JP2002538774A - TIAM2 (T cell lymphoma invasion and METASTASIS2) nucleotide exchange factor - Google Patents

Abstract

  (57) [Summary] The present invention is in the field of molecular biology. More particularly, the invention relates to polynucleotide sequences and the corresponding TIAM2 proteins. The invention also provides a nucleic acid sequence encoding a TIAM2 protein. The invention also includes diagnostic assays, expression vectors, antisense molecules, ribozymes and host cells for expressing the polypeptide encoded by the nucleic acid sequence. The invention also includes claims for the polypeptide sequence encoded by the nucleic acid sequence.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION The present invention is in the field of molecular biology. More particularly, the present invention relates to polynucleotide sequences and corresponding TIAM2 proteins.

BACKGROUND OF THE INVENTION [0002] The characterization of the TIAM1 gene and encoded protein has been described by Havets.
Et al., Cell 77: 537-549 (1994); Hart, M .; J. J
. Biol. Chem. 269: 62-65 (1994); Haslam et al., N.
atature 363: 309-310 (1993); and Mayer, B. et al. J
. Et al., Cell 73: 629-630 (1993).

(Summary) The present invention relates to a polynucleotide comprising the polynucleotide of SEQ ID NO: 8.

[0004] The present invention also relates to the polypeptide encoded by SEQ ID NO: 8.

[0005] The present invention further relates to polynucleotides having at least 80% sequence identity to SEQ ID NO: 8.

[0006] The present invention still further relates to polynucleotides having at least 85% sequence identity to SEQ ID NO: 8.

[0007] The present invention also relates to polynucleotides having at least 90% sequence identity to SEQ ID NO: 8.

[0008] The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 8.

[0009] The present invention relates to a polynucleotide comprising the polynucleotide of SEQ ID NO: 9.

[0010] The present invention also relates to the polypeptide encoded by SEQ ID NO: 9.

[0011] The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 9.

[0012] The present invention still further relates to polynucleotides having at least 85% sequence identity to SEQ ID NO: 9.

[0013] The present invention also relates to polynucleotides having at least 90% sequence identity to SEQ ID NO: 9.

[0014] The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 9.

[0015] The present invention relates to a polynucleotide comprising the polynucleotide of SEQ ID NO: 10.

[0016] The present invention also relates to the polypeptide encoded by SEQ ID NO: 10.

The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 10.

[0018] The invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO: 10.

The present invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO: 10.

[0020] The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 10.

The present invention relates to a polypeptide having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

The present invention also relates to polypeptides having at least 85% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

The invention further relates to a polypeptide having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

The present invention still further relates to polypeptides having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

The invention is further encoded by SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 or by a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 The present invention relates to an antibody capable of specifically binding to a polypeptide.

The present invention further relates to an antibody capable of specifically binding to a polypeptide having the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

The invention also relates to a method of detecting the expression of a TIMA2 expression product in a biological sample, the method comprising obtaining a polypeptide from the biological sample, TIAM
Contacting the polypeptide with an antibody capable of specifically binding to 2, and detecting the presence or absence of the antibody-polypeptide complex.

The invention also includes a step of expressing a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.
It relates to a method for obtaining an IAM2 polypeptide.

The present invention further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

The present invention still further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 and at least one regulatory region.

The present invention also relates to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10
The present invention relates to a host cell containing a polynucleotide having 0% sequence identity.

The present invention further comprises the step of comparing the polynucleotide sequence of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 with the polypeptide sequence of the region of chromosome 6q25 of an ovarian tissue sample that may be cancerous, Chromosome 6 in ovarian cancer, comprising detecting the presence or absence of the sequence in the polynucleotide of the tissue sample
The present invention relates to a method for detecting deletion of the q25 region.

DETAILED DESCRIPTION OF THE INVENTION TIAM2 (DP-75) (for T cell lymphoma invasion and metastasis 2) relates to a novel DNA and amino acid sequence with some sequence homology to TIAM1. (Havets et al., Cell 77: 537-749 (1994);
And Havets et al., Oncogene 10: 1371-1376 (199).
5)). Overexpression of the full-length or truncated form of TIAM1 increases the likelihood of lymphoma cell metastasis in mice. TIAM1 is Rho-like and Ra
It is a member of the family GDP dissociation stimulator (GDS), a protein that activates c-like GTPases. GDS, and Rho and Rac have oncogenic potential.

According to the present invention, TIAM2, a novel protein with high homology to TIAM1, has been identified. TIAM2 has about 4.4 kb and about 3.3 kb.
kb message, which is the long form of the TIAM2 protein (
TIAM2 _L ) and the short form (TIAM2 _S ). TIAM2 _L is
Starting in a region having identity to the coiled-coil region of TIAM1, it includes both the EX and PDZ domains found in TIAM1. Both TIAM2 _L and TIAM2 _S are the DHs of TIAM1
And the region identical to the carboxy-terminal PH domain. An additional level of complexity is added by the alternative splicing of the approximately 4.4 kb message, which places a 24 kb between the EX and DHR domains.
Guides amino acid insertion.

Analysis of the approximately 4.4 kb message indicates that 5
ATG at nucleotide 1 was identified, while further analysis indicated that OR
It became clear that F could be extended from the 5 'of the ATG to the first 51 nucleotides. The extended ORF may indicate that made Sara extending the TIAM _L 5 'sequence is present. Initiation probably begins at nucleotide position 51 because the size of the cDNA clone (4586 nt) is equal to or greater than the estimated size of the cerebellar message (approximately 4.4 kb). And because, despite numerous attempts, no additional 5 'sequences were identified.

A His-tagged version of TIAM2 _S was expressed in a baculovirus system, a preferred system for the expression of TIAM2, and purified on a nickel column. His-TIAM2 _S is compared to SOS and RAC over RAS.
Have been shown to have GEF activity.

The high similarity, expression pattern, and GEF activity between the coding sequences of the TIAM1 and TIAM2 proteins are similar to those of TIAM1 (Havets et al., Cel.
1 77: 537-549, 1994; Hordijk et al., Science 2
78: 1464-1466, 1997; Ehler et al., Mol. Cell. Ne
urosci. 9: 1-12, 1997; van Leeuwen et al. Ce
11 Biol. 139: 797-807, 1997), suggesting that TIAM2 may play a role in neural development. High levels of TIAM2 expression throughout the E13.5 telencephalon suggest that TIAM2 may play an important role in forebrain development. At E13.5, post-mitotic neurons are produced; these cells move to their precise location in the developing brain and establish contact with their precise targets Proliferative pituitary (growt
h cone) must be released. All of these processes require coordinating actin-based cytoskeletal rearrangements with environmental cues. Rac
There is strong evidence that / cdc42 GTPase plays a key role in axon formation and target recognition in the nervous system (Albertinazzz)
i. Cell. biol. 142: 815-825, 1998; Hing
Et al., Cell 97: 853-863, 1999; van Leewen et al., Supra, 1997). Further analysis of TIAM2 expression during mouse embryogenesis may reveal a correlation with particular morphogenic events, or with particular GTP-ase family members, regulators or effectors. Some that are specifically established during neural development include TIAM1, RAC3, and TAM.
It appears to be due to cell type-specific expression of components of the GTPase signaling pathway such as IAM2.

