JPH07102158B2 - Oligonucleotide for detection of toxigenic Escherichia coli and detection method using the same - Google Patents

Description

Detailed Description of the Invention

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a clinical test, particularly a test for food poisoning, or the detection of Sth and / or STp producing toxogenic E. coli in a food test.

[0002]

2. Description of the Related Art When the test material is vomiting, feces, food or wipes of a patient, first, before the toxogenic E. coli producing STh or STp is detected and identified,
It is necessary to perform pure culture and confirmation culture through enrichment culture, separation culture. In addition, serological tests, biochemical tests,
And enterotoxin production test is carried out, and it is identified as a toxigenic Escherichia coli which produces a thermostable enterotoxin for the first time.

[0003]

However, the time required for each culture step is 18 to 24 hours, and the total time required for the subsequent tests requires a long time of one week or more. The only method for testing the production of thermostable enterotoxin is the milk-only mouse method, which includes 2
A mouse for 3 days must be prepared, and the operation is complicated and requires skill. In addition, there is a point that reproducibility and reliability are lacking, such as the need to test using three or more mice and obtain the average value thereof.

On the other hand, recently, a DNA probe method using an oligonucleotide or a hybridization method has been tried. However, it is difficult to obtain sufficient detection sensitivity and selectivity in a bacterial test when hybridization is carried out on a membrane or on another support by using a probe labeled with an oligonucleotide and detected.

Therefore, the present invention employs a gene amplification technique in which an oligonucleotide is made to function as a primer for a nucleic acid synthesis reaction to produce STH or ST derived from toxigenic E. coli.
The purpose of the present invention is to provide a simple, rapid, and highly sensitive test method for detecting the p gene in a food poisoning test or a diarrhea test.

[0006]

[Means for Solving the Problems] The present invention provides an oligonucleotide that selectively hybridizes with the STh and / or STp gene of toxin-producing Escherichia coli, and uses this oligonucleotide as a primer for gene amplification to obtain food poisoning symptoms. Sth or ST among pathogenic Escherichia coli
It is characterized by selectively detecting only the toxin-producing Escherichia coli producing p.

When the nucleotide sequence encoding the STh gene is targeted, the oligonucleotide used as a primer is an oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence. Group, (5 ') d-TGTAATTTTCTCTTTTGAAGACTC- (3') .... (a: SEQ ID NO: 1) (5 ') d-ATTACAACACAGTTCACAGCAG- (3') .... (b: SEQ ID NO: 2) or corresponding It is characterized in that it consists of a complementary sequence.
For example, (5 ') d-GAGTCTTCAAAAGAGAAAATTACA- (3') .... (a ') can be mentioned as the complementary strand of (a) .

When the nucleotide sequence encoding the STh gene is targeted, it is an oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence, and the synthetic nucleotide has the following sequence group (5 ' ) D-CCTCAGGATGTCTAAACCAG- (3 ') ... (c: sequence number 3) (5') d-AGGATGCTAAACAGTAGAG- (3 ') ... (d: sequence number 4) (5') d-AATTCACAGCAGTAATTGCTAC -(3 ') ... (E: SEQ ID NO: 5) or a corresponding complementary sequence.

Furthermore, when the nucleotide sequence encoding the STp gene is targeted, it is an oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence, and the synthetic nucleotide is the following sequence group (5 ' ) D-TCTTTCCCCTCTTTTAGTCAG- (3 ′) ··· (f: SEQ ID NO: 6) (5 ′) d-GTCAACTGAATCACTTGACTC- (3 ′) ··· (g: SEQ ID NO: 7) (5 ′) d-TCACAGCAGTAAAATGTGTTTG -(3 ') ... (h: SEQ ID NO: 8) or a corresponding complementary sequence.

Here, the gene amplification is carried out by the Polymerase Chain Reaction method developed by Saiki et al.
Law; Science 230 1350 (1985)). When detecting a specific nucleotide sequence region (STh gene or STp gene of toxigenic Escherichia coli in the present invention), one of the ends of the region has a + strand and the other has a − strand, respectively. Prepare an oligonucleotide that recognizes and hybridizes. The sample nucleic acid, which has been converted into a single-stranded state by heat denaturation, functions as a primer for a template-dependent nucleotide polymerization reaction, separates the generated double-stranded nucleic acid into a single strand, and causes the same reaction again. . By repeating this series of operations, the copy number of the region sandwiched between the two primers increases until it can be detected.

