JPH1090A - Identification of carrot cytoplasm - Google Patents

Abstract

PROBLEM TO BE SOLVED: To inexpensively and quickly identify carrot cytoplasm by PCR' amplification of carrot-derived cytoplasm DNA with a primer followed by separating the products with electrophoresis and visually detecting them and then by preparing a primer based on the base sequence followed by conducting a PCR using this primer. SOLUTION: Each of at least two carrot-derived ctytoplasm DNA specimens is subjected to PCR using an oligonucleotide composed of at least 7 bases as the primary primer, the amplified products are separated by electrophoresis and then visually detected. Based on the result, the amplified product existing in not all of the specimens in common is selected, its base sequence is determined, and two kinds of DNA fragment composed of at least 15 bases are prepared from the base sequence. Using the DNA fragment as the secondary primer, all of the DNA specimens derived from carrot are each subjected to PCR, the amplified products are separated by electrophoresis and then visually detected, and by comparing the results for all of the specimens, thus identifying the objective cytoplasm.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for identifying carrot cytoplasm.

[0002]

2. Description of the Related Art Most of the genes that control carrot plant traits exist in the nucleus, but genes also exist in subcellular organelles such as mitochondria and chloroplasts, each of which controls a unique trait. ing. In carrot plants, cytoplasmic identification based on differences in organelle DNA, such as mitochondrial DNA and chloroplast DNA, ie, cytoplasmic DNA, can be performed by comparing the length of fragments obtained by cutting the DNA with restriction enzymes (LR .DeBonte et al., Amer. J.Bot.
(1984) 71 (7): 932-340, H. Ichikawa et al., Theor. Ap.
pl. Genet (1989) 77: 39-43) and cytoplasmic DN
A method for comparing polymorphisms detected in Southern hybridization experiments using A as a probe (R. Scheike et al., Theo
r. Appl. Genet. (1992) 83: 419-427).

[0003]

However, in the above-mentioned conventional technique, the cytoplasm which is present only in a small amount in the specimen sample is used.
It is necessary to prepare large amounts of DNA, and cytoplasmic DNA
In isolation and Southern hybridization experiments,
It requires time, cost, and techniques, and is not always satisfactory as a method for identifying cytoplasm at the breeding site of an actual carrot plant.

[0004]

Means for Solving the Problems In view of the above situation, the present inventors have conducted intensive studies to find a better carrot cytoplasmic discrimination method. Primers) and polymerase chain reaction to amplify carrot cytoplasmic DNA, and the amplified DNA is separated by electrophoresis.
A step of performing visual detection of A, selecting a primary primer extension that is not present in common with all the samples, and preparing a carrot cytoplasmic discriminating primer (secondary primer) from the base sequence thereof; Amplification of carrot total DNA by polymerase chain reaction using a discriminating primer (secondary primer), separation of the amplified DNA by electrophoresis, and visual detection of the amplified DNA. The present inventors have found an efficient and efficient identification method and completed the present invention. That is, the present invention

I. A method for identifying carrot cytoplasm comprising the following steps. 1. (1) cytoplasmic DNA derived from at least two carrots
For each sample, a polymerase chain reaction is performed using one oligonucleotide of 7 bases or more as a primary primer under conditions in which at least one primary primer extension is amplified, and (2) a polymerase chain reaction is performed. After separating the amplified primary primer extension product by electrophoresis, the extension product is visually detected, and (3)
Based on the visual detection result of the extension, a primary primer extension that is not present in all the samples is selected, and (4) the base sequence of the selected primary primer extension is determined And a second step of preparing a secondary primer comprising preparing two types of DNA fragments of 15 bases or more from the base sequence. 2. (1) Total DN obtained from the carrot as the test sample
For each A sample, perform a polymerase chain reaction with the secondary primer created in the first step, and
(2) The secondary primer extension product amplified by the polymerase chain reaction is separated by electrophoresis, and the extension product is visually detected. (3) The visual detection results are compared for each of the above DNA samples. And the second step.
(Hereinafter referred to as the method of the present invention.)

II. One of the DNA fragments of the secondary primer is substantially 5′-ACA
DN which is a nucleotide sequence represented by TATAGGATACACCGGTGC-3 '
A fragment and the other DNA fragment is substantially 5'-T
The method for identifying a carrot cytoplasm according to the above item I, comprising a DNA fragment having a nucleotide sequence represented by GAGTCGAGCCTTCCTACTCGATT-3 ′.

III One of the DNA fragments of the secondary primer is substantially 5'-CAA
DN which is a nucleotide sequence represented by CACTGCTTTCTTTCACCTG-3 '
A fragment and the other DNA fragment is substantially 5'-T
D which is a nucleotide sequence represented by GGGCCAATTGGGACTCTCTTT-3 ′
The method for identifying a carrot cytoplasm according to the above item I, comprising an NA fragment.

IV One of the DNA fragments of the secondary primer is substantially 5′-TCG
DNA having a nucleotide sequence represented by ACCTGTGAACAAGGTAA-3 '
Fragment, and the other DNA fragment is substantially 5′-CCT
DNA having a nucleotide sequence represented by TATCATCAGTTGCAGGG-3 '
The method for identifying a carrot cytoplasm according to the above item I, comprising a fragment.

V One of the DNA fragments of the secondary primer is substantially 5′-AGA
DNA having a base sequence represented by GGAATGGGAACGAAACA-3 '
Fragment and the other DNA fragment is substantially 5'-ATA
DNA having a nucleotide sequence represented by TATGCCCCAGAAGCTAA-3 '
The method for identifying a carrot cytoplasm according to the above item I, comprising a fragment.

One of the DNA fragments of the VI secondary primer is substantially 5′-AAT
DNA having a nucleotide sequence represented by CTTTAAACTCACACAAG-3 '
Fragment, and the other DNA fragment is substantially 5'-GCT
DNA having a nucleotide sequence represented by TCATAGCTCCAACCTAT-3 '
2. The method for identifying a carrot cytoplasm according to the above item 1, comprising a fragment.