[0038] Unlike TIAM1, TIAM2 continues to be expressed at high levels in the adult forebrain. Areas of high expression in adults are synaptic (adult, hippocampus) or neurogenic (dentate gyrus, ependymal / ependymal) in adults (Gould et al., Tr.
ends Cogn. Sci. 3: 186-192, 1999; Temple,
Curr. Biol. 9: R397-399, 1999; Lowenstein
And Parent. Science 283: 1126-1127, 1999
).

[0039] TIAM2 may play a role in suppressing metastases or tumors. TIAM2
Irradiation hybrid mapping places it in the 4-cM region of chromosome 6q25, which is frequently deleted in ovarian cancer (Colitti et al., Oncogene).
16: 555-559, 1998). Most ovarian cancers are epithelial in nature and have TIAM1 (21q22.1; Chen and Antonara).
kiss, Genomics 30: 123-127, 1995), since it has been suggested that epithelial cells may act as tumor suppressors.
It may suggest a role for TIAM2 in ovarian cancer.

The expression of another form of TIAM2 suggests a distinct role for TIAM2 _L and TIAM2 _S. Both EX and PDZ domains found in TIAM2 _L is, protein - protein interactions, and play a role in the intracellular localization of proteins has been suggested. TIAM2 _s is the EX of TIAM2 _L
Because both the domain and the PDZ domain are deleted, the two forms can be localized to different regions of the cell. To understand another form of TIAM2, the GE
Expanding the knowledge of the complexity of this emerging family of F, and may ultimately yield insights into the diverse role of TIAM1 as both an invasive promoter and tumor suppressor.

GDS is involved in a variety of cancers and, based on the discussion herein, TIA
M2 may be useful for diagnosing cancerous cells. A number of techniques can be used to diagnose whether a tissue sample carries tumor cells containing TIAM2. For example, to identify the presence of a TIAM2 mRNA sequence,
Reverse transcription and PCR amplification of tumor sample RNA (Sambrook et al., Mol
eco Cloning; A Laboratory Manual, 2nd edition 1989), Chapter 14, or Gaugler et al. Exp. Med 1
79: 921-930 (1994)). Also, immunohistochemical techniques or ELISA assays can be used to identify tumors that express TIAM-2. For example, the TIAM2 protein can be expressed recombinantly, and monoclonal antibodies can be prepared according to methods known in the art. For example,
EP 174,204, Kohler and Milstein, Nature.
256: 495-497 (1975); Fong et al. Immun. Met
h. 70: 83-90 (1984); GB 2,086,937;
No. 13,715, EP 57,107, No. 62,409, EP 118,
893, EP 124,301 and EP 131,878 are suitable for the present invention. Anti-TIAM2 monoclonal antibody
It can then be used in the standard assays described above, or those assays otherwise known in the art.

[0042] Monoclonal antibodies can also be used therapeutically. Anti-TIAM2 monoclonal antibodies can be administered by means known in the art. Preferably, the antibodies are administered parenterally or subcutaneously, more preferably they are administered intravenously. Monoclonal antibodies can be administered in combination with other agents designed to enhance the activity of the antibody, or to treat an underlying condition associated with cells that express TIAM2.

In addition, branched DNA tests are shown in US Pat. Nos. 5,124,246 and 4,868,105, which are incorporated herein by reference in their entirety. To be assayed for TIAM2 DNA. TIAM2 nucleic acid probe molecules for branched DNA testing are preferably 10-50 bases in length, more preferably 15-40 bases in length, and most preferably 20-30 bases in length. It is.

The ribozyme can be designed to act on the TIAM2 sequence identified in SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or fragments thereof. (Kashani-Cabet and Scanlon
, Cancer Gene Therapy, 2: 213-223 (1995).
, Incorporated herein by reference in its entirety). To obtain cellular expression, the ribozyme gene is cloned into an available vector and transfected into selected cells. Different vectors can be selected based on the infected target cell. For example, respiratory cells can be targeted by adenovirus or adeno-associated virus (AAV) vectors. Appropriate promoters can be inserted into these vectors to ensure regulatable expression. (Kashani-Cabet, page 216).

An antisense molecule can be developed based on the TIAM2 sequence shown in SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. For example,
See U.S. Patent Nos. 5,491,133 and 5,271,941. These are incorporated herein by reference in their entirety.

The antisense RNA sequence is a prokaryote (Mizuno, T., Chou, M-
. Y. And Inouye. M. (1984), Proc. Natl. Aca
d. Sci. USA 81. (1966-1970)) and eukaryotes (Hey
wood, S.M. M. Nucleic Acids Res. , 14, 6771
-6772 (1986)), and have been described as naturally occurring biological inhibitors of gene expression, and these sequences are complementary mR
It functions by hybridizing to the NA sequence, thereby resulting in hybridization inhibition of translation (Patterson. BM, R
oberts. B. E. FIG. And Kuff. E. FIG. L. (1977) Proc. Na
tl. Acad. Sci. USA 74, 4370-4374).

An antisense oligodeoxynucleotide is a short synthetic nucleotide sequence formed to be complementary to a particular gene or RNA message. Through the binding of these oligomers to a target DNA or mRNA sequence, transcription or translation of a gene can be selectively blocked and the disease process produced by that gene can be stopped. The cytoplasmic arrangement of mRNA provides a target that is believed to be readily accessible to antisense oligonucleotides that enter cells; thus, much work in this field has
Focuses on RNA as a target.

[0048] Antisense therapy is the administration of an oligonucleotide that binds to a target polynucleotide located within a cell. These oligonucleotides are usually exogenous, but they can be expressed endogenously. The term "antisense" refers to the fact that such oligonucleotides are complementary to their intracellular target (eg, TIAM2). For example, Jack Cohen, Oligon
cleotides. Antisense Inhibitors of G
ene Expression, CRC Press, 1989; and Syn
thesis 1: 1-5 (1988).

As the antisense oligonucleotide of TIAM2 of the present invention, an S-oligonucleotide (a phosphorothioate derivative or an S-oligo, Jack Cohen, supra) exhibiting enhanced cancer cell growth inhibitory action. And the like. The TIAM2 antisense oligonucleotide of the present invention comprises
It can be RNA or DNA. The RNA or DNA is complementary to and stably hybridizes to the TIAM2 genome or the corresponding mRNA. The use of oligonucleotides complementary to this region is described in TIAM2
allows selective hybridization to mRNA and
Hybridization to RNA is not allowed.

Preferably, the antisense oligonucleotide of TIAM2 of the present invention comprises
15 of the antisense DNA molecules that hybridize to AM2 mRNA
４０40 mer fragment. Alternatively, preferred TIAM2 antisense oligonucleotides hybridize to a region in RIAM2,
To 30 mer oligonucleotides. Pharmaceutical compositions containing an effective amount of at least one TIAM2 antisense oligonucleotide of the invention in combination with a pharmaceutically acceptable carrier are included in the invention. In one embodiment, a single TIAM2 antisense oligonucleotide is utilized. In another embodiment, two TIAM2 antisense oligonucleotides are utilized, which are complementary to adjacent regions of the TIAM2 genome.

Administration of two TIAM2 antisense oligonucleotides, which are complementary to adjacent regions of the TIAM2 genome, or the corresponding mRNA, will result in more efficient transcription of the TIAM2 genome or translation of the mRNA. Can be effectively inhibited, resulting in more effective inhibition of the growth of cancer cells. Preferably,
The TIAM2 antisense oligonucleotide is co-administered with an agent that enhances the uptake of the antisense molecule by cells. For example, a TIAM2 antisense oligonucleotide can be combined with a lipophilic cationic compound, which can be in the form of a liposome.