The sample may be a clinical test material such as feces, urine, blood, tissue homogenate, or food material. In order to use these materials as a PCR sample, an operation of releasing the nucleic acid component from the bacterial cells present in the material is required as a pretreatment. However, if the nucleic acid to which the primer can hybridize is present from several molecules to several tens of molecules or more, PCR will proceed. Therefore, simply treating the test material with a lytic enzyme, a surfactant, an alkali, etc. for a short time is sufficient for the PCR to proceed. A sample solution containing a large amount of nucleic acid can be prepared.

The above-mentioned oligonucleotide used as a primer in the present invention is a nucleotide fragment having a length of 10 bases or more, preferably 15 bases or more, in view of selectivity, detection sensitivity, and reproducibility. Either can be used. Further, the primer does not have to be labeled particularly for detection. The amplified region in the nucleotide sequence of the Sth or STp gene of toxin-producing Escherichia coli defined by the primer is 50 to 2,000 bases, preferably 100 to 1,000 bases.
It should be a base.

A thermostable DNA polymerase is used for the template-dependent nucleotide polymerization reaction, but the origin of this enzyme may be derived from any species as long as it retains the activity at a temperature of 90 to 95 ° C. Thermal denaturation temperature is 90-95
℃, the temperature of the annealing operation to hybridize the primer is 37 ~ 65 ℃, the polymerization reaction is 50 ~ 75 ℃,
20 to 42 cycles of PCR in which the operation from the heat denaturation to the polymerization reaction is one cycle are performed to amplify the STh or STp gene contained in the sample.

For detection, the presence of the amplified nucleotide fragment and its length can be confirmed by subjecting the reaction solution after the PCR to agarose gel electrophoresis as it is.

From the result, it can be judged whether or not the sample has a nucleotide having a sequence to be recognized by the primer. This determination directly determines the presence or absence of pathogenic Escherichia coli having the STh or STp gene. Other electrophoresis and chromatography are also effective for detecting the amplified nucleotide fragment. Also,
An oligonucleotide having one of the above sequences (a) to (h) may function as a probe to selectively detect the target nucleotide sequence on the membrane or other support. In this case, the oligonucleotide is preferably modified with a label.

[0016]

The present invention detects a specific gene of toxigenic Escherichia coli by a gene amplification technique in which an oligonucleotide functions as a primer for a nucleic acid synthesis reaction, and can be detected simply, rapidly and with high sensitivity.

[0017]

[Example] [Example 1: STh of toxigenic Escherichia coli,
The STp heritage detection of gene] (Experimental Example 1) pathogenic E. coli isolated from prepared diarrhea patients analytes using total 492 strains shown in longitudinal heading table 1-22, the respective strains suitable increase The bacterial medium was inoculated and cultured overnight at 37 ° C. under aerobic conditions. Each strain culture solution was diluted with 10 mM Tris-hydrochloric acid buffer pH 7.5 (hereinafter TE buffer), and the temperature was 95 ° C.
After heat treatment for 10 minutes at 10 ° C., these were centrifuged and the supernatant was used as a sample.

Primer Synthesis Nucleotide sequence of STh or STp gene of toxigenic Escherichia coli (Moseley, SL, et al., Infect. Immun. 39, 1167-1174)
(1983)), the sequences ((a) and (b)) shown in claim 1 were selected, and an oligonucleotide having the same sequence was chemically synthesized. Cyclone Plus DN for chemical synthesis
This was carried out by the β-cyanoethylphosphoramidite method using an A synthesizer (Milligen / Bioresearch). Purification of the synthesized oligonucleotide was performed by high performance liquid chromatography using a C18 reverse phase column.

