JPH1087699A - Slit-like polypeptide - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new polypeptide usable for diagnosing and treating diseases specific to brain and cancers, comprising a slit-like polypeptide derived from human, specifically developed in brain and tumor cell, containing a specific amino acid sequence. SOLUTION: This new slit-like polypeptide contains an amino acid seqeunce of the formula, is specifically developed in brain and tumor cell and is useful for producing an antibody for specifically recognizing the polypeptide and diagnosing and treating diseases and cancers specific to brain by using the polypeptide. The polypeptide is obtained by screening a cDNA library derived from human fatal brain by using a labeled probe prepared by using a synthetic oligo DNA coding a partial sequence of the polypeptide, integrating the prepared gene to a vector, transducing the vector to a host cell, transforming the cell, culturing the prepared transformant cell and expressing the cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a novel human-like slit-like polypeptide, a DNA encoding the polypeptide, a method for producing the polypeptide, and an antibody that specifically recognizes the polypeptide.

[0002]

2. Description of the Related Art The formation of the brain and nervous system of higher vertebrates is completed during the embryonic period, and it is extremely difficult to regenerate the damage. Understand the formation process of the brain and nervous system, and the clinical application of molecules related to this process to various brain and neurological diseases is being studied.
In recent years, many cell-cell interaction molecules or cell-substrate interaction molecules involved in nervous system development and neural circuit formation have been found. These molecules include cell membrane-bound receptor molecules that transmit information between cells and their ligand molecules (receptor-ligand molecules),
They are broadly classified into extracellular matrix molecules that are matrix substances between cells, and cell adhesion molecules that are responsible for cell-cell or cell-matrix adhesion.

Examples of ligand molecules include humoral factor nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF),
Neurotrophin 3 (NT-3) (JP-A-5-161)
493), glial cell line-derived neurotrophic factor (GD
NF), ciliary body derived neurotrophic factor (CNTF), Netrin (Serafini et al., Cell,
78, 409-424, 1994), colapsin (Co
llapsin) (Luo et al., Cell, 75, 217).
-227, 1993) and Notch family ligand molecules Delta, Serrate, Ep as membrane-bound factors.
The h family ligand molecules and the like are known. Some of these molecules have been studied for development as pharmaceuticals.

[0004] Extracellular matrix molecules include collagen, fibronectin, laminin, which are not particularly limited to the nervous system, and reelin (Ree), which is mainly secreted to the central nervous system.
lin) (D'Archangelo et al., Nature)
e, 374, 719-723, 1995) and Agrin (Rupp) secreted mainly to the peripheral nervous system.
Et al., Neuron, 6, 811-823, 1991) are known molecules specific to the nervous system. Examples of cell adhesion molecules include N-cadherin, PB-cadherin, and N-cadherin.
-CAM, L1, integrin, facyclin (Fas
ciclin) (Hirano, Protein Nucleic Acid Enzyme, 40, 724-735, 1995).

[0005] Here, the classification is roughly divided into three, but it cannot be classified in a strict sense. For example, Delta, which is classified here as a receptor-ligand molecule, is known to be a factor that transmits information to Notch and also has a function as an adhesion molecule (Artavanis-
Tsakonas et al., Science, 268, 225.
-232, 1995 and Fehon et al., Cell, 6
1, 523-534, 1990). In another example, an integrin classified as an adhesion molecule recognizes an RGD (Arg Gly Asp) sequence in the extracellular matrix and plays a role as a receptor molecule capable of transmitting information into cells (Watson et al., Original translation) Matsubara et al., Molecular Biology of Cell Third Edition, Kyoikusha, 995-1000, 199
5). Therefore, the classification of receptor-ligand molecules, extracellular matrix molecules, cell adhesion molecules is for convenience and the importance of these molecules for nervous system development and neural circuit formation is not distinguished by this classification. . Therefore, in the present invention, these molecules are collectively referred to as cell-acting molecules.

[0006] By the multiple action of a plurality of cell-acting molecules as described above, the generation, differentiation, tissue construction, localization of nerve cells, elongation of nerve fibers, bundle formation of nerve axons, formation of neural networks, etc. It is thought that the formation is performed continuously and concurrently, and a complex and specific brain / nervous system is formed.
However, despite the discovery of a variety of cell-acting molecules, the development of the nervous system and the formation of neural circuits remain largely unclear and are still one of the most biologically unknown fields. This is because organs of the nervous system are composed of heterogeneous cell groups, and there are numerous cell-acting molecules to integrate these cell groups, and furthermore, the concentration, density, affinity and time, It is thought that spatial expression plays an important role, but the types of cell-acting molecules that are currently understood are not yet sufficient, and there are unidentified cell-acting molecules that play an important role. It is thought that it is.

[0007]

An object of the present invention is to find a novel cell-acting molecule expressed in the brain and nervous system and to provide it as a polypeptide.

[0008]

Means for Solving the Problems EGF (epiderm)
The al growth factor (epidermal growth factor) motif is a molecular structure found in some of the important cell-acting molecules involved in the development of the brain and nervous system and the formation of neural circuits. The present inventors have focused on this point, and in addition to known molecules, cell-acting molecules having an EGF motif exist in the brain and nervous system, and these are important cell-acting molecules for brain and nervous system development and neural circuit formation. I thought it was working. Then, a gene database is searched, and an EST (expressed sequence ta) having a gene sequence encoding the EGF motif is searched.
gs) clones are searched and selected, and PCR (polymerase chain re
(action) A primer was prepared, and PCR was performed using cDNA derived from human fetal brain as a template to obtain a gene fragment homologous to the EST clone.

Using this gene fragment as a probe,
Screening by the hybridization method was performed, and the nucleotide sequence of the obtained clone was determined. As a result of earnest efforts, cloning of cDNA encoding the entire amino acid, including the nucleotide sequence of the gene fragment, was successful. The amino acid sequence deduced from this gene sequence is an LRR (leucine rich reppe) composed of four units.
at) sequence and a novel sequence having 9 EGF motifs. This sequence surprisingly plays a key role in Drosophila central nervous development (Slit) protein (Rothberg et al.,
Gene Dev, 4,2169-2187, 1990
And International Publication No. WO 92/10518) and about 41
% Homology.

Thus, the present inventors have named the novel polypeptide of the present invention human slit. As a result of Northern blotting using an antisense fragment of the DNA encoding the human slit,
Human slits are specifically expressed only in the brain in organs throughout the body, and their distribution in the brain is examined in detail. It was found to be strongly expressed in hippocampus and cerebral cortex.
Observation of the expression distribution of the human slit in the rat brain by in situ hybridization revealed that the expression was dependent on the layer structure of the hippocampus, cerebral cortex, and olfactory bulb, and it was presumed to act on the morphogenesis, maintenance, and regeneration of these tissues Was done. Further, the present inventors prepared a human slit expression system using DNA encoding the entire amino acid sequence of the human slit, and prepared a recombinant preparation of the polypeptide of the present invention. The amino acid sequence of the human slit and the nucleic acid sequence encoding the same are shown in SEQ ID NOs: 1 to 3 in the sequence listing. Furthermore, an antibody was prepared using the recombinant preparation as an immunogen, a purification method was established, and the present invention was completed.

That is, the present invention relates to (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 1 in the sequence listing,
(2) a DNA encoding the polypeptide described in (1) above, and (3) a DNA encoding the polypeptide described in (2) above as SEQ ID NO: 2.
(4) a recombinant DNA obtained by linking the DNA according to (2) and a vector DNA that can be expressed in a host cell, 5) cells transformed with the recombinant DNA of (4), (6) production of the polypeptide containing the amino acid sequence produced using the recombinant DNA of (4) A method, (7) an antibody that specifically recognizes the polypeptide described in (1), and (8) a method for diagnosing cancer using the antibody described in (7).

Hereinafter, the present invention will be described in detail. In the sequence listing, the amino acid sequence shown in SEQ ID NO: 1 is the amino acid sequence of the mature protein excluding the signal peptide of the human slit of the present invention. The nucleic acid sequence shown in SEQ ID NO: 2 is a cDNA sequence containing the human slit translation region, 5 ′ untranslated region and 3 ′ untranslated region of the present invention. The sequence shown in SEQ ID NO: 3 is the entire amino acid sequence including the signal peptide of the human slit of the present invention. The amino acid sequence shown in SEQ ID NO: 4 is a part of the amino acid sequence of the mouse slit first revealed in the present invention. The nucleotide sequence shown in SEQ ID NO: 5 is a part of the mouse slit cDNA sequence. The nucleotide sequence shown in SEQ ID NO: 6 is a part of the rat slit cDNA sequence, and the amino acid sequence shown in SEQ ID NO: 7 is a part of the rat slit amino acid sequence.
SEQ ID NOs: 8, 9, 10, 11, 12, 13, 15, 1
The base sequences 6, 17, and 18 are the sequences of PCR primers. The amino acid sequence of SEQ ID NO: 14 is a FLAG sequence. In each amino acid sequence shown in the sequence listing, the left end is an amino terminal (N-terminal), and the right end is a carboxyl terminal (C-terminal).
In each nucleic acid sequence, the left end is the 5 'end and the right end is the 3' end.

The importance of cell-cell and cell-substrate interacting molecules for nervous system development and neural circuit formation has been described above. Not only the nervous system, but also many of the molecules involved in these interactions of cells have structurally conserved domain structures for adhesion and binding. This domain structure includes an immunoglobulin (Ig) -like domain, a cadherin motif, a type III fibronectin repeat (FN
Type III repeat), LRR (leucine rich)
repeat) sequence, EGF (epidermal)
(growth factor) motif and the like are known.

The Ig-like domain is contained in many molecules belonging to the immunoglobulin superfamily, and is a cell adhesion molecule N-CAM expressed in various cells including nerve cells.
Both L1 and type II facyclins have five Ig-like domains (Molecular Biology of Cells, 3rd ed., 968-969).
The cadherin motif is normally contained in the cadherin family in five domain structures, including N-cadherin expressed in neural crest cells (Cell Biology Third Edition, 966-
968). FNIII type repeats are extracellular matrix molecules such as type III fibronectin and tenescin, N-CA
It is included in cell adhesion molecules such as M and L1. (Cellular Biology Third Edition, 986-988)

[0015] The LRR sequence is a recently reported NLRR-1 expressed in mouse nervous system cells (Taguchi et al., Mo.
l Brain Res, 35, 31-40, 199
6), NLRR-3 (Taniguchi et al., Mol.
Brain Res, 36, 45-52, 1996)
include. The steric structure of the LRP sequence contained in the porcine ribonuclease inhibitor has been clarified by crystal analysis (Kove et al., Nature, 3).
74, 183-186, 1995). In some molecules having an LRR sequence, the N-terminal side of the LRR sequence,
It has been reported that a conserved region also exists at the C-terminal side (Rothberg et al., Gene Dev, 4,216).
9-2187, 1990).

The EGF motif is a motif contained in receptor-ligand molecules such as Notch and Delta, which inhibit ectoderm differentiation into neuroblasts, and in extracellular matrix molecules such as tenescin and laminin. It is generally believed to have one Ca ²⁺ binding site. The three-dimensional structure of the EGF motif has been elucidated by crystallographic analysis (Rao et al., Cell,
82, 131-141, 1995). Some of these molecules have a structure in which the EGF motifs are arranged in tandem. In the case of Notch, 36 EGF motifs take a repeat structure, and the eleventh and twelfth EGF motifs are involved in binding to a ligand. (Fehon et al., Cell, 61, 523-53).
4, 1990).

Gene cloning of a novel protein targeting these domain structures can be performed by several methods. For example, a method of preparing a mixed PCR primer corresponding to the conserved amino acid sequence portion and obtaining a gene fragment corresponding to the amino acid sequence by PCR, or an oligo DN corresponding to the conserved amino acid sequence portion
A method of preparing an A probe and performing screening by a hybridization method, or when a gene group forming a family or a gene equivalent to a heterologous gene is known, a nucleic acid fragment corresponding to a conserved region of the known gene is used. As a probe, a method in which hybridization is performed under slightly lower specificity conditions and the like are generally performed. In any case, genomic DNA and cDNA can be used as a library.

In recent years, DNA sequencing technology has been improved, and attempts have been made to elucidate all genomic DNA and cDNA sequences of species such as humans, nematodes, and Arabidopsis by randomly sequencing genomic DNA and cDNA libraries (Genome). Directory, Nature,
377, 3S, 1995). For human cDNA,
TIGR (The Institute for Ge)
The EST project by Nomic Research, the EST project by the University of Washington-Merck, the STS project by the University of Colorado, and others have entered this business. CD submitted by these institutions
The partial nucleotide sequence of NA is registered and disclosed in the gene databases of Genbank and EMBL. Genbank release 9 issued in October 1995
According to No. 1, the cumulative number of registered EST clones was about 330,000, and the average length was 346 base pairs (bp). Therefore, a novel gene can be cloned by preparing a probe for the hybridization method based on the nucleotide sequence of the EST clone (NLRR-1 and NLRR-3 described above).

The present inventors have selected about 30 types of known molecules having the above-mentioned various domain structures and expressed in the nervous system, and using a base sequence encoding the relevant domain structure as a template, a gene database. A homology search was performed on EST clones registered in Genbank Release 91 (Genetyx-CD, manufactured by Software Development Co., Ltd.). The algorithm used for the search is Gene
A program with built-in tyx-CD software was used.
As a result, about 600 EST clones having about 60% or more gene sequence homology were candidates. The gene sequences of these clones together with the complementary sequence
Each clone was translated into six amino acid sequences, and it was examined whether the clone had the corresponding amino acid sequence. At this time,
Since the nucleotide sequence reported in the EST clone often has a missing sequence, a duplication, or an unknown sequence represented by N, the amino acid sequence was carefully generated in consideration of changes in the amino acid frame.

In particular, several tens of bp at both ends of the sequence information have almost no E-code because of the appearance of an apparent stop codon or an unknown sequence.
The amino acid frame could not be assembled at all in the ST clone, and about 100 bp in total at both ends was not practically useful sequence information. An EST clone having only short fragment information of about 200 bp or less was excluded from the candidates because it was too short to be suitable as a hybridization probe for screening in consideration of the above reasons. Of the EST clones finally remaining as candidates, Genban
The two clones, k accession numbers H14216 and T08049, were found to have the same nucleotide sequence information encoding the EGF motif, and the inventors prepared PCR primers based on this information as in Example 1. Then, a PCR reaction was performed using a mixed solution of cDNA derived from human fetal brain (manufactured by Clontech) as a template. The PCR product thus obtained was subcloned into a plasmid vector, and DNA sequencing confirmed that the nucleotide sequence contained a nucleotide sequence homologous to the EST clone.

Next, using the thus obtained DNA fragment, a human genomic gene library or cDNA
It is possible to obtain the full length of the target gene from the library. Full-length cloning can be obtained by labeling a DNA fragment partially cloned by the above-described method with an isotope label and various non-isotopic labels, and screening the library by a method such as hybridization. As a method for labeling the isotope, for example, a method of labeling the end using [ ³² P] γ-ATP and T4 polynucleotide kinase, a labeling method by another nick translation method, a primer extension method, or the like can be used.

As shown in Example 2, the present inventors
The DNA fragment obtained by CR is labeled with a radioisotope, used as a hybridization probe, and used as a screening library.
A and the like were used to perform screening and the like, and the DNA sequences of the obtained clones were determined. These were finally cDNAs derived from a single mRNA and consisting of the nucleic acid sequence shown in SEQ ID NO: 2 in the sequence listing. It was estimated. This DNA
The sequence contains 15 codons, from the start codon starting at position 233 (ATG) to the stop codon ending at position 4837 (TAG).
There was an open reading frame that could encode a 34 amino acid sequence. The amino acid sequence translated from the open reading frame is shown in SEQ ID NO: 3.
The plasmid pBSSlit containing the DNA containing the open reading frame was introduced into E. coli strain DH5 (manufactured by Toyobo). The strain, E. coli. coli:
DH5-pBSSlit was deposited on October 28, 1996 under the accession number FERM P-15920 at the Research Institute of Biotechnology and Industrial Technology, Ministry of International Trade and Industry, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan. .

The nucleotide sequence of this DNA (SEQ ID NO: 2 in the sequence listing) was compared with the nucleotide sequence of a known gene in a gene database (Genbank, Release 93, 1996). Other than admitted, no matching sequences were found, and thus are entirely novel sequences with respect to the entire sequence. Similarly, this amino acid sequence (SEQ ID NO: 1 in the sequence listing) was
ank (Release 93, 1996) and Swiss-P
rot (Release 32, 1995, November) compared with the known amino acid sequence, but no identical sequence was found.
This sequence is a completely new sequence. However, as a sequence having relatively high homology, Drosophila melanogaste (Drosophila melanogaste)
r) a slit (S) that plays an important role in neurogenesis
lit) molecules were found to have about 41% homology in amino acid sequence.

Further, a lower animal, a nematode (Caenorh)
Abditis elegans was found to have 33% homology partially (599 amino acids) with the amino acid sequence deduced from a part of the nucleotide sequence of the genomic DNA fragment (cosmid clone F40E10).
The presence of a homolog of the slit protein has not been reported in vertebrates, and there is no description in the Drosophila slit (International Publication No. WO92 / 10518) suggesting a homolog of vertebrates. The amino acid sequence has been elucidated for the first time.
Further, the homology of the open reading frames of the Drosophila slit and the human slit is only about 50%, and it is quite impossible to clone a human slit by a hybridization method or the like using a probe prepared based on the nucleotide sequence of the Drosophila slit. Have difficulty.

The amino acid sequence described in SEQ ID NO: 3 in the sequence listing was obtained by the method of Kyte-Doolittle (J. Mol. B.
iol. , 157: 105, 1982), the hydrophobic portion and the hydrophilic portion were analyzed from the amino acid sequence. As a result, it was presumed that the human slit of the present invention was a free secretory protein having a signal peptide and no cell membrane transit portion. That is, according to the analysis results, the amino acid sequence of the secretory precursor of the human slit is a polypeptide consisting of 1534 amino acid residues shown in SEQ ID NO: 3 in the sequence listing, and the signal peptide region is- It was estimated that 26 amino acid residues corresponding to -1st alanine from methionine 26th and 1508 amino acid residues corresponding to 1508 alanine from 1st tryptophan in the same sequence listing correspond to the secretory mature form region. However, this signal peptide cleavage site is only deduced from the amino acid sequence, and it is sufficiently conceivable that the actual cleavage site in a living body differs within 10 amino acids before and after.

As expected from the amino acid sequence, the portion to which the sugar chain is added is a portion to which N-acetyl-D-glucosamine can be bonded to the N-glycoside, and the portion at position 46 in the amino acid sequence of SEQ ID NO: 1 in the sequence listing is considered. 166th, 38
No. 0, 545, 604, 736, 775, 78
No. 0, 1000, 1053, 1163, 1233
No. 1280 and 1429 asparagine residues. Generally, it is considered that a protein to which a sugar chain is added is more stable against degradation in vivo than a polypeptide itself, and has a strong physiological activity. Therefore, in the amino acid sequence of the peptide containing the sequence of SEQ ID NO: 1 or 3 in the sequence listing, N-acetyl-D-glucosamine is a sugar chain such as N-glucoside or N-acetyl-galactosamine, which is N-glucoside or O-glucoside. A polypeptide comprising a glucosidic bond is also included in the present invention.