VII One of the DNA fragments of the secondary primer is substantially 5′-CTT
DNA having a nucleotide sequence represented by ACCGTAATGCGAATCTC-3 '
Fragment, and the other DNA fragment is substantially 5′-TTT
DNA having a nucleotide sequence represented by TCAAGGAAGTGAGTCTC-3 '
2. The method for identifying a carrot cytoplasm according to the above item 1, comprising a fragment.

VIII One of the DNA fragments of the secondary primer is substantially 5′-GTA
CTGTATAGTAG DNA having a base sequence represented by GTATAG-3 '
Fragment and the other DNA fragment is substantially 5'-CGA
DNA having a nucleotide sequence represented by TCATTAGAAATTCACGA-3 '
The method for identifying a carrot cytoplasm according to the above item I, comprising a fragment.

IX A DNA fragment containing a DNA fragment having a base sequence selected from the following base sequence group: (1) 5'-ACATATAGGATACACCGGTGCC-3 '(2) 5'-TGAGTCGAGCCTTCCTACTCGATT-3' (3) 5'-CAACACTGCTTTCTTTCACCTG-3 '(4) 5'-TGGGCCAATTGGGACTCTCTTT-3' (5) 5'-TCGACCTGTGAACAAGGTAA-3 ' (6) 5'-CCTTATCATCAGTTGCAGGG-3 '(7) 5'-AGAGGAATGGGAACGAAACA-3' (8) 5'-ATATATGCCCCAGAAGCTAA-3 '(9) 5'-AATCTTTAAACTCACACAAG-3' (10) 5'-GCTTCATAGCTCCAACCTAT-3 ' (11) 5'-CTTACCGTAATGCGAATCTC-3 '(12) 5'-TTTTCAAGGAAGTGAGTCTC-3' (13) 5'-GTACTGTATAGTAGGTATAG-3 '(14) 5'-CGATCATTAGAAAAATTCACGA-3'

[0014]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below in detail.

The present invention relates to a carrot plant,
It is extremely useful for easily and efficiently distinguishing whether or not it has various traits controlled by mitochondrial DNA which is DNA. That is, by using the present invention, in the conventional method at the DNA level, mitochondrial DNA isolated and purified from a large amount of mitochondria of a carrot plant is compared with the length of a fragment cut with a restriction enzyme. Hassle, moreover mitochondrial DNA
The labor of comparing polymorphisms detected in Southern hybridization experiments using a probe as a probe, or cultivating carrot plants for a long time until they grow sufficiently, performing a mating test, and eliminating the labor of confirming fertility, It is possible to immediately determine whether or not the target plant has various traits controlled by mitochondrial DNA at the seed, seedling or cultured cell stage. For example, the present invention, in carrot plants, to improve the efficiency of breeding improvement in the search for genetic resources and parent lines of pure varieties and F1 varieties, contribute to cost reduction,
Also, in the case of breed purity inspection, quick and simplified inspection, or in the case of mutant strain checking during storage, quick and simplified inspection of the original progeny production and genetic seed resource storage state, if there is a violation of the rights of registered varieties This speeds up the submission of high-level evidence, such as no change in the cultivation environment, etc. in the dispute ruling. Further, the present invention relates to mitochondrial DN which is a cytoplasmic DNA.
A cytoplasm with CMS properties caused by mutations in A (CMS
It is also useful for determining whether or not the subject has cytoplasm) and for identifying its fertility. Furthermore, the present invention is effective for early estimation of fertility in carrot plants in fertility control technology by cell fusion, and the present invention is also useful for early confirmation of introduction of the target cytoplasm by cell fusion. Very effective. For example, in a method of controlling fertility by introducing a heterologous (CMS) cytoplasm by a cell fusion method, whether or not the heterologous cytoplasm is incorporated into a fusion individual greatly affects fertility. By preparing a heterologous cytoplasmic identification primer according to the present invention and identifying the cytoplasm of the fused individual, it is possible to estimate whether or not the fused individual has the desired fertility without waiting for a long period of cultivation until flowering. And is very efficient.

The carrots used in the present invention include carrot cultivars and closely related wild species.

[0017] "Cytoplasmic DNA" (mitochondrial DNA, chloroplast) used for preparing the primary primer and the like used in the first step of the method of the present invention.
DNA) can be prepared, for example, by the method described in Experimental Methods for Plant Molecular Biology, translated by Masu Toyama, 1991, Maruzen, Tokyo. Specifically, for example, after cell membrane disruption of a protoplast or plant tissue derived from cultured cells of a test plant in a buffer solution, the disrupted product is centrifuged to obtain a target cytoplasmic fraction (mitochondria, chloroplast, etc.). to recover. That is, the supernatant obtained by removing nuclei of the disrupted substance by low-speed centrifugation (for example, 3000 g for 10 minutes) is used. 1) When fractionating chloroplast, medium-speed centrifugation (for example, 2) When fractionating mitochondria, first remove the chloroplast fraction by medium speed centrifugation (eg, 6000 g, 10 minutes), and then centrifuge at high speed (eg, 15000 g,
10 minutes) to obtain the desired cytoplasmic fraction. The mixed genomic DNA is removed by treating the obtained cytoplasmic fraction with DNase. The purified cytoplasmic fraction is treated with proteinase to digest the desired organelle membrane, extracted with phenol and chloroform, and RNase is added to the resulting mixture of cytoplasmic DNA and RNA.
Process ase. A method for obtaining cytoplasmic DNA by extracting again with phenol and chloroform can be mentioned.