PCR Using 3 μl of the above-mentioned sample liquid, sterile distilled water 16.05
μl, 10 × reaction buffer 3 μl, dNTP solution 4.8
μl, primer (1) 1.5 μl, primer (2) 1.
5 μl, and thermostable DNA polymerase 0.15 μl
Was added to prepare a reaction solution having a total volume of 30 μl. 50 containers of mineral oil (SIGMA) in this reaction solution
μl was added and overlaid on the reaction solution.

Content of each used solution and primer
The combination of (1) and (2) is as follows. 10X reaction buffer: 500 mM KCl, 100 mM Tris-HCl pH8.3, 15 mM MgCl
2 0.1% (W / V) Gelatin dNTP solution: A mixture of dATP, dCTP, dGTP and dTTP with a final concentration of 1.25 mM Primers (1) and (2): Each aqueous solution of the aforementioned chemically synthesized product ( Concentration 50D / ml) Combination of primers: primer (1); sequence (a ') primer (2); sequence (b) Thermostable DNA polymerase: Taq DNA polymerase (5 unit / ml; manufactured by PerkinElmer Cetus).

The reaction conditions are as follows. Thermal denaturation: 94 ° C, 1 minute Annealing: 55 ° C, 1 minute Polymerization reaction: 72 ° C, 1 minute The process from thermal denaturation to annealing to polymerization reaction is 1
A cycle (required time: 5.7 minutes) was used, and this was performed for 35 cycles (total required time: about 3 hours). These operations are DN
A thermal cycler (manufactured by Perkin Elmer Cetus) was programmed with the above reaction conditions.

In order to detect the amplified nucleotide fragment from the detection reaction solution, agarose gel electrophoresis was performed as follows.

The agarose gel had a gel concentration of 3% (W / V) and contained ethidium bromide (0.5 μg / ml ).
The electrophoresis conditions were constant voltage of 100 V and 30 minutes. The operating method and other conditions are described by Maniatis et al. In Molecular Cloning.
The technique described in the second edition (1989) was used. In addition to the reaction solution, a molecular weight marker was also electrophoresed at the same time, and the length of the nucleotide fragment was calculated by comparing the relative mobilities.

Results As described above, STh or ST of toxigenic E. coli
The base sequence of the p gene has already been determined, and the size of the oligonucleotide of the present invention, that is, the nucleotide amplified by the primer by PCR, can be easily estimated. According to this, when the combination of the primers (a) and (b) is used, nucleotides having a length of 120 bases should be amplified. If these estimates match the length of the amplified nucleotides, each primer is
It was determined that the target region of h or STp gene was correctly amplified, and "+" was entered in Tables 1 to 22. On the other hand, "-" was entered for those in which amplification of nucleotides was not observed.

Tables 1 to 22 show the results of examination with the pathogenic Escherichia coli 492 strain. As can be seen from Tables 1 to 22, the primers used were Sth or STp among pathogenic Escherichia coli.
It shows that only the bacteria confirmed by the colony hybridization method with the gene are correctly detected.

Experimental Example 2 The result obtained in Experimental Example 1 is S
Against pathogenic E. coli with Th or STp gene,
In order to confirm whether it is selective, diarrhea bacteria, etc., which are the test targets other than pathogenic E. coli, were compared and examined in clinical tests. The method is Experimental Example 1 except for the sample preparation method.
Is the same as that shown in.

[0027]Sample preparation Contact each strain in Tables 23 to 25 with an appropriate enrichment medium.
Seed and culture overnight at 37 ° C under aerobic or anaerobic conditions
The strains cultured under anaerobic conditions were
InClostridium perfringens,Campylobacter jejun
i,Bacteroides flagilis,Bacteroides vulgatus, And
AndLactobacillus acidophilusIs).

The bacterial cells were collected from 0.5 ml of each strain culture medium by centrifugation and washed once with TE buffer.
N-acetylmuramidase solution and achromopeptidase solution dissolved in 50 mM phosphate buffer pH 7.5 were added to the cells at final concentration of 50 μg / ml and 1 mg.
/ Ml, and treated at 37 ° C for 10 minutes to lyse the cells. A mixed solution (mixing ratio 1: 1) consisting of phenol and chloroform saturated with TE buffer was added to the lysate and stirred well.