The use of liposomes to introduce nucleotides into cells is taught, for example, in US Pat. Nos. 4,897,355 and 4,394,448. These disclosures are incorporated herein by reference in their entirety.
Also, general methods for preparing liposomes containing biological materials are described in U.S. Pat. Nos. 4,235,871, 4,231,877 and 4,224. No. 179, No. 4,753,788, No. 4,673,567
Nos. 4,247,411 and 4,814,270.

Alternatively, the TIAM2 antisense oligonucleotide comprises cholesterol,
It can be combined with a lipophilic carrier, such as any one of a number of sterols, including cholate and deoxycholic acid. Preferred sterols are
Cholesterol. Further, TIAM2 antisense oligonucleotides can be conjugated to peptides that are taken up by cells. Examples of useful peptides include peptide hormones, antigens, or antibodies, and peptide toxins. Selecting a peptide that is selectively taken up by neoplastic cells can result in specific delivery of the antisense agent.

[0054] TIAM2 antisense oligonucleotides can be covalently linked through the 5'H group by formation of an activated aminoalkyl derivative. The selected peptide can then be covalently attached to the activated TIAM2 antisense oligonucleotide via amino and sulfhydryls that react with the heterobifunctional reagent. The latter is attached to cysteine residues present in the peptide. Upon exposure of the cells to the TIAM2 antisense oligonucleotide attached to the peptide, the peptidyl antisense agent is endocytosed, and the TIAM2 antisense oligonucleotide binds to the target TIAM2 mRNA to cause translation. Inhibit. PCT Application Publication No. PCT / US89 / 02
See 363.1.

The TIAM2 antisense oligonucleotides and pharmaceutical compositions of the invention comprise
Administration can be by any means to achieve their intended purpose. For example, administration of the antisense compounds or other compounds of the present invention can be by parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, or transdermal routes.

The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if necessary, frequency of treatment, and the nature of the effect desired. Dependent. Compositions within the scope of the present invention include all compositions, wherein the TIAM2 antisense oligonucleotides achieve inhibition of cancer cell proliferation and / or stimulate differentiation in a subject. Contained in an amount that is effective for

While individual needs vary, determination of optimal ranges of effective amounts of each composition is within the skill of the art. Typically, a TIAM2 antisense oligonucleotide is administered to a mammal (eg, a human) at a dose of 0.005 to 1 mg / kg / day, or a daily equivalent of the weight of the mammal to be treated. It can be administered in any amount of their pharmaceutically acceptable salts.

In addition to administering TIAM2 antisense oligonucleotides as raw chemicals in solution, TIAM2 antisense oligonucleotides also process TIAM2 antisense oligonucleotides into pharmaceutically usable preparations. It can be administered as part of a pharmaceutical preparation containing a suitable pharmaceutically acceptable carrier, containing excipients and excipients that facilitate the preparation. The term pharmaceutically acceptable refers to compounds and compositions that can be administered to mammals without undue toxicity. Exemplary pharmaceutically acceptable salts include inorganic acid salts, such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and acetates, propionates, malonates, benzoates Organic acid salts, such as acid salts.

Formulations suitable for parenteral administration include aqueous solutions of the TIAM2 antisense oligonucleotide in water-soluble form, for example, water-soluble salts. Additionally, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include, for example, fatty oils, such as sesame oil, or synthetic fatty acid esters, such as, for example, ethyl oleate or triglycerides. Aqueous injection suspensions can contain substances, including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran.
If desired, the suspension may also contain stabilizers.

[0060] The antisense oligonucleotides of the invention can be prepared according to any method known to those skilled in the art. Preferably, the antisense oligonucleotide is prepared by solid phase synthesis. For an overview of chemical synthesis of oligonucleotides, see Goo
dchild, J.M. Bioconjugate Chemistry, 1:16
See 5-167 (1990). Alternatively, antisense oligonucleotides can be obtained from a number of companies that specialize in custom synthesis of oligonucleotides.

The TIAM2 polypeptide, polynucleotide, or antibody may be administered orally, topically, or parenterally, including subcutaneous and intramuscular injection, implantation of a sustained release depot,
It can be administered by intravenous injection, intranasal administration and the like. When used to treat a tumor, it may be advantageous to apply the TIAM2 polypeptide or antibody directly to the site, for example, during surgery to remove a tumor mass.
Thus, a TIAM2 polypeptide, polynucleotide, or antibody can be administered as a pharmaceutical composition containing a pharmaceutically acceptable excipient. Such compositions can be aqueous solutions, emulsions, creams, ointments, suspensions, gels, liposome suspensions, and the like. Suitable excipients include water, saline, Ringer's solution, dextrose solution, and ethanol, glucose, sucrose, dextran, mannose, mannitol, sorbitol, polyethylene glycol (PE
G), phosphates, acetates, gelatin, collagen, Carbopol®, vegetable oil solutions and the like. One may further include suitable preservatives, stabilizers, antioxidants, antimicrobial agents, and buffering agents (eg, BHA, BHT, citric acid, ascorbic acid, tetracycline, etc.). Bases for creams or ointments useful in the formulation include lanolin, Silvadene® (M
Arion), Aquaphor (registered trademark) (Duke Laborator)
ies). Other topical formulations include aerosols, band-aids, and other wound dressings.

Alternatively, one can place the TIA in a suitable polymer matrix or membrane.
The M2 polypeptide, polynucleotide, or antibody may be incorporated or encapsulated, thereby providing a slow-release device suitable for implantation near the site to be treated locally. Other devices include indwelling catheters and devices, such as Alzet® minipumps. Ophthalmic preparations are available from Sorbi-care® (Allergan), Neode.
cadron® (Merck, Sharp & Dohme), La
U.S. Pat. No. 5,124,1 which can be formulated using a commercially available vehicle such as Crilbe® or the like, or is incorporated herein by reference.
Topical preparations such as those described in No. 55 may be used. further,
For one, the TIAM2 polypeptide, polynucleotide or antibody may be provided in solid form, particularly as a lyophilized powder. Lyophilized formulations typically contain stabilizers and bulking agents (eg, human serum albumin, sucrose, mannitol, and the like). A thorough discussion of pharmaceutically acceptable excipients can be found in R
emington's Pharmaceutical Science (Ma
rck Pub. Co).

The amount of a TIAM2 polypeptide, polynucleotide, or antibody required for the treatment of any particular disorder will, of course, determine the nature and severity of the disorder, the age and condition of the subject, and those skilled in the art. Will vary depending on other factors that are easily determined by Appropriate dosages can be determined by one skilled in the art.

In gene therapy methods, it may be useful to administer the nucleic acid molecules described above (ie, ribozymes or antisense molecules). Accordingly, the vectors and techniques described below are useful. The following expression systems describe vectors, promoters, and regulatory elements that are useful in gene therapy applications for delivery of the above-described polynucleotides.

[0065] Vectors and expression systems useful in the present invention include viral and non-viral systems. Exemplary viral delivery systems include retrovirus, adenovirus, adeno-associated virus (AAV), Sindbis and helper virus. In one aspect of the invention, a viral vector can integrate the nucleic acid sequence described above into the genome of a host cell for long-term expression.

One preferred retrovirus is the murine leukemia virus. But,
It may be preferable to avoid integration into the genome of the host cell. Non-viral vectors include naked DNA, and DNA formulated with cationic lipids or liposomes. A non-viral system that can be used is the T7 / T7 system.