The “polymerase chain reaction” performed in the first step of the method of the present invention is a method in which 1
One oligonucleotide is used as a primer (primary primer) under conditions where at least one primary primer extension is amplified. The polymerase chain reaction is a reaction that repeats a DNA replication cycle consisting of a denaturation step, a primer annealing step, and an extension step with a DNA polymerase.
Et al., Science, Vol. 230, pp. 1350--1354 (1985
Year) etc., the usual method is described. As an example of the above-mentioned polymerase chain reaction, one oligonucleotide (primary primer) of 7 bases or more, a DNA polymerase, four kinds of bases (dATP, dTTP, dCTP, dGTP) and the total DNA of the plant were added to about 1.0. About 15 to about 50, preferably about 25 times in an amplification buffer containing mM to 4.0 mM, preferably about 1.5 mM to about 3.0 mM magnesium chloride or the like.
One example is a reaction in which a DNA replication cycle is repeated from about 40 times to about 40 times. Further, each step in the polymerase chain reaction can be performed, for example, under the following conditions. The denaturation step is, for example, usually about 90 ° C. to about 90 ° C.
The heating is performed at 95 ° C., preferably about 94 ° C. to about 95 ° C., for about 1 minute to about 3 minutes, preferably for about 1 minute to about 3 minutes. The annealing step of the primer is, for example, usually at about 30 ° C to 65 ° C, preferably at about 35 ° C to 50 ° C.
By incubating with the primer for about 1 minute to about 3 minutes, preferably for about 1 minute to about 2 minutes. The primary primer is, for example, Omeron 10mer-
A commercially available product such as a kit can also be used. The extension step by DNA polymerase is usually performed at about 70 ° C. to 7 ° C.
3 ° C., preferably about 72 ° C. to 73 ° C., for about 1 minute to about 4 ° C.
For about 1 minute, preferably about 1 to about 3 minutes. Examples of thermostable DNA polymerases include those manufactured by Takara Shuzo Co., Ltd.
Commercially available products such as DNA polymerase can be used.

The "primer extension product amplified" by the above method is separated by an electrophoresis method usually used for separating DNA. Generally, shorter than 1000 base pairs
About 3% to about 20% polyacrylamide gel is used for separation of DNA fragments, and about 3% to about 20% for separation of longer DNA.
0.2% to about 2% agarose gel can be given. Preferably, about 0.8% to about 1.5% agarose gel is suitable. Buffers used for electrophoresis include Tris-phosphate (pH 7.5-8.3) and Tris-acetic acid (pH 7.5-8.3).
7.5-8.0), Tris-boric acid type (pH 7.5-8.3) and the like, and preferably Tris-acetic acid type. If necessary, EDTA and the like can be added. Electrophoresis conditions include, for example, 100 V, 35 minutes and 50
V, 80 minutes, etc. As the size marker, commercially available markers such as a kilobase marker and a 100 base marker (manufactured by Pharmacia) can be used.

In the present invention, "visual detection of the amplified primary primer extension" is, for example, a staining method using a phenanthridine dye such as ethidium bromide and a substance which interacts with nucleic acid. , DNA
Can be detected. The staining method is
In a buffer used in advance for electrophoresis, for example,
When a substance such as ethidium bromide at a final concentration of about 0.5 μg / ml is added, the gel is irradiated with ultraviolet rays such as 254 nm or 366 nm in a dark place, so that DN
The red band of the conjugate of A and ethidium bromide can be detected.However, usually, after the electrophoresis, the gel is immersed in a solution of a substance such as ethidium bromide for about 15 to about 60 minutes, and then exposed to a light of 254 nm or 366 nm in a dark place. By irradiating the gel with ultraviolet light, the red band of the conjugate of DNA and ethidium bromide is detected.

In this manner, the extension is visually detected, and based on the result of the visual detection, a primary primer extension which is not present in all the samples is selected. Here, “primary primer extension that is not commonly present in all of the samples” refers to, for example, sample A
, B and C, a primary primer extension present only in A, present only in B, and present only in C, or present in A and B, present in A and C, or present in B and C Means the primary primer extension.

Then, the base sequence of the selected primary primer extension is determined, and two kinds of DNA fragments (secondary primers) of 15 bases or more are prepared from the base sequence. The base sequence of the selected primary primer extension may be determined by a conventional method, and a secondary primer may be prepared based on the determined sequence using an automatic DNA synthesizer or the like.

Next, a polymerase chain reaction is performed on each of all the DNA samples obtained from the carrot, which is the test substance, using the secondary primer prepared in the first step.

The “total DNA sample” used in the second step of the method of the present invention may be, for example, the following: “Basics of latest agricultural experiments, edited by Department of Agriculture, Faculty of Agriculture, Tohoku University”, 1990, published by Soft Science Co., Ltd. It can be prepared by the usual total DNA extraction method described in Experimental Protocol, supervised by Isao Shimamoto and Takuji Sasaki, published by Shujunsha Co., Ltd., Tokyo, 1995. Specifically, for example, a tissue such as a green leaf of a test plant is ground in liquid nitrogen. A cetyltrimethylammonium bromide (CTAB) solution is added to the ground material, and after incubation, chloroform-isoamyl alcohol is added and mixed well. The aqueous layer is separated and collected by centrifugation, and isopropyl alcohol is added thereto and mixed. After collecting the precipitate by centrifugation, for example, EDTA
Add a buffer solution containing this and dissolve, and RNase. After the treatment, the solvent is replaced in the order of phenol, phenol and chloroform-isoamyl alcohol, and chloroform-isoamyl alcohol. After the substitution treatment, ethanol may be added, mixed well, and centrifuged to obtain total DNA.

Further, each step in the polymerase chain reaction can be performed, for example, under the following conditions. The “polymerase chain reaction” performed in the second step of the method of the present invention is performed using the oligonucleotide prepared in the first step as a primer (secondary primer). The polymerase chain reaction is a reaction in which a DNA replication cycle consisting of a denaturation step, a primer annealing step, and an elongation step with a DNA polymerase is repeatedly performed.For example, Saiki et al., Science, No.
Volume 230, pages 1350 to 1354 (1985), etc., describe conventional methods. Examples of the above-mentioned polymerase chain reaction include the addition of the oligonucleotide (secondary primer) prepared in the first step, the DNA polymerase, four types of bases (dATP, dTTP, dCTP, and dGTP) and the total DNA of the plant. 1.0 mM to 4.0 mM, preferably about 1.0 mM to about
In an amplification buffer containing 2.5 mM magnesium chloride or the like, about 15 to about 50 times, preferably about 25 to about 40 times DN
A Repeated duplication cycles can be mentioned. Further, each step in the polymerase chain reaction can be performed, for example, under the following conditions. The denaturation step is performed, for example, by heating usually at about 90 ° C. to about 95 ° C., preferably about 94 ° C. to about 95 ° C., for about 1 minute to about 3 minutes, preferably for about 1 minute to about 2 minutes. The annealing step of the primer is carried out, for example, by incubating the primer with the primer usually at about 40 ° C to 65 ° C, preferably at about 50 ° C to 60 ° C, for about 1 minute to about 3 minutes, preferably for about 1 minute to about 2 minutes. Do. The primer is
Carrot cytoplasm can be identified by using one or a combination of the oligonucleotides (secondary primers) prepared in the first step. The extension step by DNA polymerase is performed, for example, usually at about 70 ° C. to 73 ° C.
Preferably at about 72 ° C. to 73 ° C. for about 1 minute to about 4 minutes,
It is preferably carried out by treating with a thermostable DNA polymerase for about 2 to about 1 minute to about 3 minutes. Examples of the heat-resistant DNA polymerase include, for example, heat-resistant DN manufactured by Takara Shuzo Co., Ltd.
Commercially available products such as A polymerase can be mentioned.

