography are also effective for detecting the amplified nucleotide fragment. Alternatively, an oligonucleotide having one of the above primers may function as a probe to selectively detect a target nucleotide sequence on a membrane or on another support.

[0012]

EXAMPLES (Example 1) Preparation of specimen Enterohemorrhagic Escherichia coli (hereinafter referred to as EHEC) used
Was derived from patients and the like, and totaled 347 strains. Each strain was inoculated into LB medium (1% tryptone, 0.5% yeast extract, and 1% sodium chloride), and cultured under shaking at 37 ° C under aerobic conditions overnight. The culture solution of each strain was adjusted to 10 mM Tris-HCl buffer pH
After diluting 10-fold with 7.5 (hereinafter referred to as TE buffer) and performing a heat treatment at 95 ° C. for 10 minutes, these were centrifuged and the supernatant was used as a sample.

[0013] From O-antigen combining region gene of the nucleotide sequence of the synthetic pathogenic E. coli O157 primers (Shimizu, K., Et al.), To select the respective sequences are shown in one of claims, chemical oligonucleotides thereof and homologous sequences Synthesized. Chemical synthesis was performed by the β-cyanoethylphosphoramidite method. Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

PCR Use 3 μl of the sample solution and add 17.05 sterile distilled water to it.
μl, 3 μl of 10x reaction buffer, dNTP solution 4.8
μl, primer (1) 1.0 μl, primer (2) 1.0 μl
and 0.15 μl of a thermostable DNA polymerase were added to prepare a reaction solution having a total volume of 30 μl. 50 μl of mineral oil (manufactured by SIGMA) is added to the container containing the reaction solution.
In addition, a layer was formed on the reaction solution. The contents of each used solution and the combinations of the primers (1) and (2) are as follows.

10x reaction buffer: 500mM KCl, 100mM Tris
-HCl pH8.3, 15mM magnesium chloride, 0.1% (w / V) gelatin dNTP solution: A mixture of dATP, dCTP, dGTP, dTTP, each having a final concentration of 1.25mM Primer (1) and (2) Aqueous solution of purified chemically synthesized product (concentration 3.75 OD / ml) Combination of primers: The above-mentioned chemically synthesized product was used in combination.

Primer (1) + Primer (2) (a) + (c) (b) + (d) Thermostable DNA polymerase: Taq DNA polymerase (5 units / ml; manufactured by PerkinElmer Cetus) The reaction conditions are as follows: It is as follows. Thermal denaturation: 94 ° C, 1 minute Annealing: 55 ° C, 1 minute Polymerization reaction: 72 ° C, 1 minute The process from heat denaturation to annealing to the polymerization reaction is defined as one cycle (the required time is 5.7 minutes). Was performed for 35 cycles (total required time: about 3 hours). These operations are
The above reaction conditions were programmed into an NA thermal cycler (Perkin Elmer Cetus) and performed.

In order to detect the amplified nucleotide fragment from the detection reaction solution, agarose gel electrophoresis was performed as follows. The agarose gel used had a gel concentration of 3% (W / V) and contained ethidium bromide (0.5 μl / ml). The electrophoresis was performed at a constant voltage of 100 V for 30 minutes. The operating method and other conditions are described in Maniatis et al., Molecular Cloning 2nd edition (1.
989). In addition to the reaction solution, electrophoresis of a molecular weight marker was performed at the same time, and the length of the nucleotide fragment was calculated by comparing the relative mobilities.

Agglutination Test with Anti-O157 Serum Whether or not the O antigen of the strain used was O157 was examined by a bacterial agglutination test using a commercially available anti-O157 serum (manufactured by Denka Seiken). The details of the agglutination test were based on the instructions attached to the antiserum. Results As described above, the nucleotide sequence of the O antigen synthesis region gene of pathogenic Escherichia coli O157 has already been determined, and the size of the oligonucleotide of the present invention, that is, the nucleotide to be amplified by the primer by PCR can be easily estimated. According to the results, the combination of primers (a) and (c)
A nucleotide of length 05 bases (or 305 base pairs) should be amplified, and the combination of primers (b) and (d) would amplify 457 (or 457 base pairs) nucleotides. When the lengths of these estimated values and the actually amplified nucleotides match, the combination of the primers correctly amplifies the target region in the O antigen synthesis region gene, and the strain is E. coli O157. Was determined to have a specific O antigen synthesis region gene. Table 1 shows the results of the tests performed on the test strain 347 strains. The combination of each primer was used to amplify only the DNA of the strain whose serotype was determined to be O157 in an agglutination test using anti-O157 serum, and to amplify the strain DN having a serotype other than O157.
It did not react with A at all. That is, E. coli O157
Shows that the O antigen synthesizing region gene was correctly amplified and enterohemorrhagic Escherichia coli, which is a serotype of O157, was correctly detected.

[0019]

[Table 1-1]

[0020]

[Table 1-2]

[0021]

[Table 1-3]

[0022]

[Table 1-4] (Example 2) Diarrhea other than enterohemorrhagic Escherichia coli to be tested in clinical tests to confirm whether the results obtained in Example 1 are selective for Escherichia coli having the O157 antigen. It was examined whether the primers of the present invention react with genes such as bacteria. The method is the same as that shown in Example 1 except for the method of preparing the sample.