In addition, it is useful to produce a TIAM2 protein from the nucleic acid sequences disclosed herein, eg, for use in assays to test for inhibitors or for preparing monoclonal antibodies. TIAM2 can be expressed by a baculovirus that has been transformed with a native or modified TIAM2 nucleic acid sequence. A TIAM2 nucleic acid sequence useful in the present invention encodes a protein having an amino acid sequence that is substantially identical to the amino acid sequence of native TIAM2.

[0068] Preferably, the TIAM2 nucleic acid or protein sequence is homologous to the partial sequences listed below. Preferably, the sequence is 80% relative to SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or a fragment thereof.
And more preferably it is more than 85% homologous, more preferably more than 90% homologous and even more preferably 91%, 92%
%, 93%, 94%, or more than 95% homologous. Most preferably, it is greater than 96%, 97%, 98%, or 99% homologous. Substantially identical means that the sequences are identical or differ by one or more changes (deletions, additions, substitutions) that do not deleteriously affect the activity of the protein. Preferably, the protein sequences are homologous in the same proportions as described above. Percent identity or homology can be calculated using methods and algorithms known in the art. A suitable but non-limiting method is to use the following search parameters to set the
ine) MPSRCH program using gap search (Oxford Bi)
Smith-Waterm, as performed in
An homology search algorithm for: 12 gap open penalties,
And a gap extension penalty of 1.

The exact chemical structure of a TIAM2 sequence can depend on a number of factors. Where ionized amino and carboxyl groups are present in the molecule, certain proteins may be obtained as acidic or basic salts or in their natural form.
All such preparations, which retain their activity when placed under appropriate environmental conditions, are included in the definition of protein herein. In addition, the primary amino acid sequence of the protein is
Or it can be increased by other additional molecules such as lipids, phosphates, acetyl groups and the like. Certain aspects of such augmentation are achieved through the post-translational processing system of the production host; other such modifications can be introduced in vitro. In any event, such modifications are included in the definition of protein herein, as long as the activity of the protein is not disrupted. It is anticipated that such modifications can either quantitatively or qualitatively affect activity, either by enhancing or decreasing the activity of the protein in various assays. In addition, individual amino acid residues in the chain can be modified by oxidation, reduction, derivatization, and the protein can be cleaved to obtain fragments that retain activity. Such changes that do not disrupt activity do not remove the protein sequence from the definition of TIAM2 herein.

[0070] Modifications to the primary sequence itself by deletion, addition, or alteration of amino acids incorporated into the sequence during translation can be made without disrupting the activity of the protein. For example, site-directed mutagenesis results in an alteration in the polypeptide structure, DN
Certain changes in the A structure may be possible. Mark et al., US Pat. No. 4,959.
No. 314, and Sambrook et al., Supra, Volume 2, Chapter 15 (these include:
(Incorporated herein by reference in its entirety)).

[0071] TIAM2 proteins include variants, fragments, fusions, and proteins encoded by the sequences recited in SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or fragments thereof. Can be Native TIAM2 protein is a naturally occurring protein. The amino acid sequence of the native polypeptide varies slightly (typically less than 10 to 12 amino acids encoded by SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10). Contains an array.

The term “polynucleotide” or “nucleic acid sequence” as used herein refers to a polymer of nucleotides of any length (preferably, deoxyribonucleotides), and the term “oligonucleotide” And "oligomer" are used interchangeably herein. This term refers only to the primary structure of the molecule. Thus, the term includes double- and single-stranded DNA, as well as antisense polynucleotides. Also included are known types of modifications, such as the presence of labels known in the art, methylation, terminal "caps", replacement of one or more naturally occurring nucleotides with analogs, Modifications between nucleotides (eg,
Specific types of uncharged bonds (eg, methylphosphonates, phosphorotriesters, phosphoramidates, carbamates, etc.) or substitutions with charged bonds (eg, phosphorothioates, phosphorodithioates, etc.), pendant moieties (For example, proteins (nucleases, toxins, antibodies, signal peptides,
Poly-L-lysine, etc.), intercalating agents (eg, acridine, psoralen, etc.), chelating agents (eg, radioactive species of metals, boron, oxidizing agents, etc.), alkylating agents (eg, α-anomeric nucleic acids, etc.) Introduction of.

The polynucleotide sequence encoding the native TIAM2 protein has a TI
It can be easily modified to encode other classes of AM2 proteins. TIA
It is recognized in the art that the amino acid sequence of some of the M2 polypeptides can be altered without significant effect on the structure or function of the protein. If such alterations in the sequence are contemplated, it should be remembered that there are important regions on the protein that determine activity. In general, residues forming the quaternary structure can be substituted as long as residues performing similar functions are used. In other examples, residues of this type may be completely trivial when changes occur in non-critical regions of the protein. Amino acid substitutions can also alter the selectivity of binding to cell surface receptors. Ostad
e et al., Nature 361: 266-268 (1993) describe certain mutations that result in the selective binding of TNF-α to only one of the two known types of TNF receptors. Thus, the polypeptides of the invention may contain one or more amino acid substitutions, deletions or additions, either by natural mutation or by human manipulation.

Accordingly, the present invention further includes variations of TIAM2 polypeptides that exhibit substantial TIAM2 polypeptide activity or that include regions of the TIAM2 protein, such as the protein portions discussed below. Such variants include deletions, insertions, conversions, repetitions, and type substitutions. As indicated above, guidance regarding that amino acid changes are likely to be phenotypically silent is given by B
owie, J .; U. Et al., "Deciphering the Message."
in Protein Sequences: Tolerance to Am
ino Acid Substitutions ", Science 247:
1306-1310 (1990).

A particular object is the replacement of a charged amino acid with another charged amino acid and with a neutral or negatively charged amino acid. The latter results in a protein with a reduced positive charge to improve the characteristics of the TIAM2 protein. It is highly desirable to prevent agglomeration. Aggregation of proteins can cause problems not only in the loss of activity, but also in preparing pharmaceutical formulations because they can be immunogenic. (Pinkard et al., Clin Exp. Immunol.
. 2: 331-340 (1967); Robbins et al., Diabetes 3
6: 838-845 (1987); Cleland et al., Crit. Rev .. Th
erupeutic Drug Carrier Systems 10: 3
07-377 (1993)).

The amino acids in the polypeptides of the invention that are essential for function can be determined by site-directed mutagenesis or alanine scan mutagenesis (Cunningham and Wells, S
science 244: 1081-1085 (1989)). The latter procedure introduces a single alanine mutation at each residue in the molecule. The resulting mutant molecules are then tested for receptor binding or biological activity in vitro, ie, as in an in vitro proliferation assay. Important sites for ligand-receptor binding are also
It can also be determined by structural analysis such as crystallization, nuclear magnetic resonance, or photoaffinity labeling (Smith et al., J. Mol. Biol. 244: 899-904 (19
92) and de Vos et al., Science 255: 306-312 (19
92)).

For example, variants can be constructed by making conservative amino acid substitutions. The following are examples of conservative substitutions:

[0078]

Embedded image . A subset of variants, called muteins, are groups of polypeptides that have cysteines involved in non-disulfide bonds replaced with neutral amino acids (typically, serine). These variants are more stable over a wider range of temperatures than the native TIAM2 protein. As indicated, the alterations are preferably of a minor nature (eg, conservative amino acid substitutions that do not significantly affect the folding or activity of the protein). Of course, the number of amino acid substitutions made by one of skill in the art will depend on many factors, including those described above. Generally speaking,
The number of substitutions for any given TIAM2 polypeptide is 50, 40, 30
, 25, 20, 15, 10, 5, or 3. The coding sequence for the variant is
It can be constructed by in vitro mutagenesis of a sequence encoding a native TIAM2 polypeptide.