The "secondary primer extension amplified" by the above method is separated by an electrophoresis method usually used for separating DNA. Generally, shorter than 1000 base pairs
About 3% to about 20% polyacrylamide gel is used for separation of DNA fragments, and about 3% to about 20% for separation of longer DNA.
0.2% to about 2% agarose gel can be given. Preferably, about 0.8% to about 1.5% agarose gel is suitable. Buffers used for electrophoresis include Tris-phosphate (pH 7.5-8.3) and Tris-acetic acid (pH 7.5-8.3).
7.5-8.0), Tris-boric acid type (pH 7.5-8.3) and the like, and preferably Tris-acetic acid type. If necessary, EDTA and the like can be added. Electrophoresis conditions include, for example, 100 V, 35 minutes and 50
V, 80 minutes, etc. As the size marker, commercially available markers such as a kilobase marker and a 100 base marker (manufactured by Pharmacia) can be used.

In the present invention, the "visual detection of the amplified secondary primer extension" is, for example, a staining method using a phenanthridine dye such as ethidium bromide and a substance which interacts with nucleic acid. , DNA
Can be detected. The staining method is
In a buffer used in advance for electrophoresis, for example,
When a substance such as ethidium bromide at a final concentration of about 0.5 μg / ml is added, the gel is irradiated with ultraviolet rays such as 254 nm or 366 nm in a dark place, so that DN
The red band of the conjugate of A and ethidium bromide can be detected.However, usually, after the electrophoresis, the gel is immersed in a solution of a substance such as ethidium bromide for about 15 to about 60 minutes, and then exposed to a light of 254 nm or 366 nm in a dark place. By irradiating the gel with ultraviolet light, the red band of the conjugate of DNA and ethidium bromide is detected.

In this manner, the visual detection of each of the total DNA samples is performed, and the results of the visual detection are compared, that is, the carrot cytoplasm can be identified based on the presence or absence of the detected “amplified secondary primer extension”. To

[0029]

The present invention will be described in more detail with reference to the following Examples, but it should not be construed that the present invention is limited to these Examples. Example 1 (Experimental system 1: carrot mitochondrial DNA)
Extraction of Carrot (Daucus carota L.) strain and variety were used. As fertility pure varieties, trade name: Kokubun Shunbun Daicho (hereinafter referred to as cultivar number 1), trade name: imperator (hereinafter referred to as cultivar number 2), trade name: Nantes Scarlet (hereinafter cultivar) No. 3), Product Name: Kinbetsu Kinki (hereinafter referred to as Type No. 4), Koizumi Ideal Gosun (hereinafter referred to as Type No. 5), Kikuyo Gosun (hereinafter referred to as Type No. 6) MS-1 and MS of cytoplasmic male sterile lines that have been cultivated and flowered in the current generation and progeny of commercially available varieties, showed male sterility in all flowers, and confirmed that the trait was derived from the cytoplasm. The following mitochondrial DNA was extracted using -2 (hereinafter referred to as cultivar numbers 7 and 8).