After centrifugation, the upper layer liquid was collected and treated with ethanol to precipitate nucleic acid components. 1 ml of this precipitate
The sample was dissolved in the TE buffer solution. In addition, human placenta-derived DNA (Human placenta DNA) was prepared at a concentration of 1 μg / ml, and PCR was performed in the same manner.

Results As shown in Tables 23 to 25, the primers used did not amplify any of various DNAs including diarrhea bacterium DNA. Therefore, it can be asserted that the oligonucleotide of the present invention, that is, the primer, selectively reacts only with the pathogenic E. coli having the STh or STp gene.

When the agarose gel electrophoresis used in the examples of the present invention is carried out under the above-mentioned conditions, 5 to 10 base pairs or 100 to 500 base pairs of nucleotides of 100 base pairs or less are obtained. Within the range of nucleotides, differences in nucleotide length of 10 to 20 base pairs can be distinguished.

Furthermore, by using acrylamide or the like as the gel material, the accuracy of measuring the length of nucleotides can be improved, and the reliability in the selective detection of STh or STp gene is considered to be further increased. Example 2: Detection of STh gene of toxigenic Escherichia coli ] (Experimental example 1) Preparation of sample A sample was prepared in the same manner as in Example 1.

Primer Synthesis Toxogenic Escherichia coli STh gene nucleotide sequence (Moseley,
SL, et al, Infect.Immun. 39, 1167-1174 (1983))
From the sequences ((c), (d), and (e) shown in claim 2)
) Was selected and an oligonucleotide having the same sequence as that was chemically synthesized. The chemical synthesis and the purification of the synthesized oligonucleotide were performed in the same manner as in Example 1.

The same procedure as in Example 1 was carried out except that the following combinations of PCR primers were used.

Primer (1) Primer (2) (c) (e) (d) (e) Detection The same procedure as in Example 1 was carried out.

Results As described above, the base sequence of the Sth gene of toxigenic Escherichia coli has already been determined, and the size of the oligonucleotide of the present invention, that is, the nucleotide amplified by the primer by PCR, can be easily estimated.

According to this, when the respective combinations of the primers (c) and (e) and (d) and (e) are used, respectively,
131 , 127 nucleotides in length should be amplified. When these estimated values and the lengths of the amplified nucleotides matched, it was judged that each primer correctly amplified the target region of the STh gene, and "+" was entered in Table 1. On the other hand, "-" was entered for those in which amplification of nucleotides was not observed. Table 1
22 to 22 show the results of examination with the pathogenic Escherichia coli 492 strain.

As can be seen from Tables 1 to 22, each of the two sets of primers shows that among the pathogenic E. coli, only the bacteria confirmed to have the STh gene by the colony hybridization method are correctly detected. .

Experimental Example 2 The result obtained in Experimental Example 1 is S
In order to confirm whether or not the pathogenic Escherichia coli having the Th gene is selective, the diarrheal bacteria and the like to be inspected other than the pathogenic Escherichia coli were compared and examined by the same method as in Example 1.

As shown in Tables 23 to 25, each set of primers did not amplify the DNA of all the various DNAs including the diarrhea bacterium DNA. Therefore, the oligonucleotide of the present invention, that is, the primer is used only for pathogenic E. coli having the STh gene,
It can be asserted that it reacts selectively.

Example 3: STp inheritance of toxigenic Escherichia coli
Detection of Offspring ] (Experimental Example 1) Preparation of Sample A sample was prepared in the same manner as in Example 1.

Primer Synthesis Toxogenic Escherichia coli STp gene nucleotide sequence (Moseley,
SL, et al, Infect.Immun. 39, 1167-1174 (1983))
From the sequences ((f), (g), and (h) shown in claim 3)
) Was selected and an oligonucleotide having the same sequence as that was chemically synthesized. The chemical synthesis and the purification of the synthesized oligonucleotide were performed in the same manner as in Example 1.

The same procedure as in Example 1 was carried out except that the following combinations of PCR primers were used.

Primer (1) Primer (2) (f) (h) (g) (h) Detection The same procedure as in Example 1 was carried out.