As used herein, the term “protein” or “polypeptide”
Refers to a polymer of amino acids and does not refer to a particular length of the product; thus, peptides, oligopeptides, polypeptides, proteins, and polyproteins, and fragments thereof, are included in this definition. This term also
No mention or elimination of post-expression modifications (eg, glycosylation, acetylation, phosphorylation, etc.) of the protein is made. For example, proteins containing analogs of one or more amino acids (including, for example, unnatural amino acids, etc.), proteins with substituted bonds, and other modifications known in the art (naturally occurring) And non-naturally occurring) are included in this definition.

A nucleic acid sequence “derived from” or “encoded by (co)
ed by) "or" encoded by "
"A polypeptide or protein or amino acid sequence is an amino acid sequence of a polypeptide encoded in the sequence, or a portion of which is at least 3-5 contiguous amino acids, and more preferably at least 8-10 amino acids. And even more preferably refers to a polypeptide having an amino acid sequence that is identical to a portion thereof composed of at least 11 to 15 amino acids, or immunologically using a polypeptide encoded in the sequence. Refers to a polypeptide that can be identified. The term also includes polypeptides expressed from the specified nucleic acid sequence.

“Purified” and “isolated” when referring to a polypeptide or nucleotide sequence, in the substantial absence of other biological macromolecules of the same type,
It means that the indicated molecule is present. The term “purified,” as used herein, refers to at least seven of the same type of biological macromolecules present.
5% by weight, more preferably at least 85% by weight, more preferably still at least 95% by weight, and most preferably at least 98% by weight (but water, buffers and other small molecules (especially less than 1000) Having a molecular weight of
May exist).

[0082] Fragments of a polynucleotide encoding a TIAM2 polypeptide disclosed herein are also within the scope of the invention. Such a fragment may encode an antigenic region of a protein, or a biologically functional region of a protein described herein. Such fragments also encode the polypeptide components of the fusion proteins disclosed herein. Fragments are also suitable for use as probes to identify polynucleotides that can hybridize to SEQ ID NOs: 8, 9, and / or 10. The fragment is from about 10 base pairs in length to a full-length polynucleotide that is 3344 base pairs for SEQ ID NO: 8, 4590 base pairs for SEQ ID NO: 9, and 4514 base pairs for SEQ ID NO: 10. Range. Preferred fragments are 15, 20, 25, 30 for SEQ ID NOs: 8, 9, or 10.
, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90
, 95, 100, 125, 150, 200, 250, 300, 350, 400,
500, 600, 700, 800, 900, 1000, 1100, 1200, 1
300, 1400, 1500, 1600, 1700, 1800, 1900, 20
00, 2100, 2200, 2300, 2400, 2500, 2600, 270
0, 2800, 2900, 3000, 3100, 3200, or 3300 base pairs; for SEQ ID NO: 9 or 10, 3400, 3500, 3600, 370
0, 3800, 4000, 4100, 4200, 4300, 4400, 4500
Or 4510 base pairs; and for SEQ ID NO: 10, 4520, 4550
, 4575, or 4580 base pairs. A particularly preferred fragment comprises nucleotides 1 to 104 of SEQ ID NO: 8.

