JPH1036395A - New membrane protein - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new membrane protein specifically expressed in the brain, nerve tissue and tumor cell, containing a specific amino acid sequence and giving an antibody expected to be usable for the diagnosis of diseases specific to brain and nervous system and cancers such as cervical cancer and malignant melanoma. SOLUTION: This new membrane protein is composed of a polypeptide containing an amino acid sequence expressed by the formula and specifically expressed in the brain, nervous system tissue and tumor cells. The antibody specifically recognizing the membrane protein is expected to be usable for the diagnosis of diseases specific to brain and nervous system and cancers such as cervical cancer and malignant melanoma. The new membrane protein can be produced by screening a λ-phage cDNA library of human fetus brain by the plaque hybridization with a labeled DNA probe composed of a part of the membrane protein gene, integrating a gene of the new membrane protein obtained from positive clone into a plasmid, etc., inserting the plasmid into a host cell and expressing the gene in the transformed cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel membrane protein, and more particularly, to a novel membrane protein expressed by human-derived cells, and a method for producing the same. The present invention also relates to the gene of the membrane protein cloned using a genetic engineering technique. The present invention also relates to a DNA fragment and an RNA fragment synthesized from the amino acid sequence of the membrane protein.
The present invention also relates to a recombinant DNA comprising a DNA encoding the membrane protein produced by applying genetic engineering technology and a vector DNA. The present invention also relates to a transformed cell expressing the membrane protein produced by applying a genetic engineering technique. Furthermore, the present invention relates to a method for producing the membrane protein by applying the technology of genetic engineering. Furthermore, the present invention relates to an antibody that specifically binds to the membrane protein.

[0002]

2. Description of the Related Art The formation of the brain and nervous system of higher vertebrates is completed during the embryonic period, and it is extremely difficult to regenerate the damage. Understand the formation process of the brain and nervous system, and the clinical application of molecules related to this process to various brain and neurological diseases is being studied.
In recent years, many cell-cell interaction molecules or cell-substrate interaction molecules involved in nervous system development and neural circuit formation have been found. These molecules include cell membrane-bound receptor molecules that transmit information between cells and their ligand molecules (receptor-ligand molecules),
They are broadly classified into extracellular matrix molecules that are matrix substances between cells, and cell adhesion molecules that are responsible for cell-cell or cell-matrix adhesion.

Examples of ligand molecules include humoral factor nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF),
Neurotrophin 3 (NT-3) (JP-A-5-161)
493), glial cell line-derived neurotrophic factor (GD
NF), ciliary body derived neurotrophic factor (CNTF), Netrin (Serafini et al., Cell,
78, 409-424, 1994), colapsin (Co
llapsin) (Luo et al., Cell, 75, 217).
-227, 1993), and Delta and Serrate, which are ligand molecules of the Notch family as membrane-bound factors,
Eph family ligand molecules are known. Some of these molecules have been studied for development as pharmaceuticals.

[0004] Extracellular matrix molecules include collagen, fibronectin, laminin, which are not particularly limited to the nervous system, and reelin (Ree), which is mainly secreted to the central nervous system.
lin) (D'Archangelo et al., Nature)
e, 374, 719-723, 1995) and Agrin (Rupp) secreted mainly to the peripheral nervous system.
Et al., Neuron, 6, 811-823, 1991) are known molecules specific to the nervous system. Examples of cell adhesion molecules include N-cadherin, PB-cadherin,
N-CAM, L1, integrin, facyclin (Fa
sciclin) (Hirano, Protein Nucleic Acid Enzyme, 40, 724-735, 1995).

[0005] Here, the classification is roughly divided into three, but it cannot be classified in a strict sense. For example, Delta, which is classified here as a receptor-ligand molecule, is known to be a factor that transmits information to Notch and also has a function as an adhesion molecule (Artavanis-
Tsakonas et al., Science, 268, 225.
-232, 1995 and Fehon et al., Cell, 6
1, 523-534, 1990). In another example, the integrin, which is classified as an adhesion molecule, recognizes an RGD (Arg Gly Asp) sequence in the extracellular matrix and plays a role as a receptor molecule capable of transmitting information into cells (Original Watson et al., Translation) Matsubara et al., Molecular Biology of Cells III
Edition, Kyoikusha, 995-1000, 1995). Therefore, the classification of receptor-ligand molecules, extracellular matrix molecules, cell adhesion molecules is for convenience and the importance of these molecules for nervous system development and neural circuit formation is not distinguished by this classification. . Therefore, in the present invention, these molecules are collectively referred to as cell action molecules.

[0006] By the multiple action of a plurality of cell-acting molecules as described above, the generation, differentiation, tissue construction, localization of nerve cells, elongation of nerve fibers, bundle formation of nerve axons, formation of neural networks, etc. It is thought that the formation is performed continuously and concurrently, and a complex and specific brain / nervous system is formed.
However, despite the discovery of a variety of cell-acting molecules, the development of the nervous system and the formation of neural circuits remain largely unclear and are still one of the most biologically unknown fields. This is because organs of the nervous system are composed of a heterogeneous group of cells, and a large number of cell-acting molecules exist to integrate these cell groups. Furthermore, the concentration, density, affinity, and time, This is because spatial expression is considered to play an important role, but the types of cell-acting molecules found therefor and the functional analysis thereof are not sufficient.

[0007]

An object of the present invention is to provide a novel cell-acting molecule expressed in the brain and nervous system.

[0008]

It has been stated that cell-cell and cell-substrate interactions are important for the development of the nervous system and the formation of neural circuits. Many molecules involved in these interactions not only in the nervous system but also in cells have structurally conserved domain structures for adhesion and binding. This domain structure includes an immunoglobulin (Ig) -like domain,
Cadherin motif, type III fibronectin repeat (FNIII type repeat), LRR (leucine r)
ich repeat) sequence, EGF (epiderm)
al growth factor (epidermal growth factor) motif and the like are known. The Ig-like domain is contained in a large number of molecules belonging to the immunoglobulin superfamily, and N-CAM, L1, and type II facyclin, which are cell adhesion molecules expressed in various cells including neurons, have five I-types.
having a g-like domain (see above, Molecular Biology of Cells III)
Edition, 968-969).

The cadherin motif is normally contained in the cadherin family in five domain structures, including N-cadherin expressed in neural crest cells (supra, Molecular Biology of Cells, 3rd ed., 966-968). FNIII type repeat is II
Included in extracellular matrix molecules such as type I fibronectin and tenescin, and cell adhesion molecules such as N-CAM and L1. (See above, Molecular Biology of Cells Third Edition, 986-98
8) The LRR sequence is a recently reported NLRR-1 expressed in mouse nervous system cells (Taguchi et al., Mol Brai).
n Res, 35, 31-40, 1996), NLRR
-3 (Taniguchi et al., Mol Brain R
es, 36, 45-52, 1996), and the three-dimensional structure has been clarified by crystal analysis (Kove et al.,
Nature, 374, 183-186, 1995).
Also, in some molecules having an LRR sequence, LR
It has been reported that conserved regions also exist on the N-terminal and C-terminal sides of the R sequence (Rothberg et al., Gene De).
v, 4,2169-2187, 1990).

The EGF motif is a neuroblast of the ectoderm
Receptors such as notches and deltas that suppress differentiation into
-Extracellular matrices such as ligand molecules, tenescin and laminin
A motif included in the Rix molecule, and three dys
Sulfide bond and one Ca ^{2 +}Has a binding site. E
Three-dimensional structure of GF motif revealed by crystal analysis
(Rao et al., Cell, 82, 131-141,
1995). Some of these molecules are EGF motifs
Have a structure arranged in tandem, and in the case of a notch, 36
EGF motif takes a repeat structure, the eleventh of which
And twelfth EGF motifs are involved in binding to ligand
(Fehon et al., C
ell, 61, 523-534, 1990). The inventor
And others, among these motifs, the EGF motif is
Important cellular actions involved in the development of the transsystem and the formation of neural circuits
Is the molecular structure found in some of the molecules
Of the brain and nervous system
Novel cellular action with differentially expressed EGF motif
I tried to find a molecule.

As the method, we have used a method of searching a database of gene sequences. That is, EG
A gene sequence predicted to have a DNA sequence encoding the F motif was obtained from the gene sequence database Genba.
EST (Expressed Seq) which is a database of gene fragments of nk random human cDNA sequences.
uence Tag) using gene sequence search software Genetyx / CD (manufactured by Software Development Co., Ltd.), and these short gene fragments were cloned by PCR. Next, Northern hybridization was performed using these gene fragments as probes, and human brain,
A probe specifically expressed in nervous system tissue was found. Next, cloning of a gene fragment longer than this was attempted using the probe from a human fetal cDNA library or the like, a full-length gene was obtained, and the sequence was successfully determined.

From the amino acid sequence deduced from this gene sequence, it was revealed that it was a completely novel sequence having 10 EGF motifs. The amino acid sequence of this EGF motif was closest to the Notch EGF motif,
It had only about 40% homology. In addition, there was an inserted sequence of about 170 amino acids between the second and third EGF motifs, which had two cysteines inside. The method of Kyte-Doolittle et al. (J. Mo.
l. Biol. 157: 105, 1982)
The hydrophobic part and the hydrophilic part were analyzed from the amino acid sequence. As a result, the molecule of the present invention was expected to be expressed on cells as a cell membrane protein.

As a result of Northern blotting using an antisense fragment of DNA encoding the above-mentioned membrane protein, the expression of the membrane protein gene is specifically recognized only in the brain, spinal cord and adrenal gland in the whole body organs. We clarified that the membrane protein is a molecule specifically expressed in nerve tissue. Furthermore, when the distribution in the brain was examined in detail, expression was observed in all analyzed regions such as the cerebrum, diencephalon, midbrain, cerebellum, and medulla. Furthermore, the present inventors prepared an expression system for the membrane protein using a DNA encoding the full length polypeptide of the membrane protein, and prepared a recombinant sample of the polypeptide. The amino acid sequence of the membrane protein and the nucleic acid sequence encoding the same are shown in SEQ ID NOs: 1 to 3 in the sequence listing.
Furthermore, an antibody was prepared using the recombinant preparation as an immunogen, a purification method was established, and the present invention was completed.

That is, according to the present invention, SEQ ID NO: 1 in the sequence listing
The novel polypeptide containing the amino acid sequence represented by these is provided. Further, according to another aspect of the present invention, there is provided a novel polypeptide comprising the amino acid sequence represented by SEQ ID NO: 2 in the Sequence Listing containing the amino acid sequence represented by SEQ ID NO: 1 in the Sequence Listing. According to another aspect of the present invention, there is provided a polypeptide having a polypeptide having an arbitrary amino acid sequence recognizable by a specific antibody at the C-terminus of the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing. Provided. According to another aspect of the present invention, there is provided a polypeptide having a complex form of a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing and another polypeptide. According to another aspect of the present invention, there is provided a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing.

According to another aspect of the present invention, there is provided a DNA encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 in the sequence listing. According to still another embodiment of the present invention, there is provided a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing.
There is provided a recombinant DNA obtained by linking a nucleotide sequence containing NA and a vector DNA that can be expressed in a host cell. According to still another aspect of the present invention, there is provided a nucleotide sequence containing a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, and a vector DNA that can be expressed in a host cell. Recombinant DN obtained by linking
Body A is provided. According to still another embodiment of the present invention, there is provided a nucleotide sequence containing a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing, and a vector DNA that can be expressed in a host cell. And a cell transformed with the recombinant DNA obtained by ligating the above. According to still another aspect of the present invention, there is provided a nucleotide sequence containing a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing, and a vector DNA that can be expressed in a host cell. And a cell transformed with the recombinant DNA obtained by ligating the above.

According to still another aspect of the present invention, cells capable of producing a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 in the sequence listing are cultured in a medium, and And a method for producing the polypeptide, comprising: collecting the culture supernatant from the culture solution, and separating and purifying the polypeptide from the collected culture supernatant. According to still another aspect of the present invention, cells capable of producing a polypeptide containing the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing are cultured in a medium, and There is provided a method for producing a polypeptide, comprising producing a peptide, collecting a culture supernatant from a culture solution, and separating and purifying the polypeptide from the collected culture supernatant. According to still another aspect of the present invention, there is provided an antibody that specifically binds to at least a part of the polypeptide represented by the amino acid sequence represented by SEQ ID NO: 2 in the sequence listing.

According to still another aspect of the present invention, there is provided a sense DNA comprising at least 18 consecutive nucleotide sequences of the nucleotide sequence of SEQ ID NO: 3 in the sequence listing,
Isolating a DNA fragment selected from the group consisting of an antisense DNA complementary to said sense DNA and said antisense DNA to methylate, methylphosphate, thiophosphate or deaminate, respectively. And an isolated DNA fragment selected from the group consisting of the sense DNA and the derivative of the antisense DNA. According to still another embodiment of the present invention, an antisense RNA containing at least 18 consecutive nucleotide sequences complementary to the nucleotide sequence of SEQ ID NO: 3 in the sequence listing, and a sense complementary to the antisense RNA R
An isolated RNA fragment selected from the group consisting of NA, and the antisense RNA and the antisense RNA obtained by subjecting the antisense RNA and the sense RNA to methylation, methylphosphate, thiophosphate, or deamination, respectively. An isolated RNA fragment selected from the group consisting of a sense RNA and a derivative of the sense RNA is provided.

The method for cloning the novel membrane protein gene of the present invention is described in detail below. In recent years, DNA sequencing technology has been improved, and genomes and cDNAs have been randomly sequenced, and attempts have been made to elucidate the entire genomic DNA and cDNA sequences of species such as humans, nematodes, and Arabidopsis thaliana (Genome Directory, Natu).
re, 377, 3S, 1995). For human cDNA, TIGR (The Institute for The
An EST project by Genomic Research, an EST project by Washington University-Merck, and an STS project by University of Colorado have entered this project. The partial nucleotide sequences of the cDNAs submitted by these institutions were obtained from Genbank and EMB.
L is registered and disclosed in the L gene database. According to Genbank Release 91 issued in October 1995, the cumulative number of registered EST clones was about 330,000, and the average length was 346 base pairs (bp).