Analysis of the domain structure of the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing revealed that the human slit was composed of a dense domain structure in almost the entire polypeptide. That is, the LRR sequence arranged in tandem and the N-terminal conserved region (LRR)
-NR) and the C-terminal conserved region of LRR (LRR-CR)
This unit is composed of four units, and these units are consecutively arranged from the N-terminus. Immediately after that, six EGF motifs are arranged in tandem. After that, three EGF motifs are arranged again. .

More specifically, LRR-NR (LRR-NR1) of the first unit is represented by SEQ ID NO: 1 in the sequence listing.
In the amino acid sequence described in No. 8 cysteine to No. 39 arginine, the first unit LRR sequence (LRR1) has a repeat structure of 7 times, and in the same sequence listing, No. 40 leucine to No. 189 asparagine; 1 unit LRR
-CR (LRR-CR1) is histidine at position 190 to serine at position 255 in the same sequence listing, and LRR- of the second unit.
NR (LRR-NR2) is a glutamic acid from the 256th cysteine to 287th glutamic acid in the same sequence list, the LRR sequence of the second unit (LRR2) has a repeat structure of 6 times, and 413 asparagine from the 288th isoleucine in the same sequence list; LRR-CR (LRR-CR2) of the second unit is 414th to 486th valine of the same sequence listing, and LRR-NR (LRR-NR3) of the third unit is 48th of the same sequence listing.
The 7th cysteine to the 518th glutamic acid, the third unit LRR sequence (LRR3) has a repeat structure of 6 times, and the same sequence listing as the 519th leucine to the 645th asparagine and the 3rd unit LRR-CR (LRR- CR
3) is LRR-NR (LRR-NR4) of the fourth unit from 646th glutamine to 707th glutamine in the same sequence listing
Is glutamic acid from position 708 to position 739 of glutamic acid in the same sequence list, and LRR (LRR4) of the fourth unit has a repeat structure of 5 times.
No. 0 asparagine, fourth unit LRR-CR (LR
R-CR4) corresponds to proline 841 to 902 in the same sequence listing.
Leucine No. 1, the first EGF motif is cysteine No. 903 to 935 of the same sequence list, the second EGF motif is cysteine No. 942 to cysteine No. 9 of the same sequence list, and the third EGF motif is cysteine No. 983 to Cysteine No. 1014 of the same sequence list. The fourth EGF motif is cysteine No. 1021 to cysteine No. 1054, the fifth EGF motif is cysteine No. 1061 to cysteine No. 1092, and the sixth EGF motif is cysteine No. 1105 to cysteine No. 1136 of the same sequence list. The 7EGF motif is a cysteine from position 1316 to 1347 of the same sequence list, the eighth EGF motif is a cysteine from position 1355 to cysteine 1386 in the sequence list, and a ninth EGF motif is 1 from position 1396 cysteine in the sequence list. No. 27 cysteine, of the sequence listing 14
Cysteine 33 to cysteine 1507 are cysteine-rich regions, of which 1434 to 14
R that is an adhesion domain with integrin
There is a GD (Arg GlyAsp) motif.

The structure of the Drosophila slit (Rot)
hberg et al., Gene Dev, 4,2169-21.
87, 1990 and International Publication No. WO 92/1051.
8) indicates that there are four units consisting of LRR-NR, LRR, and LRR-CR. Regarding the detailed structure of the LRR repeat, LRR1 is a human LR
Drosophila 6 times for the repetition of R, LRR
As for No. 3, the difference between Drosophila 5 times and human 6 times was recognized. Regarding the EGF motif, there are seven humans and nine Drosophila, and the seventh, eighth, and ninth human EGF motifs take a triple repeat structure, whereas only one Drosophila. The cysteine-rich region near the C-terminal is conserved in the number and position of cysteines in human-Drosophila, but there is no RGD motif in Drosophila. Also, two cysteines between the two separate repeat groups of the EGF motif are conserved. That is, in humans, they are Nos. 1287 and 1313 of SEQ ID NO: 1 in the sequence listing.

It has been reported that two types of transcripts exist in the Drosophila slit after the seventh EGF motif by alternative splicing. No alternative splicing was found for the human slit clones sequenced by the present inventors, but the Northern blotting described in Example 3 shows that in addition to the main band of about 8.4 kb, 1
A band of about 5.9 kb in which the expression was weak was observed,
It was assumed that transcripts with different sequences were present.

Regarding nematodes, the cosmid clone C
EF40E10 is a 27016 bp DNA derived from the genome
It is presumed to encode multiple proteins, including fragments. The nucleotide sequence encoding the slit-like amino acid sequence starts from the 5 'end of the insert of this cosmid clone, so the putative slit-like protein (hereinafter, nematode slit) amino acid sequence is reported only in the middle. It has not been. That is, this nematode slit is LR
It is presumed that it starts from the middle of R-CR4 and includes the entire EGF motif region and extends to the C-terminus. From the amino acid sequence of this fragment, it is inferred that the nematode slit has seven EGF motifs like the Drosophila slit. According to this guess, LRR-CR4
The last three cysteines contained in the sequence are conserved among three species: human, Drosophila and nematode.

The first EGF motif repeats six times in all three types. However, in C. elegans, the cysteine of the third EGF motif is an odd number of seven, and it is unclear whether disulfide bonds are well bound. Two EGF
There are two cysteines between all three motif repeats, and amino acids other than cysteine are relatively conserved. In the latter half of the EGF motif, there is one Drosophila and one C. elegans, but only three humans. Although the cysteine-rich region has three species and the number and position of cysteines are conserved, only the last cysteine is not found in nematodes.

Table 1 shows the LRR repeat structure, LRR-NR structure and LRR-CR structure consisting of four units. However, the abbreviations used in the table are A: Al
a, B: Asx, C: Cys, D: Asp, E: Gl
u, F: Phe, G: Gly, H: His, I: Il
e, K: Lys, L: Leu, M: Met, N: As
n, P: Pro, Q: Gln, R: Arg, S: Se
r, T: Thr, V: Val, W: Trp, x: Xa
a, Y: represents Tyr. Kyte-Doolit
Le et al. (J. Mol. Biol., 157, 10).
5, 1982), the abbreviation U for hydrophobic amino acids (Ile, Val, Leu, Phe) having a hydrophobicity index of 2.8 or more, and the hydrophilic amino acids (His, Glu, Gln, Asp, Asn,
Lys, Arg) is represented by the abbreviation J.

Regarding the LRR, the fifth, eighth, eleventh, fourteenth, sixteenth, and second from the left of the common sequence in Table 1
It has been reported that the 1st and 24th amino acid residues are leucine or highly hydrophobic amino acids, and the 19th is asparagine (Hickey et al., Pro.
c. Natl. Acad. Sci. USA, 86, 67
73-6777, 1989) is the LRR of the human slit.
1, LRR2, LRR3, and LRR4 almost apply to this rule, and in particular, the 19th asparagine was all conserved. However, regarding the eighth amino acid of the LRR consensus sequence, in the human slit, the fourth stage of LRR1 is asparagine, the second stage of LRR2 is tyrosine, and the rule of leucine or a highly hydrophobic amino acid does not completely apply. .

With respect to LRR-NR, from the left of the consensus sequence in Table 1, the first, fifth, seventh, and fourteenth cysteines, the second and twenty-seventh prolines, the nineteenth leucine, and the twelfth from the left of the consensus sequence in Table 1. Valine reported (Rothbe
rg et al., Gene Dev, 4,2169-2187,
1990). From the left of the consensus sequence of Table 1 for the LRR-CR, from the left of the consensus sequence in Table 1, cysteine at positions 4, 6, 27, 48, leucine at position 8, leucine at position 10, tryptophan at position 30, proline at position 30,
The phenylalanine at position 46 was consistent with the above report.

[0036]

[Table 1]

Furthermore, as shown in Example 4, the present inventors used the nucleotide sequence information shown in SEQ ID NO: 2 in the sequence listing to obtain a mouse DNA fragment having high homology to the nucleotide sequence. Cloning was successful. D obtained
When the nucleotide sequence of the NA fragment was sequenced and the structure was examined, it was revealed that the fragment had the nucleotide sequence shown in SEQ ID NO: 5 in the sequence listing. The amino acid sequence deduced from this nucleotide sequence is shown in SEQ ID NO: 4 in the sequence listing. The amino acid sequence of the human slit corresponding to this amino acid sequence corresponds to amino acids 1171 to 1398 of glycine in the amino acid sequence described in SEQ ID NO: 1 in the sequence listing, and the amino acid sequence homology of this region is about 95%. This proved to be a part of the homolog of the mouse human slit (mouse slit). The amino acid sequence in vertebrates was well conserved compared to 41% homology between Drosophila and human.

A homology search (Genbank, Release 93, 1996) was performed on a human-derived EST clone using the nucleotide sequence shown in SEQ ID NO: 2 in the Sequence Listing revealed by the present inventors. % Of the clones having the homology of not less than Genbank accession numbers H14216 and T08049 used for the cloning of the present invention.
, But several clones showing 50% or more homology were found. When these clones were translated into amino acid sequences and compared with the amino acid sequence of SEQ ID NO: 3 in the sequence listing, the clone of Genbank accession number H10952 corresponds to the LLR-NR1 region corresponding to alanine 7 to isoleucine 71 in the same sequence listing. It contains 66% homology in 77 amino acid residues including the sequence. In addition, the clones of Genbank accession numbers T65521 and HSC33B121 have a common base sequence, and the amino acid sequence deduced from this sequence is LRR3 corresponding to 557th glycine to 657th glycine in the amino acid sequence described in SEQ ID NO: 1 in the sequence listing. From LRR-
It contains a sequence corresponding to the region up to CR3, where the homology is 70% out of 102 amino acid residues.

Further, Genbank registration number H6858
8, R78731 and T55690 clones have a common nucleotide sequence, and the amino acid sequence deduced from this sequence is calculated from glutamic acid at position 1224 to 1401 in the same sequence listing.
It contains a sequence corresponding to the region containing EGF7, EGF8, and EGF9, which is the cysteine number, and the homology in this region is 51% among 179 amino acid residues. From these facts, it was confirmed that the human slit of the present invention contained a mutant or a related molecule. Therefore, it is possible to clone human slit analogous molecules by using a method similar to the present invention based on these sequences.

The polypeptide of the present invention comprises the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing, and is produced by mutations such as intra-species mutations and allelic mutations known to occur in nature. Also, homologous variants of the polypeptide are included in the present invention. The novel polypeptide of the present invention may lack a part of the amino acid sequence described in SEQ ID NO: 1 in the sequence listing, or may be partially mutated by point mutation. Those which do not lose the property of SEQ ID NO: 1 in the sequence listing of the polypeptide of the present invention are included in the present invention. However, Genba
Polypeptides consisting solely of the amino acid sequence region corresponding to the DNA sequence revealed by the clones of nk accession numbers H14216 and T08049 are excluded from the present invention.

In addition, the N-terminal or C
At the end, some amino acid residues and peptide residues may be added. Furthermore, the present invention also includes those in which a sugar chain such as N-acetyl-D-glucosamine or N-acetyl-D-galactosamine is bonded to the amino acid sequence by an N-glycoside or o-glycoside bond. The homology between the above variant of the polypeptide and the amino acid sequence of the polypeptide is determined by Genbank accession number H10952,
T65521, HSC33B121, H68588, R
It is preferably 50% or more as compared with 78731 and T55690, and more preferably 90% or more as compared with a mouse slit.

Research in Drosophila (Rothbe
rg et al., Gene Dev, 4,2169-2187,
In 1990 and International Publication No. WO 92/10518), a slit is a protein that is specifically expressed in midline glial cells differentiated from mesoderm during neurogenesis, is secreted and transported along commissural axons, and grows cones. And localized at sites connecting to the myocardium. It is known that the Drosophila embryo, which is a mutant lacking the slit, is disrupted in the formation of the central nervous system and is killed during development. The appearance of slits in adults is unknown.

The use of the nucleotide sequence revealed by the present inventors enables detailed analysis of the expression and function of vertebrate slits using recent genetic manipulation techniques and developmental engineering techniques. That is, from 12mer to 16me having a part or the entire nucleotide sequence of SEQ ID NO: 2 in the sequence listing.
r or more, preferably 18 mer or more complementary nucleic acids,
That is, antisense DNA, RNA, and their methylated, methylphosphated, deaminated, or thiophosphated derivatives can be used for hybridization, PCR, or the like. As shown in Example 4, homologs of the present human slit of other vertebrates such as mice can be detected and gene cloning can be performed in the same manner. Furthermore, cloning of genes on the genome including humans is also possible.

The present inventors prepared a probe using the nucleotide sequence information shown in SEQ ID NO: 2 in the sequence listing to examine the mRNA expression site of the human slit as shown in Example 3, and labeled it with an isotope label. Then, Northern blotting of human-derived organs was performed. As a result, in the embryo, the strongest expression was observed in the brain, and weak expression was also observed in the lung and kidney. In adults, no expression was observed in organs other than the brain. Furthermore, the distribution of expression in the brain was examined in detail, and it was revealed that strong expression was observed in the cerebellum and hippocampus, but not in the cerebellum and spinal cord. These findings suggest that human slits are closely related to higher brain functions such as memory, spatial understanding, and creation. Invertebrate studies suggest that the slit acts as a guide for the formation of the central nervous system and growth cones in the peripheral nerves, whereas it is expressed not only in human embryos but also in adults, and even higher. The fact that it is specifically expressed in organs that have evolved uniquely in vertebrates was first clarified by the knowledge obtained by the present inventors. Also, among various cancer cell lines, lymphoblastoma leukemia cell line MOLT-4 and rectal epithelial cancer cell line SW480
It was clarified that human slits were expressed.

It has previously been shown that the use of the nucleotide sequence information of the human slit of the present invention allows the cloning of slit homolog genes of other vertebrates. In addition, using the gene of the slit homolog of experimental animals, in situ hybridization using tissue sections, regulation of expression by antisense oligomers and dominant negative, inactivation of transgenic mice, gene targeting mice, and genes related to this gene. It is possible to analyze the expression and function of vertebrate slits in detail by using any method such as the above-mentioned double knockout. By using the vertebrate slit homolog gene, it is also possible to analyze higher brain functions that cannot be obtained with the Drosophila slit gene whose neurogenesis processes differ greatly. Furthermore, extrapolation of these data to humans is possible.

The present inventors cloned a rat homolog of the human slit by the method described in Example 9 and in situ hybridized the expression of rat slit mRNA in rat brain and whole fetus by the method described in Example 10. Observed by the method. The rat slit was strongly expressed in the fetal cerebral cortex. The expression site in the adult brain was remarkable in the hippocampus, especially in the dentate gyrus and CA2 region. Relatively strong expression was also observed in the cerebral cortex, and expression was observed throughout the cortex. Among them, strong expression was observed along the sixth layer of the layer structure of the cortex. Expression is also observed in the olfactory bulb, where expression is present in the entire olfactory bulb, and the anterior olfactory nucleus in the olfactory bulb
eu) along with the layer structure. Lateral septal nucleus (lateral septal nucl)
eus) was also observed.

Further, from the results of the microautoradiography described in Example 10 (6), the rat slit was found to have hippocampus, cerebral cortex, amygdala,
rtical amygdaloid nucleus
Expression in specific details was observed. Cells expressing rat slits were generally refractory to cresyl violet stain and were relatively large nucleated cells. In particular, in the cerebral cortex, expression was observed around the cell body part of neurons having dendrites. From these results, it was strongly presumed that the rat slit was expressed in specific neurons and worked as a cell-acting molecule.

Taking into account the expression site of vertebrate slits revealed by the present inventors and the data revealed in Drosophila, the human slit of the present invention has a It was clarified to be involved in formation and its maintenance. Furthermore, considering the molecular structure of the human slit such as LRR and EGF motif, it is considered that the molecule is a cell-acting molecule involved in cell-cell interaction and cell-substrate interaction, and is considered to be neuron-glial cell, neuron-neuron, It is considered that it acts on the interaction between glial cells and glial cells and the interaction between these cells and the substrate. The presence of neural stem cells in the hippocampus, cerebral cortex, and olfactory bulb at the expression sites revealed by the present inventors has been reported (Weiss et al., Trend
ds Nuerosci. , 19, 387-393, 1
996), and is considered to be involved in the regeneration of nerve cells, considering the action of the EGF motif as a growth factor. Further, in the hippocampus, cerebral cortex, amygdala, and olfactory bulb, which are the expression sites, enormous research has been conducted on memory, learning, spatial recognition, creation, emotion, and the like (Paxinous et al., The Rat Nervous).
s System, Academic Press, 1
994), it is presumed that the slit is closely related to these higher brain functions. Therefore, the polypeptide of the present invention can be used as a therapeutic drug for nerve cell regeneration and diseases caused by brain degeneration such as Alzheimer's disease, Down's syndrome, and stroke, as an anti-dementia drug and an anxiolytic drug.

Using the nucleotide sequence information of the human slit, chromosome mapping on the genome and genomic sequence determination, followed by analysis of promoter and enhancer regions and splicing structure can be performed. If there is a genomic abnormality, it can be applied to gene diagnosis and gene therapy. Of the proteins having an EGF motif, 48
Deficiency of fibrillin with one EGF motif is known to cause the congenital disease Marfan syndrome (Pereira et al., Hum. Mol. Gene).
t. , 2, 961-968, 1993).

Drosophila slit is expressed in midline glial cells.
Single-minded (sim) is known (Klambt et al., Cell. 64,801-815,).
1991). sim is a basic helix-loop-helix (bHLH) -type transcriptional regulator, and overexpression of sim causes an increase in the number of slit-expressing cells (Nambu et al., Cell, 67, 1157-11).
67, 1991), the slit is closely related to sim. On the other hand, the human sim homolog gene hS
It has been reported that IM is located in the Down syndrome region on chromosome 21, and the association between hSIM and Down syndrome has been pointed out (Dahman et al., Proc. Nat.
l. Acad. Sci. USA, 92, 9191-91.
95, 1995). For these reasons, human slits may be associated with congenital and acquired brain and neurological diseases such as Down syndrome.

In recent years, with regard to gene therapy vectors for brain and nerve cells, neural vectors using lipid vectors and virus vectors such as adenovirus vectors, herpes simplex virus vectors, adeno-associated virus vectors, immunodeficiency virus vectors and foamy virus vectors. Gene transfer into cell lines has become possible. Regarding gene transfer into brain cells, it can be delivered to a specific site using a catheter. Also, a technique for arbitrarily controlling gene expression by improving a promoter region has been developed. If such peripheral technologies are further advanced, even if there is no abnormality in the genome, gene therapy can be actively performed for the purpose of improving brain function, treating dementia, etc., and regenerating nerve cells.