[0083] The polypeptide fragment may be a mutant or native T1AM2 protein.
Amino- and / or carboxyl-terminal amino acid deletions of the protein. Shortened
The number of amino acids determined depends on whether the polypeptide fragment has the desired sequence homology,
It is not significant as long as it exhibits epidemiological or biological activity. Preferred fragment
No. 10, 15, 20, 25, 30 of SEQ ID NO: 7, 11, 12, or 13
, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90
, 95, 100, 125, 150, 175, 200, 250, 300, 350,
400, 450, 500, 550, 600 or 625 amino acids; SEQ ID NO: 12
Or 13 of 650, 675, 750, 800, 825, 900, 950, 10
00, 1025, or 1050 amino acids; and 1060 of SEQ ID NO: 13.
1065, 1070 or 1075 amino acids. Immunologically important polypep
Tide fragments are shared, for example, by the native TIAM2 protein.
At least one epitope. Such a TIAM2 protein comprises 5
It may be only １５15 amino acids long. Examples of amino acid sequences of fragments include:
Including: amino acid numbers 1 to 8 of SEQ ID NO: 7, 11, 12, or 13 (aa
1 to aa8); aa2 to aa9 of SEQ ID NO: 7, 11, 12, or 13;
No. 7, 11, 12, or 13 aa3 to aa10; SEQ ID NOs: 7, 11, 12,
Or 13 aa4 to aa11; SEQ ID NO: 7, 11, 12, or 13 aa5
To aa12; aa6 to aa13 of SEQ ID NO: 7, 11, 12, or 13;
No. 7, 11, 12, or 13 aa7 to aa14;
Or 13 aa8 to aa15; SEQ ID NO: 7, 11, 12, or 13 aa9
To aa16; aa10 to aa17 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa11 to aa18 of No. 7, 11, 12, or 13; SEQ ID Nos. 7, 11, 1
2 or 13 aa12 to aa19; SEQ ID NO: 7, 11, 12, or 13
aa13 to aa20; aa14 to aa2 of SEQ ID NO: 7, 11, 12, or 13
1; aa15 to aa22 of SEQ ID NO: 7, 11, 12, or 13;
Aa16 to aa23 of 11, 12, or 13; SEQ ID NOs: 7, 11, 12, or
Is aa17 to aa24 of 13; aa18 of SEQ ID NO: 7, 11, 12, or 13
To aa25; aa19 to aa26 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa20-aa27 of Nos. 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2 or 13 aa21 to aa28; SEQ ID NO: 7, 11, 12, or 13
aa22 to aa29; aa23 to aa3 of SEQ ID NO: 7, 11, 12, or 13
0; aa24 to aa31 of SEQ ID NO: 7, 11, 12, or 13;
Aa 25 to aa 32 of 11, 12, or 13;
Is aa26 to aa33 of 13; aa27 of SEQ ID NO: 7, 11, 12, or 13
~ Aa34; aa28 to aa35 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa29 to aa36 of Nos. 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2 or 13 aa30 to aa37; SEQ ID NO: 7, 11, 12, or 13
aa31 to aa38; aa32 to aa3 of SEQ ID NO: 7, 11, 12, or 13
9; aa33 to aa40 of SEQ ID NO: 7, 11, 12, or 13;
Aa34 to aa41 of 11, 12, or 13; SEQ ID NOs: 7, 11, 12, or
Is aa35 to aa42 of 13; aa36 of SEQ ID NO: 7, 11, 12, or 13
To aa43; aa37 to aa44 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa38 to aa45 of Nos. 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2 or 13 aa39 to aa46; SEQ ID NO: 7, 11, 12, or 13
aa40 to aa47; aa41 to aa4 of SEQ ID NO: 7, 11, 12, or 13
8; aa42 to aa49 of SEQ ID NO: 7, 11, 12, or 13;
Aa43 to aa50 of 11, 12, or 13;
Is aa44 to aa51 of 13; aa45 of SEQ ID NO: 7, 11, 12, or 13
~ Aa52; aa46 to aa53 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa47 to aa54 of Nos. 7, 11, 12, or 13; SEQ ID Nos. 7, 11, 1
2 or 13 aa48 to aa55; SEQ ID NO: 7, 11, 12, or 13
aa49 to aa56; aa50 to aa5 of SEQ ID NO: 7, 11, 12, or 13
7; aa51 to aa58 of SEQ ID NO: 7, 11, 12, or 13;
Aa52 to aa59 of 11, 12, or 13;
Is aa53 to aa60 of 13; aa54 of SEQ ID NO: 7, 11, 12, or 13
~ Aa61; aa55 to aa62 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa56 to aa63 of Nos. 7, 11, 12, or 13; SEQ ID Nos. 7, 11, 1
2 or 13 aa57 to aa64; SEQ ID NO: 7, 11, 12, or 13
aa58 to aa65; aa59 to aa6 of SEQ ID NO: 7, 11, 12, or 13
6; aa60 to aa67 of SEQ ID NO: 7, 11, 12, or 13;
Aa 61 to aa 68 of 11, 12, or 13;
Is aa62 to aa69 of 13; aa63 of SEQ ID NO: 7, 11, 12, or 13
~ Aa70; aa64 to aa71 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa 65 to aa 72 of numbers 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa66 to aa73; SEQ ID NO: 7, 11, 12, or 13
aa67 to aa74; aa68 to aa7 of SEQ ID NO: 7, 11, 12, or 13
5; aa69 to aa76 of SEQ ID NO: 7, 11, 12, or 13;
Aa70-aa77 of 11, 12, or 13;
Is 13 aa71-aa78; SEQ ID NO: 7, 11, 12, or 13 aa72
~ Aa79; aa73 to aa80 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa74 to aa81 of Nos. 7, 11, 12, or 13;
2 or 13 aa75 to aa82; SEQ ID NO: 7, 11, 12, or 13
aa76 to aa83; aa77 to aa8 of SEQ ID NO: 7, 11, 12, or 13
4; aa78 to aa84 of SEQ ID NO: 7, 11, 12, or 13;
11, 12, or 13 aa79 to aa86; SEQ ID NOs: 7, 11, 12, or
Is aa80 to aa87 of 13; aa81 of SEQ ID NO: 7, 11, 12, or 13
~ Aa88; aa82 to aa89 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa83 to aa90 of Nos. 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2 or 13 aa84 to aa91; SEQ ID NO: 7, 11, 12, or 13
aa85 to aa92; aa86 to aa9 of SEQ ID NO: 7, 11, 12, or 13
3; aa87 to aa94 of SEQ ID NO: 7, 11, 12, or 13;
Aa88-aa95 of 11, 12, or 13; SEQ ID NOs: 7, 11, 12, or
Is aa89 to aa96 of 13; aa90 of SEQ ID NO: 7, 11, 12, or 13
To aa97; aa91 to aa98 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa92 to aa99 of Nos. 7, 11, 12, or 13;
2, or 13 aa93 to aa100; SEQ ID NOs: 7, 11, 12, or 13
Aa94 to aa101; aa95 to aa of SEQ ID NO: 7, 11, 12, or 13
a102; aa96 to aa103 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa97 to aa104 of Nos. 7, 11, 12, or 13;
Aa98 to aa105 of 12, or 13; SEQ ID NO: 7, 11, 12, or 1
Aa99 to aa106 of 3; aa100 to aa of SEQ ID NO: 7, 11, or 13
107; aa101 to aa108 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa102 to aa109 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa103-aa110; SEQ ID NOs: 7, 11, 12, or
Is 13 aa104 to aa111; SEQ ID NO: 7, 11, 12, or 13 aa
105-aa112; aa106-aa of SEQ ID NO: 7, 11, 12, or 13
113; aa107 to aa114 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa108 to aa115 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa109-aa116; SEQ ID NOs: 7, 11, 12, or
Is 13 aa110-aa117; SEQ ID NO: 7, 11, 12, or 13 aa
111 to aa118; aa112 to aa of SEQ ID NO: 7, 11, 12, or 13
119; aa113-aa120 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa114 to aa121 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa 115-aa122; SEQ ID NOs: 7, 11, 12,
Is 13 aa116 to aa123; SEQ ID NO: 7, 11, 12, or 13 aa
117 to aa124; aa118 to aa of SEQ ID NO: 7, 11, 12, or 13
125; aa119-aa126 of SEQ ID NO: 7, 11, 12, or 13;