A homology search is performed on the data of these databases based on gene sequences and amino acid sequences of known or newly cloned novel molecules and the like,
The possibility of the existence of the similar molecule family molecule can be known, and the sequence information of the partial gene can be obtained. As the analysis software, commercially available analysis software may be used, or the analysis software attached to each database, for example, BLA attached to Genbank
It can be analyzed using ST, that is, it can be calculated by accessing the National Center of Biotechnology Information in the United States, the Institute for Chemical Research, Kyoto University in Japan, via the WWW (World Wide Web), e-mail, etc. .

Through such an operation, a gene fragment (200 to 350 b
Gene length information). The gene fragment sequence information obtained in this manner generally contains the gene sequence information, as well as the clone name of the gene, and information on the organs and tissues that existed. Regarding the gene sequence information, since it is close to the raw data information of the DNA sequencer, the gene sequence is undecided and described as N or the gene sequence information is often incorrect,
The information on these gene sequences is not always certain. From the gene information, a region where no N data is output in the gene sequence is extracted as being considered to be the most probable part of the gene sequence information, and further compared. Then, it is desirable that the similarity of the gene sequence is about 45% or more.) A gene fragment is identified. Regarding the gene fragments identified in this way, some genes can be purchased from the U.S. Genome System Co., Ltd. if the clone name is known, but since the expression organ is specified,
It can be separated from the cDNA of a commercially available expression organ by PCR.

However, as shown in the present invention, there are many EST clones having an EGF motif, and it is difficult to select only a desired clone from them. Furthermore, the genetic information obtained from the EST clones thus found is partial information, and it is impossible to estimate the entire amino acid sequence only from information on the partial gene fragments. Therefore, only after obtaining the full length of the gene based on the information on the gene partial fragment, the amino acid sequence encoded by the fragment can be inferred, and the physiological activity as a protein can be discussed.

The present inventors have selected about 30 types of known molecules having the above-mentioned various domain structures and expressed in the nervous system, and using the base sequence encoding the relevant domain structure as a template, a gene database. Genbank (G
homology search was performed on EST clones registered in the ESTyx-CD (software development company). The algorithm used for the search was Genetyx-CD
A program with built-in software was used. As a result, about 6% having about 50% or more gene sequence homology
00 EST clones were candidates. The gene sequences of these clones were translated into six amino acid sequences per clone together with the complementary sequences, and it was examined whether or not they had the corresponding amino acid sequences. At this time, since the base sequence reported in the EST clone often has a missing sequence, a duplication, or an unknown sequence represented by N, the amino acid sequence was carefully generated in consideration of the change in the amino acid frame.
In particular, several tens of bp at both ends of the sequence information have an amino acid frame that cannot be assembled at all in most EST clones due to the appearance of an apparent stop codon and an unknown sequence.
0 bp was practically not useful sequence information.

An EST clone having only a short fragment information of about 200 bp or less was excluded from the candidates because it was too short to be suitable as a hybridization probe for screening in consideration of the above reasons. For the EST clones finally remaining as candidates, PCR primers were prepared based on the respective DNA sequence information, and a cDNA mixed solution (Clon) derived from human fetal brain was prepared.
PCR) was used as a template to perform a PCR reaction. The PCR product thus obtained was subcloned into a plasmid vector, and DNA sequencing confirmed that the nucleotide sequence contained a nucleotide sequence homologous to the EST clone. Next, these Ps in human tissues
The expression of the gene encoded by the CR product was analyzed. As a method of analyzing a tissue expressing a gene, generally, Northern hybridization, RT-PCR (reverse
transscriptase-polymerase
chain reaction).

The present inventors confirmed the gene expression organization of the DNA fragment using Northern hybridization,
A DNA fragment specifically expressed in brain and nervous system tissues, that is, an EST clone of Genbank accession number R24709 was identified. In addition, on the Genbank database, clones having the same sequence as R24709, R36774, R12231, T80514, H
14710 were present.

Next, using the DNA fragment thus obtained, a human genomic gene library or a live cell of a tissue or a cell producing the novel membrane protein of the present invention, such as the brain, the spinal cord or the adrenal gland. Rally (c
The membrane protein can be cloned from a DNA library). A gene library is obtained by purifying mRNA from a cell of interest, and converting the mRNA into a single-stranded complementary DN.
A (cDNA) can then be made by synthesizing double-stranded DNA and transforming the complementary DNA into a host with a phage or plasmid. R from human brain
NA is determined by the guanidine thiocyanate method (T. Mania
tis et al. , Molecular clon
ing 2nd edition, Cold Spri
ng Harbor Lab. , 1989). Next, mRNA is obtained according to a conventional method. At this time, mRNA Purification
Kit (Pharmacia) can be used.

Using the mRNA thus obtained as a template, the method of Okayama Berg (Molecular
nd Cellular Biology, 2, 16
1, 1982 and 3, 280, 1983), and the obtained cDNA is incorporated into a plasmid. As a plasmid incorporating the cDNA,
For example, pBR322, pUC18, pUC derived from Escherichia coli
19, pUC118 and pUC119 (all sold by Takara Shuzo Co., Ltd.), and any other types can be used as long as they can be replicated and propagated in the host. Examples of the phage vector into which the cDNA is incorporated include λgt10 and λgt11. Other phage vectors can be used as long as they can be propagated in the host. The plasmid thus obtained can be used in a suitable host, for example Escherichia (Esch
erichia), Bacillus
It is introduced into the genus using a calcium chloride method.

Examples of the above Escherichia bacteria include Escherichia coli K12HB101, MC1061, LE
392 and JM105. Examples of the bacterium of the genus Bacillus include Bacillus subtilis MI114. A phage vector can be prepared, for example, by using an in vitro packaging method (Proc.
atl. Acad. Sci. (1978) 71, 244
2) can be introduced. According to the above method, a cDNA library of the membrane protein-producing cells containing the cDNA of the novel membrane protein of the present invention can be prepared. As a method of cloning the DNA encoding the membrane protein from the cDNA library, for example, the membrane protein c prepared using the phage vector λgt10 can be used.
A plaque hybridization method using, as a probe, a DNA library and an EST clone selected by the above method, for example, a DNA fragment derived from R24709, may be mentioned.

The nucleotide sequence of the DNA obtained in this manner is determined, for example, by the method of Sanger et al. (Sanger, F., et al.).
al. Proc. Natl. Acad. Sci. (1
977) 74, 5463). As described above, DNA encoding the membrane protein is obtained. DNA containing DNA encoding the membrane protein
Is shown in SEQ ID NO: 3 in the sequence listing.

As shown in Example 3, the present inventors
The DNA fragment obtained by CR is labeled with a radioisotope, used as a hybridization probe, and used as a screening library.
Screening was performed using A, and the DNA sequences of the obtained clones were determined. These were clones having the DNA base sequence shown in SEQ ID NO: 3 in the sequence listing. This DNA sequence has a start codon (ATG) beginning at position 84 and a stop codon (TAG) ending at position 2297.
Until A), there was an open reading frame that could encode a 737 amino acid sequence. The amino acid sequence translated from the open reading frame is shown in SEQ ID NO: 2. The plasmid pBERT containing the open reading frame was transfected into E. coli strain JM109 (manufactured by Toyobo). When these sequences were compared in a gene database (Genbank), they were completely novel sequences.

The amino acid sequence described in SEQ ID NO: 2 in the sequence listing was obtained by the method of Kyte-Doolittle (J. Mol. B.
iol. , 157: 105, 1982), the hydrophobic portion and the hydrophilic portion were analyzed from the amino acid sequence. As a result, it was presumed that the polypeptide of the present invention had a signal peptide and was a membrane protein having a cell membrane transit portion. That is, according to the analysis results, the amino acid sequence of the membrane protein precursor is a polypeptide consisting of 737 amino acid residues shown in SEQ ID NO: 3 in the sequence listing, and the signal peptide region is -26 of the amino acid sequence in the sequence listing. 26 amino acid residues corresponding to -1 th alanine from methionine,
The extracellular part is 612 amino acid residues corresponding to serine 612 from glycine 1; the transmembrane domain is 26 amino acid residues corresponding to leucine 613 to isoleucine 638;
It was estimated to be composed of 73 amino acid residues corresponding to the th leucine. However, each of these parts is a domain structure expected from the amino acid sequence to the last, and it is sufficiently considered that the form actually present on the cell and in the solution may be slightly different from the above-described structure. It is also conceivable that the constituent amino acids of each domain are around 5 to 10 amino acids.

As expected from the amino acid sequence, the portion to which the sugar chain is added is a portion to which N-acetyl-D-glucosamine can be bonded to the N-glycoside, and the portion to which N-acetyl-D-glucosamine can bind is N-glycoside. 178th, 18
No. 2, 197, 260, 335, 349, 41
Eleven asparagine residues at positions 6, 429, 523 and 538 are included. Generally, it is considered that a protein to which a sugar chain is added is more stable against degradation in vivo than a polypeptide itself, and has a strong physiological activity. Analysis of the domain structure of the amino acid sequence set forth in SEQ ID NO: 2 in the sequence listing revealed that the membrane protein was composed of almost the entire polypeptide with a dense domain structure. That is, two EGF motifs are arranged in tandem in order from the N-terminus of the novel membrane protein, then one immunoglobulin loop-like motif is interposed therebetween, and then eight EGF motifs are arranged again. End.

More specifically, the first EGF motif is cysteine 22 to cysteine 65 to cysteine 22 in the same sequence list, the second EGF motif is cysteine 72 to cysteine 106 in the same sequence list, and the third EGF motif is 281 in the same sequence list. Cysteine to 321 cysteine, fourth
The EGF motif is 3 cysteines from position 327 of the sequence listing.
The cysteine No. 63 and the fifth EGF motif are 3 in the sequence listing.
Cysteine No. 70 to No. 401, 6th EGF
The motif is cysteine 408 to 439 from cysteine of the same sequence list, the 7th EGF motif is the cysteine of 446th cysteine to 476th cysteine of the same sequence list, and the motif of the 8th EGF motif is 483 cysteine to 514th cysteine of the same sequence list. The cysteine at positions 521 to 552 and the 10th EGF motif in the sequence listing are composed of cysteines at positions 559 to 590 in the sequence listing. The immunoglobulin loop-like motif is expected to be composed of cysteines at positions 176 and 224 in the sequence listing.

The human-derived ES was identified using the nucleotide sequence shown in SEQ ID NO: 2 in the sequence listing that the present inventors clarified.
When a homology search was performed on T clones, 9
Clones having 0% or more homology include HUM400E, including R24709 used in the cloning of the present invention.
08B, HUM093E10B, R36774, R12
231, T80514, H39689, and H14710 corresponded to a total of eight clones. No homology of 60% or more and less than 90% was found. Also, 50
Many clones showing homology of not less than 60% and less than 60% were observed. Among eight clones having 90% or more homology, HUM400E08B, HUM093E10B, HUM400E08B
The three clones 39689 substantially corresponded to the 3 ′ untranslated region of the DNA sequence shown in SEQ ID NO: 3 in the sequence listing. In addition, the remaining R24709, R36774, R1223
1, 5 clones of T80514 and H14710 were further translated into amino acid sequences, and
Or, when they were compared with the amino acid sequences of No. 2 and No. 2, they were all considered to correspond to the novel membrane protein of the present invention.

The novel membrane protein of the present invention comprises a polypeptide having the amino acid sequence shown in SEQ ID NO: 1 or 2 in the Sequence Listing, but it has mutations in all species known to occur in nature and alleles. Homologous variants of the polypeptide that result from mutations, such as mutations, are also included in the present invention. In addition, the novel membrane protein of the present invention is represented by SEQ ID NO: 1 or 2 in the sequence listing.
May lack a part of the amino acid sequence described in,
Mutants which can be partially mutated by point mutation and which do not lose the properties of SEQ ID NO: 1 or 2 in the sequence listing of the novel membrane proteins of the present invention are included in the present invention. Also, the amino acid sequence N
Some amino acid residues and peptide residues may be added at the terminal or C terminal. Furthermore, the present invention also includes those in which a sugar chain such as N-acetyl-D-glucosamine or N-acetyl-D-galactosamine is bonded to the amino acid sequence by an N-glycoside or o-glycoside bond. The homology between the above-mentioned mutant of the compound and the amino acid sequence of the compound is usually preferably 60% or more,
It is particularly preferably at least 70%, more preferably at least 80%, particularly preferably at least 90%.

By using the nucleotide sequence revealed by the present inventors, it is possible to carry out a detailed analysis on the expression and function of the novel membrane protein of the present invention by applying recent gene manipulation techniques and developmental engineering techniques. That is, from 12mer to 16m having a part or the entire nucleotide sequence of SEQ ID NO: 3 in the sequence listing.
It can be carried out by a nucleic acid capable of complementation of er or more, preferably 18 mer or more, that is, antisense DNA, RNA, and a derivative in which they are methylated, methylphosphated, deaminated, or thiophosphated. Furthermore, the cloning of genes on the genome is likewise possible. The present inventors prepared a probe using the nucleotide sequence information shown in SEQ ID NO: 2 in the sequence listing to examine the mRNA expression site of the novel membrane protein of the present invention as shown in Example 4, and Labeling and Northern blotting of human-derived organs were performed. As a result, in the embryo, the strongest expression was observed in the brain, and weak expression was also observed in the kidney. In the adult, strong expression was observed in the spinal cord, brain and adrenal gland.