Since the human slit mRNA is not expressed in normal adult cells other than the brain but is expressed in certain types of cancer cells, the nucleotide sequence information of the human slit can be used for cancer genetic diagnosis. is there. That is, using mRNA of a part of an organ obtained by blood collection or pypsy, detection with a human slit-specific probe is performed by Northern blotting or the like.
Reverse transcription into DNA and PCR or other DNA using primers prepared based on the base sequence information of the human slit
By amplifying nucleic acid fragments by polymerase,
The mRNA of the human slit can be detected and used for cancer diagnosis. Further, since the human slit mRNA is specifically expressed only in the brain in normal adult cells, the promoter region of the human slit gene on the genome is cloned and inserted into an appropriate expression vector to convert any gene into a brain-specific gene. Technology that can be expressed in

Further, a reporter gene such as a luciferase gene is ligated downstream of the promoter, and transfected into appropriate cells.
For example, stimulation is performed using a peptide having an arbitrary sequence, or various compounds, or fermentation products of various microorganisms, and a factor that induces or inhibits expression of the human slit by comparing reporter gene expression. It is possible to screen for factors. The DNA encoding the cloned human slit of the present invention is:
It can be used as it is or digested with a restriction enzyme if desired. Cloned DNA
A region to be expressed can be excised from, and ligated downstream of a promoter in a vector suitable for expression to obtain a recombinant DNA.

Further, the form may be a single polypeptide, but a polypeptide having a complex form is also possible. The "composite" used in the present invention is not a mixture of two or more substances simply mixed,
A compound, conjugate, wherein one or more compounds have any mode of attachment, including covalent bonds,
Or a generic term for a complex. Examples of such a complex include a complex of the chimeric protein and the immunoglobulin via a covalent bond by a disulfide bond, or an antigen-antibody reaction between the polypeptide having the FLAG sequence prepared in Example 5 and an anti-FLAG antibody. Examples of the form include a complex.

Further, a method of expressing the protein as a chimeric protein with the Fc portion of human IgG and expressing it as a multimer via a disulfide bond by the hinge portion of the antibody, and a method of expressing the antibody recognition site at the C-terminal or the N-terminal. Expressed as a protein and expressed as C
A method of reacting with an antibody that specifically recognizes an N-terminal or N-terminal antibody recognition site to form a multimer is exemplified. Therefore, SEQ ID NO: 1 in the sequence listing having a dimer or higher form by genetic engineering techniques
The present invention also includes a compound containing a polypeptide having the described amino acid sequence. Examples of the vector include a plasmid derived from Escherichia coli, a plasmid derived from Bacillus subtilis, a plasmid derived from yeast, a bacteriophage such as λ phage, and an animal virus such as retrovirus and vaccinia virus. Any promoter may be used as long as it is appropriate for the host used for gene expression.

The recombinant DNA thus obtained can be obtained by transforming eukaryotic cells such as animal cells, insect cells, yeasts and molds, and prokaryotic cells such as bacteria and actinomycetes as hosts. Examples of cells that can be transformed include COS-1, a monkey cell as a eukaryotic cell,
Vero, Chinese hamster cells CHO, silkworm cells SF9 and the like, and prokaryotic cells include Escherichia and Bacillus. These transformed cells can be used to produce and purify the recombinant compound. For these operations, numerous methods are known by books (Krie
gler, Gene Transferand Exp
response-A Laboratory Manu
al, Stockton Pres, 1990 and Yokota et al., Bio Manual Series 4, Gene Transfer and Expression / Analysis, Yodosha, 1994).

By using the polypeptide thus obtained, it is possible to search for the physiological activity of the human slit. Human slits are also expressed in brain cells, especially in the cerebral cortex and hippocampus, in fetal lung and kidney. In Drosophila, it is specifically expressed at the midline during development, but in vertebrates, the corresponding sites are the bottom plate and the lid plate. By isolating tissues at these sites from experimental animals, or by using various cell lines to cause the polypeptide to act, it is possible to search for in vitro physiological activities. Further, by applying this assay system, it is possible to screen for a compound that inhibits the action of the polypeptide.

The human slit of the present invention has a polypeptide as a basic skeleton. Therefore, if used as a pharmaceutical, a lyophilized product of the polypeptide of the present invention having the above-mentioned form together with a suitable stabilizer, for example, human serum albumin, is prepared, and dissolved or dissolved in distilled water for injection at the time of use. A shape that can be used in suspension is desirable. For example, 1 to 1
It can be provided as an injection or a drop prepared at a concentration of 000 μg / ml. We have determined that the polypeptide of the present invention 1 mg / ml, human serum albumin 1 mg / ml
Then, it was confirmed that the physical and chemical properties of the polypeptide were maintained over a long period of time. Regarding the toxicity of the polypeptide, 10 mg / Kg was intraperitoneally administered to mice, but no death cases of the mice were confirmed.

The in vivo physiological activity of the human slit of the present invention can be determined by administering to any disease model mouse or an animal such as a rat or monkey exhibiting a symptom similar to that of a disease model. It becomes possible by examining recovery of physiological functions and abnormalities. Alternatively, if an experimental animal is used and a model system of behavioral physiology such as learning ability and spatial recognition is used, it is possible to examine the effect on higher brain functions. Of course, since these results can be extrapolated to humans, it is possible to obtain effective data for evaluating the efficacy of the polypeptide of the present invention. When the human slit of the present invention is used as a medicine, the field of application is any neurological disease, preferably a disease caused by dysfunction of the cerebral cortex, hippocampus, and amygdala. The dosage at that time depends on the form and the like, but specifically, 10 μg / K
g to about 10 mg / Kg may be administered. In addition, a catheter or the like can be used as an administration method for administration into the brain.

An antibody that specifically recognizes the human slit can be prepared as described in Example 8. In addition, Antibodies a laboratory
manual, E.L. Harlow et al. , C
old Spring Harbor Laborat
or immunoglobulin genes isolated by various methods described in (ory) and gene cloning method, etc., and can also be produced by a recombinant antibody expressed in cells. The antibody thus produced can be used for purifying the polypeptide. That is, as shown in Example 8, if an antibody that specifically recognizes the polypeptide is used, human slits can be detected and measured, and can be used as a diagnostic agent for the above-mentioned diseases and the like. Further, no expression was observed in normal cells other than the brain from the results of Northern blotting in Example 3, and human slits were expressed in cancer cells of lymphoblastoma leukemia and rectal epithelial cancer. Therefore, the antibody was used as a diagnostic agent for cancer. Can be used.

By the method described in Example 11, the present inventors
The human slit in the culture supernatant of rectal epithelial cancer cell line SW480 and normal cells was detected using the anti-human slit antibody, and was detected only in the cancer cell line. Therefore, by detecting the human slit using the antibody from a blood sample or a biopsy sample of a patient suspected of having cancer,
Diagnosis of cancer is possible. Details of methods for diagnosing cancer using antibodies are described in the books of Kawai et al. (Clinical Laboratory, 33, 1989) and Urushizaki et al. Have been.

Incidentally, operations such as preparation of cDNA described in the present specification, examination of expression by Northern blot, screening by hybridization, preparation of recombinant DNA, determination of DNA base sequence, preparation of cDNA library, etc. Is commonly performed by those skilled in the art, and examples of the experimental book include Molecular Cloning, All, edited by Maniatis et al.
laboratorymanual, 1989, Ed
s. , Sambrook, J .; Fritsch, E .;
F. , And Maniatis, T .; , Cold S
spring Harbor Laboratory P
It can be easily implemented by following the Less. All of the enzymes and reagents to be used may be commercially available products, and unless otherwise specified, the objectives can be completely achieved according to the use conditions specified for the products.

[0063]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Embodiments of the present invention will be described below by way of example, but the present invention is not necessarily limited thereto. Example 1 Preparation of PCR primer and PCR As a PCR primer corresponding to the clone of Genbank accession number T08049, a sense primer T08049S having a base sequence shown in SEQ ID NO: 8 in the sequence listing and a base sequence shown in SEQ ID NO: 9 in the sequence listing A synthetic oligo DNA having the sequence of the antisense primer T08049A (both 20 mer) was prepared.

The synthetic oligonucleotide was prepared using a fully automatic DNA synthesizer based on the solid phase method. Fully automatic D
Applied Biosystems Company 391 as NA synthesizer
PCR-MATE was used. Carriers, solutions, and reagents having nucleotides and 3'-nucleotides immobilized thereon were used according to the manufacturer's instructions. The predetermined coupling reaction was terminated, and the oligonucleotide carrier from which the protecting group at the 5 'end had been removed with trichloroacetic acid was allowed to stand in concentrated ammonia at room temperature for 1 hour to release the oligonucleotide from the carrier. Next, in order to release the protecting groups for the nucleic acid and the phosphate, the reaction solution containing the nucleic acid was left at 55 ° C. for 14 hours or more in a concentrated ammonia solution in a sealed vial. Purification of each oligonucleotide from which the carrier and the protecting group were released was performed using an OPC cartridge manufactured by Applied Biosystems, and detritylated with 2% trifluoroacetic acid. The purified primer has a final concentration of 100p
mol / μl in deionized water and PCR
Used for

Amplification by PCR was performed as follows.
Human fetal brain-derived cDNA mixed solution (QUICK-Clo
ne cDNA, CLONTECH) (1 μl) and a 10 × buffer (500 mM KCl, 100 mM)
Tris-HCl (pH 8.3), 15 mM MgCl
₂ , 0.01% gelatin) 5 μl, dNTP Mixt
ure (manufactured by Takara Shuzo), 4 μl of the aforementioned sense primer T08049S (100 pmol / μl) and antisense primer T08049A (100 pmol / μl)
l) with 0.25 μl of each, and 0.2 of Taq DNA polymerase (AmpliTaq: 5U / μl, manufactured by Takara Shuzo)
μl, and finally distilled water to make a total volume of 50 μl, and then at 95 ° C. for 45 seconds, at 55 ° C. for 45 seconds, and at 72 ° C. for 2 seconds.
This cycle is defined as 35 cycles per minute.
After cycling, PCR was performed by leaving the mixture at 72 ° C. for 7 minutes. A part of this PCR product was subjected to 2% agarose gel electrophoresis, stained with ethidium bromide (manufactured by Nippon Gene Co., Ltd.), and observed under ultraviolet light to obtain about 250 bp of c.
It was confirmed that the DNA was amplified.

The total amount of the PCR product obtained by using the PCR primers corresponding to T08049 thus obtained was 2% prepared with low melting point agarose (GIBCO BRL).
After electrophoresis on an agarose gel and staining with ethidium bromide, a band of about 250 bp was cut out under ultraviolet irradiation, and the same volume of distilled water as the gel was added.
After heating for 0 min to completely dissolve the gel, an equal volume of TE
Add saturated phenol (Nippon Gene) and add 1500
After centrifugation at 0 rpm for 5 minutes, the supernatant was separated, and the same separation operation was performed using TE-saturated phenol: chloroform (1: 1).
1) Performed in solution and further in chloroform. The DNA was recovered from the finally obtained solution by ethanol precipitation.

PCRII Ve as a plasmid vector
ctor (Invitrogen, pCRII)
This plasmid vector and the above DNA
Are mixed so that the molar ratio becomes 1: 3, and T4 D
DNA was inserted into the plasmid vector using NA ligase (manufactured by Invitrogen). The pCRII into which the DNA was incorporated was used to prepare Escherichia coli One Shot Compe.
The gene was introduced into tent cells (Invitrogen), and ampicillin (Sigma) was added to 50 μl.
g / ml on an L-Broth (Takara Shuzo) semi-solid medium plate, leave at 37 ° C. for about 12 hours, randomly select colonies that have appeared, and L-Broth liquid containing the same concentration of ampicillin. Inoculate 2 ml of medium, 18
After culturing with shaking at about 37 ° C. for about hours, the bacterial cells were collected, the plasmid vector was separated using Wizard Mini Prep (promega) according to the attached instructions, and the plasmid vector was digested with the restriction enzyme EcoRI. When about 250 bp of DNA is cut out, the PCR
It was confirmed that the product had been integrated, and the plasmid vector clone thus confirmed
The nucleotide sequence of NA was examined with a fluorescent DNA sequencer (Applied Biosystems, model 373S), and it was confirmed that the nucleotide sequence was homologous to the nucleotide sequence of T08049 sandwiched between the primers. This clone was transformed into $ 9 / pC
It was named RII.

Example 2 Full-length cloning and nucleotide sequence determination of a novel human slit gene cDNA library derived from human fetal brain (cDNA inserted into lambda phage vector λgt-10,
CLONTECH) from Plaque Hybridization-
1x search for clones with full-length cDNA
The procedure was performed from 10 ⁶ plaques. The plaques appear on a nylon filter (Hybond N +: Amers).
ham), and the transferred nylon filter is treated with an alkali (1.5 M NaCl, 0.5 M NaO).
H on a filter paper impregnated with H for 7 minutes), and then neutralized (1.5 M NaCl, 0.5 M Tris-HC).
1 (pH 7.2), left on a filter paper impregnated with 1 mM EDTA for 3 minutes twice, and then SSPE solution (0.36 M NaCl, 0.02 M sodium phosphate (pH 7.7), 2 mM EDTA) After shaking for 5 minutes in a 2 × solution of the above, the plate was washed and air-dried. Then 0.4M
The filter was allowed to stand on a filter paper impregnated with NaOH for 20 minutes, shaken with a 5-fold concentration SSPE solution for 5 minutes, washed, and air-dried again. Using this filter, screening was carried out using a DNA fragment of about 250 bp described in Example 1 labeled with ³² P as a probe.

The above D labeled with the radioactive isotope ³² P
The NA probe was prepared as follows. That is, the ￥ 9 / pCRII described in Example 1 was digested with the restriction enzyme EcoRI, and electrophoresed on a low-melting agarose gel.
A 0 bp DNA fragment was purified and recovered. The obtained DNA fragment is labeled with a DNA labeling kit (Megaprime DN).
A labeling system: Amersha
m company). That is, DNA 25 ng
Add 5 μl of primer solution and deionized water to
Perform a boiling water bath for 5 minutes with 3 μl, then dNTP
10 μl of reaction buffer containing 5 μl of α- ³² P-dCTP
l and T4 DNA polynucleotide kinase solution 2μ
and a water bath at 37 ° C. for 10 minutes.
mn Sephadex G-50: manufactured by Boehringer Mannheim Co., Ltd.) and a boiling water bath for 5 minutes.
Used after cooling on ice for minutes.

The filter prepared by the above-described method was applied to an SSPE solution having a final concentration of 5 times each component, a Denhardt solution (5 times concentration) (manufactured by Wako Pure Chemical Industries, Ltd.), 0.5% SDS
(Sodium dodecyl sulfate) and 10 μg / ml of a denatured salmon sperm DNA (manufactured by Sigma) in a boiling water bath.
After shaking at 5 ° C. for 2 hours, it is immersed in a hybridization solution having the same composition as the pre-hybridization solution containing the ³² P-labeled probe by the method described above, and shaken at 55 ° C. for 16 hours to perform hybridization. Was.
Next, the filter was immersed in an SSPE solution containing 0.1% SDS, shaken at 55 ° C., washed twice, and further 0.1%
Immerse in a 10-fold diluted SSPE solution containing SDS,
Washed four times at ° C. After the washing, the filter was subjected to autoradiography using an intensifying screen. As a result, we picked up the clones that were strongly exposed,
Plaques were replated again, and screening was performed by the method described above, and a single clone was completely isolated.

The phage clones isolated were 27 clones. The phage of all these clones was prepared at about 1 × 10 ⁹ pfu according to the method described in the written description, the phage DNA was purified, digested with the restriction enzyme EcoRI, and pBluescript II K similarly digested with EcoRI.
S (Stratagene), hereinafter pBluesc
(indicated as ipt). When the nucleotide sequences at both ends of these clones were analyzed by a DNA sequencer using M13 reversal primers and M13 universal primers, clone # 51 was cloned from positions 3107 to 5094 of the DNA sequence of SEQ ID NO: 2 in the sequence listing, and clone # 9 was cloned. Nos. 1684 to 3853 in the same Sequence Listing, and # 43 clone is 2092 in the same Sequence Listing.
It was a clone containing the sequence corresponding to No. 4663. In addition, these clones, including the clones # 10 and # 17 obtained by analyzing a part of the nucleotide sequence, were used to prepare a deletion mutant using a kilosequencing deletion kit (manufactured by Takara Shuzo) according to the attached instructions. ,
The cDNA base sequence was analyzed from both 5 ′ and 3 ′ directions using a DNA sequencer. As a result, a nucleotide sequence corresponding to positions 1684 to 5094 of the same sequence listing was determined.

However, a stop codon was found at the position corresponding to position 4835 in the same sequence listing, but a sequence which could be judged as a start codon was not found on the 5 'side, so that 5'RA
Using a CE system (manufactured by Gibco-BRL) according to the attached instructions, 5'RACE (rapid ampli)
and the obtained DNA fragment was inserted into a pCRII vector, and the nucleotide sequence of this DNA fragment was examined using a DNA sequencer. As a result, the nucleotide sequence of nucleotides 1251 to 1702 of SEQ ID NO: 2 was determined. Clone RAC equivalent to
E1 was found and the nucleotide sequence of this clone was determined.
Further, 5′RACE was repeated in the same manner, and clone RACE corresponding to positions 257 to 1308 of the same sequence listing was obtained.
2 was found and the nucleotide sequence was determined.

Then, since a sequence which could be judged as a start codon could not be found yet, the sequence from positions 280 to 661 in the sequence listing was not found.
The DNA fragment slit corresponding to No.
CR method (however, as a sense primer of the nucleotide sequence described in SEQ ID NO: 10 in the sequence listing, {3-14S, SEQ ID NO: 11
As described antisense primers, {3-10A, P
(Clone RACE2 was used as a CR template)
And a human fetal brain-derived cDNA library was screened in the same manner as in the plaque hybridization described above.

As a result, 46 positive phage clones were obtained, and phage DNA was purified from some of these phage clones and digested with the restriction enzyme EcoRI.
Similarly, after integration into a pUC18 plasmid vector (manufactured by Toyobo Co., Ltd.) digested with EcoRI, the nucleotide sequence of both ends was analyzed using a DNA sequencer.
2.1 clones numbered 1 to 1270 in the sequence listing, #
2.8 clones are Nos. 1 to 786 of the same sequence listing, # 2.
Twenty clones were numbered 355 to 2679 in the same sequence listing, #
The 2.22 clone is a clone containing the nucleotide sequence corresponding to Nos. 293 to 2187 of the same sequence list, and the nucleotide sequence corresponding to Nos. 1 to 257 of the same sequence list of # 2.1 and # 2.8 clones. And 233 to 233 in the sequence listing
A start codon matching the amino acid frame corresponding to position 35 was found, and the nucleotide sequence around this was determined by Kozak et al. (J. Cell. Biol., 115, 887-90).
3, 1991), and confirmed that there was no difference in the initiation codon.