The hypocotyl of the 10-day-old carrot varieties that had been aseptically germinated was sterilized with antiformin having an effective salt concentration of 1% for 20 minutes, washed thoroughly with sterile water, and added to 2,4-D MS medium.
(2,4-dichlorophenoxyacetic acid) was added at 1 mg / l, and placed on a solid medium solidified with 0.8% agar powder and cultured at 25 ° C. to form a callus. Approximately one month after the culture, the calli were subdivided, and 2,4-D (0.5 mg / l) was added to the MS medium, and the medium was placed on a solid medium solidified with 0.8% agar powder. It was subcultured. This callus was subdivided again, transplanted to a liquid medium containing 0.5 mg / l of 2,4-D added to MS medium, and
Shaking culture was performed for about 3 weeks at 100 ° C. and 100 ° C. afterwards,
Once every two weeks, about 1/20 volume was subcultured into a fresh medium to complete liquid subcultured cells. Approximately 10 g of liquid culture cells on the third day of passage are collected by centrifugation, and
nozuka RS, 1% Driselase, 0.01% Pectolyase Y-2
3, 0.1% MES (2- (N-morpholino) ethanesulfonic aci
d) In an enzyme solution (pH 5.7) containing 0.5MMannitol, 30 ° C,
The mixture was treated at 50 rpm in a dark place for 3 hours to obtain a crude protoplast solution. This crude protoplast solution was filtered through a stainless mesh having a pore size of 32 μm to remove cell wall residues. The obtained protoplasts were treated with 0.5 M Mannitol (pH 5.7)
Gently, and centrifuged at 150 g for 3 minutes. The washing solution was added, the mixture was gently stirred, and the protoplasts were suspended. Further, the same operation was repeated twice to obtain a purified protoplast. Purified protoplasts 40ml 100m
M Tris-HCl, 1mM EDTA, 1% (wt / v) BSA and 0.3
% (Wt / v) 2-mercaptoethanol was suspended in a 0.4 M sorbitol solution and incubated on ice for 20 minutes. 18 gau of protoplasts contained in the suspension
The protoplast membrane was gently broken by passing several times with a se needle. The crushed protoplast membrane was centrifuged (3000 g, 10 minutes) to precipitate nuclei. Take the supernatant and centrifuge (6000
g, 5 minutes) to precipitate a mixed fraction of nucleus and plastid. After taking the supernatant and repeating the above treatment once, the supernatant was collected again, and the precipitate (mitochondrial fraction) was collected by centrifugation (15000 g, 15 minutes). The resulting precipitate was gently treated with 50 mM Tris-HCl buffer (pH 7.5) containing DNase, 10 mM MgCl ₂ and 0.3 M sucrose for 30 minutes. Remove 5 m of mitochondrial solution to remove DNase
l of 10 mM Tri containing 0.02 M EDTA and 0.6 M sucrose
layer on s-HCl buffer (pH 7.2) and centrifuge (15000g,
10 minutes). 100 μg of proteinase
K, 1% (wt / v) N-laurylsarcosine and 20 mM EDTA
In 50 mM Tris-HCl buffer (pH 8.0) containing
After a time treatment, the mitochondrial membrane was digested. This was subjected to the following phenol extraction. That is, an equal amount of phenol and chloroform-isoamyl alcohol (chloroform: isoamyl alcohol = 24: 1) were added and mixed by shaking for 15 minutes. The mixture was centrifuged (1940 g, 15 minutes), and the obtained aqueous layer was collected. To this, an equal amount of phenol and chloroform-isoamyl alcohol (chloroform: isoamyl alcohol = 24: 1) were added again.
Shake and mix for 15 minutes. The mixture was centrifuged (1940 g,
The resulting aqueous layer was collected for 15 minutes) and purified by the following ethanol precipitation. That is, 2.5 times the amount of ethanol was added and mixed several times with shaking. Centrifugation (1940g
, 10 minutes), and after collecting the obtained precipitate, 70%
The precipitate obtained by washing by adding ethanol and centrifuging (1940 g, 15 minutes) was dried under reduced pressure. 0.4 ml to the precipitate
50 mM Tris-HCl buffer (pH 7.5) containing 1 mM EDTA
Was added and suspended. After the precipitate was completely dissolved, 2.5 units of RNase (manufactured by Wako Pure Chemical Industries, Ltd.) was added, and the mixture was incubated at 37 ° C for 1 hour. This is purified by phenol extraction and ethanol precipitation in the same manner as above, and the precipitate is
50 mM Tris-HCl buffer (pH 7.5) containing 1 mM EDTA was added and suspended. Carrot (Daucus carot)
About 5 to 10 μg of aL) mitochondrial DNA was obtained.

Example 2 (Experimental system 1: Detection of polymorphism in carrot mitochondrial DNA using primary primers and
Preparation method of next primer) As a primary primer, a commercially available 10-mer random primer OPB04 (5'-GGACTGGAGT-3 '; manufactured by Operon) was used. 20 pmol of the primary primer, 2.5 units of heat-resistant DNA polymerase (Takara Shuzo Co., Ltd.), 1.0 nmol of each of the four bases (dATP, dTTP, dCTP, dGTP) and
A 10 mM Tris-HCl buffer (pH: 10%) containing 0.01% (wt / v) gelatin and 50 mM magnesium chloride to which 0.02 μg of various carrot mitochondrial DNA obtained in Example 1 was added.
In 8.3), a polymerase chain reaction was performed. The reaction volume was 20 μl, and about 20 μl to prevent evaporation of the reaction solution.
Of mineral oil was added. Each step in the above polymerase reaction was performed under the following conditions. Denaturation step is 94 ° C
And heat for 5 minutes.
Incubate with the primer for 2 minutes at
A Polymerase extension step is 72 ° C, 3 minutes heat resistant
After one cycle of DNA polymerase treatment, the denaturation step is heated at 94 ° C for 1 minute, the primer annealing step is incubated at 40 ° C for 2 minutes with the primer, and the DNA polymerase extension step is 72 minutes. ° C,
Second cycle of heat-resistant DNA polymerase treatment for 3 minutes
The denaturation step is heated at 94 ° C for 1 minute, the primer annealing step is incubated at 40 ° C for 2 minutes with the primer, and the elongation step with DNA polymerase is performed at 72 ° C for 10 minutes. A third cycle of processing was performed once. The resulting primary primer extension product (amplified mitochondrial DNA) was separated by electrophoresis using a 1.5% agarose gel in 40 mM Tris-20 mM acetate buffer (pH 8.0) containing 1 mM EDTA at 100 V for 35 minutes. did. At that time, a 100 base marker and a kilo base marker (manufactured by Pharmacia) were used as size markers. After the separation was completed, the gel was immersed in a 0.5 μg / ml ethidium bromide aqueous solution for 30 minutes, and then irradiated with ultraviolet light of 254 nm in a dark place to detect a red band of a conjugate of DNA and ethidium bromide. As a result, about 2.2 kbp for varieties 1, 2, 7, and 8 and about 1.2 kb for all varieties
A band of about 1.1 kbp was detected only in p and cultivar Nos. 7 and 8. Of these, a band of about 1.1 kbp was cut out from the gel, and the purified one was incorporated into a pCRII vector according to the protocol of TA cloning kit (manufactured by Invitrogen), transformed into E. coli, amplified, and then purified. And the base sequence of about 300 bp at both ends of the about 1.1 kbp DNA fragment was determined by ABI 373S-18 DNA Sequencer. Of the base sequences at both ends, a DNA fragment of about 20 bases not containing the OPB04 primer which amplifies the inside of the about 1.1 kbp DNA fragment, that is, a DNA fragment having the base sequence of SEQ ID NO: 1 (5'-ACATATAGGATACACCGGTGC- 3 ')
And a DNA fragment (5′-TGAGTCGAGCCTTCCTACTCGATT-3 ′) having the nucleotide sequence of SEQ ID NO: 2 was newly synthesized as a secondary primer.