Very weak expression was observed in the kidney, pancreas, small intestine, large intestine, stomach and trachea. No expression was observed in other organs. Furthermore, when the distribution of expression in the brain was examined in detail, high expression was observed in all analyzed sites such as the cerebrum, diencephalon, midbrain and cerebellum. From the above results, it was revealed that the novel membrane protein of the present invention is a molecule that is specifically and strongly expressed in brain and nervous system tissues. Further, among various cancer cell lines, human uterine shin region cancer cells HeLa cell
Both the S3 strain and the human melanoma cell line G361 revealed that the membrane protein was expressed in epithelial cancer cells.

Using the nucleotide sequence information of the novel human membrane protein of the present invention, it is expected that cloning of the homologous gene of the membrane protein of another vertebrate is possible. Therefore, obtaining the gene of the membrane protein homolog of an experimental animal,
In situ using a tissue section using the gene fragment
u-hybridization, expression control by antisense oligomer or dominant negative, transgenic mouse, gene targeting mouse, double knockout in which both genes related to the present gene are inactivated, etc. It is possible to analyze the expression and function of membrane proteins. Further, by using the nucleotide sequence information of the membrane protein, chromosome mapping on the genome and genomic sequence determination, and subsequently, analysis of promoter and enhancer regions and analysis of splicing structure are possible. If there is a genomic abnormality, it can be applied to gene diagnosis and gene therapy.

In recent years, with respect to gene therapy vectors for brain and nerve cells, it has become possible to introduce genes into nerve cell systems using viral vectors such as adenovirus vectors and herpes simplex virus vectors and liposomes.
Regarding gene transfer into brain cells, it can be delivered to a specific site using a catheter. Also, a technique for arbitrarily controlling gene expression by improving a promoter region has been developed. As these peripheral technologies progress further,
Even if there is no abnormality in the genome, gene therapy can be actively performed for the purpose of improving brain function, treating dementia and the like, and regenerating nerve cells.

Further, mRNA of the membrane protein is hardly expressed in normal cells other than brain and nervous system tissues, and is expressed in certain cancer cells. It can be used for That is, mRNA is extracted from a part of an organ obtained by blood collection or pypsy, and is detected by a probe specific to the membrane protein by Northern blotting or the like.
Is reverse transcribed into cDNA using reverse transcriptase, and the primers are prepared using primers prepared based on the base sequence information of the membrane protein.
By amplifying the gene fragment by R or other DNA polymerase, the mRNA of the membrane protein is detected,
Can be used to diagnose cancer. The DNA encoding the polypeptide of the present invention cloned as described above can be used as it is depending on the purpose, or digested with a restriction enzyme if desired. A region to be expressed is excised from the cloned DNA and ligated downstream of a promoter in a vector suitable for expression to obtain an expression type vector.

As described in Examples 5 and 7, as a form for expressing the novel membrane protein of the present invention, a method using a cDNA encoding a polypeptide having an amino acid sequence represented by SEQ ID NO: 2 in the Sequence Listing can also be used. However, in this state, it is a membrane-bound type, and as described in Examples 6 and 8, the amino acid sequence described in SEQ ID NO: 1, Only the extracellular portion of the polypeptide can be expressed. Therefore, using a DNA encoding the amino acid sequence of SEQ ID NO: 1 in the form containing the extracellular portion,
It can also be expressed and produced in secretory form. Further, the form may be a single polypeptide, but a polypeptide having a complex form is also possible. The “complex” used in the present invention is not a mixture of two or more substances simply mixed, but a polypeptide or conjugate comprising one or more polypeptides having some kind of binding mode including a covalent bond. A generic term for gates or complexes.

Examples thereof include a complex formed by covalently bonding a chimeric protein to an immunoglobulin by a disulfide bond or an antigen-antibody reaction between a polypeptide having a FLAG sequence prepared in Example 8 and an anti-FLAG antibody. Such as a complex formed. Further, a method of expressing the protein as a chimeric protein with the Fc portion of human IgG and expressing it as a multimer having a disulfide bond at the hinge portion of the antibody, or a method of expressing the antibody recognition site as a chimeric protein expressed at the C-terminal or N-terminal. A method of forming a multimer by reacting a polypeptide containing the extracellular portion of the expressed polypeptide with an antibody that specifically recognizes a C-terminal or N-terminal antibody recognition site.

Further, as another method, a method of expressing a fusion protein with only the hinge region portion of the antibody to form a dimer by a disulfide bond, or any other effect on the activity of the polypeptide Multimeric polypeptide having a high specific activity of at least a dimer composed of a fusion protein prepared to express a peptide capable of forming a disulfide bond in a C-terminal, N-terminal or other site in a non-existent manner You can also get Further, there is a method of arranging two or more tandemly in a frame-matched form to express a multimeric structure when a DNA encoding the amino acid sequence of SEQ ID NO: 1 in the sequence listing is translated into amino acids. In addition, any of the currently known methods for providing a multimeric structure of a dimer or more can be applied. Therefore, the polypeptide in a form having a dimer or higher form by a genetic engineering technique, or a polypeptide comprising part or all of the amino acid sequence described in SEQ ID NO: 1 or 2 in the sequence listing The present invention is also included in the present invention.

By using the novel membrane protein thus obtained, it is possible to search for the physiological activity of the novel membrane protein as a research reagent. The expression of the membrane protein is specifically high in the brain, spinal cord and adrenal gland. By isolating tissues at these sites or using various cell lines and allowing the membrane protein to act, it is possible to search for in vitro physiological activities. Further, by applying this assay system, it is possible to screen for a compound that inhibits the action of the membrane protein. The DNA encoding the novel membrane protein of the present invention may have a translation initiation codon at its 5 'end and a translation termination codon at its 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. To express the DNA, a promoter is connected upstream thereof. An example including a start codon and a stop codon is illustrated in SEQ ID NO: 3 in the sequence listing.

Examples of the vector include the above-mentioned plasmids derived from Escherichia coli, plasmids derived from Bacillus subtilis, plasmids derived from yeast, and bacteriophages such as λ phage and animal viruses such as retrovirus and vaccinia virus. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. The tac promoter, trp promoter, lac promoter and the like are used when the host used for the transformation is Escherichia, and the SPO1 and SPO2 promoters are used when the host is Bacillus. PGK promoter, GAP promoter A
DH promoters and the like are preferred.

When the host is an animal cell, SV40
Derived promoter, retroviral promoter,
A metallothionein promoter, a heat shock promoter and the like can be used, respectively. Using the expression plasmid containing the DNA encoding the membrane protein thus constructed, a transformant is produced. Examples of the host include Escherichia, Bacillus, yeast, animal cells and the like. Examples of animal cells include monkey cells such as COS-1, Vero, Chinese hamster cells CHO, and silkworm cells SF9. Thus, the DNA encoding the novel membrane protein of the present invention
Thus, a transformant transformed with the expression plasmid containing is obtained. The membrane protein can be produced by culturing each transformant in a suitable medium under a suitable culture condition by a known method.

The membrane protein can be separated and purified from the above culture by, for example, the following method. When extracting the membrane protein from cultured cells or cells,
After the culture, the cells or cells are collected by a known method, suspended in an appropriate buffer, disrupted by ultrasonication, lysozyme, and / or freeze-thawing, and then disrupted by centrifugation or filtration. A method for obtaining a crude extract of a membrane protein or the like may be appropriately used. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100. When the membrane protein is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a method known per se, and the supernatant is collected. The membrane protein contained in the thus obtained culture supernatant or extract can be purified by an antibody against the membrane protein obtained by the method described in Example 11.

The novel membrane protein of the present invention has a polypeptide as a basic skeleton. Therefore, if used as a pharmaceutical, a lyophilized product of the novel membrane protein of the present invention having the above-mentioned form together with a suitable stabilizer, such as human serum albumin, is prepared and dissolved in distilled water for injection at the time of use. Alternatively, a shape that can be used by suspending is desirable. For example, it can be provided as an injection or a drop prepared at a concentration of 1 to 1000 μg / ml. The present inventors have determined that the novel membrane protein of the present invention 1 mg / ml, human serum albumin 1 mg / ml
As a result of examining the stability of the novel membrane protein of the present invention, the physical and chemical properties of the membrane protein were maintained for a long period of time. Regarding the toxicity of the membrane protein, 10 mg / Kg was intraperitoneally administered to mice, but no death cases of the mice were confirmed.

The in vivo physiological activity of the membrane protein of the present invention can be determined by administering to any disease model mouse or an animal such as a rat or a monkey exhibiting a symptom similar to the disease, using the model as a model. Function recovery,
It becomes possible by examining the abnormality. Alternatively, if an experimental animal is used and a model system of behavioral physiology such as learning ability and spatial recognition is used, it is possible to examine the effect on higher brain functions. Of course, since these results can be extrapolated to humans, it is possible to obtain effective data for evaluating the novel membrane protein of the present invention as a medicinal effect.

When the membrane protein of the present invention is used as a drug, the field of application is all neurological diseases and diseases. The dose per adult dose varies depending on age, gender, weight, symptoms, etc., but is generally about 0.1 μg to
It is 100 mg / kg and can be administered once a day or several times as needed. In addition, a catheter or the like can be used as an administration method for administration into the brain.
When the novel membrane protein of the present invention is used as an injection, a thickener such as sucrose, glycerin, methylcellulose, carboxymethylcellulose and the like, a pH adjuster for various inorganic salts, and the like can be added as additives.

Further, using the novel membrane protein gene of the present invention, a promoter sequence capable of controlling the expression of the membrane protein gene can be obtained from the genome, and a reporter gene such as a luciferase gene can be obtained downstream of the promoter. And transfecting the cells into appropriate cells, stimulating the cells with various specimens, for example, peptides having any sequence, or various polypeptides, or fermentation products of various microorganisms, etc. It is possible to screen for a factor that induces or inhibits the expression of the membrane protein gene by comparing the expression of.

The novel membrane protein of the present invention can be immobilized as an adaptation to a cell therapy method. As a method for immobilization, the membrane protein can be covalently bonded to a culture vessel by utilizing an amino group or a carboxyl group of the membrane protein, using an appropriate spacer, or using the above-mentioned crosslinking agent. . Therefore, it has a form existing on a solid surface, further has at least a novel polypeptide activity, and further contains a part or all of the amino acid sequence selected from the group consisting of SEQ ID NOS: 1 and 2 in the sequence listing. The present invention also includes polypeptides.

When a DNA encoding part or all of the gene sequence of SEQ ID NO: 3 in the sequence listing is used as shown in Example 4, Northern blotting can be performed. Therefore, as a method for examining the expression of the present gene, a 12-mer to 16-mer or more, preferably 18-mer or more complementary nucleic acid having a partial gene sequence of SEQ ID NO: 3 in the sequence listing, that is, antisense DNA, RNA, and Methylation, methylphosphate, deamination,
Alternatively, it can be carried out using a thiophosphated derivative. The expression of the present gene can also be examined by PCR using these sense and antisense oligonucleotides as primers. Furthermore, a homolog of the present gene of another organism such as a mouse or rat can be detected or cloned by a method similar to the method described in Example 2, or a PCR method.

Further, cloning of genes on the genome including humans is also possible. Therefore, by using these cloned genes, more detailed functions of the novel membrane protein of the present invention can be clarified. For example, using recent gene manipulation technology,
Any method can be used, such as transgenic mice, jet targeting mice, and double knockout in which the gene related to the present gene is inactivated together. Further, if there is a genomic abnormality of the present gene, application to gene diagnosis and gene therapy is also possible.

The antibody of the present invention that specifically recognizes the membrane protein can be prepared as shown in Example 11. In addition, Antibodies a Labo
ratmanual, E.L. Harlow et
al. , Cold Spring Harbor L
(A. laboratory), immunoglobulin genes isolated by a gene cloning method or the like, and can also be produced by a recombinant antibody expressed in cells. The antibody thus produced can be used for purifying the membrane protein. That is, as shown in Example 11, if an antibody that specifically recognizes the membrane protein is used, the membrane protein can be detected and measured, and can be used as a diagnostic agent for the above-mentioned diseases and the like. In addition, since no expression is observed in normal cells other than the brain, spinal cord and adrenal gland, and the membrane protein is expressed in uterine shin cancer cell lines and malignant melanoma cell lines, the antibody can be used as a diagnostic agent for cancer.

The polypeptide in any of the forms described in the present invention, ie, SEQ ID NOs: 1 and 2 in the sequence listing
The present invention includes polypeptides containing a part or all of the amino acid sequence of the amino acid sequence selected from the group consisting of: and a complex composed of them. The general procedures necessary for handling DNA and Escherichia coli as a recombinant host described in the present specification are those commonly performed by those skilled in the art. T. Ma
niatis et al. , Molecular C
loaning A Laboratory Manua
1, Cold Spring Harbor Labo
ratability 1982, 1989). Commercially available enzymes and reagents can be used for all the enzymes and reagents to be used. Unless otherwise specified, these objects can be completely achieved according to the use conditions specified for the products.

[0056]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described in detail with reference to embodiments, but the present invention is not limited to these embodiments. Example 1 Preparation of Probe In order to obtain a DNA fragment having a base sequence homologous to the clone of Genbank accession number R24709 and use it as a probe for cDNA screening, a sense primer R2 was used as a PCR primer corresponding to R24709.
4709S: 5'-TTACCATGGCCTCTAC
TGTG-3 '(described in SEQ ID NO: 4 in the sequence listing), and antisense primer R24709A: 5'-AGA
A synthetic oligo DNA having a sequence of TGCACGTGCCATTCAGG-3 ′ (described in SEQ ID NO: 5 in the sequence listing) (both 20 mer) was prepared.