Next, a plasmid vector containing the full length of the human slit open reading frame was prepared.
That is, clone # 9 was replaced with restriction enzymes AflII and SphI.
And a DNA fragment of about 0.8 kb obtained by electrophoresis was cloned similarly to clone #
2.20 ligated into a DNA fragment of about 5 kb, which was designated as clone (355-3444) / pUC18, and clone (355-3444) / pUC18 was further restricted with restriction enzyme H
About 2.8 kb obtained by digestion with indIII and SphI
Was ligated to the approximately 4.7 kb DNA fragment of clone # 51 treated in the same manner, and this was cloned into clone (6
86-5094) / pBS, a DNA fragment of about 0.7 kb obtained by digesting clone # 2.1 with restriction enzymes SalI and HindIII, and a clone (686-5094) / pBS 7.4 kb similarly treated. All DNAs described in SEQ ID NO: 2 in the sequence listing
A plasmid pHSL containing a DNA fragment having a sequence was prepared. Plasmid pHSL was transfected into E. coli strain JM109. Further, a plasmid pBSSlit having a base sequence obtained by removing the 3 ′ non-transcribed region from the DNA sequence of the human slit contained in the plasmid pHSL was prepared,
The gene was introduced into Escherichia coli strain DH5 (manufactured by Toyobo). This strain, E. coli. E. coli: DH5-pBSSlit is the accession number FERMP from the Ministry of International Trade and Industry, Ministry of International Trade and Industry, National Institute of Advanced Industrial Science and Technology, 1-3-1 Higashi, Tsukuba, Ibaraki, Japan
No. 15920 was deposited on October 28, 1996.

Example 3 mR of a novel human slit by Northern blotting
Identification of NA Expression Site In order to examine the expression of mRNA of the human slit, Hu is a filter in which mRNA has been transcribed in advance.
man Multiple Tissue North
ern Blot, Human Multiple T
issue Northern Blot II, Hum
an Multiple TissueNorther
n Blot III, Human Fetal Multi
ipleTissue Northern Blot,
Human Cancer Cell Line Mu
single Tissue Northern Bl
ot, Human Brain Multiple T
issue Northern Blot, Human
Brain Multiple TissueNor
then Blot II, Human Brain
Multiple Tissue Northern
Using Blot III (all CLONTECH), from No. 280 to 66 of SEQ ID NO: 2 in the sequence listing described in Example 2
The DNA fragment slit corresponding to No. 1 was converted to a DNA labeling kit (MegaPrime DNA label) described above.
(Ling system: manufactured by Amersham)) and ³² P was labeled by the above-mentioned method, and the expression was examined.

As a result, expression was observed only in the brain of human adult tissues. However, heart, placenta, lung, liver, skeletal muscle, kidney, pancreas, spleen, prostate, ovary, thymus, testis, small intestine, large intestine, peripheral blood lymphocytes, stomach, thyroid,
No expression was found in the spinal cord, lymph nodes, trachea, adrenal gland, or bone marrow. In human fetal tissue, it is strong in the brain,
Weak expression was observed in the kidney, but not in the liver. In cancer cells, the lymphoblastic leukemia strain MO
Although expression was observed in LT-4 and colorectal epithelial cancer cell line SW480, promyelocytic leukemia cell line HL-60 and HeLa cell S
No expression was observed in three strains, chronic myeloma leukemia strain K562, Burkitt's lymphoma Raji strain, lung cancer strain A549, and melanoma G361. In brain tissue, strong expression was observed especially in the frontal lobe of the cerebral cortex, and hypothalamus amygdala and ca
udate nucleus, hippocampus, hypothalamus, sub
thalamic nucleus and putamen are expressed, and corpus callosum, s
Weak expression was observed in ubthalamic nigra, and no expression was observed in the thalamus, cerebellum, medulla oblongata, and spinal cord. In the organ in which expression was observed, a weak band of about 5.9 kb was observed in addition to the main band of about 8.4 kb.

Example 4 Cloning of a New Mouse Slit Gene Fragment Using a PCR primer prepared from the nucleotide sequence information shown in SEQ ID NO: 2 in the sequence listing, cDN derived from mouse fetal brain
Using the mixed solution A (manufactured by CLONTECH) as a PCR template, a DNA fragment of a mouse-derived slit homolog was cloned by performing a PCR reaction. A combination of more than 20 primers,
By examining the temperature conditions of the PCR reaction, the cloning of one kind of DNA fragment derived from the mouse slit was finally succeeded.

That is, as a PCR primer prepared from the nucleotide sequence information in the above sequence listing,
Base sequence sense primer ￥ 3-1S described in No. 2 and antisense primer ￥ 3-3A described in SEQ ID NO: 13
(100 pmol / μl each) 0.25 μl each,
1 μl of a mixed solution of cDNA derived from mouse fetal brain, 0.75 μl of polymerase of Expand High Fidelity (Boehringer Mannheim), 5 μl of 10-fold concentrated buffer, and 4 μl of dNTP Mixture (Takara Shuzo), and the entire volume was mixed Was added to distilled water so as to be 50 μl.

This mixture was subjected to 35 cycles of a cycle consisting of 95 ° C. for 45 seconds, 48 ° C. for 45 seconds and 72 ° C. for 2 minutes, and finally 35 cycles of this process at 72 ° C.
The PCR was performed by allowing the mixture to stand for minutes. This PCR product was subjected to 2% agarose gel electrophoresis, stained with ethidium bromide (manufactured by Nippon Gene Co., Ltd.), and then exposed to about 720 b under ultraviolet light.
Bands of p, 600 bp, 350 bp and 80 bp were observed. Of these, a band of about 720 bp was cut out, purified, and subcloned into a pCRII vector. Examination of the nucleotide sequence of this clone using a DNA sequencer revealed that the clone contained a novel nucleotide sequence represented by SEQ ID NO: 5 in the sequence listing. The amino acid sequence deduced from this nucleotide sequence is shown in SEQ ID NO: 4 in the sequence listing.

Example 5 Preparation of a Novel Human Slit Expression Vector Using the plasmid pHSL described in Example 2, an expression vector for a human slit chimeric protein was prepared. Eight amino acids at the C-terminus of the polypeptide at positions −26 to 1534 of the amino acid sequence of SEQ ID NO: 3 in the sequence listing, that is, a polypeptide having the amino acid sequence of SEQ ID NO: 14 in the sequence listing (hereinafter referred to as FLAG sequence) The cDNA encoding the chimeric protein with the added cDNA is ligated to an expression vector pMKITNeo (Maruyama et al., Available from Tokyo Medical and Dental University, Maruyama, 1991), which contains an SRα promoter and a neomycin resistance gene. An expression vector was prepared.

In preparing the above expression vector, first, p
An approximately 4.6 kb DNA fragment obtained by digesting HSL with restriction enzymes NruI and Aor51HI was digested with restriction enzymes E
ligated to pCRII digested with coRV,
A plasmid pHSLEN containing a DNA fragment corresponding to positions 208 to 4838 of the DNA sequence of SEQ ID NO: 2 between the RI site and the NotI site was prepared.
Next, a PCR reaction was carried out using the plasmid pHSLEN as a template under the same conditions as in Example 1 using the PCR primer FLAGNOT having the nucleotide sequence described in SEQ ID NO: 15 and the PCR primer SL1-S in SEQ ID NO: 16 in the sequence listing. A PCR product having a base sequence obtained by adding a cDNA encoding the FLAG sequence, a termination codon and a restriction enzyme NotI site after the base sequence from positions 4499 to 4834 of the nucleic acid sequence of SEQ ID NO: 2 was obtained.

The PCR product was inserted into a pCRII vector by the method described in Example 1, and the nucleotide sequence of the inserted DNA fragment was confirmed by a DNA sequencer.
I and NotI were digested, electrophoresed to cut out a DNA fragment of about 370 bp, ligated to a DNA fragment of about 8.2 kb of pHSLEN treated with the same restriction enzyme, and the plasmid thus prepared was pHSLFL
AG. pHSLFLAG is a DNA sequence encoding the FLAG sequence and the TGA of the termination codon between the EcoRI site and the NotI site in the multiple cloning site of pCRII in the DNA sequence from 209 to 4834 of the nucleic acid sequence of SEQ ID NO: 2 in the sequence listing. Connected D
NA fragment is included.

Next, pHSLFLAG was replaced with the restriction enzyme Eco.
3. About 4 obtained by digestion with RI and NotI and electrophoresis.
A 6 kb DNA fragment was obtained and pMK treated in the same manner.
An expression vector was constructed by connecting to ITNeo. This vector was named pMKIT / HSFLAG. In the same manner, a recombinant having no FLAG sequence
An expression vector for the human slit protein was prepared. That is, pHSLEN is digested with restriction enzymes EcoRI and NotI, ligated to pMKITNeo similarly treated, and a vector pMKIT / H expressing a cDNA encoding a polypeptide consisting of the amino acid sequence of SEQ ID NO: 3 in the sequence listing.
SL was constructed.

Example 6 Gene Transfer and Expression of Human Slit Expression Vector into Cells The expression vector prepared in Example 5 was obtained from COS-7 cells (available from RIKEN, Cell Development Bank, RCB053).
9) The gene was introduced. Culture of cells before gene transfer is D
-MEM (Dulbecco's modified MEM medium, GIBCO-B
RL) (10% FCS). The day before the gene transfer, the medium of the cells was changed, and the number of cells was increased to 5 × 10 ⁵ cells.
s / ml and cultured overnight. On the day of gene transfer, the cells were precipitated by centrifugation, washed twice by centrifugation with PBS (-), and then 1 × 10 ⁷ in 1 mM MgCl ₂ and PBS (−).
Cells were prepared at cells / ml. Gene transfer was performed by electroporation using a gene transfer device Gene Pulser manufactured by Bio-Rad. The above cell suspension is placed in a 500 μl electroporation cell (0.4 cm gap), and the expression vector p
20 μg of MKIT / HSFLAG was added, and the mixture was left on ice for 5 minutes. Thereafter, a voltage was applied twice under the conditions of 3 μF and 550 V, and the mixture was left at room temperature for 30 seconds and 1 minute. Thereafter, the cells were allowed to stand in ice for 5 minutes, and then the cells were seeded on a 10 cm-diameter cell culture dish in which 10 ml of the above-described medium had been previously dispensed, and cultured at 37 ° C. in a 5% carbon dioxide gas incubator.

The next day, the culture supernatant was removed, and the cells adhering to the dish were washed twice with 10 ml of PBS (-).
10 ml of serum-free D-MEM was added, and the mixture was further cultured for 7 days. The culture supernatant was recovered, and the buffer was replaced with PBS (-) using Centricon 30 (manufactured by Amicon), followed by 10-fold concentration. Using the sample thus obtained, the human slit FLA was obtained by Western blotting.
The expression of the G chimeric protein was confirmed. That is, the concentrated culture supernatant was subjected to SDS-PAGE using an SDS-PAGE electrophoresis tank and SDS-PAGE polyacrylamide gel (gradient gel 5-15%) manufactured by ACI Japan according to the attached instruction manual. Was. The sample was subjected to a reduction treatment by adding 2-mercaptoethanol (2-ME) and heating in a boiling water bath for 5 minutes, using a rainbow marker (for high molecular weight) manufactured by Amersham as a marker. It was prepared according to the attached instruction manual. S
After the completion of DS-PAGE, acrylamide gel is PVDF
BioR for membrane filter (manufactured by BioRad)
Transfer was performed using a mini-trans blot cell manufactured by Ad.

The filter thus prepared was subjected to Block Ace, TBS-T (20 mM Tris, 137 mM
NaCl (pH 7.6), 0.1% Tween 2
0) was shaken at 4 ° C. overnight to perform blocking. ECL western blotting detection system (Amersham
According to the instructions attached to the mouse monoclonal antibody Anti-FLAG M2 (manufactured by Kodak) as a primary antibody and peroxidase-labeled anti-mouse I as a secondary antibody
g sheep antibody (Amersham) was reacted. The reaction time of each antibody was 1 hour at room temperature.
The operation of shaking and washing at room temperature for 10 minutes in BS-T was repeated three times. After the last wash, the filters were removed using the ECL Western Blotting Detection System (Amersham).
5 min., Wrapped in polyvinylidene chloride wrap and exposed to an X-ray film.

As a result, the sample was observed to exhibit a band which reacts with an anti-FLAG antibody of about 200 kDalton, and contains the human slit FLAG chimeric protein, ie, the amino acid sequence of SEQ ID NO: 1 in the sequence listing of the present invention. Was produced. As a control, a culture supernatant of COS-7 cells into which the pMKITNeo vector was introduced was tested in the same manner, but no band reactive with the anti-FLAG antibody was detected.

Example 7 Purification of Human Slit FLAG Chimeric Protein Using Transgenic Cells Human Slit FLA Expression was Detected by the Method of Example 6
A large amount of COS-7 cell culture supernatant containing the G chimeric protein was prepared, and the chimeric protein was purified using an affinity column. That is, 2 liters of the culture supernatant obtained by the method described in Example 6 was used for Anti-FLAG.
Through a column filled with M2 Affinity Gel (manufactured by Kodak), the FLAG sequence of the human slit FLAG chimera protein and the gel Anti-FLAG
The chimeric protein was adsorbed to the column by the affinity of the antibody. As the column, a disposable column (manufactured by Bio-Rad) having an inner diameter of 10 mm was used, and 5 ml of the above gel was filled.

Next, a circulation type circuit of a culture supernatant tank → column → peristaltic pump → culture supernatant tank was assembled, and circulated at a flow rate of 1 ml / min for 72 hours to adsorb the chimeric protein onto the column. Thereafter, the column was washed with PBS (-) 35.
wash with 0.5M Tris-glycine (pH
3.0) eluted at 50 ml. Place 0.5M Tris-HC in a small tube (Falcon 2063) in advance.
1 (pH 9.5) was dispensed in an amount of 200 μl, and the eluate was collected in 25 ml fractions of 2 ml each, and each fraction was neutralized.

Each of 10 μl of the elution fraction of the chimeric protein purified by the above method was subjected to the reduction treatment described in Example 6, followed by SDS-PAGE electrophoresis using a 5-15% gradient polyacrylamide gel. After completion of the electrophoresis, silver staining was performed using Wako Silver Dye Kit II manufactured by Wako Pure Chemical Industries, Ltd. according to the attached instructions. A band of about 200 kDalton was detected in the eluted fractions from No. 4 to No. 8, and this molecular weight was consistent with the result of Western blotting using the anti-FLAG antibody obtained in Example 6. That is, separation of a pure human slit FLAG chimeric protein was confirmed.

Example 8 Preparation of Antibody Recognizing Novel Human Slit and Purification of Recombinant Human Slit Protein Human slit FLA purified by the method described in Example 7
After immunizing rabbits with the G chimeric protein as an immunogen and measuring the antibody titer, whole blood is collected, and serum is collected.
The anti-human slit rabbit polyclonal antibody was purified and prepared using an Econopack serum IgG purification kit manufactured by oRad according to the attached instruction manual. In addition, human slit FLA purified by the method described in Example 7
Using the G chimera protein as an immunogen, a mouse monoclonal antibody was prepared according to the method of Seisho. That is, the chimeric protein purified as described above was immunized subcutaneously or intradermally with Balb / c mice (manufactured by Japan SLC) at 10 μg per mouse. After the second immunization, blood was collected from the fundus and an increase in the antibody titer in the serum was observed. After the third immunization, the spleen cells of the mouse were removed, and the mouse myeloma cell line P3X63Ag8 (ATCC TIB9) and polyethylene glycol method were used. Cell fusion was performed. Hybridomas are selected in a HAT medium (manufactured by Japan Institute of Immunology), and a hybridoma strain producing an antibody recognizing a human slit in the medium by the enzyme antibody method is separated to specifically recognize the human slit. A hybridoma producing strain producing a mouse monoclonal antibody was established.

The thus-established culture supernatant of the hybridoma was used as the Mab TrapG II manufactured by Pharmacia.
Was used to purify and prepare an anti-human slit monoclonal antibody according to the attached instruction manual. An affinity column was prepared using this monoclonal antibody.
The preparation of the affinity column is performed by Pharmacia CN
This was performed using Br-activated Sepharose 4B according to the attached instruction manual. The coupling efficiency was 99.6%. A column having a size of ² cm ² × 1 cm was prepared from ² ml of this gel.

In the same manner as in Example 6, the plasmid pMK was used.
The culture supernatant containing the recombinant human slit protein obtained by culturing COS-7 cells transfected with ITNeo / HSL was applied to this column at 20 ml / hr.
Flow at the same speed, then PBS (-) at the same speed for 15m
1 flow to wash and finally 0.1 M sodium acetate,
Elution was performed with 0.5 M NaCl (PH 4.0). The eluate was collected in 1 ml portions, and 1M Tris-HC was added to each fraction.
1 (pH 9.5) was added in 200 μl portions to neutralize.
Further, according to the method described in Example 7, the purified protein was subjected to SDS-PAGE under reducing conditions, silver staining, and Western blotting, and the molecular weight was estimated. As a result, a band of about 200 kDalton was detected, which revealed that the recombinant human slit protein can be purified with this affinity column.

Example 9 Cloning of a New Rat Slit Gene Fragment SEQ ID NO: 17 in the Sequence Listing against the common sequence of the human slit nucleotide sequence described in SEQ ID NO: 2 in the Sequence Listing and the mouse slit nucleotide sequence described in SEQ ID NO: 5 in the Sequence Listing PCR
Primer HMSLIS and HM described in SEQ ID NO: 18
SLIA was prepared, and PCR was performed according to the method described in Example 4 using a mixed solution of cDNA derived from rat fetal brain (manufactured by CLONTECH) as a PCR template. In agarose electrophoresis, a DNA fragment of about 590 bp was detected, and this DNA fragment was purified and subcloned into a pCR2.1 vector (manufactured by Invitrogen).
This vector was designated as RSLI / pCR and used for fluorescent DNA
Analysis of the nucleotide sequence of the inserted DNA fragment by a sequencer revealed a novel nucleotide sequence of 591 bp. The nucleotide sequence obtained by removing the two PCR primers from this nucleotide sequence is shown in SEQ ID NO: 6 in the sequence listing. The amino acid sequence deduced from the nucleotide sequence is shown in SEQ ID NO: 7 in the sequence listing. The homology between the amino acid sequence and the amino acid sequence of the human slit shown in SEQ ID NO: 1 in the sequence listing and the amino acid sequence of the mouse slit shown in SEQ ID NO: 4 were approximately 96% and 100%, respectively.
The NA fragment was found to encode a rat homolog of the human slit.

Example 10 In Situ Hybridization of a Novel Rat Slit Gene (1) Construction of a Riboprobe-Producing Vector The vector PRSI / pCR containing the rat slit gene fragment obtained in Example 9 was obtained by using restriction enzymes KpnI and Xpn.
An approximately 600 bp DNA fragment obtained by digestion with hoI was ligated with a T7 RNA polymerase promoter and SP6.
Plasmid vector pGEM7Zf (+) having an RNA polymerase promoter (promega,
EM) described above and treated with the same restriction enzymes.
0 kb DNA fragment and ligated with plasmid RSL
It was named I / pGEM.

(2) Synthesis of ³⁵ S-labeled RNA probe An RNA probe was prepared using a riboprobe in vitro transcription system (Promega) based on the attached materials. That is, in producing a sense probe,
Plasmid RSLI / pGEM was linearized with a restriction enzyme XbaI, treated with a phenol / chloroform / isoamyl alcohol mixed solution (manufactured by BRL), and subjected to DNA precipitation by ethanol precipitation.
The fragments were recovered and dissolved in distilled water treated with diethyl polycarbonate (hereinafter referred to as DEPC water).
0.5 μl of A solution, 2 μl of 5 × transfer buffer attached to the kit, 0.5 μl of 100 mM dithiothreitol, R
0.5 μl Nase inhibitor solution, 10 mM AT
0.5 μl each of P, CTP and GTP solutions and [ ³⁵ S]
Add UTP (manufactured by Amersham) and mix well.
Further add 1 μl of RNA polymerase,
The reaction was carried out for 2 minutes, and 2 µl of DNase was added thereto.
The reaction was performed for 10 minutes.