Example 3 (Experimental System 1: Extraction of Carrot Total DNA) As carrot (Daucus carota L.) strains and varieties,
Three types of cytoplasmic male sterility, strain name 493s
(Hereinafter referred to as type number 9), 2566A (hereinafter referred to as type number 10), 9304A (hereinafter referred to as type number 11)
And fertile lines 493 n (hereinafter referred to as cultivar number 12) and 2566B (hereinafter referred to as cultivar number 13)
It is written. ), 9304B (hereinafter referred to as product number 14). In addition, as fertile pure varieties, cultivar numbers 1, 2, 3
, 4, 5, 6, and 7 of the cytoplasmic male sterile lines
Was used. The green leaf tissues (fresh weight 3 g) of the various carrot plants were finely chopped, and the tissue pieces were immersed in about 100 ml of liquid nitrogen for 1 minute and frozen. The frozen product was powdered in liquid nitrogen using a mortar and pestle, and then liquid nitrogen was vaporized. The obtained powder was placed in 10 ml of a 2% (W / V) CTAB solution that had been kept at 60 ° C. in advance, and mixed well. After incubating at 60 ° C for 30 minutes, an equal volume of chloroform-isoamyl alcohol (chloroform:
Isoamyl alcohol (24: 1) was added and mixed by infiltration for 15 minutes. The mixture was centrifuged (1940 g, 15 minutes), and the resulting precipitate was collected. To the precipitate was added 0.7 volume of isopropyl alcohol and mixed with shaking. The mixture was centrifuged (1940 g, 15 minutes), and the resulting precipitate was collected. Five
After air-drying for 20 minutes, this contains 1 ml of 1 mM EDTA.
mM Tris-HCl buffer (pH 7.5) was added and suspended. After the precipitate was completely dissolved, 2.5 units of RNase (manufactured by Wako Pure Chemical Industries, Ltd.) was added, and the mixture was incubated at 37 ° C for 45 minutes. An additional 1 ml of phenol was added and shaken for 10 minutes. After collecting the aqueous layer obtained by centrifugation (1940 g, 10 minutes), 0.5 ml of phenol and 1 ml of chloroform-isoamyl alcohol (chloroform: isoamyl alcohol = 24: 1) were added thereto, and the mixture was permeated for 10 minutes. did.
The resulting aqueous layer was collected by centrifugation (1940 g, 5 minutes), and then 0.1 ml of 3M sodium acetate and 2.5 ml of ethanol were added, followed by shaking and mixing several times. Centrifugation (19
(40 g, 10 minutes), and the precipitate was washed with 1 ml of 70% ethanol. Ethanol was removed by air drying for 60 minutes to obtain about 100 μg of total DNA of various varieties of carrot plants.

Example 4 (Experimental system 1: Identification of carrot cytoplasm using secondary primer) An oligonucleotide having 20 pmoles of a base sequence represented by SEQ ID NOS: 1 and 2 in advance as a primer,
2.5 units of heat-resistant DNA polymerase (Takara Shuzo Co., Ltd.) 1.0 nanomoles of four bases (dATP, dTTP,
dCTP, dGTP) and 0.1 μg of the total DNA of various carrot (Daucus carota L.) varieties obtained in Example 3 were added.
10 mM Tris-HCl buffer (pH 8.3) containing 0.01% gelatin, 50 mM potassium chloride and 2 mM magnesium chloride
, A polymerase chain reaction was performed. The reaction volume is
The volume was adjusted to 20 μl, and about 20 μl of mineral oil was added to prevent evaporation of the reaction solution. Each step in the above polymerase chain reaction was performed under the following conditions. Denaturation step is 94
At 5 ° C for 5 minutes.
Incubate with the primers at 55 ° C for 2 minutes, and extend with DNA polymerase at 72 ° C for 3 minutes.
After one cycle of polymerase treatment, the denaturation step is heated at 94 ° C for 1 minute, the primer annealing step is incubated at 55 ° C for 1 minute with the primer, and the DNA polymerase extension step is performed at 72 ° C. The second cycle of heat-resistant DNA polymerase treatment was performed 30 times for 1 minute. The denaturation step was heated at 94 ° C. for 1 minute. The process is 72
One third cycle of thermostable DNA polymerase treatment at 10 ° C. for 10 minutes was performed. The resulting amplified genomic DNA is 1.5%
Using agarose gel, 40 mM containing 1 mM EDTA
In Tris-20 mM acetate buffer (pH 8.0) at 100 V for 35 minutes. At that time, a kilobase marker manufactured by Pharmacia was used as a size marker. After separation, the gel was immersed in a 0.5 μg / ml ethidium bromide aqueous solution for 30 minutes and then irradiated with 254 nm ultraviolet light in the dark to detect the red DNA band of the DNA-ethidium bromide conjugate. . As a result, the product number
Approximately 1.1 kb DNA band was detected in 9 and 7,
No DNA band was detected in 2, 3, 4, 5, 6, 10, 11, 12, 13, and 14. As described above, the carrot cytoplasm was identified in two groups.

Example 5 (Experimental system 2: Polymorphism detection of carrot mitochondrial DNA using primary primers and 2
Preparation method of primary primer) As primary primer, use 10me instead of OPB04 of Example 2.
The same test as in Example 2 was conducted using r random primer FPT16 (5'-AGATCGGCAT-3 '; Takara Shuzo).
As a result, many bands were detected. Among them, about 2.4 kbp band was detected only in varieties 7 and 8. The band of about 2.4 kbp was obtained in the same manner as in Example 2.
The nucleotide sequences at both ends of the DNA fragment were determined to be about 300 bp. Of the base sequences at both ends, a DNA fragment of about 20 bases not containing the FPT16 primer that amplifies the inside of the about 2.4 kbp DNA fragment, that is, a DNA fragment having the base sequence of SEQ ID NO: 3 (5'-CAACACTGCTTTCTTTCACCTG- 3 ′) and a DNA fragment having the nucleotide sequence of SEQ ID NO: 4 (5′-TGG
GCCAATTGGGACTCTCTTT-3 ′) was newly synthesized as a secondary primer.

Example 6 (Experimental System 2: Identification of Carrot Cytoplasm Using Secondary Primers) Instead of the DNA fragment having the nucleotide sequence shown in SEQ ID NO: 1 or 2, the nucleotide sequence shown in SEQ ID NO: 3 or 4 The test was carried out under the same conditions as in Example 4 using the DNA fragment thus obtained. As a result, a DNA band of about 2.4 kb was detected in cultivar number 7, and cultivar numbers 1, 2, 3, 4, 5, 6, 6, 9, 10, and 1 were detected.
No DNA band was detected in 1, 12, 13, or 14. As described above, the carrot cytoplasm of cultivar number 7 was specifically identified.