The synthetic oligonucleotide was prepared using a fully automatic DNA synthesizer based on the solid phase method. Fully automatic D
Applied Biosystems Company 391 as NA synthesizer
PCR-MATE was used. Carriers, solutions, and reagents having nucleotides and 3'-nucleotides immobilized thereon were used according to the manufacturer's instructions. The predetermined coupling reaction was terminated, and the oligonucleotide carrier from which the protecting group at the 5 'end had been removed with trichloroacetic acid was allowed to stand in concentrated ammonia at room temperature for 1 hour to release the oligonucleotide from the carrier. Next, in order to release the protecting groups for the nucleic acid and the phosphate, the reaction solution containing the nucleic acid was allowed to stand at 55 ° C. for 14 hours or more in a concentrated ammonia solution in a sealed vial. Purification of each oligonucleotide from which the carrier and the protecting group were released was performed using an OPC cartridge manufactured by Applied Biosystems, and detritylated with 2% trifluoroacetic acid. The purified primer has a final concentration of 100p
mol / μl in deionized water and PCR
Used for

Amplification by PCR was performed as follows.
Human fetal brain-derived cDNA mixed solution (QUICK-Clo
ne cDNA, CLONTECH) (1 μl) and a 10 × buffer (500 mM KCl, 100 mM)
Tris-HCl (pH 8.3), 15 mM MgCl
₂ , 0.01% gelatin) 5 μl, dNTP Mixt
ure (manufactured by Takara Shuzo), 4 μl of the aforementioned sense primer R24709S (100 pmol / μl) and antisense primer R24709A (100 pmol / μl)
l) with 0.25 μl of each, and 0.2 of Taq DNA polymerase (AmpliTaq: 5U / μl, manufactured by Takara Shuzo)
μl, and finally distilled water to make a total volume of 50 μl, and then at 95 ° C. for 45 seconds, at 55 ° C. for 45 seconds, and at 72 ° C. for 2 seconds.
This cycle is defined as 35 cycles per minute.
After cycling, PCR was performed by leaving the mixture at 72 ° C. for 7 minutes. A part of this PCR product was subjected to 2% agarose gel electrophoresis, stained with ethidium bromide (manufactured by Nippon Gene Co., Ltd.), and observed under ultraviolet light.
It was confirmed that the DNA was amplified.

The total amount of the PCR product obtained by using the PCR primers corresponding to R24709 thus obtained was 2% prepared using low melting point agarose (manufactured by GIBCO BRL).
After electrophoresis on an agarose gel and staining with ethidium bromide, a band of about 210 bp was cut out under ultraviolet irradiation, and the same volume of distilled water as the gel was added.
After heating for 0 min to completely dissolve the gel, an equal volume of TE
Add saturated phenol (Nippon Gene) and add 1500
After centrifugation at 0 rpm for 5 minutes, the supernatant was separated, and the same separation operation was performed using TE-saturated phenol: chloroform (1: 1).
1) Performed in solution and further in chloroform. The DNA was recovered from the finally obtained solution by ethanol precipitation.

As a plasmid vector, pCRII Ve
ctor (Invitrogen, pCRII)
This plasmid vector and the above DNA
Are mixed so that the molar ratio becomes 1: 3, and T4 D
DNA was inserted into the plasmid vector using NA ligase (manufactured by Invitrogen). The pCRII into which the DNA was incorporated was used to prepare Escherichia coli One Shot Compe.
The gene was introduced into tent cells (Invitrogen), and ampicillin (Sigma) was added to 50 μl.
g / ml on an L-Broth (Takara Shuzo) semi-solid medium plate, leave at 37 ° C. for about 12 hours, randomly select colonies that have appeared, and L-Broth liquid containing the same concentration of ampicillin. Inoculate 2 ml of medium, 18
The cells were shake-cultured at about 37 ° C. for about an hour, the cells were collected, and the plasmid vector was separated using Wizard Mini Prep (promega) according to the attached instructions.

This plasmid vector was replaced with the restriction enzyme Eco.
After digestion with RI, about 210 bp of DNA was cut out to confirm that the PCR product had been incorporated, and for the confirmed plasmid vector clone, the nucleotide sequence of the incorporated DNA was determined by fluorescence. DNA sequencer (Applied Biosystems, Model 3
73S), and the R
It was confirmed to be homologous to the nucleotide sequence of 24709. This DNA fragment having a nucleotide sequence homologous to EST clone R24709 is referred to as "probe # 7". This plasmid having probe # 7 was named pCR # 7.

Example 2 Northern hybridization using probe # 7 Probe # 7 obtained by the method described in Example 1
To examine the expression of mRNA of the gene encoded by
lontech Human Multiple T
issue Northern Blot, Human
Multiple Tissue Northern
Blot II, Human Multiple Ti
Northern hybridization was performed using sueNorthern Blot III. Probe # 7 obtained by the method described in Example 1 was used for DNA labeling kit (Megaprime DNA labeling).
A probe for Northern hybridization was obtained by labeling with a radioisotope ³² P using a system (manufactured by Amersham).

That is, 5 μl of a primer solution and deionized water were added to 25 ng of DNA to make the total volume 33 μl, and a boiling water bath was carried out for 5 minutes. Thereafter, 10 μl of a reaction buffer containing dNTP, 5 μl of α-32P-dCTP, and T4D
Add 2 μl of NA polynucleotide kinase solution and add
A water bath at 7 ° C. for 10 minutes, and then a Sephadex column (Quick Spin Column Seph)
adex G-50: Boehringer Mannheim), and used in a boiling water bath for 5 minutes followed by ice cooling for 2 minutes. Next, hybridization was performed with the above filter under the conditions described below. Hybridization was performed at a final concentration of each component of 5 times (hereinafter, 5 ×).
SSPE solution, Denhardt's solution of 5 times concentration (manufactured by Wako Pure Chemical Industries, Ltd.), 2% SDS (sodium dodecyl sulfate),
It is immersed in a prehybridization solution, which is denatured salmon sperm DNA in 50% formamide and a boiling water bath of 100 μg / ml, shaken at 42 ° C. for 2 hours, and then contains a probe containing a ³² P-labeled probe by the method described above. It was immersed in a hybridization solution having the same composition as the hybridization solution and shaken at 42 ° C. for 16 hours.

Next, the filter was immersed in a 2 × SSPE solution containing 0.1% SDS and washed by shaking at room temperature for 15 minutes, and this was performed four times. After the washing, the filter was subjected to autoradiography for 72 hours using an intensifying screen. As a result, remarkable expression was observed in the brain, spinal cord and adrenal gland among human adult tissues. However, almost no expression was observed in other organs, and it was revealed that the gene encoded by probe # 7 is a gene that is specifically expressed in brain and nervous system tissues.

Example 3 cDNA Cloning and Identification Probe # 7 was labeled with a radioisotope ³² P using the same method as described in Example 2 to obtain a probe for cDNA screening. Lambda phage c in human fetal brain
A part of the phage solution of the DNA library (manufactured by CLONTECH) was taken and SM buffer (0.1 M NaC) was used.
1, 8 mM MgSO4.7H2O, 50 mM Tri
s-HCl (pH 7.5), 0.01% gelati
n) at several dilutions, coli
The phage plating cell prepared from NM514 was infected and titrated by forming plaque on an agar plate of L medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl). × 10 ⁵ pfu / ml.

Approximately 900,000 clones of the λgt10 recombinant in the above library were screened by plaque hybridization using a DNA probe labeled with the aforementioned radioisotope ³² P to obtain 24 positive clones. That is, 2 ml of the phage solution of the above library
To E. E. coli NM514 and 9 × 10 ⁵ plaques formed on an agar plate of L medium were passed through a nylon filter (Hybond N +: Amersh).
am) and the transferred nylon filter is treated with an alkali (1.5 M NaCl, 0.5 M NaOH).
For 7 minutes on a filter paper impregnated with), and then neutralized (1.5 M NaCl, 0.5 M Tris-HCl)
(PH 7.2), left on a filter paper impregnated with 1 mM EDTA for 3 minutes), and then an SSPE solution (0.
36M NaCl, 0.02M sodium phosphate (pH
7.7) After shaking for 5 minutes in a 2 × solution of 2 mM EDTA), the plate was washed and air-dried. Then, 0.4M NaOH
For 20 minutes on filter paper impregnated with
After shaking with an SPE solution for 5 minutes, the plate was washed and air-dried again.

Next, D labeled with the radioactive isotope ³² P
Hybridization was performed with the NA probe under the conditions described below. Hybridization was performed using an SSPE solution in which the final concentration of each component was 5 times (hereinafter referred to as 5 ×), a Denhardt solution (5 times concentration) (manufactured by Wako Pure Chemical Industries, Ltd.), 0.5
% SDS (sodium dodecyl sulfate) and 20 μg /
After being immersed in a prehybridization solution, which is denatured salmon sperm DNA in a boiling water bath, and shaken at 50 ° C. for 2 hours, the same composition as that of the prehybridization solution containing the ³² P-labeled probe by the above-mentioned method was used. , And shaken at 50 ° C. for 16 hours.

Next, the filter was immersed in a 2 × SSPE solution containing 0.1% SDS, washed by shaking at room temperature for 15 minutes, and subjected to four times. After the washing, the filter was subjected to autoradiography for 24 hours using an intensifying screen. As a result, phage was extracted from the agar region corresponding to the strongly exposed portion, and plaque hybridization was performed again according to the above-described steps, thereby obtaining 24 types of purified λgt10 recombinants. From these 24 kinds of recombinants, the method of Grossberger et al.
r et al. , Nucleic Acids Re
search (1987) 15, 6737).
gt10 recombinant DNA was extracted.

Next, the obtained λgt10 recombinant DNA
After digestion with EcoRI, agarose gel electrophoresis revealed an insert cDNA of about 2.9 kb. A gel fragment containing this cDNA fragment was cut out. Gene Clean II from gel fragment
(BIO101) and DNA was extracted according to the attached protocol. The obtained DNA fragment of about 2.9 kb was subcloned into the EcoRI site of pBluescript II KS + (manufactured by Toyobo), and plasmid p #
70. A deletion mutant was prepared for base sequence determination. A mutant kit for kilosequence (Takara Shuzo) was used to prepare the mutant. The nucleotide sequence of each mutant was determined by the method of Sanger et al.
et al. Proc. Natl. Acad. Sci.
(1977) 74, 5463), 2.9
The entire base sequence of the kb cDNA fragment was determined. The determined nucleotide sequence is shown in SEQ ID NO: 3 in the sequence listing. The nucleotide sequence was determined using a DNA fluorescence sequencer (Applied Biosystem, manufactured by Applied Biosystems).
Performed according to the attached manual.

The present DNA sequence had an open reading frame capable of encoding a 737 amino acid sequence from the start codon (ATG) starting at position 83 to the stop codon (TGA) ending at position 2297. The amino acid sequence translated from the open reading frame is shown in SEQ ID NO: 2 in the sequence listing. The orientation of the gene of plasmid p # 70 was determined by the lamination of pBluescript II vector.
The 5 'side shown in SEQ ID NO: 3 in the reverse direction to the cZ gene was present on the SacI side of the multicloning site of the pBluescript II KS + vector.

Example 4 Expression of mRNA by Northern Blotting In order to examine the expression of mRNA of the present novel membrane protein, Clo, a filter to which mRNA has been previously transcribed, was used.
ntech Human MultipleTiss
ue Northern Blot, Human Mu
singleTissue Northern Blo
t II, Human Multiple Tissue
Northern Blot III, Human Ca
ncer Cell Line Multiple T
issue Northern Blot, Human
Fetal Multiple Tissue No
rthern Blot, Human Brain M
multiple Tissue Northern B
lot, Human Brain Multiple
Tissue Northern Blot II, Hu
man Brain Multiple Tissue
Northern Blot III was used.

The probe was 5'-TCCCAGTCTC
Oligo DNA having the sequence of CCAGCCACTG-3 '
(Primer # 7-10S, described in SEQ ID NO: 15 in the sequence listing) and 5'-TCACCACCAGAGTTTAAGCG
Oligo DNA having the sequence of C-3 ′ (primer # 7-
11A, described in SEQ ID NO: 16 in the sequence listing) as a primer, and plasmid p # 70 as a template for PCR. It was confirmed by agarose gel electrophoresis that approximately 500 bp of DNA (the 491th to 990th positions of the DNA sequence of SEQ ID NO: 3 in the sequence listing) was amplified. A gel fragment containing the PCR product was cut out and Genecl was cut out.
The gene fragment purified using ean II (manufactured by BIO101) was subjected to DNA labeling kit (MegaPr
imDNA labeling system: Am
ersham) and labeled with ³² P by the method described above, and the expression was examined.

As a result, remarkable expression was observed in the brain, spinal cord and adrenal gland among human adult tissues. In addition, extremely weak expression was observed in the heart, kidney, pancreas, prostate, small intestine, large intestine, stomach, and trachea. However, the placenta, lungs, liver,
No expression was observed in skeletal muscle, spleen, thymus, testis, ovary, peripheral blood leukocytes, thyroid, lymph nodes, and bone marrow. In human fetal tissues, expression was found in the brain and kidney, but no expression was found in the heart, lung, and liver. Furthermore, the expression site in the human adult brain was analyzed in detail. Expression in cerebellar tonsils, caudate nucleus, corpus callosum, hippocampus, hypothalamus, midbrain substantia nigra, subthalamic nucleus, thalamus, cerebellum, cerebral cortex, spinal cord, occipital lobe, frontal lobe, temporal lobe, putamen Remarkable expression was observed at all sites. Also,
In human cancer cells, the cervix carcinoma cell line HeLa c
Expression was observed in ell S3, a melanoma cell line G361. However, the promyelocytic leukemia cell line HL-
60, no expression was observed in chronic myeloid leukemia cell line K-562, lymphoblastic leukemia cell line MOLT-4, Burkitt's lymphoma cell line Raji, colorectal adenocarcinoma cell line SW480, and lung cancer cell line A549.