To this reaction solution, 40 μl of DEPC water, 7.5
M ammonium acetate solution (25 μl), 10 mg / ml yeast tRNA (1 μl), ethanol (150 μl) and RN
A in order to precipitate A and further to shorten the RNA, this precipitate was added to a 0.1 M sodium carbonate solution (pH 10.3).
2) Dissolve in 200 μl, react at 45 ° C. for 45 minutes, stop the reaction by adding 1 μl of glacial acetic acid, precipitate the RNA again by the ethanol method described above,
Dissolved in μl. The radioactivity of 1 μl was measured with a liquid scintillation counter. The procedure for preparing the antisense probe is the same as the procedure for preparing the sense probe, except that the restriction enzyme XbaI is replaced with HindI.
II, T7 RNA polymerase was used in place of SP6 RNA polymerase.

(3) Preparation of Rat Paraffin-Embedded Section Specimens Adult rat brain sections and embryonic day 18 whole rat sections were prepared. Seven-week-old male Sprague Dawley rats were drawn whole blood by cardiac incision, perfused and fixed with 4% paraformaldehyde / PBS, and opened to remove the whole brain. After leaving the same tissue in the fixative overnight at 4 ° C., the meninges were removed in cold PBS, and the cold PBS, cold saline,
0% ethanol / 50% saline, 70% ethanol twice, 85% ethanol, 95% ethanol, 100%
Immerse in xylene / paraffin (1: 1) at 60 ° C. for 2 hours, then immerse in paraffin at 60 ° C. for 1 hour.
This was repeated twice, degassed in a vacuum oven at 60 ° C. overnight, then solidified at room temperature, and then stored at 4 ° C.

Further, a 10 μm thick section of this sample was prepared with a microtome, and 3-aminopropyltriethoxysilane (manufactured by Aldrich Chemical Co., Ltd.) was previously prepared.
Was attached to a slide glass coated with, and extended to prepare a paraffin-embedded section specimen. Pregnant rats of the Sprague Dawley strain were perfused and fixed in the same manner as in the 18-day embryonic rat, the fetus was removed by laparotomy, the same fixative was injected from the umbilical cord, and left overnight in the same fixative. A section specimen was prepared in the same manner as described above.

(4) In situ hybridization In in situ hybridization,
Except for the organic solvent, the reagents and buffers contained in Insitu Hybridization Regents (Nippon Gene) were used, and the test was carried out based on the attached materials. That is, the paraffin-embedded sections of the rat brain and rat fetus prepared in Example 10 (3) were treated three times with xylene,
3 times in 100% ethanol, 90% ethanol, 80%
Deparaffinize by immersion in ethanol, 70% ethanol, and 50% ethanol once each for 5 minutes to remove PB
S, immersed twice in PBS glycine buffer for 10 minutes each, further immersed in PBS twice for 3 minutes each, transferred the sample to a beaker containing acetylation buffer, and stirred with acetic anhydride (final concentration: 0. 25% V /
V) was slowly added dropwise over 5 minutes, stirred for another 15 minutes, and immersed twice in 4-fold concentration SSC for 10 minutes to wash the specimen. Next, the sample was immersed in 50% formamide / 2-fold concentration SSC at 50 ° C. for 1 hour to perform pre-hybridization.

Next, a hybridization solution was prepared. 50% formamide, 2 times concentration SSC, 1 μg /
μl tRNA, 1 μg / μl salmon sperm DNA, 1 μg
/ Μl bovine serum albumin, 93 μl hybridization buffer consisting of 10% dextran sulfate
Was added with 8.5 μl of 1.2 M dithiothreitol, and the RNA probe prepared in Example 10 (2) was further added to 10 ^6.
A hybridization solution was obtained by adding dpm. Hybridization solutions each containing a sense probe or an antisense probe were separately prepared.

Next, the sample subjected to prehybridization was taken out of the solution, allowed to stand horizontally with the section surface facing up, and 50 μl of the hybridization solution per sample was gently dropped on the section, and 2 μl of the hybridization solution was placed on the section. .5cm x 3cm
Of parafilm, this sample is 12cm × 12c
m, and the periphery of the Petri dish was sealed with a vinyl tape, followed by hybridization at 50 ° C. for 16 hours. As the sample used for hybridization, continuous sections prepared in Example 10 (3) were used, and hybridization was performed with a solution containing each of the sense and antisense probes.

Next, the parafilm was removed from the sample subjected to hybridization, and 50% formamide / 2
Washed twice in SSC at double concentration at 50 ° C. for 20 minutes, NT
Immersion in E buffer at 37 ° C for 5 minutes to a final concentration of 20
The plate was immersed in an NTE buffer containing RNase A at 37 ° C for 30 minutes at 37 ° C.
Immersion for 3 minutes at 50 ° C in 0.1 times concentration SSC.
The plate was washed three times for 20 minutes, immersed in 70% ethanol, 90% ethanol, 100% ethanol, xylene, 100% ethanol, and 100% ethanol for 3 minutes each for dehydration and air-dried.

(5) Autoradiography of ³⁵ S in the sample The sample hybridized with the probe in Example 10 (4) was a bio-imaging analyzer BAS-3000.
Autoradiography was performed using a Fuji Photo Film Co., Ltd. The operation followed the attached manual. An imaging plate for BAS-3000 for tritium detection was adhered to the section surface of the specimen via a polyvinylidene chloride wrap, and allowed to stand in a dedicated cassette at room temperature for 12 days. Next, the imaging plate was scanned with a BAS-3000 image reading device at a gradation of 4096, a resolution of 50 μm,
Images were read under the conditions of sensitivity 10000 and latitude 4. The results are shown in FIG. 1 and FIG.

FIG. 1 is a sagittal section specimen of an adult rat brain. AS in the figure is an antisense probe, S
Indicates that hybridization was performed with the sense probe. In the hybridization with the sense probe, nonspecific hybridization was not observed except for the background of the whole brain tissue section. In the specific hybridization with the antisense probe, strong expression was observed particularly in the layer structure of the hippocampus. Among them, expression in the dentate gyrus and CA2 region was remarkable. Relatively strong expression was also observed in the cerebral cortex. Expression was observed in the entire cortex, and among them, strong expression was observed along the sixth layer of the cortical layer structure. Expression in the olfactory bulb was also observed. There is expression throughout the olfactory bulb,
Anterior olfactory nucleus
strong expression was observed along the layer structure of U. cleus. Lateral septum (lateral septal)
nucleus) was also observed.

FIG. 2 is a section specimen of an embryonic day 18 rat. In the figure, AS indicates that hybridization was performed with an antisense probe, and S indicates that hybridization was performed with a sense probe. Specific expression was observed with the antisense probe in the cerebral cortex, and strong expression was observed throughout the cortex. These results indicate that the rat slit is involved in the formation and maintenance of the brain layer structure.

(6) Microautoradiography In order to further examine the rat slit mRNA-expressing cells in the sample, the sample prepared in Example 10 (4) was subjected to microautoradiography. That is, in a dark room, the emulsion NTB-2 (manufactured by Kodak) was heated to 42 ° C., 20 ml thereof was diluted with an equal volume of distilled water and kept at 42 ° C., and the sample was immersed in the emulsion for 5 seconds. After air-drying for a minute, the slide was put together with silica gel in a black plastic slide case. The case was sealed with vinyl tape, wrapped in aluminum foil to shield light, wrapped in a lead plate, and exposed to light at 4 ° C. for 6 months.

The sample was developed with a developer D-19 (manufactured by Kodak) at 20 ° C. for 5 minutes, washed in running water for 1 minute,
The cells were fixed with Fuji fix (manufactured by Fuji Photo Film Co., Ltd.) for 5 minutes and washed in running water for 30 minutes. Next, the specimen was immersed in a staining solution obtained by diluting cresyl violet (manufactured by Muto Chemical Co., Ltd.) with distilled water for 30 seconds, washed in running water for 10 minutes, and stained. In addition, the samples are 50%, 70%, 80%
%, 90%, and 100% ethanol, and then immersed in xylene twice for 3 minutes each for dehydration. 100 μl of Enterlan New (manufactured by Merck) was dropped on the section, and a cover glass was placed thereon. A 120 g weight was placed on the horizontal stand for 14 hours, and the section was sealed.

The specimen was irradiated directly with light on the side of a slide glass with a cold-lighting system (Model PICL-NEX manufactured by Japan PI Co., Ltd.) to illuminate silver particles precipitated in the specimen, and an inverted microscope (Olympus model) IX70) together with a phase contrast image. BAS
Similar to the result at -3000, no specific hybridization was observed with the sense probe, and specific hybridization was observed only with the antisense probe.

FIGS. 3 to 6 show sagi of adult rat brain.
It is a photograph in which a rat slit expression site of a specimen obtained by hybridizing a ttal section with an antisense probe is strongly magnified, in which the yellow-white particles in the photograph are silver particles precipitated.
FIG. 3 shows a bent portion of the dentate gyrus of the hippocampus. Cells expressing rat slit mRNA were hardly stained with cresyl violet, and were nucleated and relatively large cells. FIG.
Is a part of the hippocampal CA2 region, and cells expressing the mRNA were nucleated and relatively large cells, which did not easily stain cresyl violet. Figure 5 shows the occi of the cerebral cortex.
the sixth layer of the Cx.
Was hardly stained with cresyl violet, and expression was observed around the cell body portion of neurons having dendrites, but expression was not necessarily observed in all neurons. FIG. 6 shows the amygdala and the mRNA
Were cells that were not easily stained with cresyl violet and had a relatively large round morphology.

Example 11 Detection of Human Slit in Culture Supernatant of Colon Adenocarcinoma Cell Line SW480 Cell line SW480 (available from Dainippon Pharmaceutical Co.)
The cells were cultured in a 90 mmφ culture dish at 37 ° C. in a 5% CO ₂ atmosphere in an L-15 medium (available from Dainippon Pharmaceuticals) containing% FCS, and grown to confluence. The cells were washed three times with PBS (-), and a serum-free L-15 medium was added and cultured for 4 days. The culture supernatant was collected, and 2 ml of the supernatant was concentrated with Centricon 50 (manufactured by Amicon) and buffer-substituted with PBS, and concentrated to a final volume of 50 μl. This sample was prepared in Example 6.
Western blotting was performed according to the method described in (1). However, the anti-human slit rabbit polyclonal antibody described in Example 8 was used as the primary antibody for detection, and the peroxidase-labeled anti-rabbit Ig sheep antibody (Am) was used as the secondary antibody.
ersham). As a result, it was observed that the sample exhibited a band reacting with an anti-human slit antibody of about 200 kDalton, indicating that the colon adenocarcinoma cell line SW4
80 was found to secrete the human slit. As a control, a culture supernatant of normal human fibroblasts (available from Dainippon Pharmaceutical Co., Ltd.) was similarly tested, but no band was detected that reacted with the anti-human slit antibody.

[0113]

Industrial Applicability According to the present invention, there is provided a novel slit-like polypeptide specifically expressed in brain and tumor cells, a gene thereof, a production method thereof, and an antibody which specifically recognizes the polypeptide. For the diagnosis and treatment of diseases and cancers specific to

[0114]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1508 Sequence type: Amino acid Topology: Unknown Sequence type: Protein Origin Organism name: Human sequence Trp Arg Leu Gly Ala Ser Ala Cys Pro Ala Leu Cys Thr Cys Thr 1 5 10 15 Gly Thr Thr Val Asp Cys His Gly Thr Gly Leu Gln Ala Ile Pro 20 25 30 Lys Asn Ile Pro Arg Asn Thr Glu Arg Leu Glu Leu Asn Gly Asn 35 40 45 Asn Ile Thr Arg Ile His Lys Asn Asp Phe Ala Gly Leu Lys Gln 50 55 60 Leu Arg Val Leu Gln Leu Met Glu Asn Gln Ile Gly Ala Val Glu 65 70 75 Arg Gly Ala Phe Asp Asp Met Lys Glu Leu Glu Arg Leu Arg Leu 80 85 90 Asn Arg Asn Gln Leu His Met Leu Pro Glu Leu Leu Phe Gln Asn 95 100 105 Asn Gln Ala Leu Ser Arg Leu Asp Leu Ser Glu Asn Ala Ile Gln 110 115 120 Ala Ile Pro Arg Lys Ala Phe Arg Gly Ala Thr Asp Leu Lys Asn 125 130 135 Leu Arg Leu Asp Lys Asn Gln Ile Ser Cys Ile Glu Glu Gly Ala 140 145 150 Phe Arg Ala Leu Arg Gly Leu Glu Val Leu Thr Leu Asn Asn Asn 155 160 165 Asn Ile Thr Thr Ile Pro Val Ser Ser Phe Asn His Met Pro Lys 170 175 180 Leu Arg Thr Phe Arg Leu His Ser Asn His Leu Phe Cys Asp Cys 185 190 195 His Leu Ala Trp Leu Ser Gln Trp Leu Arg Gln Arg Pro Thr Ile 200 205 210 Glu Leu Phe Thr Gln Cys Ser Gly Pro Ala Ser Leu Arg Gly Leu 215 220 225 Asn Val Ala Glu Val Gln Lys Ser Glu Phe Ser Cys Ser Gly Gln 230 235 240 Gly Glu Ala Gly Arg Val Pro Thr Cys Thr Leu Ser Ser Gly Ser 245 250 255 Cys Pro Ala Met Cys Thr Cys Ser Asn Gly Ile Val Asp Cys Arg 260 265 270 Gly Lys Gly Leu Thr Ala Ile Pro Ala Asn Leu Pro Glu Thr Met 275 280 285 Thr Glu Ile Arg Leu Glu Leu Asn Gly Ile Lys Ser Ile Pro Pro 290 295 300 Gly Ala Phe Ser Pro Tyr Arg Lys Leu Arg Arg Ile Asp Leu Ser 305 310 315 Asn Asn Gln Ile Ala Glu Ile Ala Pro Asp Ala Phe Gln Gly Leu 320 325 330 Arg Ser Leu Asn Ser Leu Val Leu Tyr Gly Asn Lys Ile Thr Asp 335 340 345 Leu Pro Arg Gly Val Phe Gly Gly Leu Tyr Thr Leu Gln Leu Leu 350 355 360 Leu Leu Asn Ala Asn Lys Ile Asn Cys Ile Arg Pro Asp Ala Phe 365 370 375 Gln Asp Leu Gln Asn Leu Ser Leu Leu Ser Leu TyrAsp Asn Lys 380 385 390 Ile Gln Ser Leu Ala Lys Gly Thr Phe Thr Ser Leu Arg Ala Ile 395 400 405 Gln Thr Leu His Leu Ala Gln Asn Pro Phe Ile Cys Asp Cys Asn 410 415 420 Leu Lys Trp Leu Ala Asp Phe Leu Arg Thr Asn Pro Ile Glu Thr 425 430 435 Ser Gly Ala Arg Cys Ala Ser Pro Arg Arg Leu Ala Asn Lys Arg 440 445 450 Ile Gly Gln Ile Lys Ser Lys Lys Phe Arg Cys Ser Ala Lys Glu 455 460 465 Gln Tyr Phe Ile Pro Gly Thr Glu Asp Tyr Gln Leu Asn Ser Glu 470 475 480 cys Asn Ser Asp Val Val Cys Pro His Lys Cys Arg Cys Glu Ala 485 490 495 Asn Val Val Glu Cys Ser Ser Leu Lys Leu Thr Lys Ile Pro Glu 500 505 510 Arg Ile Pro Gln Ser Thr Ala Glu Leu Arg Leu Asn Asn Asn Glu 515 520 525 Ile Ser Ile Leu Glu Ala Thr Gly Met Phe Lys Lys Leu Thr His 530 535 540 540 Leu Lys Lys Ile Asn Leu Ser Asn Asn Lys Val Ser Glu Ile Glu 545 550 555 Asp Gly Ala Phe Glu Gly Ala Ala Ser Val Ser Glu Leu His Leu 560 565 570 Thr Ala Asn Gln Leu Glu Ser Ile Arg Ser Gly Met Phe Arg Gly 575 580 585 Leu Asp Gly Leu Arg Thr Leu Met Leu ArgAsn Asn Arg Ile Ser 590 595 600 Cys Ile His Asn Asp Ser Phe Thr Gly Leu Arg Asn Val Arg Leu 605 610 615 Leu Ser Leu Tyr Asp Asn Gln Ile Thr Thr Val Ser Pro Gly Ala 620 625 630 Phe Asp Thr Leu Gln Ser Leu Ser Thr Leu Asn Leu Leu Ala Asn 635 640 645 Pro Phe Asn Cys Asn Cys Gln Leu Ala Trp Leu Gly Gly Trp Leu 650 655 660 Arg Lys Arg Lys Ile Val Thr Gly Asn Pro Arg Cys Gln Asn Pro 665 670 675 Asp Phe Leu Arg Gln Ile Pro Leu Gln Asp Val Ala Phe Pro Asp 680 685 690 Phe Arg Cys Glu Glu Gly Gln Glu Glu Gly Gly Cys Leu Pro Arg 695 700 705 Pro Gln Cys Pro Gln Glu Cys Ala Cys Leu Asp Thr Val Val Arg 710 715 720 Cys Ser Asn Lys His Leu Arg Ala Leu Pro Lys Gly Ile Pro Lys 725 730 735 Asn Val Thr Glu Leu Tyr Leu Asp Gly Asn Gln Phe Thr Leu Val 740 745 750 Pro Gly Gln Leu Ser Thr Phe Lys Tyr Leu Gln Leu Val Asp Leu 755 760 765 Ser Asn Asn Lys Ile Ser Ser Leu Ser Asn Ser Ser Phe Thr Asn 770 775 780 Met Ser Gln Leu Thr Thr Leu Ile Leu Ser Tyr Asn Ala Leu Gln 785 790 795 Cys Ile Pro Pro Leu Ala Phe GlnGly Leu Arg Ser Leu Arg Leu 800 805 810 Leu Ser Leu His Gly Asn Asp Ile Ser Thr Leu Gln Glu Gly Ile 815 820 825 Phe Ala Asp Val Thr Ser Leu Ser His Leu Ala Ile Gly Ala Asn 830 835 840 Pro Leu Tyr Cys Asp Cys His Leu Arg Trp Leu Ser Ser Trp Val 845 850 855 Lys Thr Gly Tyr Lys Glu Pro Gly Ile Ala Arg Cys Ala Gly Pro 860 865 870 Gln Asp Met Glu Gly Lys Leu Leu Leu Thr Thr Pro Ala Lys Lys 875 880 885 Phe Glu Cys Gln Gly Pro Pro Thr Leu Ala Val Gln Ala Lys Cys 890 895 900 Asp Leu Cys Leu Ser Ser Pro Cys Gln Asn Gln Gly Thr Cys His 905 910 915 Asn Asp Pro Leu Glu Val Tyr Arg Cys Ala Cys Pro Ser Gly Tyr 920 925 930 Lys Gly Arg Asp Cys Glu Val Ser Leu Asn Ser Cys Ser Ser Gly 935 940 945 Pro Cys Glu Asn Gly Gly Thr Cys His Ala Gln Glu Gly Glu Asp 950 955 960 Ala Pro Phe Thr Cys Ser Cys Pro Thr Gly Phe Glu Gly Pro Thr 965 970 975 Cys Gly Val Asn Thr Asp Asp Cys Val Asp His Ala Cys Ala Asn 980 985 990 Gly Gly Val Cys Val Asp Gly Val Gly Asn Tyr Thr Cys Gln Cys 995 1000 1005 Pro Leu Gln Tyr Glu Gl y Lys Ala Cys Glu Gln Leu Val Asp Leu 1010 1015 1020 Cys Ser Pro Asp Leu Asn Pro Cys Gln His Glu Ala Gln Cys Val 1025 1030 1035 Gly Thr Pro Asp Gly Pro Arg Cys Glu Cys Met Pro Gly Tyr Ala 1040 1045 1050 Gly Asp Asn Cys Ser Glu Asn Gln Asp Asp Cys Arg Asp His Arg 1055 1060 1065 Cys Gln Asn Gly Ala Gln Cys Met Asp Glu Val Asn Ser Tyr Ser 1070 1075 1080 Cys Leu Cys Ala Glu Gly Tyr Ser Gly Gln Leu Cys Glu Ile Pro 1085 1090 1095 Pro His Leu Pro Ala Pro Lys Ser Pro Cys Glu Gly Thr Glu Cys 1100 1105 1110 Gln Asn Gly Ala Asn Cys Val Asp Gln Gly Asn Arg Pro Val Cys 1115 1120 1125 Gln Cys Leu Pro Gly Phe Gly Gly Pro Glu Cys Glu Lys Leu Leu 1130 1135 1140 Ser Val Asn Phe Val Asp Arg Asp Thr Tyr Leu Gln Phe Thr Asp 1145 1150 1155 Leu Gln Asn Trp Pro Arg Ala Asn Ile Thr Leu Gln Val Ser Thr 1160 1165 1170 Ala Glu Asp Asn Gly Ile Leu Leu Tyr Asn Gly Asp Asn Asp His 1175 1180 1185 Ile Ala Val Glu Leu Tyr Gln Gly His Val Arg Val Ser Tyr Asp 1190 1195 1200 Pro Gly Ser Tyr Pro Ser Ser Ala Ile Tyr Ser Ala Glu Thr Ile 1205 1210 1215 Asn Asp Gly Gln Phe His Thr Val Glu Leu Val Ala Phe Asp Gln 1220 1225 1230 Met Val Asn Leu Ser Ile Asp Gly Gly Ser Pro Met Thr Met Asp 1235 1240 1245 Asn Phe Gly Lys His Tyr Thr Leu Asn Ser Glu Ala Pro Leu Tyr 1250 1255 1260 Val Gly Gly Met Pro Val Asp Val Asn Ser Ala Ala Phe Arg Leu 1265 1270 1275 Trp Gln Ile Leu Asn Gly Thr Gly Phe His Gly Cys Ile Arg Asn 1280 1285 1290 Leu Tyr Ile Asn Asn Glu Leu Gln Asp Phe Thr Lys Thr Gln Met 1295 1300 1305 Lys Pro Gly Val Val Pro Gly Cys Glu Pro Cys Arg Lys Leu Tyr 1310 1315 1320 Cys Leu His Gly Ile Cys Gln Pro Asn Ala Thr Pro Gly Pro Met 1325 1330 1335 Cys His Cys Glu Ala Gly Trp Val Gly Leu His Cys Asp Gln Pro 1340 1345 1350 Ala Asp Gly Pro Cys His Gly His Lys Cys Val His Gly Gln Cys 1355 1360 1365 Val Pro Leu Asp Ala Leu Ser Tyr Ser Cys Gln Cys Gln Asp Gly 1370 1375 1380 Tyr Ser Gly Ala Leu Cys Asn Gln Ala Gly Ala Leu Ala Glu Pro 1385 1390 1395 Cys Arg Gly Leu Gln Cys Leu His Gly His Cys Gln Ala Ser Gly 1400 1405 14 10 Thr Lys Gly Ala His Cys Val Cys Asp Pro Gly Phe Ser Gly Glu 1415 1420 1425 Leu Cys Glu Gln Glu Ser Glu Cys Arg Gly Asp Pro Val Arg Asp 1430 1345 1440 Phe His Gln Val Gln Arg Gly Tyr Ala Ile Cys Gln Thr Thr Arg 1445 1450 1455 Pro Leu Ser Trp Val Glu Cys Arg Gly Ser Cys Pro Gly Gln Gly 1460 1465 1470 Cys Cys Gln Gly Leu Arg Leu Lys Arg Arg Lys Phe Thr Phe Glu 1475 1480 1485 Cys Ser Asp Gly Thr Ser Phe Ala Glu Glu Val Glu Lys Pro Thr 1490 1495 1500 Lys Cys Gly Cys Ala Leu Cys Ala 1505 1508