Example 7 (Experimental System 3: Detection of Polymorphism in Carrot Mitochondrial DNA Using Primary Primers and
Preparation method of the following primers) In accordance with the method described in Example 1, cultivar Nos. 1, 2, 3, 9
, 10, 11, 12, 13 and 14 were extracted. Next, according to the method described in Example 2, the above-mentioned mitochondrial DNA was subjected to carrot mitochondrial DNA polymorphism detection using the following primary primers, thereby preparing the following secondary primers. When the primary primer (1) [5'-CTCCATGGGG-3 '] was used, a DNA band of about 1.8 kb specific to cultivar number 1 and an approximately 1.9 kb DNA band specific to cultivar numbers 9, 10, and 11 were used. When the primary primer (2) [5'-AAGCGGCCTC-3 '] was used, about 1.1 kb specific to cultivar Nos. 9, 10 and 11 was detected.
DNA band was detected and the primary primer (3) [5'-CC
CAAGGTCC -3 '], the product number 1, 2, 3, 1
A DNA band of about 1.7 kb specific to 2, 13, and 14 was detected, and when the primary primer (4) [5'-AAGACCCCTC-3 '] was used, specific varieties Nos. 9, 10, and 11 were detected. About 1.1kb
DNA band was detected and the primary primer (5) [5'-CC
GAACACGG -3 '], varieties 2, 3, 12,
A DNA band of about 2.4 kb specific to 13 and 14 was detected.

[0037]

[Table 1] ──────────────────────────────────── Primary primer Secondary primer ──── ──────────────────────────────── (1) 5'-CTCCATGGGG -3 '5'-TCGACCTGTGAACAAGGTAA -3' (SEQ ID NO: 5) 5'-CCTTATCATCAGTTGCAGGG -3 '(SEQ ID NO: 6) (2) 5'-AAGCGGCCTC-3' 5'-AGAGGAATGGGAACGAAACA -3 '(SEQ ID NO: 7) 5'-ATATATGCCCCAGAAGCTAA -3' (SEQ ID NO: 8) (3) 5'-CCCAAGGTCC -3 '5'-AATCTTTAAACTCACACAAG -3' (SEQ ID NO: 9) 5'-GCTTCATAGCTCCAACCTAT -3 '(SEQ ID NO: 10) (4) 5'-AAGACCCCTC -3' 5'-CTTACCGTAATGCGAATCTC -3 '(SEQ ID NO: 11) 5'-TTTTCAAGGAAGTGAGTCTC -3' (SEQ ID NO: 12) (5) 5'-CCGAACACGG -3 '5'-GTACTGTATAGTAGGTATAG -3' (SEQ ID NO: 13) 5'-CGATCATTAGAAATTCACGA -3 '(SEQ ID NO: 14) ────────────────────────────────────

Example 8 (Experimental System 3: Identification of Carrot Cytoplasm Using Secondary Primer)
According to the method described, carrot cytoplasm was identified using the above-mentioned secondary primer prepared in Example 7. As a result, secondary primer extension products as shown in Table 2 were detected, and carrot cytoplasm could be identified. When a DNA fragment having the nucleotide sequence shown in SEQ ID NO: 5 or 6 was used as the secondary primer, about 1.8 kb
, About 1.5 kb and about 1.1 kb (hereinafter referred to as band Nos. 1, 2 and 3) having a base sequence represented by SEQ ID NOs: 7 and 8 as a secondary primer
When a DNA fragment was used, DNA bands of about 1.9 kb and about 1.1 kb (hereinafter referred to as band numbers 4 and 5) were detected, and DNAs having the nucleotide sequences shown in SEQ ID NOs: 9 and 10 as secondary primers When using a fragment, about 1.7 kb
A DNA band (hereinafter referred to as band No. 6) was detected, and when a DNA fragment having the base sequence shown in SEQ ID NOS: 11 and 12 was used as a secondary primer, about 1.3 kb
And a DNA band of about 1.1 kb (hereinafter, band numbers 7 and 8)
It is written. ) Is detected, and when a DNA fragment having the nucleotide sequence of SEQ ID NO: 13 or 14 is used as a secondary primer, a DNA band of about 2.4 kb (hereinafter, band number 9) is used.
It is written. ) Was detected.

[0039]

[Table 2] 名 Carrot variety (strain) name Band number (species) 1 2 3 4 5 6 7 8 9 ─────────────────────────────── PI295854 (D. aureus) + + + PI295862 (D. carota ssp. maximus) + + + + + PI279776 (D. carota var. atrorubens) + + + + PI279777 (D. carota var. atrorubens) + + + + + PI279798 (D. guttatus) + + + PI286611 (D. guttatus) ) + PI279763 (D. muricatus) + PI295863 (D. muricatus) + + + + PI349267 (D. pusillus) + + + + PI478369 (D. carota ssp. Sativus) + + + + PI511864 (D. pusillus) + + + PI421301 (D. carota ssp. Sativus) + + + + + PI478882 (D. carota ssp. Sativus) + + + PI279762 (D. carota ssp. Drepanensis) + + + PI279794 (D. carota ssp. Drepanensis) + + + PI478883 (D. carota ssp. Gadecaei) + + + + + + PI279775 (D. carota ssp. Gummifer) + + + + PI478884 (D. ca) rota ssp. gummifer) + + + + PI279788 (D. carota ssp. maximus) + + + ───────────────────────────── ── * "+" indicates that a DNA band (secondary primer extension) was detected.

[0040]

Industrial Applicability According to the present invention, it is not necessary to prepare a large amount of cytoplasmic DNA, and a method for identifying cytoplasm in a carrot plant in a short time, at low cost, and easily can be realized.