Example 5 Preparation of a Plasmid for Expression of a Full-length Gene for a Novel Membrane Protein To introduce a full-length gene for a novel membrane protein of the present invention obtained by the method described in Example 3 into an animal cell, Coding for the described polypeptide
A, and 8 amino acids at the C-terminus of the amino acid sequence of SEQ ID NO: 2 in the sequence listing using IBI FLAG manufactured by Kodak Company, that is, Asp-Tyr-Ly as an amino acid sequence.
A DNA encoding the polypeptide to which a polypeptide having s-Asp-Asp-Asp-Asp-Asp-Lys (hereinafter referred to as FLAG, described in SEQ ID NO: 14 in the sequence listing) was added to the multiple cloning site of plasmid pSVK3 (Pharmacia). Each of the plasmids was separately ligated, and the full-length expression plasmids pSVBertFu and pSV
BertFuFLAG was prepared.

In preparing an expression vector for a polypeptide-expressing cell containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing, a restriction enzyme XbaI site was added except for the 5 ′ non-transcribed region of SEQ ID NO: 3 in the sequence listing to obtain 5 ′ -AATCTA
Oligo DNA having a sequence of GATGCAGCCCCGCCGCGCCCA-3 ′ (primer A, described in SEQ ID NO: 6 in the sequence listing), 5′-CACCGGGTTGGCCA
PCR using oligo DNA having the sequence of GGGAGCT-3 '(primer B, described in SEQ ID NO: 7 in the sequence listing) as a primer and p # 70 as a template
Was done. After confirming that a DNA of about 110 bp was amplified by agarose gel electrophoresis, the PCR product was purified by the method described in Example 1, and pT7Blue
It was subcloned into a vector (Novagen). Thereafter, plasmid DN was obtained from the colonies of the three clones.
A was purified and sequenced to confirm the gene sequence. The gene sequence was found to have no error in the gene sequence, that is, the target gene sequence, ie, DNA sequence Nos. 84 to 194 of SEQ ID NO: 3 in the sequence listing.
It was confirmed that the fragment had the sequence of No.
Hereinafter, the plasmid having this fragment is referred to as pBert
-1.

Next, to add a restriction enzyme XhoI site except for the 3 ′ non-transcribed region of the novel membrane protein gene of SEQ ID NO: 3 in the sequence listing, 5′-ATCCATCCGGCATG
Oligo DNA having the sequence of CCAGGTT-3 '(primer C, described in SEQ ID NO: 8 in the sequence listing), 5'-AAC
TCGAGATTACAAATCTTTTAGTTTTTA
An oligo DNA having the sequence of ATCAG-3 ′ (primer D, described in SEQ ID NO: 9 in the sequence listing) was used as a primer, plasmid p # 70 was used as a template, and PC
R was performed. After confirming that about 130 bp DNA was amplified by agarose gel electrophoresis, this PCR
The product was purified by the method described in Example 1 to give pT7Blu
The vector was subcloned into an e vector (Novagen). After that, plasmid D
The NA was purified, sequenced, and the gene sequence was confirmed. The gene sequence was found to have no error and the target gene sequence, that is, 2 from 2168 of the DNA sequence of SEQ ID NO: 3 in the sequence listing.
It was confirmed to be a fragment having the sequence of No. 297. Hereinafter, the plasmid having this fragment is called pB
ert-2.

Further, 8 amino acids at the C-terminus of the full-length amino acid sequence of the novel membrane protein of SEQ ID NO: 2 in the sequence listing, ie, Asp-Tyr-Lys-Asp-A
A polypeptide having sp-Asp-Asp-Lys (F
LAG, described in SEQ ID NO: 14 in the sequence listing), to prepare an expression vector having a gene sequence encoding a polypeptide to which the above primer C,
5'-AACTCGAGGTCATTTATCATCAT
CATCTTTATAATCCAATCTTTAGT
Oligo DNA having the sequence of TTTAATCAGTGTG-3 ′ (Primer E, described in SEQ ID NO: 10 in Sequence Listing)
Was performed using the plasmid p # 70 as a template, subcloning into the pT7Blue vector, sequencing 4 clones, confirming the gene sequence, and confirming the target gene sequence, ie, SEQ ID NO: 3 in the sequence listing. 2 from 2168 of the DNA sequence
5'-GATTATAAAAG at the 3 'end of the 294th sequence
ATGATGATGATAAATGA-3 '(FLA
G: described in SEQ ID NO: 14 in the sequence listing) was confirmed to be a fragment having a continuous sequence. Hereinafter, the vector having this fragment is referred to as pBert-3.

Next, p # 70 was replaced with restriction enzymes XbaI and
Approximately 5.9 kbp of a DNA fragment digested with BalI and purified in the same manner as in Example 3, that is, the 3 'end of the DNA fragment containing the sequence Nos. 184 to 3230 of the DNA sequence of SEQ ID NO: 3 in the sequence listing. First, a fragment in which pBluescriptII from which the sequence from the EcoRI site to the XbaI site of the multiple cloning site was removed via EcoRI was added to the fragment as described above.
A 110 bp fragment obtained by digesting Bert-1 with restriction enzymes XbaI and BalI was used as a DNA Ligation.
Kit Ver. 2 (manufactured by Takara Shuzo Co., Ltd.) to obtain a plasmid pBert-4. Furthermore, pBert-
4 was digested with restriction enzymes SphI and XhoI, and a fragment of about 5 kbp was determined by agarose gel electrophoresis. PBluescript II in which the sequence from the XhoI site to the XbaI site of the multicloning site has been removed,
A fragment connected via XbaI of a restriction enzyme site was cut out and purified by the method described above. This gene fragment is designated as F1.

Similarly, pBert-2 and pBer
t-3 was digested with restriction enzymes SphI and XhoI to purify DNA fragments of about 120 bp and about 150 bp, respectively. These DNA fragments are referred to as F2 and F3, respectively. Then, F1 and F2, and F1 and F3 are each connected by the above-described method, and the plasmid pBSBertFu1 from which the gene fragment of the portion encoding the polypeptide of SEQ ID NO: 2 in the sequence listing is cut out with the restriction enzymes XbaI and XhoI, and a restriction enzyme A plasmid pBSBertFu2 was prepared in which a gene fragment corresponding to a portion encoding a polypeptide having a FLAG amino acid sequence at the C-terminus of the polypeptide of SEQ ID NO: 2 was excised with XbaI and XhoI.

The plasmid pB thus prepared
SBertFu1 and pBSBertFu2 were replaced with restriction enzymes X
digested with baI and XhoI, and electrophoresed to obtain a DNA fragment of about 2.2 kbp, ie, a DNA fragment containing a DNA fragment encoding the amino acid sequence of the novel polypeptide.
The A fragment was separated and purified. These two types of DNA fragments were treated with the above-mentioned pSVK3 with restriction enzymes XbaI and XhoI to give a DNA fragment of about 3.9 kb purified by the method described in Example 3, and T4 DNA ligase (Takara Shuzo). And ligated to construct an expression plasmid for the novel polypeptide. The thus prepared expression plasmid containing no FLAG sequence is referred to as pSVBertFu, and the expression plasmid containing the FLAG sequence is referred to as pSVBertFuFLAG.

Example 6 Preparation of Expression Plasmid for Extracellular Partial Gene of New Membrane Protein The C-terminal of the extracellular portion of the novel membrane protein encoded by the novel gene obtained by the method described in Example 3, that is, SEQ ID NO: FLA at the C-terminus of the amino acid sequence
Expression plasmid pSVBertEcFLAG for producing a polypeptide to which an G sequence has been added in animal cells, and human immunoglobulin I
An expression plasmid pSVBertEcIg was constructed which allows animal cells to produce a polypeptide to which the amino acid sequence of the Fc portion below the hinge portion of gG1 has been added.

PSVBertEcFLAG, ie
8 amino acids at the C-terminus of the polypeptide having the extracellular partial amino acid sequence of the novel polypeptide of SEQ ID NO: 1 in the sequence listing, that is, Asp-Tyr-Lys-Asp as an amino acid sequence
-In preparing an expression plasmid having a gene sequence encoding a polypeptide to which a polypeptide having Asp-Asp-Asp-Lys (FLAG: described in SEQ ID NO: 14 in the sequence listing) is added, a method similar to that for the full length plasmid is used. ,
5'-TGTACAAGGATCCCTGGCCTAA
Oligo DNA having a sequence of -3 '(primer F, described in SEQ ID NO: 11 in the sequence listing), 5'-AACTCGAGGT
CATTATCATCATCATCATCTTTTATAAT
PCR was performed using oligo DNA having the sequence of CGGAGTGCCGTGGCATGTTTGG-3 ′ (primer G, described in SEQ ID NO: 12 in the Sequence Listing) as a primer and plasmid p # 70 containing the gene of SEQ ID NO: 3 in the Sequence Listing as a template. . Approximately 320 bp DN
After confirming that A was amplified by agarose gel electrophoresis, the PCR product was purified by the method described in Example 1 and subcloned into the pT7Blue vector.

Thereafter, plasmid DNA was purified from the colonies of the five clones and sequenced to confirm the gene sequence.
That is, 5'-GATTATA was added to the 3 'end of the sequence from position 1708 to position 1997 of the DNA sequence of SEQ ID NO: 3 in the sequence listing.
AAGATGATGATGATAAATGA-3 ′ (described in SEQ ID NO: 14 in the sequence listing) was confirmed to be a fragment having a connected sequence, and plasmid pBer was confirmed.
It was set to t-5. The above plasmid pBert-4 was digested with restriction enzymes BamHI and XhoI (manufactured by Takara Shuzo Co., Ltd.), and a DNA fragment of about 4.5 kbp was obtained by removing a DNA fragment of the sequence No. 1719 and after of the DNA sequence of SEQ ID NO: 3 in the sequence listing.
Similarly, pBert-5 was added to the fragment with the restriction enzyme BamHI.
And a DNA fragment of about 310 bp obtained by digestion with XhoI were ligated with T4 DNA ligase to give plasmid pBS.
BertEcFLAG was obtained.

The thus prepared plasmid pB
Substituting SBertEcFLAG with restriction enzymes XbaI and XhoI
And a DNA fragment containing a DNA sequence encoding the amino acid sequence of the extracellular region of the novel polypeptide was separated and purified by electrophoresis. This DNA fragment was ligated with the expression vector pS described above.
VK3 was similarly treated with restriction enzymes XbaI and XhoI, and then ligated with a vector DNA fragment of about 3.9 kb obtained by purification using T4 DNA ligase (Takara Shuzo).
A plasmid capable of producing a polypeptide having a FLAG sequence at the C-terminus of the amino acid sequence of SEQ ID NO: 1 in the sequence listing of the novel polypeptide was prepared. The expression plasmid prepared as described above is referred to as pSVBertEcFLAG.

Next, pSVBertEcIg, that is, a polypeptide in which the amino acid sequence of the Fc portion below the hinge portion of human IgG has been added to the C-terminal of the polypeptide of the novel polypeptide extracellular partial amino acid sequence of SEQ ID NO: 1 in the sequence listing, In preparing an expression plasmid having an encoding gene sequence, in order to add a restriction enzyme BglII site to the C-terminal of the polypeptide having the amino acid sequence of SEQ ID NO: 1 in the sequence listing, the primer F , 5'-AAAGATCTGAGTGCCCGT
Oligo DNA having the sequence of GGCATGTTTGG-3 '
PCR was performed using (primer H, described in SEQ ID NO: 13 in the sequence listing) as a primer and plasmid p # 70 containing the gene of SEQ ID NO: 3 in the sequence listing as a template. After confirming that a DNA of about 300 bp had been amplified by agarose gel electrophoresis, the PCR product was purified by the method described in Example 1 and subcloned into the EcoRV site of the pT7Blue vector (Novagen).

Thereafter, plasmid DNA was purified from the colonies of 10 clones and sequenced to confirm the DNA sequence.
A restriction enzyme Bgl was added to the 3 'end of the sequence from No. 8 to No. 1996.
II was confirmed to be a fragment having the connected sequence, and the DNA fragment was found to have a translation direction of pT7
A clone ligated in the opposite direction to the lacZ gene of the Blue vector, that is, the 5 ′ end of No. 1708 of SEQ ID NO: 3 in the sequence listing of the DNA fragment is pT7Blu.
A clone linked to the BamHI site side of the multiple cloning site of the e vector was selected, and pBert-6 was selected.
And

Next, the production of a fusion protein with an immunoglobulin Fc protein was carried out using Zettlemessl (Zetmeissl).
tlmeissl et al. , DNA cell
Biol. , 9.347-354, 1990), using a gene using genomic DNA containing introns. That is, human Ig containing introns
Plasmid pBS having a gene encoding G1Fc
hIgFc (International Publication No. WO 96/11212) is digested with restriction enzymes BamHI and XbaI (manufactured by Takara Shuzo Co., Ltd.), purified by the method described in Example 3, and purified to about 1.4 kb.
Genomic DNA corresponding to the hinge part of the heavy chain of human IgG1 (sequence is Kabat et al., Seq.
uence of Immunological In
terest, NIH publication No
91-3242, 1991). Next, the plasmid pBert-6 was replaced with the restriction enzymes BglII and Xgl.
Approximately 3.2 kb digested with baI and separated by electrophoresis
DNA fragment of p, ie pT7B of pBert-6
Ec of multiple cloning site of lue vector sequence
A DNA fragment obtained by removing about 20 bp from the oRV site to the XbaI site was added to the aforementioned about 1.4 kbp human Ig.
The genomic DNA fragment encoding the G1Fc portion was converted to T4D
Ligated with NA ligase (Takara Shuzo) and plasmid pB
ert-7 was obtained.