SEQ ID NO: 2 Sequence length: 5094 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin: Organism: Human Tissue type: Brain Sequence type Features Symbol representing features: CDS Location: 233. . 4834 Method for determining feature: S Symbol indicating feature: sig peptide Location of occurrence: 233. . 310 Method for determining feature: S Symbol representing feature: mat peptide Location: 311. . 4834 method to determine the characteristics: S sequence GCGAAACGGC AGAGGAGCCG AGCCCCCTCC GCCCAAGGCG CCCTCCCTCC GTCCGCGCAC 60 AGGCGCCGTC GCTTGGAGGA GCAAGGTGCC TCCCAGCCCG CAGGGGCGCC GCGCGCAAGC 120 CCGCGGGCTC TTCGGTGGCT CTGCCCCGGG ACTGCACCTG GAGGCGGCCC CGGACGGGGA 180 TGGTCAGCGG CTGCTGCCGT CTGGCTCGCG AGCGGGACGC TGTGAGGGCA CC 232 ATG GCG CTG ACT CCC GGG TGG GGG TCC TCG GCG 265 Met Ala Leu Thr Pro Gly Trp Gly Ser Ser Ala -26 -25 -20 GGG CCG GTC CGG CCG GAG CTC TGG CTG CTG CTG TGG GCA GCC GCG 310 Gly Pro Val Arg Pro Glu Leu Trp Leu Leu Leu Trp Ala Ala Ala -15- 10 -5 TGG CGC CTG GGT GCC TCG GCG TGC CCC GCC CTC TGC ACC TGC ACC 355 Trp Arg Leu Gly Ala Ser Ala Cys Pro Ala Leu Cys Thr Cys Thr 1 5 10 15 GGA ACC ACG GTG GAC TGC CAC GGC ACG GGG CTG CAG GCC ATT CCC 400 Gly Thr Thr Val Asp Cys His Gly Thr Gly Leu Gln Ala Ile Pro 20 25 30 AAG AAT ATA CCT CGG AAC ACC GAG CGC CTG GAA CTC AAT GGC AAC 445 Lys Asn Ile Pro Arg Asn Thr Glu Arg Leu Glu Leu Asn Gly Asn 35 40 45 AAC ATC ACT CGG ATC CAT AAG AAT GAC TTT GCG GGG CTC AAG CAG 490 Asn Ile Thr Arg Ile His Lys Asn Asp Phe Ala Gly Leu Lys Gln 50 55 60 CTG CGG GTG CTG CAG CTG ATG GAG AAC CAG ATT GGA GCA GTG GAA 535 Leu Arg Val Leu Gln Leu Met Glu Asn Gln Ile Gly Ala Val Glu 65 70 75 CGT GGT GCT TTT GAT GAC ATG AAG GAG CTG GAG CGG CTG CGA CTG 580 Arg Gly Ala Phe Asp Asp Met Lys Glu Leu Glu Arg Leu Arg Leu 80 85 90 AAC CGA AAC CAG CTG CAC ATG TTA CCG GAA CTG CTG TTC CAG AAC 625 Asn Arg Asn Gln Leu His Met Leu Pro Glu Leu Leu Phe Gln Asn 95 100 105 AAC CAG GCT TTG TCA AGA CTG GAC TTG AGT GAG AAC GCC ATC CAG 670 Asn Gln Ala Leu Ser Arg Leu Asp Leu Ser Glu Asn Ala Ile Gln 110 115 120 GCC ATC CCC AGG AAA GCT TTT CGG GGA GCT ACG GAC CTT AAA AAT 715 Ala Ile Pro Arg Lys Ala Phe Arg Gly Ala Thr Asp Leu Lys Asn 125 130 135 TTA CGG CTG GAC AAG AAC CAG ATC AGC TGC ATT GAG GAA GGG GCC 760 Leu Arg Leu Asp Lys Asn Gln Ile Ser Cys Ile Glu Glu Gly Ala 140 145 150 TTC CGT GCT CTG CGG GGG CTG GAG GTG CTG ACC CTG AAC AAC AAC 805 Phe Arg Ala Leu Arg Gly Leu Gl u Val Leu Thr Leu Asn Asn Asn 155 160 165 AAT ATC ACC ACC ATC CCC GTG TCC AGC TTC AAC CAT ATG CCC AAG 850 Asn Ile Thr Thr Ile Pro Val Ser Ser Phe Asn His Met Pro Lys 170 175 180 CTA CGG ACC TTC CGC CTG CAC TCC AAC CAC CTG TTT TGC GAC TGC 895 Leu Arg Thr Phe Arg Leu His Ser Asn His Leu Phe Cys Asp Cys 185 190 195 CAC CTG GCC TGG CTC TCG CAG TGG CTG AGG CAG CGG CCA ACC ATC 940 His Leu Ala Trp Leu Ser Gln Trp Leu Arg Gln Arg Pro Thr Ile 200 205 210 GGG CTC TTC ACC CAG TGC TCG GGC CCA GCC AGC CTG CGT GGC CTC 985 Gly Leu Phe Thr Gln Cys Ser Gly Pro Ala Ser Leu Arg Gly Leu 215 220 225 AAT GTG GCA GAG GTC CAG AAG AGT GAG TTC AGC TGC TCA GGC CAG 1030 Asn Val Ala Glu Val Gln Lys Ser Glu Phe Ser Cys Ser Gly Gln 230 235 240 GGA GAA GCG GGG CGC GTG CCC ACC TGC ACC CTG TCC TCC GGC TCC 1075 Gly Glu Ala Gly Arg Val Pro Thr Cys Thr Leu Ser Ser Gly Ser 245 250 255 TGC CCG GCC ATG TGC ACC TGC AGC AAT GGC ATC GTG GAC TGT CGT 1120 Cys Pro Ala Met Cys Thr Cys Ser Asn Gly Ile Val Asp Cys Arg 260 265 270 GGA AAA GGC CTC ACT GCC ATC CCG GCC AAC CTG CCC GAG ACC ATG 1165 Gly Lys Gly Leu Thr Ala Ile Pro Ala Asn Leu Pro Glu Thr Met 275 280 285 ACG GAG ATA CGC CTG GAG CTG AAC GGC ATC AAG TCC ATC CCT CCT 1210 Thr Glu Ile Arg Leu Glu Leu Asn Gly Ile Lys Ser Ile Pro Pro 290 295 300 GGA GCC TTC TCA CCC TAC AGA AAG CTA CGG AGG ATA GAC CTG AGC 1255 Gly Ala Phe Ser Pro Tyr Arg Lys Leu Arg Arg Ile Asp Leu Ser 305 310 315 AAC AAT CAG ATC GCT GAG ATT GCA CCC GAC GCC TTC CAG GGC CTC 1300 Asn Asn Gln Ile Ala Glu Ile Ala Pro Asp Ala Phe Gln Gly Leu 320 325 330 CGC TCC CTG AAC TCG CTG GTC CTC TAT GGA AAC AAG ATC ACA GAC 1345 Arg Ser Leu Asn Ser Leu Val Leu Tyr Gly Asn Lys Ile Thr Asp 335 340 345 CTC CCC CGT GGT GTG TTT GGA GGC CTA TAC ACC CTA CAG CTC CTG 1390 Leu Pro Arg Gly Val Phe Gly Gly Leu Tyr Thr Leu Gln Leu Leu 350 355 360 CTC CTG AAT GCC AAC AAG ATC AAC TGC ATC CGG CCC GAT GCC TTC 1435 Leu Leu Asn Ala Asn Lys Ile Asn Cys Ile Arg Pro Asp Ala Phe 365 370 375 CAG GAC CTG CAG AAC CTC TCA CTG CTC TCC CTG TAT GAC AAC AAG 1480 Gln Asp Leu Gln Asn Leu Ser Leu Leu Ser Leu Tyr Asp Asn Lys 380 385 390 ATC CAG AGC CTC GCC AAG GGC ACT TTC ACC TCC CtG CGG GCC ATC 1525 Ile Gln Ser Leu Ala Lys Gly Thr Phe Thr Ser Leu Arg Ala Ile 395 400 405 CAG ACT CTG CAC CTG GCC CAG AAC CCT TTC ATT TGC GAC TGT AAC 1570 Gln Thr Leu His Leu Ala Gln Asn Pro Phe Ile Cys Asp Cys Asn 410 415 420 CTC AAG TGG CTG GCA GAC TTC CTG CGC ACC AAT CCC ATC GAG ACG 1615 Leu Lys Trp Leu Ala Asp Phe Leu Arg Thr Asn Pro Ile Glu Thr 425 430 435 AGT GGT GCC CGC TGT GCC AGT CCC CGG CGC CTC GCC AAC AAG CGC 1660 Ser Gly Ala Arg Cys Ala Ser Pro Arg Arg Leu Ala Asn Lys Arg 440 445 450 ATC GGG CAG ATC AAG AGC AAG AAG TTC CGG TGC TCA GCC AAA GAG 1705 Ile Gly Gln Ile Lys Ser Lys Lys Phe Arg Cys Ser Ala Lys Glu 455 460 465 CAG TAC TTC ATT CCA GGC ACG GAG GAT TAC CAG CTG AAC AGC GAG 1750 Gln Tyr Phe Ile Pro Gly Thr Glu Asp Tyr Gln Leu Asn Ser Glu 470 475 480 TGC AAC AGC GAC GTG GTC TGT CCC CAC AAG TGC CGC TGT GAG GCC 1795 Cys Asn Ser Asp Val Val Cys Pro His Lys Cys Arg Cys Glu Ala 485 490 495 AAC GTG GTG GAG TGC TCC AGC CTG AAG CTC ACC AAG ATC CCT GAG 1840 Asn Val Val Glu Cys Ser Ser Leu Lys Leu Thr Lys Ile Pro Glu 500 505 510 510 CGC ATC CCC CAG TCC ACG GCA GAA CTG CGA TTG AAT AAC AAT GAG 1885 Arg Ile Pro Gln Ser Thr Ala Glu Leu Arg Leu Asn Asn Asn Glu 515 520 525 ATT TCC ATC CTG GAG GCC ACT GGG ATG TTT AAA AAA CTT ACA CAT 1930 Ile Ser Ile Leu Glu Ala Thr Gly Met Phe Lys Lys Leu Thr His 530 535 540 CTG AAG AAA ATC AAT CTG AGC AAC AAC AAG GTG TCA GAA ATT GAA 1975 Leu Lys Lys Ile Asn Leu Ser Asn Asn Lys Val Ser Glu Ile Glu 545 550 555 GAT GGG GCC TTC GAG GGC GCA GCC TCT GTG AGC GAG CTG CAC CTA 2020 Asp Gly Ala Phe Glu Gly Ala Ala Ser Val Ser Glu Leu His Leu 560 565 570 ACT GCC AAC CAG CTG GAG TCC ATC CGG AGC GGC ATG TTC CGG GGT 2065 Thr Ala Asn Gln Leu Glu Ser Ile Arg Ser Gly Met Phe Arg Gly 575 580 585 CTG GAT GGC TTG AGG ACC CTA ATG CTG CGG AAC AAC CGC ATC AGC 2110 Leu Asp Gly Leu Arg Thr Leu Met Leu Arg Asn Asn Arg Ile Ser 5 90 595 600 TGC ATC CAC AAC GAC AGC TTC ACG GGC CTG CGC AAC GTC CGG CTC 2155 Cys Ile His Asn Asp Ser Phe Thr Gly Leu Arg Asn Val Arg Leu 605 610 615 CTC TCG CTC TAC GAC AAC CAG ATC ACC ACC GTA TCC CCA GGA GCC 2200 Leu Ser Leu Tyr Asp Asn Gln Ile Thr Thr Val Ser Pro Gly Ala 620 625 630 TTC GAC ACC CTC CAG TCC CTC TCC ACA CTG AAT CTC CTG GCC AAC 2245 Phe Asp Thr Leu Gln Ser Leu Ser Thr Leu Asn Leu Leu Ala Asn 635 640 645 CCT TTC AAC TGC AAC TGC CAG CTG GCC TGG CTA GGA GGC TGG CTA 2290 Pro Phe Asn Cys Asn Cys Gln Leu Ala Trp Leu Gly Gly Trp Leu 650 655 660 CGG AAG CGC AAG ATC GTG ACG GGG AGA CCGA TGC CAG AAC CCT 2335 Arg Lys Arg Lys Ile Val Thr Gly Asn Pro Arg Cys Gln Asn Pro 665 670 675 GAC TTT TTG CGG CAG ATT CCC CTG CAG GAC GTG GCC TTC CCT GAC 2380 Asp Phe Leu Arg Gln Ile Pro Leu Gln Asp Val Ala Phe Pro Asp 680 685 690 TTC AGG TGT GAG GAA GGC CAG GAG GAG GGG GGC TGC CTG CCC CGC 2425 Phe Arg Cys Glu Glu Gly Gln Glu Glu Gly Gly Cys Leu Pro Arg 695 700 705 CCA CAG TGC CCA CAG GAG TGC GC C TGC CTG GAC ACC GTG GTC CGA 2470 Pro Gln Cys Pro Gln Glu Cys Ala Cys Leu Asp Thr Val Val Arg 710 715 720 TGC AGC AAC AAG CAC CTG CGG GCC CTG CCC AAG GGC ATT CCC AAG 2515 Cys Ser Asn Lys His Leu Arg Ala Leu Pro Lys Gly Ile Pro Lys 725 730 735 AAT GTC ACA GAA CTC TAT TTG GAC GGG AAC CAG TTC ACG CTG GTT 2560 Asn Val Thr Glu Leu Tyr Leu Asp Gly Asn Gln Phe Thr Leu Val 740 745 750 CCG GGA CAG CTG TCT ACC TTC AAG TAC CTG CAG CTC GTG GAC CTG 2605 Pro Gly Gln Leu Ser Thr Phe Lys Tyr Leu Gln Leu Val Asp Leu 755 760 765 AGC AAC AAC AAG ATC AGT TCC TTA AGC AAT TCC TCC TTC ACC AAC 2650 Ser Asn Asn Lys Ile Ser Ser Leu Ser Asn Ser Ser Phe Thr Asn 770 775 780 ATG AGC CAG CTG ACC ACT CTG ATC CTC AGC TAC AAT GCC CTG CAG 2695 Met Ser Gln Leu Thr Thr Leu Ile Leu Ser Tyr Asn Ala Leu Gln 785 790 795 TGC ATC CCG CCT TTG GCC TTC CAG GGA CTC CGC TCC CTG CGC CTG 2740 Cys Ile Pro Pro Leu Ala Phe Gln Gly Leu Arg Ser Leu Arg Leu 800 805 810 CTG TCT CTC CAC GGC AAT GAC ATC TCC ACC CTC CAA GAG GGC ATC 2785 Leu Se r Leu His Gly Asn Asp Ile Ser Thr Leu Gln Glu Gly Ile 815 820 825 TTT GCA GAC GTG ACC TCC CTG TCT CAC CTG GCC ATT GGT GCC AAC 2830 Phe Ala Asp Val Thr Ser Leu Ser His Leu Ala Ile Gly Ala Asn 830 835 840 CCC CTA TAC TGT GAC TGC CAC CTC CGC TGG CTG TCC AGC TGG GTG 2875 Pro Leu Tyr Cys Asp Cys His Leu Arg Trp Leu Ser Ser Trp Val 845 850 855 AAG ACT GGC TAC AAG GAA CCG GGC ATT GCT CGT TGT GCT GGG CCC 2920 Lys Thr Gly Tyr Lys Glu Pro Gly Ile Ala Arg Cys Ala Gly Pro 860 865 870 CAG GAC ATG GAG GGC AAG CTG CTC CTC ACC ACG CCT GCC AAG AAG 2965 Gln Asp Met Glu Gly Lys Leu Leu Leu Thr Thr Pro Ala Lys Lys 875 880 885 TTT GAA TGC CAA GGT CCT CCA ACG CTG GCT GTC CAG GCC AAG TGT 3010 Phe Glu Cys Gln Gly Pro Pro Thr Leu Ala Val Gln Ala Lys Cys 890 895 900 GAT CTC TGC TTG TCC AGT CCG TGC CAG AAC CAG GGC ACC TGC CAC 3055 Asp Leu Cys Leu Ser Ser Pro Cys Gln Asn Gln Gly Thr Cys His 905 910 915 AAC GAC CCC CTT GAG GTG TAC AGG TGC GCC TGC CCC AGC GGC TAT 3100 Asn Asp Pro Leu Glu Val Tyr Arg Cys Ala Cys Pro Ser Gly Tyr 920 925 930 AAG GGT CGA GAC TGT GAG GTG TCC CTG AAC AGC TGT TCC AGT GGC 3145 Lys Gly Arg Asp Cys Glu Val Ser Leu Asn Ser Cys Ser Ser Gly 935 940 945 CCC TGT GAA AAT GGG GGC ACC TGC CAT GCA CAG GAG GGC GAG GAT 3190 Pro Cys Glu Asn Gly Gly Thr Cys His Ala Gln Glu Gly Glu Asp 950 955 960 GCC CCG TTC ACG TGC TCC TGT CCC ACC GGC TTT GAA GGA CCA ACC 3235 Ala Pro Phe Thr Cys Ser Cys Pro Thr Gly Phe Glu Gly Pro Thr 965 970 975 TGT GGG GTG AAC ACA GAT GAC TGT GTG GAT CAT GCC TGT GCC AAT 3280 Cys Gly Val Asn Thr Asp Asp Cys Val Asp His Ala Cys Ala Asn 980 985 990 GGG GGC GTC TGT GTG GAT GGT GTG GGC AAC TAC ACC TGC CAG TGC 3325 Gly Gly Val Cys Val Asp Gly Val Gly Asn Tyr Thr Cys Gln Cys 995 1000 1005 CCC CTG CAG TAT GAG GGA AAG GCC TGT GAG CAG CTG GTG GAC TTG 3370 Pro Leu Gln Tyr Glu Gly Lys Ala Cys Glu Gln Leu Val Asp Leu 1010 1015 1020 TGC TCT CCG GAT CTG AAC CCA TGT CAA CAC GAG GCC CAG TGT GTG 3415 Cys Ser Pro Asp Leu Asn Pro Cys Gln His Glu Ala Gln Cys Val 1025 1030 1035 GGC ACC CCG GAT GGG CCC AGG TGT GAG TGC ATG CCA GGT TAT GCA 3460 Gly Thr Pro Asp Gly Pro Arg Cys Glu Cys Met Pro Gly Tyr Ala 1040 1045 1050 GGT GAC AAC TGC AGT GAG AAC CAG GAT GAC TGC AGG GAC CAC CGC 3505 Gly Asp Asn Cys Ser Glu Asn Gln Asp Asp Cys Arg Asp His Arg 1055 1060 1065 TGC CAG AAT GGG GCC CAG TGT ATG GAT GAA GTC AAC AGC TAC TCC 3550 Cys Gln Asn Gly Ala Gln Cys Met Asp Glu Val Asn Ser Tyr Ser 1070 1075 1080 TGC CTC TGT GCT GAG GGC TAC AGT GGA CAG CTC TGT GAG ATC CCT 3595 Cys Leu Cys Ala Glu Gly Tyr Ser Gly Gln Leu Cys Glu Ile Pro 1085 1090 1095 CCC CAT CTG CCT GCC CCC AAG AGC CCC TGT GAG GGG ACT GAG TGC 3 Pro His Leu Pro Ala Pro Lys Ser Pro Cys Glu Gly Thr Glu Cys 1100 1105 1110 CAG AAT GGG GCC AAC TGT GTG GAC CAG GGC AAC AGG CCT GTG TGC 3685 Gln Asn Gly Ala Asn Cys Val Asp Gln Gly Asn Arg Pro Val Cys 1115 1120 1125 CAG TGC CTC CCA GGC TTC GGT GGC CCT GAG TGT GAG AAG TTG CTC 3730 Gln Cys Leu Pro Gly Phe Gly Gly Pro Glu Cys Glu Lys Leu Leu 1130 1135 1140 AGT GTC AAC TTT GTG GAT CGG GAC ACT TAC CTG CAG TTC ACT GAC 3775 Ser Val Asn Phe Val Asp Arg Asp Thr Tyr Leu Gln Phe Thr Asp 1145 1150 1155 CTG CAA AAC TGG CCA CGG GCC AAC ATC ACG TTG CAG GTC TCC ACG 3820 Leu Gln Asn Trp Pro Arg Ala Asn Ile Thr Leu Gln Val Ser Thr 1160 1165 1170 GCA GAG GAC AAT GGG ATC CTT CTG TAC AAC GGG GAC AAC GAC CAC 3865 Ala Glu Asp Asn Gly Ile Leu Leu Tyr Asn Gly Asp Asn Asp His 1175 1180 1185 ATT GCA GTT GAG CTG TAC CAG GGC CAT GTG CGT GTC AGC TAC GAC 3910 Ile Ala Val Glu Leu Tyr Gln Gly His Val Arg Val Ser Tyr Asp 1190 1195 1200 CCA GGC AGC TAC CCC AGC TCT GCC ATC TAC AGT GCT GAG ACG ATC 3955 Pro Gly Ser Tyr Pro Ser Ser Ala Ile Tyr Ser Ala Glu Thr Ile 1205 1210 1215 AAC GAT GGG CAA TTC CAC ACC GTT GAG CTG GTT GCC TTT GAC CAG 4000 Asn Asp Gly Gln Phe His Thr Val Glu Leu Val Ala Phe Asp Gln 1220 1225 1230 ATG GTG AAT CTC TCC ATT GAT GGC GGG AGC CCC ATG ACC ATG GAC 4045 Met Val Asn Leu Ser Ile Asp Gly Gly Ser Pro Met Thr Met Asp 1235 1240 1245 AAC TTT GGC AAA CAT TAC ACG CTC AAC AGC GTC GCG CCA CTC TAT 4090 Asn Phe Gly Lys His Tyr Thr Leu Asn Ser Glu Ala Pro Leu Tyr 1250 1255 1260 GTG GGA GGG ATG CCC GTG GAT GTC AAC TCA GCT GCC TTC CGC CTG 4135 Val Gly Gly Met Pro Val Asp Val Asn Ser Ala Ala Phe Arg Leu 1265 1270 1275 TGG CAG ATC CTC AAC GGC ACC GGC TTC CAC GGT TGC ATC CGA AAC 4180 Trp Gln Ile Leu Asn Gly Thr Gly Phe His Gly Cys Ile Arg Asn 1280 1285 1290 CTG TAC ATC AAC AAC GAG CTG CAG TTC ACC AAG ACG CAG ATG 4225 Leu Tyr Ile Asn Asn Glu Leu Gln Asp Phe Thr Lys Thr Gln Met 1295 1300 1305 AAG CCA GGC GTG GTG CCA GGC TGC GAA CCC TGC CGC AAG CTC TAC 4270 Lys Pro Gly Val Val Pro Gly Cys Glu Pro Cys Arg Lys Leu Tyr 1310 1315 1320 TGC CTG CAT GGC ATC TGC CAG CCC AAT GCC ACC CCA GGG CCC ATG 4315 Cys Leu His Gly Ile Cys Gln Pro Asn Ala Thr Pro Gly Pro Met 1325 1330 1335 TGC CAC TGC GAG GCT GGC TGG GTG GGC CTG CAC TGT GAC CAG CCC 4360 Cys His Cys Glu Ala Gly Trp Val Gly Leu His Cys Asp Gln Pro 1340 1345 1350 GCT GAC GGC CCC TGC CAT GGC CAC AAG TGT GTC CAT GGG CAA TGC 4405 Ala Asp Gly Pro Cys His Gly His Lys Cys Val His Gly Gln Cys 1355 1360 1365 GTG CCC CTC GAC GCT CTT TCC TAC AGC TGC CAG TGC CAG GAT GGG 4450 Val Pro Leu Asp Ala Leu Ser Tyr Ser Cys Gln Cys Gln Asp Gly 1370 1375 1380 TAC TCG GGG GCA CTG TGC AAC CAG GCC GGG GCC CTG GCA GAG CCC 4495 Tyr Ser Gly Ala Leu Cys Asn Gln Ala Gly Ala Leu Ala Glu Pro 1385 1390 1395 TGC AGA GGC CTG CAG TGC CTG CAT GGC CAC TGC CAG GCC TGC G 4540 Cys Arg Gly Leu Gln Cys Leu His Gly His Cys Gln Ala Ser Gly 1400 1405 1410 ACC AAG GGG GCA CAC TGT GTG TGT GAC CCC GGC TTT TCG GGC GAG 4585 Thr Lys Gly Ala His Cys Val Cys Asp Pro Gly Phe Ser Gly Glu 1415 1420 1425 CTG TGT GAG CAA GAG TCC GAG TGC CGG GGG GAC CCT GTC CGG GAC 4630 Leu Cys Glu Gln Glu Ser Glu Cys Arg Gly Asp Pro Val Arg Asp 1430 1345 1440 TTT CAC CAG GTC CAG AGG GGC TAT GCC ATC TGC CAGACC ACG CGC 4675 Phe His Gln Val Gln Arg Gly Tyr Ala Ile Cys Gln Thr Thr Arg 1445 1450 1455 CCC CTG TCA TGG GTG GAG TGC CGG GGC TCG TGC CCA GGC CAG GGC 4720 Pro Leu Ser Trp Val Glu Cys Arg Gly Ser Cys Pro Gly Gln Gly 1460 1465 1470 TGC TGC CAG GGC CTT CGG CTG AAG CGG AGG AAG TTC ACC TTT GAG 4765 Cys Cys Gln Gly Leu Arg Leu Lys Arg Arg Lys Phe Thr Phe Glu 1475 1480 1485 TGC AGC GATGG ACC TCT TTT GCC GAG GAG GTG GAA AAG CCC ACC 4810 Cys Ser Asp Gly Thr Ser Phe Ala Glu Glu Val Glu Lys Pro Thr 1490 1495 1500 AAG TGT GGC TGT GCC CTC TGC GCA TAGCGC TGGGCGTGGA CAGGCCGGTG 4860 Lys Cys Gly Cys Ala Leu 1505 1508 AGGGCGGGCA AGGGGCCCCA GCCGCTGCAG CAGCGGAGAC AGTCGCCAGC AGCTGGGCTG 4920 GGGTGCAGGT CATCACAGGA CGGCTCCTGG GCAGCTGGGC CCTCCTGGGT GGGGTGGTGC 4980 CAGAGCAGCC TTTTAAAAGC AAATTGCGCC ATAGCTGGGG GCAGGCGATCTGGG GCAGGCGATCTGGG GCAGGCGA TCTTGGAGGCGATCTTGGAAGG