[0041]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 21 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear sequence ACATATAGGATACACCGGTGC 21

SEQ ID NO: 2 Sequence length: 24 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence TGAGTCGAGCCTTCCTACTCGATT 24

SEQ ID NO: 3 Sequence length: 22 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence CAACACTGCTTTCTTTCACCTG 22

SEQ ID NO: 4 Sequence length: 22 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence TGGGCCAATTGGGACTCTCTTT 22

SEQ ID NO: 5 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence TCGACCTGTGAACAAGGTAA 20

SEQ ID NO: 6 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence CCTTATCATCAGTTGCAGGG 20

SEQ ID NO: 7 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence AGAGGAATGGGAACGAAACA 20

SEQ ID NO: 8 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence ATATATGCCCCAGAAGCTAA 20

SEQ ID NO: 9 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence AATCTTTAAACTCACACAAG 20

SEQ ID NO: 10 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence GCTTCATAGCTCCAACCTAT 20

SEQ ID NO: 11 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence CTTACCGTAATGCGAATCTC 20

SEQ ID NO: 12 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence TTTTCAAGGAAGTGAGTCTC 20

SEQ ID NO: 13 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence GTACTGTATAGTAGGTATAG 20

SEQ ID NO: 14 Sequence length: 20 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear sequence CGATCATTAGAAATTCACGA 20

Claims (9)

[Claims] 1. A method for identifying carrot cytoplasm comprising the following steps. 1. (1) cytoplasmic DNA derived from at least two carrots
For each sample, a polymerase chain reaction is performed using one oligonucleotide of 7 bases or more as a primary primer under conditions in which at least one primary primer extension is amplified, and (2) a polymerase chain reaction is performed. After separating the amplified primary primer extension product by electrophoresis, the extension product is visually detected, and (3)
Based on the visual detection result of the extension, a primary primer extension that is not present in all the samples is selected, and (4) the base sequence of the selected primary primer extension is determined And a second step of preparing a secondary primer comprising preparing two types of DNA fragments of 15 bases or more from the base sequence. 2. (1) Total DN obtained from the carrot as the test sample
For each A sample, perform a polymerase chain reaction with the secondary primer created in the first step, and
(2) The secondary primer extension product amplified by the polymerase chain reaction is separated by electrophoresis, and the extension product is visually detected. (3) The visual detection results are compared for each of the above DNA samples. And the second step. 2. One of the DNA fragments of the secondary primer contains a DNA fragment having a base sequence substantially represented by 5'-ACATATAGGATACACCGGTGC-3 ', and the other DNA fragment comprises
The method for identifying a carrot cytoplasm according to claim 1, wherein the method comprises a DNA fragment having a base sequence substantially represented by 5'-TGAGTCGAGCCTTCCTACTCGATT-3 '. 3. One of the DNA fragments of the secondary primer contains a DNA fragment having a base sequence substantially represented by 5′-CAACACTGCTTTCTTTCACCTG-3 ′, and the other DNA fragment comprises
2. The method for identifying a carrot cytoplasm according to claim 1, comprising a DNA fragment having a base sequence substantially represented by 5'-TGGGCCAATTGGGACTCTCTTT-3 '. 4. One of the DNA fragments of the secondary primer contains a DNA fragment having a base sequence substantially represented by 5′-TCGACCTGTGAACAAGGTAA-3 ′, and the other DNA fragment is substantially 5 ′. 2. A DNA fragment having a nucleotide sequence represented by -CCTTATCATCAGTTGCAGGG-3 '.
The method for identifying carrot cytoplasm according to the above. 5. The method according to claim 5, wherein one of the DNA fragments of the secondary primer contains a DNA fragment having a base sequence substantially represented by 5′-AGAGGAATGGGAACGAAACA-3 ′, and the other DNA fragment is substantially 5 ′. 2. A DNA fragment having a nucleotide sequence represented by -ATATATGCCCCAGAAGCTAA-3 '.
The method for identifying carrot cytoplasm according to the above. 6. One of the DNA fragments of the secondary primer contains a DNA fragment having a base sequence substantially represented by 5′-AATCTTTAAACTCACACAAG-3 ′, and the other DNA fragment is substantially 5′-AATCTTTAAACTCACACAAG-3 ′. 2. A DNA fragment having a base sequence represented by -GCTTCATAGCTCCAACCTAT-3 '.
The method for identifying carrot cytoplasm according to the above. 7. One of the DNA fragments of the secondary primer contains a DNA fragment having a nucleotide sequence substantially represented by 5′-CTTACCGTAATGCGAATCTC-3 ′, and the other DNA fragment is substantially 5 ′. 2. A DNA fragment having a base sequence represented by -TTTTCAAGGAAGTGAGTCTC-3 ′.
The method for identifying carrot cytoplasm according to the above. 8. One of the DNA fragments of the secondary primer contains a DNA fragment having a base sequence substantially represented by 5′-GTACTGTATAGTAGGTATAG-3 ′, and the other DNA fragment is substantially 5′-GTACTGTATAGTAGGTATAG-3 ′. 2. A DNA fragment having a base sequence represented by -CGATCATTAGAAATTCACGA-3 '.
The method for identifying carrot cytoplasm according to the above. 9. A DNA fragment containing a DNA fragment having a base sequence selected from the following base sequence group: (1) 5'-ACATATAGGATACACCGGTGCC-3 '(2) 5'-TGAGTCGAGCCTTCCTACTCGATT-3' (3) 5'-CAACACTGCTTTCTTTCACCTG-3 '(4) 5'-TGGGCCAATTGGGACTCTCTTT-3' (5) 5'-TCGACCTGTGAACAAGGTAA-3 ' (6) 5'-CCTTATCATCAGTTGCAGGG-3 '(7) 5'-AGAGGAATGGGAACGAAACA-3' (8) 5'-ATATATGCCCCAGAAGCTAA-3 '(9) 5'-AATCTTTAAACTCACACAAG-3' (10) 5'-GCTTCATAGCTCCAACCTAT-3 ' (11) 5'-CTTACCGTAATGCGAATCTC-3 '(12) 5'-TTTTCAAGGAAGTGAGTCTC-3' (13) 5'-GTACTGTATAGTAGGTATAG-3 '(14) 5'-CGATCATTAGAAATTCACGA-3'