Next, the above plasmid pBert-7 was digested with restriction enzymes SacI and BamHI (manufactured by Takara Shuzo Co., Ltd.) and separated by electrophoresis. A DNA fragment of about 4.6 kbp, that is, the pT7Blue vector sequence of pBert-7 About 20 bp from the EcoRV site to the SacI site of the multiple cloning site, and the restriction enzymes Bam Nos. 1708 to 1715 of SEQ ID NO: 3 in the sequence listing.
The DNA fragment from which about 8 bp of the DNA fragment having the DNA sequence up to the HI site had been removed was added to the aforementioned plasmid pB.
ert-4 is also converted to the restriction enzymes SacI and BamHI.
1.6 kbp D separated by electrophoresis
The NA fragment, that is, a DNA fragment having a DNA sequence from the BamHI site at position 84 to position 1715 of SEQ ID NO: 3 in the sequence listing, was ligated with T4 DNA ligase (Takara Shuzo Co., Ltd.) and the plasmid pT7BertEcIg was ligated.
I got

The plasmid pT thus prepared
7BertEcIg was replaced with restriction enzymes EcoRI and SalI.
(Manufactured by Takara Shuzo Co., Ltd.) and electrophoresed to approximately 3.3
A kbp DNA fragment, that is, a DNA fragment containing a DNA sequence encoding the amino acid sequence of a fusion protein in which a human IgG1 Fc protein was added to the C-terminus of the extracellular region of the novel polypeptide was separated and purified. This DNA fragment was purified by treating the above-mentioned expression vector pSVK3 with restriction enzymes EcoRI and SalI in the same manner, and then purifying the DNA fragment.
A 9 kb vector DNA fragment was ligated with T4 DNA ligase (Takara Shuzo), and human IgG1F was added to the C-terminal of the amino acid sequence of SEQ ID NO: 1 in the sequence listing of the novel polypeptide.
A plasmid capable of producing a polypeptide having the c protein was prepared. The expression plasmid prepared as described above is designated as pSVBertEcIg.

Example 7 Transformation of Balb / 3T3 cells with plasmid Mouse fibroblast Balb / 3T3 clone A3
No. 1 (available from RIKEN, Cell Development Bank, No.
RCB0005) and expression plasmids pSVBertFu and pSVBert obtained by the method described in Example 5.
Transformation was performed using FuFLAG. That is, D-ME
The above cells cultured in M (Dulbecco's modified MEM medium, GIBCO-BRL) 10% FCS were replaced on the day before the transformation to reduce the number of cells to 5 × 10 ⁶ per 10 cm diameter cell culture dish. Then, 10 ml of the above medium was added thereto, and the mixture was cultured overnight. The next day, the cells were precipitated by centrifugation, washed twice by centrifugation with PBS (-), and then washed with 1 mM Mg.
Cells were prepared in Cl ₂ and PBS (−) at a concentration of 1 × 10 ⁷ cells / ml. Gene transfer is Bio-
The electroporation was performed using a gene transfer device manufactured by Rad.

500 μl of the above cell suspension was placed in a cell (0.4 cm) dedicated to electroporation, and the expression plasmid pSVBertFu or pSVBertFuF
LAG and pSV2-neo (ATCC37150)
Is added in each case and left on ice for 5 minutes. afterwards,
Leave for one minute at room temperature and repeat for two 3 μF, 450
A voltage of V was applied. Then, after leaving to stand on ice for 5 minutes, the cells were cultured in a 10 cm diameter cell culture dish in 10 ml of the above medium for 3 days. Three days later, G418 was added to the above medium.
(Sigma) was replaced with a medium supplemented with 400 μg / ml, and thereafter, the culture was continued for about 10 days by replacing 1/3 of the medium every two days. Ten days later, the colonies formed on the dish were removed using a trypsin solution (GIBC).
(O-BRL) to obtain a cell line stably expressing the cloned gene.

Hereinafter, the thus-produced Bal
A cell line stably expressing the polypeptide containing the amino acid sequence of SEQ ID NO: 2 in the sequence listing of b / 3T3 was Balb /
A cell line that stably expresses a polypeptide having a FLAG amino acid sequence at the C-terminus of the polypeptide containing the amino acid sequence of SEQ ID NO: 2 is designated as FULL.
Indicated as b / FULLFLAG. At the same time, a control transformed cell line into which only pSV2-neo was introduced by the same method was prepared, and this is designated as Balb / CON.

Example 8 Transformation of COS-7 Cells with Plasmids COS-7 (available from RIKEN, Cell Development Bank, RCB0539) was obtained by the method described in Example 6 for plasmids pSVBertEcFLAG and pSVB.
Using ertEcIg, transformation was carried out in the same manner as described in Example 7. That is, 10% of D-MEM (Dulbecco's modified MEM medium, manufactured by GIBCO-BRL)
On the day before the transformation, the medium was exchanged with the cells cultured in FCS, the number of cells was changed to 5 × 10 ⁶ cells per 10 cm cell culture dish, 10 ml of the above medium was added, and the cells were cultured overnight. The next day, the cells were precipitated by centrifugation and
After centrifugal washing twice with S (-), 1 mM MgCl ₂ , P
Cells were prepared in BS (−) at a concentration of 1 × 10 ⁷ cells / ml. Gene transfer was performed by an electroporation method using a gene transfer device manufactured by Bio-Rad.

Transfer 500 μl of the above cell suspension into a cell (0.4 cm) dedicated to electroporation, and use the expression plasmid pSVBertEcFLAG or pSVBer.
20 μg of tEcIg is added to each, and the mixture is left on ice for 5 minutes. After that, leave for 3 minutes at room temperature,
F, a voltage of 450 V was applied. Then, after leaving to stand on ice for 5 minutes, the cells were cultured in a 10-cm diameter cell culture dish in 10 ml of the above medium. On the day after the gene transfer, the medium was replaced with serum-free D-MEM (manufactured by GIBCO-BRL). The medium was replaced every four days thereafter, and the culture supernatant was collected over two weeks. Separate the culture supernatants into Centricon 3
0 (manufactured by Amicon) to transfer buffer from medium to PBS
Exchanged to (-) and concentrated 10-fold.

Example 9 Detection of Recombinant Protein Using Western Blot In the supernatant of the transformed cells prepared by the method described in Example 8, a polypeptide containing the polypeptide shown in SEQ ID NO: 1 in the sequence listing was contained. In order to confirm the production, it was confirmed by Western blot as follows. That is, the concentrated culture supernatant was subjected to SDS-PAG manufactured by ACI Japan.
Using an electrophoresis tank for E and a polyacrylamide gel for SDS-PAGE (gradient gel 5 to 10%), SDS-PAGE was performed according to the attached instruction manual. The sample is 2-mercaptoethanol (2-ME)
Performed on a sample under reducing conditions with overheat treatment and a sample under non-reducing conditions without the treatment,
As a marker, a rainbow marker (for high molecular weight) manufactured by Amersham was used, and a sample buffer and an electrophoresis buffer were prepared according to the attached instruction manual. After completion of SDS-PAGE, the acrylamide gel was transferred to a PVDF membrane filter (BioRad) using a BioRad mini-trans blot cell.

[0096] The filter thus produced was prepared by adding 5% B
SA (manufactured by Sigma), TBS-T (20 mM Tr
is, 137 mM NaCl (pH 7.6), 0.1%
Blocking was performed while shaking at 4 ° C. overnight in Tween 20). When the target protein is a FLAG fusion protein, the mouse monoclonal antibody Anti-
FLAG M2 (manufactured by Kodak), a peroxidase-labeled anti-mouse Ig sheep antibody (Amersha) as a secondary antibody
m). In the case of an IgGFc fusion protein, a peroxidase-labeled anti-human Ig sheep antibody (Amersham) was reacted. The reaction time of each antibody was 1 hour at room temperature, and between each reaction, the operation of shaking and washing with TBS-T for 10 minutes at room temperature was repeated three times. After the last washing, the filter was immersed in a reaction solution of an Amersham ECL western blotting detection system for 5 minutes, wrapped in Saran wrap, and exposed to an X-ray film.

As a result, the FLAG fusion protein (hereinafter referred to as E
In the case of cFLAG-PTN), a protein of about 80 kDa could be detected under both reducing and reducing conditions. In addition, an IgGFc fusion protein (hereinafter referred to as EcIg-P
TN), a protein of about 110 kDalton was detected under the reducing condition, and a protein of about 220 kDalton was detected under the non-reducing condition. From the above results, it was possible to obtain a desired cell producing the polypeptide containing the amino acid sequence of SEQ ID NO: 1 in the sequence listing. The molecular weight of the detected recombinant protein having the extracellular portion of the protein of the present invention was approximately 15 kDalton larger than the molecular weight predicted from the amino acid composition, and it was predicted that the sugar chain was added.

Example 10 Purification of Recombinant Extracellular Partial Protein Expression plasmid p prepared by the method described in Example 8
SVBertEcFLAG and pSVBertEcIg
5 liters of the culture supernatant of COS-7 cells transformed using the method described above were prepared. These culture supernatants were used for Anti-
Each of the recombinant proteins was adsorbed to the column through a FLAG M2 Affinity Gel column (manufactured by Kodak) and a Protein G Sepharose column (manufactured by Pharmacia) or a Protein A Sepharose column (manufactured by Pharmacia). The size of each column is 1 cm x 3 cm and the volume is about 2 ml,
All flow rates were 1 ml / min. I went in. After the adsorption, the column was washed with 20 ml of PBS (-), and then 0.5 MT
Elution was carried out with ris-glycine (pH 3.0).

The eluted fraction was collected in 2 ml portions, and 0.5 MT
Add 200 μl of ris-HCl (pH 9.5) at a time,
Each fraction was subjected to SDS-PAGE by the method described above.
After the electrophoresis was completed, the cells were stained with a silver staining kit Wako II (manufactured by Wako Pure Chemical Industries, Ltd.) according to the attached instructions. As a result, EcF
In both LAG-PTN and EcIg-PTN, it was confirmed that the purified protein was obtained in a band having the same size as the result of the Western blot described in Example 9. From these results, EcFLAG-PTN, ie, a polypeptide having a FLAG sequence at the C-terminus of the amino acid sequence of SEQ ID NO: 1 in the sequence listing, and EcIg-PTN, ie, a polypeptide having the amino acid sequence of SEQ ID NO: 1 in the sequence listing, Polypeptides having an IgG Fc protein at the C-terminus could be obtained in pure form.

To obtain a higher purity polypeptide,
EcFLAG-PTN purified by the above method, EcI
Each g-PTN was purified by gel filtration. The eluate from the affinity column was concentrated and centrifuged with Amicon Centricon 30 and the buffer was exchanged with PBS (-). Gel filtration was performed using an FPLC system (Pharmacia).
Using a Superose 12 column of the same company. The main peak eluted at the position of the same molecular weight as the result of the Western blot under the non-reducing condition of Example 9 was collected.

Example 11 Establishment of a Monoclonal Antibody Recognizing a Novel Membrane Protein Using purified EcFLAG-PTN as an immunogen, a mouse monoclonal antibody was prepared according to the method described in the written literature. That is, the purified recombinant polypeptide Ec prepared in Example 10
FLAG-PTN was subcutaneously or intradermally immunized to Balb / c mice (manufactured by Japan SLC) at 10 μg per mouse. After the second immunization, blood was collected from the fundus and an increase in the antibody titer in the serum was observed. After the third immunization, the spleen cells of the mouse were removed, and the mouse myeloma cell line P3X63A was obtained.
Cell fusion was performed with g8 (ATCC TIB9) by the polyethylene glycol method. Hybridomas were selected in a HAT medium (manufactured by Japan Institute of Immunology), and a hybridoma strain producing an antibody recognizing both EcFLAG-PTN and EcIg-PTN in the medium by the enzyme antibody method was isolated. A hybridoma strain producing a mouse monoclonal antibody that specifically recognizes the extracellular portion of the membrane protein has been established.

[0102] The culture supernatant of the hybridoma thus established was purified from Pharmacia's Mab TrapG II.
Was used to purify and produce an anti-membrane protein monoclonal antibody according to the attached protocol. Using the monoclonal antibody, the polypeptide purified in Example 10 was subjected to Western blot under the conditions described in Example 9. As a result, a single band having the same molecular weight as the result of the Western blot shown in Example 9 was detected, and it was revealed that the present monoclonal antibody can specifically recognize a novel membrane protein.

[0103]

Industrial Applicability According to the present invention, there is provided a novel membrane protein specifically expressed in brain, nervous system tissues and tumor cells, a gene thereof, a method for producing the same, and an antibody which specifically recognizes the membrane protein. It can be used for diagnosis of diseases and cancers specific to the brain and nervous system.