Aa120 to aa127 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa121-aa128; SEQ ID NOs: 7, 11, 12,
Is 13 aa122-aa129; SEQ ID NO: 7, 11, 12, or 13 aa
123 to aa130; aa124 to aa of SEQ ID NO: 7, 11, 12, or 13
131; aa125 to aa132 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa126 to aa133 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa127-aa134; SEQ ID NOs: 7, 11, 12,
Is aa128 to aa135 of 13; aa of SEQ ID NO: 7, 11, 12, or 13
129 to aa136; aa130 to aa of SEQ ID NO: 7, 11, 12, or 13
137; aa 131 to aa 138 of SEQ ID NO: 7, 11, 12, or 13;
Aa132 to aa139 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa133-aa140; SEQ ID NOs: 7, 11, 12,
Is 13 aa134 to aa141; SEQ ID NO: 7, 11, 12, or 13 aa
135-aa142; aa136-aa of SEQ ID NO: 7, 11, 12, or 13
143; aa137 to aa144 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa138 to aa145 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa139-aa146; SEQ ID NOs: 7, 11, 12,
Is aa140 to aa147 of 13; aa of SEQ ID NO: 7, 11, 12, or 13
141 to aa148; aa 142 to aa of SEQ ID NO: 7, 11, 12, or 13
149; aa143 to aa150 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa144 to aa151 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa145-aa152; SEQ ID NOs: 7, 11, 12,
Is aa 146 to aa 153 of 13; aa of SEQ ID NO: 7, 11, 12, or 13
147 to aa154; aa148 to aa of SEQ ID NO: 7, 11, 12, or 13
155; aa149 to aa156 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa150 to aa157 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa151 to aa158; SEQ ID NOs: 7, 11, 12,
Is 13 aa152-aa159; SEQ ID NO: 7, 11, 12, or 13 aa
153-aa160; aa154-aa of SEQ ID NO: 7, 11, 12, or 13
161; aa155 to aa162 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa156 to aa163 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa157-aa164; SEQ ID NOs: 7, 11, 12,
Is 13 aa 158 to aa 165; SEQ ID NO: 7, 11, 12, or 13 aa
159 to aa166; aa160 to aa of SEQ ID NO: 7, 11, 12, or 13
167; aa161 to aa168 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa162 to aa169 of Nos. 7, 11, 12, or 13;
, 12 or 13 aa163-aa170; SEQ ID NOs: 7, 11, 12;
Is 13 aa164 to aa171; SEQ ID NO: 7, 11, 12, or 13 aa
165 to aa172; aa166 to aa of SEQ ID NO: 7, 11, 12, or 13
173; aa167 to aa174 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa168 to aa175 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa169-aa176; SEQ ID NOs: 7, 11, 12,
Is aa170 to aa177 of 13; aa of SEQ ID NO: 7, 11, 12, or 13
171 to aa178; aa172 to aa of SEQ ID NO: 7, 11, 12, or 13
179; aa173-aa180 of SEQ ID NO: 7, 11, 12, or 13;
Aa174 to aa181 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa175-aa182; SEQ ID NOs: 7, 11, 12,
Is 13 aa176-aa183; SEQ ID NO: 7, 11, 12, or 13 aa
177 to aa 184; aa 178 to aa of SEQ ID NO: 7, 11, 12, or 13
185; aa179 to aa186 of SEQ ID NO: 7, 11, 12, or 13;
Aa180 to aa187 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa181 to aa188; SEQ ID NOs: 7, 11, 12,
Is 13 aa182 to aa189; SEQ ID NO: 7, 11, 12, or 13 aa
183 to aa190; aa184 to aa of SEQ ID NO: 7, 11, 12, or 13
191; aa185 to aa192 of SEQ ID NO: 7, 11, 12, or 13;
Aa186 to aa193 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa187-aa194; SEQ ID NOs: 7, 11, 12,
Is 13 aa188-aa195; SEQ ID NO: 7, 11, 12, or 13 aa
189 to aa 196; aa 190 to aa of SEQ ID NO: 7, 11, 12, or 13
197; aa191 to aa198 of SEQ ID NO: 7, 11, 12, or 13; sequence
Nos. 7, 11, 12, or 13 aa192 to aa199; SEQ ID NOs: 7,11
, 12, or 13 aa193-aa200; SEQ ID NOs: 7, 11, 12,
Is 13 aa194-aa201; SEQ ID NO: 7, 11, 12, or 13 aa
195-aa202; aa196-aa of SEQ ID NO: 7, 11, 12, or 13
203; aa197-aa204 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa 198 to aa 205 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa199-aa206; SEQ ID NOs: 7, 11, 12,
Is 13 aa200-aa207; SEQ ID NO: 7, 11, 12, or 13 aa
201 to aa208; aa202 to aa of SEQ ID NO: 7, 11, 12, or 13
209; aa203 to aa210 of SEQ ID NO: 7, 11, 12, or 13;
Aa204 to aa211 of numbers 7, 11, 12, or 13; SEQ ID NOs: 7, 11
, 12, or 13 aa205-aa212; SEQ ID NOs: 7, 11, 12,
Is aa206 to aa213 of 13; aa of SEQ ID NO: 7, 11, 12, or 13
207 to aa 214; aa 208 to aa of SEQ ID NO: 7, 11, 12, or 13
215; aa209-aa216 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa210-aa217 of numbers 7, 11, 12, or 13; SEQ ID NOs: 7, 11
, 12 or 13 aa 211 to aa 218; SEQ ID NOs: 7, 11, 12;
Is 13 aa 212 to aa 219; SEQ ID NO: 7, 11, 12, or 13 aa
213 to aa220; aa 214 to aa of SEQ ID NO: 7, 11, 12, or 13
221; aa215 to aa222 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa 216 to aa 223 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa217-aa224; SEQ ID NOs: 7, 11, 12,
Is 13 aa218 to aa225; SEQ ID NO: 7, 11, 12, or 13 aa
219-aa226; aa220-aa of SEQ ID NO: 7, 11, 12, or 13
227; aa221 to aa228 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa222 to aa229 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa223-aa230; SEQ ID NOs: 7, 11, 12,
Is 13 aa224 to aa231; SEQ ID NO: 7, 11, 12, or 13 aa
225-aa232; and aa226 of SEQ ID NO: 7, 11, 12, or 13
To aa233; aa227 to aa234 of SEQ ID NO: 7, 11, 12, or 13
Aa228-aa235 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7
, 11, 12, or 13 aa229-aa236; SEQ ID NOs: 7, 11, 12
, Or 13 aa230-aa237; SEQ ID NOs: 7, 11, 12, or 13
Aa 231 to aa 238; aa 222 of SEQ ID NO: 7, 11, 12, or 13
~ Aa239; aa233 to aa240 of SEQ ID NO: 7, 11, 12, or 13
Aa 234 to aa 41 of SEQ ID NO: 7, 11, 12, or 13;
Aa 235 to aa 242 of 11, 12, or 13;
Or aa236 to aa243 of SEQ ID NO: 7, 11, 12, or 13
aa237 to aa244; aa238 to aa238 to SEQ ID NO: 7, 11, 12, or 13
aa245; aa239 to aa246 of SEQ ID NO: 7, 11, 12, or 13;
Aa240 to aa247 of SEQ ID NO: 7, 11, 12, or 13;
Aa241 to aa248 of 11, 12, or 13;
Or 13 of aa242-aa249; SEQ ID NO: 7, 11, 12, or 13
aa243 to aa250; aa244 to SEQ ID NO: 7, 11, 12, or 13
aa251; aa245 to aa252 of SEQ ID NO: 7, 11, 12, or 13;
Aa246 to aa253 of SEQ ID NO: 7, 11, 12, or 13;
Aa247 to aa254 of 11, 12, or 13;
Or 13 of aa248 to aa255; SEQ ID NO: 7, 11, 12, or 13
aa249 to aa256; aa250 to aa250 to SEQ ID NO: 7, 11, 12, or 13
aa257; aa251 to aa258 of SEQ ID NO: 7, 11, 12, or 13;
Aa 252 to aa 259 of SEQ ID NO: 7, 11, 12, or 13;
Aa253-aa260 of 11, 12, or 13; SEQ ID NOs: 7, 11, 12,
Or 13 aa254 to aa261; SEQ ID NO: 7, 11, 12, or 13
aa 255 to aa 262; aa 256 to aa 256 to SEQ ID NO: 7, 11, 12, or 13
aa263; aa257 to aa264 of SEQ ID NO: 7, 11, 12, or 13;