SEQ ID NO: 3 Sequence length: 1534 Sequence type: amino acid Topology: unknown Sequence type: protein Origin Organism name: human sequence Met Ala Leu Thr Pro Gly Trp Gly Ser Ser Ala -26 -25 -20 Gly Pro Val Arg Pro Glu Leu Trp Leu Leu Leu Trp Ala Ala Ala -15 -10 -5 Trp Arg Leu Gly Ala Ser Ala Cys Pro Ala Leu Cys Thr Cys Thr 1 5 10 15 Gly Thr Thr Val Asp Cys His Gly Thr Gly Leu Gln Ala Ile Pro 20 25 30 Lys Asn Ile Pro Arg Asn Thr Glu Arg Leu Glu Leu Asn Gly Asn 35 40 45 Asn Ile Thr Arg Ile His Lys Asn Asp Phe Ala Gly Leu Lys Gln 50 55 60 Leu Arg Val Leu Gln Leu Met Glu Asn Gln Ile Gly Ala Val Glu 65 70 75 Arg Gly Ala Phe Asp Asp Met Lys Glu Leu Glu Arg Leu Arg Leu 80 85 90 Asn Arg Asn Gln Leu His Met Leu Pro Glu Leu Leu Phe Gln Asn 95 100 105 Asn Gln Ala Leu Ser Arg Leu Asp Leu Ser Glu Asn Ala Ile Gln 110 115 120 Ala Ile Pro Arg Lys Ala Phe Arg Gly Ala Thr Asp Leu Lys Asn 125 130 135 Leu Arg Leu Asp Lys Asn Gln Ile Ser Cys Ile Glu Glu Gly Ala 140 145 150 Phe Arg Ala Leu Arg Gly Leu Glu Val Leu Thr Leu Asn Asn Asn 155 160 165 Asn Ile Thr Thr Ile Pro Val Ser Ser Phe Asn His Met Pro Lys 170 175 180 Leu Arg Thr Phe Arg Leu His Ser Asn His Leu Phe Cys Asp Cys 185 190 195 His Leu Ala Trp Leu Ser Gln Trp Leu Arg Gln Arg Pro Thr Ile 200 205 210 Glu Leu Phe Thr Gln Cys Ser Gly Pro Ala Ser Leu Arg Gly Leu 215 220 225 Asn Val Ala Glu Val Gln Lys Ser Glu Phe Ser Cys Ser Gly Gln 230 235 240 Gly Glu Ala Gly Arg Val Pro Thr Cys Thr Leu Ser Ser Gly Ser 245 250 255 Cys Pro Ala Met Cys Thr Cys Ser Asn Gly Ile Val Asp Cys Arg 260 265 270 Gly Lys Gly Leu Thr Ala Ile Pro Ala Asn Leu Pro Glu Thr Met 275 280 285 Thr Glu Ile Arg Leu Glu Leu Asn Gly Ile Lys Ser Ile Pro Pro 290 295 300 Gly Ala Phe Ser Pro Tyr Arg Lys Leu Arg Arg Ile Asp Leu Ser 305 310 315 Asn Asn Gln Ile Ala Glu Ile Ala Pro Asp Ala Phe Gln Gly Leu 320 325 330 Arg Ser Leu Asn Ser Leu Val Leu Tyr Gly Asn Lys Ile Thr Asp 335 340 345 Leu Pro Arg Gly Val Phe Gly Gly Leu Tyr Thr Leu Gln Leu Leu 350 355 360 Leu Leu Asn Ala Asn Lys Ile Asn Cys Ile Arg Pro Asp Ala Phe 365 370 375 Gln Asp Leu Gln Asn Leu Ser Leu Leu Ser Leu Tyr Asp Asn Lys 380 385 390 Ile Gln Ser Leu Ala Lys Gly Thr Phe Thr Ser Leu Arg Ala Ile 395 400 405 Gln Thr Leu His Leu Ala Gln Asn Pro Phe Ile Cys Asp Cys Asn 410 415 420 Leu Lys Trp Leu Ala Asp Phe Leu Arg Thr Asn Pro Ile Glu Thr 425 430 435 Ser Gly Ala Arg Cys Ala Ser Pro Arg Arg Leu Ala Asn Lys Arg 440 445 450 Ile Gly Gln Ile Lys Ser Lys Lys Phe Arg Cys Ser Ala Lys Glu 455 460 465 Gln Tyr Phe Ile Pro Gly Thr Glu Asp Tyr Gln Leu Asn Ser Glu 470 475 480 Cys Asn Ser Asp Val Val Cys Pro His Lys Cys Arg Cys Glu Ala 485 490 495 Asn Val Val Glu Cys Ser Ser Leu Lys Leu Thr Lys Ile Pro Glu 500 505 510 Arg Ile Pro Gln Ser Thr Ala Glu Leu Arg Leu Asn Asn Asn Glu 515 520 525 Ile Ser Ile Leu Glu Ala Thr Gly Met Phe Lys Lys Leu Thr His 530 535 540 Leu Lys Lys Ile Asn Leu Ser Asn Asn Lys Val Ser Glu Ile Glu 545 550 555 Asp Gly Ala Phe Glu Gly Ala Ala Ser Val Ser Glu Leu His Leu 560 565 570 Thr Ala Asn Gln Leu Glu Ser Ile Arg Ser Gly Met Phe Arg Gly 575 580 585 Leu Asp Gly Leu Arg Thr Leu Met Leu Arg Asn Asn Arg Ile Ser 590 595 600 Cys Ile His Asn Asp Ser Phe Thr Gly Leu Arg Asn Val Arg Leu 605 610 615 Leu Ser Leu Tyr Asp Asn Gln Ile Thr Thr Val Ser Pro Gly Ala 620 625 630 Phe Asp Thr Leu Gln Ser Leu Ser Thr Leu Asn Leu Leu Ala Asn 635 640 645 Pro Phe Asn Cys Asn Cys Gln Leu Ala Trp Leu Gly Gly Trp Leu 650 655 660 Arg Lys Arg Lys Ile Val Thr Gly Asn Pro Arg Cys Gln Asn Pro 665 670 675 Asp Phe Leu Arg Gln Ile Pro Leu Gln Asp Val Ala Phe Pro Asp 680 685 690 Phe Arg Cys Glu Glu Gly Gln Glu Glu Gly Gly Cys Leu Pro Arg 695 700 705 Pro Gln Cys Pro Gln Glu Cys Ala Cys Leu Asp Thr Val Val Arg 710 715 720 Cys Ser Asn Lys His Leu Arg Ala Leu Pro Lys Gly Ile Pro Lys 725 730 735 Asn Val Thr Glu Leu Tyr Leu Asp Gly Asn Gln Phe Thr Leu Val 740 745 750 Pro Gly Gln Leu Ser Thr Phe Lys Tyr Leu Gln Leu Val Asp Leu 755 760 765 Ser Asn Asn Lys Ile Ser Ser Leu Ser Asn Ser Ser Phe Thr Asn 770 775 780 Met Ser Gln Leu Thr Thr Leu Ile Leu Ser Tyr Asn Ala Leu Gln 785 790 795 Cys Ile Pro Pro Leu Ala Phe Gln Gly Leu Arg Ser Leu Arg Leu 800 805 810 Leu Ser Leu His Gly Asn Asp Ile Ser Thr Leu Gln Glu Gly Ile 815 820 825 Phe Ala Asp Val Thr Ser Leu Ser His Leu Ala Ile Gly Ala Asn 830 835 840 Pro Leu Tyr Cys Asp Cys His Leu Arg Trp Leu Ser Ser Trp Val 845 850 855 Lys Thr Gly Tyr Lys Glu Pro Gly Ile Ala Arg Cys Ala Gly Pro 860 865 870 Gln Asp Met Glu Gly Lys Leu Leu Leu Thr Thr Pro Ala Lys Lys 875 880 885 Phe Glu Cys Gln Gly Pro Pro Thr Leu Ala Val Gln Ala Lys Cys 890 895 900 900 Asp Leu Cys Leu Ser Ser Pro Cys Gln Asn Gln Gly Thr Cys His 905 910 915 Asn Asp Pro Leu Glu Val Tyr Arg Cys Ala Cys Pro Ser Gly Tyr 920 925 930 930 Lys Gly Arg Asp Cys Glu Val Ser Leu Asn Ser Cys Ser Ser Gly 935 940 945 Pro Cys Glu Asn Gly Gly Thr Cys His Ala Gln Glu Gly Glu Asp 950 955 960 Ala Pro Phe Thr Cys Ser Cys Pro Thr Gly Phe Glu Gly Pro Thr 965 970 975 Cys Gly Val Asn Thr Asp Asp Cys Val Asp His Ala Cys Ala Asn 980 985 990 Gly Gly Val Cys Val Asp Gly Val Gly Asn Tyr Thr Cys Gln Cys 995 1000 1005 Pro Leu Gln Tyr Glu Gly Lys Ala Cys Glu Gln Leu Val Asp Leu 1010 1015 1020 Cys Ser Pro Asp Leu Asn Pro Cys Gln His Glu Ala Gln Cys Val 1025 1030 1035 Gly Thr Pro Asp Gly Pro Arg Cys Glu Cys Met Pro Gly Tyr Ala 1040 1045 1050 Gly Asp Asn Cys Ser Glu Asn Gln Asp Asp Cys Arg Asp His Arg 1055 1060 1065 Cys Gln Asn Gly Ala Gln Cys Met Asp Glu Val Asn Ser Tyr Ser 1070 1075 1080 Cys Leu Cys Ala Glu Gly Tyr Ser Gly Gln Leu Cys Glu Ile Pro 1085 1090 1095 Pro His Leu Pro Ala Pro Lys Ser Pro Cys Glu Gly Thr Glu Cys 1100 1105 1110 Gln Asn Gly Ala Asn Cys Val Asp Gln Gly Asn Arg Pro Val Cys 1115 1120 1125 Gln Cys Leu Pro Gly Phe Gly Gly Pro Glu Cys Glu Lys Leu Leu 1130 1135 1140 Ser Val Asn Phe Val Asp Arg Asp Thr Tyr Leu Gln Phe Thr Asp 1145 1150 1155 Leu Gln Asn Trp Pro Arg Ala Asn Ile Thr Leu Gln Val Ser Thr 1160 1165 1170 Ala Glu Asp Asn Gly Ile Leu Leu Tyr Asn Gly Asp Asn Asp His 1175 1180 1185 Ile Ala Val Glu Leu Tyr Gln Gly His Val Arg Val Ser Tyr Asp 1190 1195 1200 Pro Gly Ser Tyr Pro Ser Ser Ala Ile Tyr Ser Ala Glu Thr Ile 1205 1210 1215 Asn Asp Gly Gln Phe His Thr Val Glu Leu Val Ala Phe Asp Gln 1220 1225 1230 Met Val Asn Leu Ser Ile Asp Gly Gly Ser Pro Met Thr Met Asp 1235 1240 1245 Asn Phe Gly Lys His Tyr Thr Leu Asn Ser Glu Ala Pro Leu Tyr 1250 1255 1260 Val Gly Gly Met Pro Val Asp Val Asn Ser Ala Ala Phe Arg Leu 1265 1270 1275 Trp Gln Ile Leu Asn Gly Thr Gly Phe His Gly Cys Ile Arg Asn 1280 1285 1290 Leu Tyr Ile Asn Asn Glu Leu Gln Asp Phe Thr Lys Thr Gln Met 1295 1300 1305 Lys Pro Gly Val Val Pro Gly Cys Glu Pro Cys Arg Lys Leu Tyr 1310 1315 1320 Cys Leu His Gly Ile Cys Gln Pro Asn Ala Thr Pro Gly Pro Met 1325 1330 1335 Cys His Cys Glu Ala Gly Trp Val Gly Leu His Cys Asp Gln Pro 1340 1345 1350 Ala Asp Gly Pro Cys His Gly His Lys Cys Val His Gly Gln Cys 1355 1360 1365 Val Pro Leu Asp Ala Leu Ser Tyr Ser Cys Gln Cys Gln Asp Gly 1370 1375 1380 Ty r Ser Gly Ala Leu Cys Asn Gln Ala Gly Ala Leu Ala Glu Pro 1385 1390 1395 Cys Arg Gly Leu Gln Cys Leu His Gly His Cys Gln Ala Ser Gly 1400 1405 1410 Thr Lys Gly Ala His Cys Val Cys Asp Pro Gly Phe Ser Gly Glu 1415 1420 1425 Leu Cys Glu Gln Glu Ser Glu Cys Arg Gly Asp Pro Val Arg Asp 1430 1345 1440 Phe His Gln Val Gln Arg Gly Tyr Ala Ile Cys Gln Thr Thr Arg 1445 1450 1455 Pro Leu Ser Trp Val Glu Cys Arg Gly Ser Cys Pro Gly Gln Gly 1460 1465 1470 Cys Cys Gln Gly Leu Arg Leu Lys Arg Arg Lys Phe Thr Phe Glu 1475 1480 1485 Cys Ser Asp Gly Thr Ser Phe Ala Glu Glu Val Glu Lys Pro Thr 1490 1495 1500 Lys Cys Gly Cys Ala Leu Cys Ala 1505 1508