[0104]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 612 Sequence type: Amino acid Topology: Unknown Sequence type: Peptide Origin Organism name: Human Sequence Gly Pro Arg Gly Ser Ser Leu Ala Asn Pro Val Pro Ala Ala Pro Leu 1 5 10 15 Ser Ala Pro Gly Pro Cys Ala Ala Gln Pro Cys Arg Asn Gly Gly Val 20 25 30 Cys Thr Ser Arg Pro Glu Pro Asp Pro Gln His Pro Ala Pro Ala Gly 35 40 45 Glu Pro Gly Tyr Ser Cys Thr Cys Pro Ala Gly Ile Ser Gly Ala Asn 50 55 60 Cys Gln Leu Val Ala Asp Pro Cys Ala Ser Asn Pro Cys His His Gly 65 70 75 80 Asn Cys Ser Ser Ser Ser Ser Ser Ser Ser Asp Gly Tyr Leu Cys Ile 85 90 95 Cys Asn Glu Gly Tyr Glu Gly Pro Asn Cys Glu Gln Ala Leu Pro Ser 100 105 110 Leu Pro Ala Thr Gly Trp Thr Glu Ser Met Ala Pro Arg Gln Leu Gln 115 120 125 Pro Val Pro Ala Thr Gln Glu Pro Asp Lys Ile Leu Pro Arg Ser Gln 130 135 140 Ala Thr Val Thr Leu Pro Thr Trp Gln Pro Lys Thr Gly Gln Lys Val 145 150 155 160 Val Glu Met Lys Trp Asp Gln Val Glu Val Ile Pro Asp Ile Ala Cys 165 170 175 Gly Asn Al a Ser Ser Asn Ser Ser Ala Gly Gly Arg Leu Val Ser Phe 180 185 190 Glu Val Pro Gln Asn Thr Ser Val Lys Ile Arg Gln Asp Ala Thr Ala 195 200 205 Ser Leu Ile Leu Leu Trp Lys Val Thr Ala Thr Gly Phe Gln Gln Cys 210 215 220 Ser Leu Ile Asp Gly Arg Ser Val Thr Pro Leu Gln Ala Ser Gly Gly 225 230 235 240 Leu Val Leu Leu Glu Glu Met Leu Ala Leu Gly Asn Asn His Phe Ile 245 250 255 Gly Phe Val Asn Asp Ser Val Thr Lys Ser Ile Val Ala Leu Arg Leu 260 265 270 Thr Thruu Val Val Lys Val Ser Thr Cys Val Pro Gly Glu Ser His Ala 275 280 285 Asn Asp Leu Glu Cys Ser Gly Lys Gly Lys Cys Thr Thr Lys Pro Ser 290 295 300 Glu Ala Thr Phe Ser Cys Thr Cys Glu Glu Gln Tyr Val Gly Thr Phe 305 310 315 320 Cys Glu Glu Tyr Asp Ala Cys Gln Arg Lys Pro Cys Gln Asn Asn Ala 325 330 335 Ser Cys Ile Asp Ala Asn Glu Lys Gln Asp Gly Ser Asn Phe Thr Cys 340 345 350 Val Cys Leu Pro Gly Tyr Thr Gly Glu Leu Cys Gln Ser Lys Ile Asp 355 360 365 Tyr Cys Ile Leu Asp Pro Cys Arg Asn Gly Ala Thr Cys Ile Ser Ser 370 375 380 Leu Ser Gly Ph e Thr Cys Gln Cys Pro Glu Gly Tyr Phe Gly Ser Ala 385 390 395 400 Cys Glu Glu Lys Val Asp Pro Cys Ala Ser Ser Pro Cys Gln Asn Asn 405 410 415 Gly Thr Cys Tyr Val Asp Gly Val His Phe Thr Cys Asn Cys Ser Pro 420 425 430 Gly Phe Thr Gly Pro Thr Cys Ala Gln Leu Ile Asp Phe Cys Ala Leu 435 440 445 Ser Pro Cys Ala His Gly Thr Cys Arg Ser Val Gly Thr Ser Tyr Lys 450 455 460 Cys Leu Cys Asp Pro Gly Tyr His Gly Leu Tyr Cys Glu Glu Glu Tyr 465 470 475 480 Asn Glu Cys Leu Ser Ala Pro Cys Leu Asn Ala Ala Thr Cys Arg Asp 485 490 495 Leu Val Asn Gly Tyr Glu Cys Val Cys Leu Ala Glu Tyr Lys Gly Thr 500 505 510 His Cys Glu Leu Tyr Lys Asp Pro Cys Ala Asn Val Ser Cys Leu Asn 515 520 525 Gly Ala Thr Cys Asp Ser Asp Gly Leu Asn Gly Thr Cys Ile Cys Ala 530 535 535 Pro Gly Phe Thr Gly Glu Glu Cys Asp Ile Asp Ile Asn Glu Cys Asp 545 550 555 560 Ser Asn Pro Cys His His Gly Gly Ser Cys Leu Asp Gln Pro Asn Gly 565 570 570 Tyr Asn Cys His Cys Pro His Gly Trp Val Gly Ala Asn Cys Glu Ile 580 585 585 590 His Leu Gln Tr p Lys Ser Gly His Met Ala Glu Ser Leu Thr Asn Met 595 600 605 Pro Arg His Ser 610

SEQ ID NO: 2 Sequence length: 737 Sequence type: amino acid Topology: unknown Sequence type: peptide Origin Organism name: human sequence Met Gln Pro Arg Arg Ala Gln Ala Pro Gly Ala Gln Leu Leu Pro Ala-25 -20 -15 Leu Ala Leu Leu Leu Leu Leu Leu Gly Ala Gly Pro Arg Gly Ser Ser -10 -5 1 5 Leu Ala Asn Pro Val Pro Ala Ala Pro Leu Ser Ala Pro Gly Pro Cys 10 15 20 Ala Ala Gln Pro Cys Arg Asn Gly Gly Val Cys Thr Ser Arg Pro Glu 25 30 35 Pro Asp Pro Gln His Pro Ala Pro Ala Gly Glu Pro Gly Tyr Ser Cys 40 45 50 Thr Cys Pro Ala Gly Ile Ser Gly Ala Asn Cys Gln Leu Val Ala Asp 55 60 65 70 Pro Cys Ala Ser Asn Pro Cys His His Gly Asn Cys Ser Ser Ser Ser 75 80 85 Ser Ser Ser Ser Asp Gly Tyr Leu Cys Ile Cys Asn Glu Gly Tyr Glu 90 95 100 Gly Pro Asn Cys Glu Gln Ala Leu Pro Ser Leu Pro Ala Thr Gly Trp 105 110 115 Thr Glu Ser Met Ala Pro Arg Gln Leu Gln Pro Val Pro Ala Thr Gln 120 125 130 Glu Pro Asp Lys Ile Leu Pro Arg Ser Gln Ala Thr Val Thr Leu Pro 135 140 1 45 150 Thr Trp Gln Pro Lys Thr Gly Gln Lys Val Val Glu Met Lys Trp Asp 155 160 165 Gln Val Glu Val Ile Pro Asp Ile Ala Cys Gly Asn Ala Ser Ser Asn 170 175 180 Ser Ser Ala Gly Gly Arg Leu Val Ser Phe Glu Val Pro Gln Asn Thr 185 190 195 Ser Val Lys Ile Arg Gln Asp Ala Thr Ala Ser Leu Ile Leu Leu Trp 200 205 210 Lys Val Thr Ala Thr Gly Phe Gln Gln Cys Ser Leu Ile Asp Gly Arg 215 220 225 230 Ser Val Thr Pro Leu Gln Ala Ser Gly Gly Leu Val Leu Leu Glu Glu 235 240 245 Met Leu Ala Leu Gly Asn Asn His Phe Ile Gly Phe Val Asn Asp Ser 250 255 260 Val Thr Lys Ser Ile Val Ala Leu Arg Leu Thr Leu Val Val Lys Val 265 270 275 Ser Thr Cys Val Pro Gly Glu Ser His Ala Asn Asp Leu Glu Cys Ser 280 285 290 Gly Lys Gly Lys Cys Thr Thr Lys Pro Ser Glu Ala Thr Phe Ser Cys 295 300 305 310 Thr Cys Glu Glu Gln Tyr Val Gly Thr Phe Cys Glu Glu Tyr Asp Ala 315 320 325 Cys Gln Arg Lys Pro Cys Gln Asn Asn Ala Ser Cys Ile Asp Ala Asn 330 335 340 Glu Lys Gln Asp Gly Ser Asn Phe Thr Cys Val Cys Leu Pro Gly Tyr 345 350 Three 55 Thr Gly Glu Leu Cys Gln Ser Lys Ile Asp Tyr Cys Ile Leu Asp Pro 360 365 370 Cys Arg Asn Gly Ala Thr Cys Ile Ser Ser Leu Ser Gly Phe Thr Cys 375 380 385 390 Gln Cys Pro Glu Gly Tyr Phe Gly Ser Ala Cys Glu Glu Lys Val Asp 395 400 405 Pro Cys Ala Ser Ser Pro Cys Gln Asn Asn Gly Thr Cys Tyr Val Asp 410 415 420 Gly Val His Phe Thr Cys Asn Cys Ser Pro Gly Phe Thr Gly Pro Thr 425 430 435 Cys Ala Gln Leu Ile Asp Phe Cys Ala Leu Ser Pro Cys Ala His Gly 440 445 450 Thr Cys Arg Ser Val Gly Thr Ser Tyr Lys Cys Leu Cys Asp Pro Gly 455 460 465 470 Tyr His Gly Leu Tyr Cys Glu Glu Glu Tyr Asn Glu Cys Leu Ser Ala 475 480 485 Pro Cys Leu Asn Ala Ala Thr Cys Arg Asp Leu Val Asn Gly Tyr Glu 490 495 500 Cys Val Cys Leu Ala Glu Tyr Lys Gly Thr His Cys Glu Leu Tyr Lys 505 510 515 Asp Pro Cys Ala Asn Val Ser Cys Leu Asn Gly Ala Thr Cys Asp Ser 520 525 530 530 Asp Gly Leu Asn Gly Thr Cys Ile Cys Ala Pro Gly Phe Thr Gly Glu 535 540 545 550 Glu Cys Asp Ile Asp Ile Asn Glu Cys Asp Ser Asn Pro Cys His His 555 560 Five 65 Gly Gly Ser Cys Leu Asp Gln Pro Asn Gly Tyr Asn Cys His Cys Pro 570 575 580 His Gly Trp Val Gly Ala Asn Cys Glu Ile His Leu Gln Trp Lys Ser 585 590 595 Gly His Met Ala Glu Ser Leu Thr Asn Met Pro Arg His Ser Leu Tyr 600 605 610 Ile Ile Ile Gly Ala Leu Cys Val Ala Phe Ile Leu Met Leu Ile Ile 615 620 625 630 Leu Ile Val Gly Ile Cys Arg Ile Ser Arg Ile Glu Tyr Gln Gly Ser 635 640 645 Ser Arg Pro Ala Tyr Glu Glu Phe Tyr Asn Cys Arg Ser Ile Asp Ser 650 655 660 Glu Phe Ser Asn Ala Ile Ala Ser Ile Arg His Ala Arg Phe Gly Lys 665 670 675 Lys Ser Arg Pro Ala Met Tyr Asp Val Ser Pro Ile Ala Tyr Glu Asp 680 685 690 Tyr Ser Pro Asp Asp Lys Pro Leu Val Thr Leu Ile Lys Thr Lys Asp 695 700 705 710 Leu