Results As described above, the nucleotide sequence of the STp gene of toxigenic Escherichia coli has already been determined, and the size of the oligonucleotide of the present invention, that is, the nucleotide amplified by the primer by PCR, can be easily estimated.

According to this, when each of the combinations of the primers (f) and (h) and (g) and (h) was used, it was 1
Nucleotides with a length of 43,123 bases should be amplified. If these estimated values and the length of the amplified nucleotides match, it is determined that each primer correctly amplifies the target region of the STh gene,
“+” Is entered in Tables 1 to 22. On the other hand, "-" was entered for those in which amplification of nucleotides was not observed. Table 1 shows the results of examination with the pathogenic Escherichia coli 492 strain.

As can be seen from Tables 1 to 22, each of the two sets of primers shows that among pathogenic E. coli, only the bacteria confirmed to have the STp gene by the colony hybridization method are correctly detected. .

Experimental Example 2 The result obtained in Experimental Example 1 is S
In order to confirm whether or not the pathogenic Escherichia coli having the Tp gene is selective, the diarrheal bacteria and the like to be inspected other than the pathogenic Escherichia coli in clinical tests were compared and examined by the same method as in Example 1.

As shown in Tables 23 to 25, the primers of each set did not amplify the DNA of all of various DNAs including the diarrhea bacteria DNA. Therefore, the oligonucleotide of the present invention, that is, the primer is used only for pathogenic E. coli having the STp gene,
It can be asserted that it reacts selectively.

[0050]

[Table 1]

[Table 2]

[Table 3]

[Table 4]

[Table 5]

[Table 6]

[Table 7]

[Table 8]

[Table 9]

[Table 10]

[Table 11]

[Table 12]

[Table 13]

[Table 14]

[Table 15]

[Table 16]

[Table 17]

[Table 18]

[Table 19]

[Table 20]

[Table 21]

[Table 22]

[Table 23]

[Table 24]

[Table 25]

[0051]

INDUSTRIAL APPLICABILITY In the present invention, the use of the PCR method and the use of a primer targeting the STh or STp gene, which is most closely associated with pathogenicity
In the detection of toxigenic E. coli having the h or STp gene, high detection sensitivity due to the gene amplification action and 2
High selectivity can be obtained by defining the reaction with one or more primers.

Further, since the detection sensitivity is high, a large amount of sample is not required and the pretreatment of the sample can be simplified. In the example of the present invention, the reaction time was 3 hours, and the operation required for detection was 3 hours.
It was 0 minutes. Furthermore, by using agarose gel electrophoresis and nucleic acid staining with ethidium bromide for detection,
Detection can be performed without labeling a primer or the like. Moreover, since the length of the amplified nucleic acid can be confirmed, the result is highly reliable.

Due to recent advances in bacteriology, various types of strains such as those having pathogenicity to humans and those having no pathogenicity to humans are included among those identified and classified as the same Escherichia coli. It has become clear that this is happening.

Therefore, when identifying Escherichia coli as a causative bacterium of food poisoning cases and diarrhea, accurate determination as a causative bacterium cannot be made unless it is examined whether or not the E. coli strain produces a pathogenic factor such as a toxin. It's gone. Therefore, the present invention selectively detects the gene of STh or STp, which is one of the Escherichia coli pathogenic factors in such a situation, and thus enables selective detection of pathogenic Escherichia coli.

[0055]

[Sequence Listing] SEQ ID NO: 1 Sequence length 24 bases Sequence type Number of nucleic acid strands Single-stranded topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Escherichia coli sequence Features of method of determining features S sequence TGTAATTTTCTCTTTTTGAAGACTC

SEQ ID NO: (SEQ ID NO); 2 Length of sequence 22 bases Type of sequence Number of nucleic acid strands Single-stranded topology Linear type of sequence Genomic DNA hypothetical sequence NO antisense NO Origin of Escherichia coli sequence CHARACTERISTICS METHOD FOR DETERMINING CHARACTERISTICS S SEQUENCE ATTACAACACAGTTTCACAGCAG

SEQ ID NO: (SEQ ID NO); 3 Sequence length 19 bases Sequence type Number of nucleic acid strand Single-stranded topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Escherichia coli sequence CHARACTERISTICS METHOD FOR DETERMINING CHARACTERISTICS S SEQUENCE CCTCAGGATGCTAAACCAG