SEQ ID NO: 4 Sequence length: 228 Sequence type: amino acid Topology: unknown Sequence type: peptide Origin Organism name: mouse Sequence Ala Glu Asp Asn Gly Ile Leu Leu Tyr Asn Gly Asp Asn Asp His 1 5 10 15 Ile Ala Val Glu Leu Tyr Gln Gly His Val Arg Val Ser Tyr Asp 20 25 30 Pro Gly Ser Tyr Pro Ser Ser Ala Ile Tyr Ser Ala Glu Thr Ile 35 40 45 Asn Asp Gly Gln Phe His Thr Val Glu Leu Val Thr Phe Asp Gln 50 55 60 Met Val Asn Leu Ser Ile Asp Gly Gly Ser Pro Met Thr Met Asp 65 70 75 Asn Phe Gly Lys His Tyr Thr Leu Asn Ser Glu Ala Pro Leu Tyr 80 85 90 Val Gly Gly Gly Met Pro Val Asp Val Asn Ser Ala Ala Phe Arg Leu 95 100 105 Trp Gln Ile Leu Asn Gly Thr Ser Phe His Gly Cys Ile Arg Asn 110 115 120 Leu Tyr Ile Asn Asn Glu Leu Gln Asp Phe Thr Lys Thr Gln Met 125 130 135 Lys Pro Gly Val Val Pro Gly Cys Glu Pro Cys Arg Lys Leu Tyr 140 145 150 Cys Leu His Gly Ile Cys Gln Pro Asn Ala Thr Pro Gly Pro Val 155 160 165 Cys His Cys Glu Ala Gly Trp Gly Gly Leu H is Cys Asp Gln Pro 170 175 180 Val Asp Gly Pro Cys His Gly His Lys Cys Val His Gly Lys Cys 185 190 195 Val Pro Leu Asp Ala Leu Ala Tyr Ser Cys Gln Cys Gln Asp Gly 200 205 210 Tyr Ser Gly Ala Leu Cys Asn Gln Val Gly Ala Val Ala Glu Pro 215 220 225 Cys Gly Gly 228

SEQ ID NO: 5 Sequence length: 684 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin Organism: mouse Tissue type: brain Sequence GCA GAG GAC AAT GGG ATT CTC CTA TAT AAT GGG GAC AAT GAC CAC 45 Ala Glu Asp Asn Gly Ile Leu Leu Tyr Asn Gly Asp Asn Asp His 1 5 10 15 ATT GCA GTT GAG CTG TAC CAG GGC CAT GTC CGT GTT AGT TAT GAC 90 Ile Ala Val Glu Leu Tyr Gln Gly His Val Arg Val Ser Tyr Asp 20 25 30 CCA GGC AGC TAC CCC AGC TCT GCT ATC TAC AGC GCT GAG ACG ATC 135 Pro Gly Ser Tyr Pro Ser Ser Ala Ile Tyr Ser Ala Glu Thr Ile 35 40 45 AAC GAT GGG CAG TTC CAC ACC GTT GAG CTG GTC ACC TTC GAC CAG 180 Asn Asp Gly Gln Phe His Thr Val Glu Leu Val Thr Phe Asp Gln 50 55 60 ATG GTG AAC CTC TCC ATC GAT GGC GGC AGC CCC ATG ACC ATG GAC 225 Met Val Asn Leu Ser Ile Asp Gly Gly Ser Pro Met Thr Met Asp 65 70 75 AAC TTT GGC AAG CAC TAC ACC CTC AAC AGC GAG GCC CCC CTC TAT 270 Asn Phe Gly Lys His Tyr Thr Le u Asn Ser Glu Ala Pro Leu Tyr 80 85 90 GTG GGA GGG ATG CCT GTG GAC GTG AAC TCA GCT GCC TTC CGC CTG 315 Val Gly Gly Met Pro Val Asp Val Asn Ser Ala Ala Phe Arg Leu 95 100 105 TGG CAG ATC CTC AAT GGT ACC AGC TTC CAC GGT TGC ATC CGG AAC 360 Trp Gln Ile Leu Asn Gly Thr Ser Phe His Gly Cys Ile Arg Asn 110 115 120 CTG TAC ATC AAC AAT GAA CTG CAG GAC TTC ACC AAG ACA CAG ATG 405 Leu Tyr Ile Asn Asn Glu Leu Gln Asp Phe Thr Lys Thr Gln Met 125 130 135 AAG CCA GGC GTG GTG CCA GGC TGT GAG CCC TGC CGC AAA CTC TAC 450 140 145 150 TGT CTA CAT GGC ATT TGC CAG CCC AAC GCC ACC CCA GGG CCT GTG 495 Cys Leu His Gly Ile Cys Gln Pro Asn Ala Thr Pro Gly Pro Val 155 160 165 TGC CAC TGT GAG GCT GGC TGG GGG GGC CTG CAC TGT GAC CAG CCA 540 Cys His Cys Glu Ala Gly Trp Gly Gly Leu His Cys Asp Gln Pro 170 175 180 GTG GAT GGC CCC TGC CAT GGC CAC AAG TGT GTC CAT GGG AAA TGC 585 Val Asp Gly Pro Cys His Gly His Lys Cys Val His Gly Lys Cys 185 190 195 GTG CCG CTC GAC GCT CTT GCC TAC AGC TGC CAG TGC CAG GAT GGG 630 Val Pr o Leu Asp Ala Leu Ala Tyr Ser Cys Gln Cys Gln Asp Gly 200 205 210 TAC TCG GGG GCT CTG TGC AAC CAG GTC GGG GCT GTG GCA GAG CCC 675 Tyr Ser Gly Ala Leu Cys Asn Gln Val Gly Ala Val Ala Glu Pro 215 220 225 TGT GGG GGC 684 Cys Gly Gly 228

SEQ ID NO: 6 Sequence length: 551 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA Origin: Organism: Rat Tissue type: Brain Sequence type Features Symbol representing features: CDS Location: 3. . 551 Method for determining characteristics: S sequence AG GGC CAT GTC CGT GTT AGC TAC GAC CCA GGC AGC TAC CCC AGC TCT 47 Gly His Val Arg Val Ser Tyr Asp Pro Gly Ser Tyr Pro Ser Ser 1 5 10 15 GCT ATC TAC AGT GCT GAA ACA ATC AAC GAT GGG CAG TTC CAC ACA GTT 95 Ala Ile Tyr Ser Ala Glu Thr Ile Asn Asp Gly Gln Phe His Thr Val 20 25 30 GAG CTG GTG ACC TTT GAC CAG ATG GTG AAC CTC TCC ATC GAT GGT GGC 143 Glu Leu Val Thr Phe Asp Gln Met Val Asn Leu Ser Ile Asp Gly Gly 35 40 45 AGC CCC ATG ACC ATG GAC AAC TTT GGA AAG CAC TAC ACA CTC AAC AGT 191 Ser Pro Met Thr Met Asp Asn Phe Gly Lys His Tyr Thr Leu Asn Ser 50 55 60 GAG GCC CCC CTC TAT GTG GGA GGG ATG CCC GTG GAT GTG AAC TCA GCT 239 Glu Ala Pro Leu Tyr Val Gly Gly Met Pro Val Asp Val Asn Ser Ala 65 70 75 GCC TTC CGC CTG TGG CAG ATC CTC AAT GGC ACC AGC TTC CAC GGT TGC 287 Ala Phe Arg Leu Trp Gln Ile Leu Asn Gly Thr Ser Phe His Gly Cys 80 85 90 95 ATC CGG AAT CTA TAC ATC ATC AAC AAC GAA CTG CAG GAC TTC ACC AAG ACA 335 Ile Arg Asn Leu Tyr Ile Asn Asn Glu Le u Gln Asp Phe Thr Lys Thr 100 105 110 CAG ATG AAG CCG GGC GTG GTG CCC GGC TGC GAG CCC TGC CGA AAA CTC 383 Gln Met Lys Pro Gly Val Val Pro Gly Cys Glu Pro Cys Arg Lys Leu 115 120 125 TAC TGT CTA CAT GGC ATT TGC CAG CCC AAC GCC ACC CCA GGG CCC GTG 431 Tyr Cys Leu His Gly Ile Cys Gln Pro Asn Ala Thr Pro Gly Pro Val 130 135 140 TGC CAC TGC GAG GCT GGC TGG GGG GGC CTG CAC TGT GAC CAG CCA GTG 479 Cys His Cys Glu Ala Gly Trp Gly Gly Leu His Cys Asp Gln Pro Val 145 150 155 GAC GGC CCC TGC CAT GGC CAC AAG TGT GTC CAT GGG AAA TGC GTG CCC 527 Asp Gly Pro Cys His Gly His Lys Cys Val His Gly Lys Cys Val Pro 160 165 170 175 CTC GAT GCA CTT GCC TAC AGC TGC 551 Leu Asp Ala Leu Ala Tyr Ser Cys 180

SEQ ID NO: 7 Sequence length: 183 Sequence type: Amino acid Topology: Unknown Sequence type: Peptide Fragment type: Middle fragment Origin Organism name: Rat Tissue type: Brain Sequence Gly His Val Arg Val Ser Tyr Asp Pro Gly Ser Tyr Pro Ser Ser 1 5 10 15 Ala Ile Tyr Ser Ala Glu Thr Ile Asn Asp Gly Gln Phe His Thr Val 20 25 30 Glu Leu Val Thr Phe Asp Gln Met Val Asn Leu Ser Ile Asp Gly Gly 35 40 45 Ser Pro Met Thr Met Asp Asn Phe Gly Lys His Tyr Thr Leu Asn Ser 50 55 60 Glu Ala Pro Leu Tyr Val Gly Gly Met Pro Val Asp Val Asn Ser Ala 65 70 75 Ala Phe Arg Leu Trp Gln Ile Leu Asn Gly Thr Ser Phe His Gly Cys 80 85 90 95 Ile Arg Asn Leu Tyr Ile Asn Asn Glu Leu Gln Asp Phe Thr Lys Thr 100 105 110 Gln Met Lys Pro Gly Val Val Pro Gly Cys Glu Pro Cys Arg Lys Leu 115 120 125 Tyr Cys Leu His Gly Ile Cys Gln Pro Asn Ala Thr Pro Gly Pro Val 130 135 140 Cys His Cys Glu Ala Gly Trp Gly Gly Leu His Cys Asp Gln Pro Val 145 150 15 5 Asp Gly Pro Cys His Gly His Lys Cys Val His Gly Lys Cys Val Pro 160 165 170 175 Leu Asp Ala Leu Ala Tyr Ser Cys 180 183

SEQ ID NO: 8 Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence AAGTCAACAG CTACTCCTGC 20

SEQ ID NO: 9 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence TGAACTGCAG GTAAGTGTCC 20

SEQ ID NO: 10 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence GAGCTCTGGC TGCTGCTGTG 20

SEQ ID NO: 11 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence GTTCTCACTC AAGTCCAGTC 20

SEQ ID NO: 12 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence ATCACGTTGC AGGTCTCCAC 20

SEQ ID NO: 13 Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence TGGCCATGCA GGCACTGCAG 20

SEQ ID NO: 14 Sequence length: 8 Sequence type: amino acid Topology: Linear Sequence type: Peptide

SEQ ID NO: 15 Sequence length: 55 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence GCGGCCGCTC ATTTATCATC ATCATCTTTA TAATCTGCGC AGAGGGCACA GCCAC 55

SEQ ID NO: 16 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence AGAGGCCTGC AGTGCCTGCA 20

SEQ ID NO: 17 Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence CATTGCAGTT GAGCTGTACC 20

SEQ ID NO: 18 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid, synthetic DNA sequence GAGTACCCAT CCTGGCACTG 20

[Brief description of the drawings]

FIG. 1 shows the expression distribution of rat slit mRNA in the brain by in situ hybridization.

FIG. 2 shows the expression distribution of rat slit mRNA at day 18 embryos by in situ hybridization.

FIG. 3 shows expression of rat slit mRNA in hippocampal dentate gyrus by in situ hybridization.

FIG. 4 shows the expression of rat slit mRNA in the hippocampus CA2 region by in situ hybridization.

FIG. 5: Occipital cerebral cortex of rat slit mRNA by in situ hybridization.
This shows expression in the sixth layer portion of the Cx region.

FIG. 6 shows expression of rat slit mRNA in amygdala by in situ hybridization.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12N 15/02 C12N 5/00 B C12P 21/02 15/00 A 21/08 C // (C12P 21/02 C12R 1:91 )

Claims (8)

[Claims] 1. A polypeptide comprising the amino acid sequence of SEQ ID NO: 1. 2. A DNA encoding the polypeptide according to claim 1. 3. The DNA according to claim 2, wherein the DNA comprises the nucleotide sequence of positions 311 to 4834 of SEQ ID NO: 2.
A. 4. A recombinant D obtained by ligating the DNA according to claim 2 with a vector DNA that can be expressed in a host cell.
NA body. A cell transformed by the recombinant DNA of claim 4. 6. A method for producing a polypeptide containing the amino acid sequence produced using the recombinant DNA according to claim 4. 7. An antibody that specifically recognizes the polypeptide according to claim 1. 8. A method for diagnosing cancer using the antibody according to claim 7.