SEQ ID NO: 3 Sequence length: 3230 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA origin Organism name: human Tissue type: fetal brain Sequence type Characteristic symbol: CDS Location: 84. . 2294 Method for determining feature: S Symbol indicating feature: sig peptide Location of occurrence: 84. . 161 Method for determining feature: S Symbol representing feature: mat peptide Location of occurrence: 162. . 2294 Characteristic determination method: S sequence GCT CTCGCAGCTC TCGTCGCCACTCTCGTCGCCAC 23 TGCCACCGCC GCCGCCGTCA CTGCGTCCTG GCTCCGGCTC CCGCGCCCTC CCGGCCGGCC 83 ATG CAG CCC CGC CGC GCC CAG GCG CCC GGT GCG CAG CTG CTG CCC GCG 131 Met Gla Gln A Ar Leu Pro Ala -25 -20 -15 CTG GCC CTG CTG CTG CTG CTG CTC GGA GCG GGG CCC CGA GGC AGC TCC 179 Leu Ala Leu Leu Leu Leu Leu Leu Gly Ala Gly Pro Arg Gly Ser Ser -10 -5 15 CTG GCC AAC CCG GTG CCC GCC GCG CCC CTG TCT GCG CCC GGG CCG TGC 227 Leu Ala Asn Pro Val Pro Ala Ala Pro Leu Ser Ala Pro Gly Pro Cys 10 15 20 GCC GCG CAG CCC TGC CGG AAT GGG GGT GTG TGC ACC TCG CGC CCT GAG 275 Ala Ala Gln Pro Cys Arg Asn Gly Gly Val Cys Thr Ser Arg Pro Glu 25 30 35 CCG GAC CCG CAG CAC CCG GCC CCC GCC GGC GAG CCT GGC TAC AGC TGC 323 Pro Asp Pro Gln His Pro Ala Pro Ala Gly Glu Pro Gly Tyr Ser Cys 40 45 50 ACC TGC CCC GCC GGG ATC TCC GGC GCC AAC TGC CAG CTT GTT GCA GAT 371 Thr Cys Pro Ala Gly Ile Ser Gly Ala Asn Cys Gln Leu Val Ala Asp 55 60 65 70 CCT TGT GCC AGC AAC CCT TGT CAC CAT GGC AAC TGC AGC AGC AGC AGC 419 Pro Cys Ala Ser Asn Pro Cys His His Gly Asn Cys Ser Ser Ser Ser 75 80 85 AGC AGC AGC AGC GAT GGC TAC CTC TGC ATT TGC AAT GAA GGC TAT GAA 467 Ser Ser Ser Ser Asp Gly Tyr Leu Cys Ile Cys Asn Glu Gly Tyr Glu 90 95 100 GGT CCC AAC TGT GAA CAG GCA CTT CCC AGT CTC CCA GCC ACT GGC TGG 515 Gly Pro Asn Cys Glu Gln Ala Leu Pro Ser Leu Pro Ala Thr Gly Trp 105 110 115 ACC GAA TCC ATG GCA CCC CGA CAG CTT CAG CCT GTT CCT GCT ACT CAG 563 Thr Glu Ser Met Ala Pro Arg Gln Leu Gln Pro Val Pro Ala Thr Gln 120 125 130 GAG CCT GAC AAA ATC CTG CCT CGC TCT CAG GCA ACG GTG ACA CTG CCT 611 Glu Pro Asp Lys Ile Leu Pro Arg Ser Gln Ala Thr Val Thr Leu Pro 135 140 145 150 ACC TGG CAG CCG AAA ACA GGG CAG AAA GTT GTA GAA ATG AAA TGG GAT 659 Thr Trp Gln Pro Lys Thr Gly Gln Lys Val Val Glu Met Lys Trp Asp 155 160 165 CAA GTG GAG GTG ATC CCA GAT ATT GCC TGT GGG AAT GCC AGT TCT AAC 707 Gln Val Glu Val Ile Pro Asp Ile Ala Cys Gly Asn Ala Ser Ser Asn 170 175 180 AGC TCT GCG GGT GGC CGC CTG GTA TCC TTT GAA GTG CCA CAG AAC ACC 755 Ser Ser Ala Gly Gly Arg Leu Val Ser Phe Glu Val Pro Gln Asn Thr 185 190 195 TCA GTC AAg ATT CGG CAA GAT GCC ACT GCC TCA CTG ATT TTG CTC TGG 803 Ser Val Lys Ile Arg Gln Asp Ala Thr Ala Ser Leu Ile Leu Leu Trp 200 205 210 AAG GTC ACG GCC ACA GGA TTC CAA CAG TGC TCC CTC ATA GAT GGA CGA 851 Lys Val Thr Ala Thr Gly Phe Gln Gln Cys Ser Leu Ile Asp Gly Arg 215 220 225 230 AGT GTG ACC CCC CTT CAG GCT TCA GGG GGA CTG GTC CTC CTG GAG GAG 899 Ser Val Thr Pro Leu Gln Ala Ser Gly Gly Leu Val Leu Leu Glu Glu 235 240 245 ATG CTC GCC TTG GGG AAT AAT CAC TTT ATT GGT TTT GTG AAT GAT TCT 947 Met Leu Ala Leu Gly Asn Asn His Phe Ile Gly Phe Val Asn Asp Ser 250 255 260 GTG ACT AAG TCT ATT GTG GCT TTG CGC TTA ACT CTG GTG GTG AAG GTC 995 Val Thr Lys Ser Ile Val Ala Leu Arg Leu Thr Leu Val Val Lys Val 265 270 275 AGC ACC TGT GTG CCG GGG GAG AGT CAC GCA AAT GAC TTG GAG TGT TCA 1043 Ser Thr Cys Val Pro Gly Glu Ser His Ala Asn Asp Le u Glu Cys Ser 270 285 290 GGA AAA GGA AAA TGC ACC ACG AAG CCG TCA GAG GCA ACT TTT TCC TGT 1091 Gly Lys Gly Lys Cys Thr Thr Lys Pro Ser Glu Ala Thr Phe Ser Cys 295 300 305 310 ACC TGT GAG GAG CAG TAC GTG GGT ACT TTC TGT GAA GAA TAC GAT GCT 1139 Thr Cys Glu Glu Gln Tyr Val Gly Thr Phe Cys Glu Glu Tyr Asp Ala 315 320 325 TGC CAG AGG AAA CCT TGC CAA AAC AAC GCG AGC TGT ATT GAT GCA AAT 1187 Cys Gln Arg Lys Pro Cys Gln Asn Asn Ala Ser Cys Ile Asp Ala Asn 330 335 340 GAA AAG CAA GAT GGG AGC AAT TTC ACC TGT GTT TGC CTT CCT GGT TAT 1235 Glu Lys Gln Asp Gly Ser Asn Phe Thr Cys Val Cys Leu Pro Gly Tyr 345 350 355 ACT GGA gAG CTT TGC CAG TCC AAG ATT GAT TAC TGC ATC CTA GAC CCA 1283 Thr Gly Glu Leu Cys Gln Ser Lys Ile Asp Tyr Cys Ile Leu Asp Pro 360 365 370 TGC AGA AAT GGA GCA ACA TGC ATT TCC AGT CTC AGT GGA TTC ACC TGC 1331 Cys Arg Asn Gly Ala Thr Cys Ile Ser Ser Leu Ser Gly Phe Thr Cys 375 380 385 390 CAG TGT CCA GAA GGA TAC TTC GGA TCT GCT TGT GAA GAA AAG GTG GAC 1379 Gln Cys Pro Glu Gly Tyr Phe Gly Ser Ala Cys Glu Glu Lys Val Asp 395 400 405 CCC TGC GCC TCG TCT CCG TGC CAG AAC AAC GGC ACC TGC TAT GTG GAC 1427 Pro Cys Ala Ser Ser Pro Cys Gln Asn Asn Gly Thr Cys Tyr Val Asp 410 415 420 GGG GTA CAC TTT ACC TGC AAC TGC AGC CCG GGC TTC ACA GGG CCG ACC 1475 Gly Val His Phe Thr Cys Asn Cys Ser Pro Gly Phe Thr Gly Pro Thr 425 430 435 TGT GCC CAG CTT ATT GAC TTC TGT GCC CTC AGC CCC TGT GCT CAT GGC 1523 Cys Ala Gln Leu Ile Asp Phe Cys Ala Leu Ser Pro Cys Ala His Gly 440 445 450 ACG TGC CGC AGC GTG GGC ACC AGC TAC AAA TGC CTC TGT GAT CCA GGT 1571 Thr Cys Arg Ser Val Gly Thr Ser Tyr Lys Cys Leu Cys Asp Pro Gly 455 460 465 470 TAC CAT GGC CTC TAC TGT GAG GAG GAA TAT AAT GAG TGC CTC TCC GCT 1619 Tyr His Gly Leu Tyr Cys Glu Glu Glu Tlu Asn Glu Cys Leu Ser Ala 475 480 485 CCA TGC CTG AAT GCA GCCACC TGC AGG GAC CTC GTT AAT GGC TAT GAG 1667 Pro Cys Leu Asn Ala Ala Thr Cys Arg Asp Leu Val Asn Gly Tyr Glu 490 495 500 500 TGT GTG TGC CTG GCA GAA TAC AAA GGA ACA CAC TGT GAA TTG TAC AAG 1715 Cys Val Cys Leu Ala Glu Tyr Lys Gly Thr His Cys Glu Leu Tyr Lys 505 510 515 GAT CCC TGC GCT AAC GTC AGC TGT CTG AAC GGA GCC ACC TGT GAC AGC 1763 Asp Pro Cys Ala Asn Val Ser Cys Leu Asn Gly Ala Thr Cys Asp Ser 520 525 530 GAC GGC CTG AAT GGC ACG TGC ATC TGT GCA CCC GGG TTT ACA GGT GAA 1811 Asp Gly Leu Asn Gly Thr Cys Ile Cys Ala Pro Gly Phe Thr Gly Glu 535 540 545 550 550 GAG TGC GAC ATT GAC ATA AAT GAA TGT GAC AGT AAC CCC TGC CAC CAT 1859 Glu Cys Asp Ile Asp Ile Asn Glu Cys Asp Ser Asn Pro Cys His His 555 560 565 GGT GGG AGC TGC CTG GAC CAG CCC AAT GGT TAT AAC TGC CAC TGc CCG 1907 Gly Gly Ser Cys Leu Asp Gln Pro Asn Gly Tyr Asn Cys His Cys Pro 570 575 580 CAT GGT TGG GTG GGA GCA AAC TGT GAG ATC CAC CTC CAA TGG AAG TCC 1955 His Gly Trp Val Gly Ala Asn Cys Glu Ile His Leu Gln Trp Lys Ser 585 590 590 595 GGG CAC ATG GCG GAG AGC CTC ACC AAC ATG CCA CGG CAC TCC CTC TAC 2003 Gly His Met Ala Glu Ser Leu Thr Asn Met Pro Arg His Ser Leu Tyr 600 605 610 ATC ATC ATT GGA GCC CTC TGC GTG GCC TTC ATC CTT ATG CTG AT C ATC 2051 Ile Ile Ile Gly Ala Leu Cys Val Ala Phe Ile Leu Met Leu Ile Ile 615 620 625 630 CTG ATC GTG GGG ATT TGC CGC ATC AGC CGC ATT GAA TAC CAG GGT TCT 2099 Leu Ile Val Gly Ile Cys Arg Ile Ser Arg Ile Glu Tyr Gln Gly Ser 635 640 645 TCC AGG CCA GCC TAT GAG GAG TTC TAC AAC TGC CGC AGC ATC GAC AGC 2147 Ser Arg Pro Ala Tyr Glu Glu Plu The Asn Cys Arg Ser Ile Asp Ser 650 655 655 660 GAG TTC AGC AAT GCC ATT GCA TCC ATC CGG CAT GCC AGG TTT GGA AAG 2195 Glu Phe Ser Asn Ala Ile Ala Ser Ile Arg His Ala Arg Phe Gly Lys 665 670 675 AAA TCC CGG CCT GCA ATG TAT GAT GTG AGC CCC ATC GCC TAT GAA GAT 2243 Lys Ser Arg Pro Ala Met Tyr Asp Val Ser Pro Ile Ala Tyr Glu Asp 680 685 690 TAC AGT CCT GAT GAC AAA CCC TTG GTC ACA CTG ATT AAA ACT AAA GAT 2291 Tyr Ser Pro Asp Asp Lys Pro Leu Val Thr Leu Ile Lys Thr Lys Asp 695 700 705 710 TTG TAATCTTTTT TTGGATTATT TTTCAAAAAG ATGAGATACT ACACTCATTT 2344 Leu AAATATTTTT AAGAAAATAA AAAGCTTAAG AAATTTAAAA TGCTAGCTGC TCAAGAGTTT 2404 TCAGTAGAAT ATTTAAGAAC TAATTTTCTG CAGCTTTT AG TTTGGAAAAA ATATTTTAAA 2464 AACAAAATTT GTGAAACCTA TAGACGATGT TTTAATGTAC CTTCAGCTCT CTAAACTGTG 2524 TGCTTCTACT AGTGTGTGCT CTTTTCACTG TAGACACTAT CACGAGACCC AGATTAATTT 2584 CTGTGGTTGT TACAGAATAA GTCTAATCAA GGAGAAGTTT CTGTTTGACG TTTGAGTGCC 2644 GGCTTTCTGA GTAGAGTTAG GAAAACCACG TAACGTAGCA TATGATGTAT AATAGAGTAT 2704 ACCCGTTACT TAAAAAGAAG TCTGAAATGT TCGTTTTGTG GAAAAGAAAC TAGTTAAATT 2764 TACTATTCCT AACCCGAATG AAATTAGCCT TTGCCTTATT CTGTGCATGG GTAAGTAACT 2824 TATTTCTGCA CTGTTTTGTT GAACTTTGTG GAAACATTCT TTCGAGTTTG TTTTTGTCAT 2884 TTTCGTAACA GTCGTCGAAC TAGGCCTCAA AAACATACGT AACGAAAAGG CCTAGCGAGG 2944 CAAATTCTGA TTGATTTGAA TCTATATTTT TCTTTAAAAA GTCAAGGGTT CTATATTGTG 3004 AGTAAATTAA ATTTACATTT GAGTTGTTTG TTGCTAAGAG GTAGTAAATG TAAGAGAGTA 3064 CTGGTTCCTT CAGTAGTGAG TATTTCTCAT AGTGCAGCTT TATTTATCTC CAGGATGTTT 3124 TTGTGGCTGT ATTTGATTGA TATGTGCTTC TTCTGATTCT TGCTAATTTC CAACCATATT 3184 GAATAAATGT GATCAAGTCA AAAAAAAAAA AAAAAAAAAA AAAAAA 3230

SEQ ID NO: 4 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid; oligonucleotide sequence 5'-TTACCATGGCCTCTACTGTG-3 '

SEQ ID NO: 5 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-AGATGCACGTGCCATTCAGG-3 '

SEQ ID NO: 6 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-AATCTAGATGCAGCCCCGCCGCGCCCA-3 '

SEQ ID NO: 7 Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid; oligonucleotide sequence 5'-CACCGGGTTGGCCAGGGAGCT-3

SEQ ID NO: 8 Sequence length: 21 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-ATCCATCCGGCATGCCAGGTT-3 '

SEQ ID NO: 9 Sequence length: 33 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid; oligonucleotide sequence 5'-AACTCGAGATTACAAATCTTTAGTTTTAATCAG-3 '

SEQ ID NO: 10 Sequence length: 60 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-AACTCGAGTCATTTATCATCATCATCTTTATAATCCAAATCTTTAGT
TTTAATCAGTGTG-3 '

SEQ ID NO: 11 Sequence length: 22 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-TGTACAAGGATCCCTGCGCTAA-3 '

SEQ ID NO: 12 Sequence length: 55 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-AACTCGAGTCATTTATCATCATCATCTTTATAATCGGAGTGCCGTGG
CATGTTGG-3 '

SEQ ID NO: 13 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-AAAGATCTGAGTGCCGTGGCATGTTGG-3 '

SEQ ID NO: 14 Sequence length: 27 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid; oligonucleotide

SEQ ID NO: 15 Sequence length: 20 Sequence type: nucleic acid Number of strands: single strand Topology: linear Sequence type: other nucleic acids; oligonucleotide sequence 5'-TCCCAGTCTCCCAGCCACTG-3 '

SEQ ID NO: 16 Sequence length: 20 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid; oligonucleotide sequence 5'-TCACCACCAGAGTTAAGCGC-3

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI Technical display location C12N 15/02 C12P 21/08 15/09 ZNA A61K 39/395 N C12P 21/02 C12N 5/00 B 21/08 9282-4B 15/00 C // A61K 38/00 9282-4B ZNAA 39/395 A61K 37/02 (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:91) (C12P 21/08 C12R 1:91)

Claims (12)

[Claims] 1. A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1. 2. A polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1 and having the amino acid sequence represented by SEQ ID NO: 2. 3. A DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1. 4. A DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 2. 5. A recombinant D obtained by linking a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 1 with a vector DNA that can be expressed in a host cell.
NA body. 6. A recombinant D obtained by linking a DNA encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 2 with a vector DNA that can be expressed in a host cell.
NA body. 7. A cell transformed with the recombinant DNA of claim 5. 8. A cell transformed with the recombinant DNA of claim 6. 9. A method for producing a polypeptide, comprising culturing cells capable of producing the polypeptide according to claim 1 or 2 in a medium, and collecting the produced polypeptide. 10. The recombinant DN according to claim 5, wherein the cell is a recombinant DN.
The production method according to claim 9, which is a cell transformed with A body. 11. The recombinant DN according to claim 6, wherein the cell is a recombinant DN.
The production method according to claim 9, which is a cell transformed with A body. 12. An antibody that specifically binds to the polypeptide of SEQ ID NO: 2.