SEQ ID NO: (SEQ ID NO); 4 Sequence length 20 bases Sequence type Number of nucleic acid strand Single-strand topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Escherichia coli sequence Features Method of determining features S Sequence AGGATGCTAAACCAGTAGAG

SEQ ID NO: (SEQ ID NO); 5 Sequence length 22 bases Sequence type Number of nucleic acid strand Single strand topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Escherichia coli sequence Features Method of determining features S Sequence AATTCACAGCAGTAATTGCTAC

SEQ ID NO: (SEQ ID NO); 6 Length of sequence 21 bases Sequence type Number of nucleic acid strand Single-stranded topology Linear type of sequence Genomic DNA hypothetical sequence NO antisense NO Origin of Escherichia coli sequence Feature Method of determining feature S Sequence TCTTTCCCCCTCTTTTAGTCAG

SEQ ID NO: (SEQ ID NO); 7 Sequence length 21 bases Sequence type Number of nucleic acid strand Single-stranded topology Linear sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features Method of determining features S Sequence GTCAACTGAATCACTTGACTC

SEQ ID NO: (SEQ ID NO); 8 Sequence length 21 bases Sequence type Number of nucleic acid strand Single-strand topology Linear sequence type Genomic DNA Hypothetical sequence NO Antisense NO Origin Escherichia coli sequence Features The method by which the features were determined S Sequence TCACAGCAGTAAAATGTGTTG

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI technical display location C12R 1:19) (72) Inventor Hiroko Ozaki 1 Kunihara, Nishinokyo Kuwahara-cho, Nakagyo-ku, Kyoto-shi, Kyoto Shimazu Co., Ltd. Factory Sanjo Factory (72) Inventor Naoyuki Nishimura 1 Nishinokyo Kuwabara-cho, Nakagyo-ku, Kyoto City, Kyoto Prefecture Shimazu Factory Sanjo Factory (56) Reference JP-A-4-44700 (JP, A)

Claims (5)

[Claims] 1. A toxigenic Escherichia coli (ente) present in a sample.
rotoxigenic Esherichia coli ) is an oligonucleotide chemically synthesized so as to be complementary to the nucleotide sequence encoding the enterotoxin gene of rotoxigenic Esherichia coli. An oligonucleotide comprising a complementary sequence. 2. A human thermostable enterotoxin of enterotoxigenic Escherichia coli (hereinafter referred to as STh gene) and a porcine thermostable enterotoxin (hereinafter referred to as ST
p gene) and synthetic nucleotides of SEQ ID NOs: 1 to
The oligonucleotide according to claim 1, which is composed of two sequences or corresponding complementary sequences. 3. The oligonucleotide according to claim 1, wherein the enterotoxin gene is the STh gene, and the synthetic nucleotide consists of the sequence group of SEQ ID NOs: 3 to 5 or the corresponding complementary sequence. 4. The oligonucleotide according to claim 1, wherein the enterotoxin gene is the STp gene, and the synthetic nucleotide consists of the sequence group of SEQ ID NOs: 6 to 8 or the corresponding complementary sequences. 5. An oligonucleotide having at least one of the sequences of each oligonucleotide described in claim 1 is caused to function as a primer for chain length reaction,
A method of selectively amplifying a target nucleotide sequence, comprising the steps of: (a) a primer is hybridized to a target nucleotide sequence in a single-stranded state in a sample, and a chain length reaction is caused by a polymerization reaction of four kinds of nucleotides. (B) When the obtained double-stranded target nucleotide sequence is separated into single strands, the complementary strand functions as a template for the chain length reaction by the other primer, (c) these two types of primers A specific nucleotide sequence is amplified by repeating simultaneous chain length reaction with, separation of a primer chain length product from the template, and hybridization with a new primer, and the amplified nucleotide fragment is detected, (d) As a result, by determining whether or not the sequence to be recognized exists in the sample, STh and / or S
A method for detecting toxigenic E. coli, which comprises detecting Tp-producing toxigenic E. coli.