Preparation of Specimens Each of the strains shown in Table 2 was inoculated into an appropriate enrichment medium, and cultured overnight at 37 ° C. under aerobic or anaerobic conditions (anaerobic conditions among them) The strain grown below is Cl
ostridium perfringens , Campylobacter jejuni , Bacte
roides fragili s , Bacteroides vulgatus , and Lacto
bacillus acidophilus ). 0.5m of each strain culture
The cells were recovered from the cells by centrifugation and washed once with a TE buffer. Add 50 mM phosphate buffer p
The final concentration of each of the N-acetylmuraminidase solution and the achromopeptidase solution dissolved in H7.5 was 50 μg /
ml and 1 mg / ml.
And lysed. A mixture of phenol and chloroform (1: 1 mixing ratio) saturated with a TE buffer was added to the lysate, followed by thorough stirring. After centrifugation,
The upper layer solution was recovered and treated with ethanol to precipitate nucleic acid components. The precipitate was dissolved in 1 ml of a TE buffer to obtain a sample. In addition, human placenta-derived DNA (Human plac
Enta DNA) was prepared at a concentration of 1 μg / ml and subjected to PCR in the same manner.

Results Table 2 shows the test results for some combinations of primers. All combinations of primers in the table are for diarrhea bacillus DN
For various DNAs including A, their DNs
A did not amplify. Therefore, it can be said that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the bacteria having the VT2 gene. When the agarose gel electrophoresis method used in the examples of the present invention is performed under the above conditions, if the nucleotide has a length of 100 bases (or 100 base pairs) or less, 5
To 10 bases (base pairs), or 10 to 2 nucleotides in the range of 100 to 500 bases (base pairs).
Differences in nucleotide length of 0 bases (base pairs) can be distinguished. Furthermore, by using acrylamide or the like for the gel material, the measurement accuracy of nucleotide length can be improved, and the reliability in the selective detection of the O antigen synthesis region gene is considered to be further increased.

[0025]

[Table 2]

[0026]

According to the present invention, the use of the PCR method and the use of primers targeting the O antigen synthesis region gene of pathogenic Escherichia coli O157, which is a major causative agent of enterohemorrhagic Escherichia coli, In the detection of bacteria having the O157 antigen, high detection sensitivity due to gene amplification and
High selectivity is obtained by defining the reaction with two or more primers. Further, since the detection sensitivity is high, a large amount of the sample is not required, and the pretreatment of the sample can be simplified. In the example of the present invention, the reaction time was 3 hours, and the operation required for the detection was 30 minutes. Furthermore, by using agarose gel electrophoresis and nucleic acid staining with ethidium bromide for detection, detection can be performed without labeling primers or the like. Moreover, since the length of the amplified nucleotide can be confirmed, the reliability of the test result is high.

The examination for enterohemorrhagic Escherichia coli requires accurate results without delay in order to promptly and appropriately treat the detected patients and to take preventive measures. The present invention also relates to the pathogenic Escherichia coli O157, which is a major causative agent of enterohemorrhagic Escherichia coli.
For selectively detecting the genes of the sugar chain antigens constituting a part of the bacterial cells of the present invention. Therefore, according to the present invention, it is possible to quickly and accurately detect and determine the causative bacteria of enterohemorrhagic Escherichia coli.

[0028]

[Sequence list] SEQ ID NO: 1 Sequence length 21 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Characteristic method Method of determining characteristics S sequence ATCATTGCGATTGTAGCACC

Sequence number (SEQ ID NO); 2 Sequence length 20 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features Method of determining features S Sequence GTATTTGGAGACATGGGAGC

SEQ ID NO: 3 Sequence length 21 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features Method for determining features S Sequence ACATGAGGAGCATTAACTTCG

SEQ ID NO: 4 Sequence length 21 bases Sequence type Number of nucleic acid strands Single strand Topology Linear Sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features Method of determining features S Sequence ACTAATGACACGATTCGTTCC

Continued on the front page (51) Int.Cl. ⁶ Identification symbol FI (C12Q 1/10 C12R 1:19)

Claims (2)

[Claims] Claims 1. A nucleotide sequence encoding the O antigen synthesis region gene of pathogenic Escherichia coli O157, which is the main causative agent of enterohemorrhagic Escherichia coli present in a specimen,
An oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence, wherein the synthetic nucleotide has the following sequence: (5 ′) d-ATCATTGACGATGTGTAGCACC- (3 ′) (SEQ ID NO: 1; a) ( 5 ′) d-GTATTTGGAGACATGGGAGC- (3 ′) (SEQ ID NO: 2; b) (5 ′) d-ACATGAGGAGCATTAACTTCG- (3 ′) (SEQ ID NO: 3; c) (5 ′) d-ACTAATGACACGATTCGTTCC -(3 ') ... (SEQ ID NO: 4; d) or an oligonucleotide comprising at least 10 consecutive nucleotides or more of a corresponding complementary sequence. 2. The method according to claim 1, wherein an oligonucleotide having at least one of the sequences described in claim 1 functions as a primer for a chain length reaction to selectively amplify a target nucleotide sequence. (1) a primer is hybridized to a target nucleotide sequence in a single-stranded state in a sample, and a chain length reaction is carried out by a polymerization reaction of four nucleotides; (2) the obtained double-stranded When the target nucleotide sequence is separated into single strands, the complementary strand functions as a template for a chain length reaction with the other primer. (3) The specific nucleotide sequence is repeated by repeating the hybridization with these two primers. Is amplified, and the nucleotide fragment amplified by electrophoresis or chromatography is detected. (4) As a result, Pathogenic E. coli by determining whether sequences should be recognized throughout the body is present O1
A method comprising detecting 57C.