Aa258 to aa265 of SEQ ID NO: 7, 11, 12, or 13;
Aa259 to aa266 of 11, 121, or 13; SEQ ID NOs: 7, 11, 12
, Or 13 aa260-aa267; SEQ ID NOs: 7, 11, 12, or 13
Aa 261 to aa 268; aa 262 of SEQ ID NO: 7, 11, 12, or 13
~ Aa269; aa263 to aa270 of SEQ ID NO: 7, 11, 12, or 13
Aa264-aa271 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7
, 11, 12, or 13 aa265-aa272; SEQ ID NOs: 7, 11, 12
, Or 13 aa266-aa273; SEQ ID NOs: 7, 11, 12, or 13
Aa267 to aa274; aa268 of SEQ ID NO: 7, 11, 12, or 13
To aa 275; aa 269 to aa 276 of SEQ ID NO: 7, 11, 12, or 13
Aa 270 to aa 277 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7
, 11, 12, or 13 aa271 to aa278; SEQ ID NOs: 7, 11, 12
, Or 13 aa272-aa279; SEQ ID NOs: 7, 11, 12, or 13
Aa273 to aa280; aa274 of SEQ ID NO: 7, 11, 12, or 13
To aa281; aa275 to aa282 of SEQ ID NO: 7, 11, 12, or 13
Aa276-aa283 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7
, 11, 12, or 13 aa277 to aa284; SEQ ID NOs: 7, 11, 12
, Or 13 aa278-aa284; SEQ ID NOs: 7, 11, 12, or 13
Aa279 to aa286; aa280 of SEQ ID NO: 7, 11, 12, or 13
~ Aa287; aa281 to aa288 of SEQ ID NO: 7, 11, 12, or 13
Aa 282 to aa 289 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7
, 11, 12, or 13; aa283 to aa290; SEQ ID NOs: 7, 11, 12
, Or 13 aa284-aa291; SEQ ID NOs: 7, 11, 12, or 13
Aa 285 to aa 292; aa 286 of SEQ ID NO: 7, 11, 12, or 13
To aa293; SEQ ID NOs: 7, 11, 12 or 13; aa287 to aa294;
Aa 288-aa 295 of SEQ ID NO: 7, 11, 12, or 13;
Aa 289 to aa 296 of 11, 12, or 13; SEQ ID NOs: 7, 11, 12,
Or 13 of aa 290-aa 297; of SEQ ID NO: 7, 11, 12, or 13
aa 291 to aa 298; aa 292 of SEQ ID NO: 7, 11, 12, or 13
aa299; aa293-aa300 of SEQ ID NO: 7, 11, 12, or 13;
Aa294-aa101 of SEQ ID NO: 7, 11, 12, or 13;
11, 12, or 13 aa 295-aa 102;
Or aa 296-aa 103 of SEQ ID NO: 7, 11, 12, or 13
aa297 to aa104; aa298 to SEQ ID NO: 7, 11, 12, or 13
aa105; aa299 to aa106 of SEQ ID NO: 7, 11, 12, or 13;
Aa300 to aa307 of SEQ ID NO: 7, 11, 12, or 13;
Aa301 to aa308 of 11, 12, or 13;
Or 13 of aa302 to aa309; SEQ ID NO: 7, 11, 12, or 13
aa303 to aa310; aa304 to aa311 of SEQ ID NO: 7, SEQ ID NO: 7,
Aa 305 to aa 312 of 11, 12, or 13;
Or 13 of aa306 to aa313; SEQ ID NO: 7, 11, 12, or 13
aa307-aa314; aa308- of SEQ ID NO: 7, 11, 12, or 13
aa315; aa309 to aa316 of SEQ ID NO: 7, 11, 12, or 13;
Aa 310 to aa 317 of SEQ ID NO: 7, 11, 12, or 13;
Aa311-aa318 of 11, 12, or 13;
Or aa 312 to aa 319 of SEQ ID NO: 7, 11, 12, or 13
aa313 to aa320; aa314 to SEQ ID NO: 7, 11, 12, or 13
aa321; aa315 to aa322 of SEQ ID NO: 7, 11, 12, or 13;
Aa 316 to aa 323 of SEQ ID NO: 7, 11, 12, or 13;
Aa317 to aa324 of 11, 12, or 13;
Or 13 of aa318-aa325; SEQ ID NO: 7, 11, 12, or 13
aa319 to aa326; SEQ ID NO: 7, 11, 12, or 13;
aa327; aa321 to aa328 of SEQ ID NO: 7, 11, 12, or 13;
Aa 322 to aa 329 of SEQ ID NO: 7, 11, 12, or 13;
Aa 323 to aa 330 of 11, 12, or 13;
Or 13 aa324 to aa331; SEQ ID NO: 7, 11, 12, or 13
aa325-aa332; aa326 of SEQ ID NO: 7, 11, 12, or 13;
To aa333; aa327 to aa334 of SEQ ID NO: 7, 11, 12, or 13
Aa328-aa335 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7
, 11, 12, or 13; aa329-aa336; SEQ ID NOs: 7, 11, 1
Aa330 to aa337 of 2, or 13; SEQ ID NO: 7, 11, 12, or 1
3 aa331 to aa338; SEQ ID NO: 7, 11, 12, or 13 aa33
2-aa339; aa333-aa34 of SEQ ID NO: 7, 11, 12, or 13
0; aa334 to aa341 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa335-aa342; SEQ ID NOs: 7, 11, 1
Aa336 to aa343 of 2, or 13; SEQ ID NO: 7, 11, 12, or 1
Aa 337 to aa 344 of SEQ ID NO: 3, aa 33 of SEQ ID NO: 7, 11, 12, or 13
8-aa345; aa339-aa34 of SEQ ID NO: 7, 11, 12, or 13
6; aa340 to aa347 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa341-aa348; SEQ ID NOs: 7, 11, 1
2, or 13 aa342-aa349; SEQ ID NOs: 7, 11, 12, or 1
Aa 343 to aa 350 of 3; aa 34 of SEQ ID NO: 7, 11, 12, or 13
4-aa351; aa345-aa35 of SEQ ID NO: 7, 11, 12, or 13
2: aa346 to aa353 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
Aa347-aa354 of 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa348 to aa355; SEQ ID NO: 7, 11, 12, or 1
Aa 349 to aa 356 of SEQ ID NO: 3, aa 35 of SEQ ID NO: 7, 11, 12, or 13
0 to aa357; aa351 to aa35 of SEQ ID NO: 7, 11, 12, or 13
8; aa352 to aa359 of SEQ ID NO: 7, 11, 12, or 13;
Aa353-aa360 of 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa354-aa361; SEQ ID NO: 7, 11, 12, or 1
Aa355 of SEQ ID NO: 7, 11, 12, or 13
6 to aa363; aa357 to aa36 of SEQ ID NO: 7, 11, 12, or 13
4; aa358 to aa365 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
7, 11, 12, or 13 aa359-aa366; SEQ ID NOs: 7, 11, 1
2, or 13 aa360 to aa367; SEQ ID NO: 7, 11, 12, or 1
Aa361 of SEQ ID NO: 7, 11, 12, or 13
2 to aa369; aa363 to aa37 of SEQ ID NO: 7, 11, 12, or 13
0; aa364 to aa371 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
Aa365 to aa372 of 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa366-aa373; SEQ ID NO: 7, 11, 12, or 1
Aa36 of SEQ ID NO: 7, 11, 12, or 13
8-aa375; aa369-aa37 of SEQ ID NO: 7, 11, 12, or 13
6; aa370 to aa377 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa371 to aa378; SEQ ID NOs: 7, 11, 1
2, or 13 aa372-aa379; SEQ ID NO: 7, 11, 12, or 1
Aa 373 to aa 380 of SEQ ID NO: 7, 11, 12, or 13
4-aa381; aa375-aa38 of SEQ ID NO: 7, 11, 12, or 13
2; aa376 to aa383 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
Aa377-aa384 of 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa378 to aa385; SEQ ID NO: 7, 11, 12, or 1
Aa 379 to aa 386 of SEQ ID NO: 3, 11, 12, or 13
0 to aa387; aa381 to aa38 of SEQ ID NO: 7, 11, 12, or 13
8; aa382 to aa389 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa383-aa390; SEQ ID NOs: 7, 11, 1
2, or 13 aa384-aa391; SEQ ID NO: 7, 11, 12, or 1
3 aa 385 to aa 392; SEQ ID NO: 7, 11, 12, or 13 aa 38
6 to aa393; aa387 to aa39 of SEQ ID NO: 7, 11, 12, or 13
4; aa388 to aa395 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa389 to aa396; SEQ ID NOs: 7, 11, 1
2, or 13 aa 390 to aa 397; SEQ ID NO: 7, 11, 12, or 1
Aa 391 to aa 398; aa 39 of SEQ ID NO: 7, 11, 12, or 13
2-aa399; aa393-aa40 of SEQ ID NO: 7, 11, 12, or 13
0; aa394 to aa401 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa 395-aa 402; SEQ ID NOs: 7, 11, 1
2, or 13 aa 396-aa 403; SEQ ID NO: 7, 11, 12, or 1
3 aa397-aa404; SEQ ID NOs: 7, 11, 12, or 13; aa39
8-aa405; aa399-aa40 of SEQ ID NO: 7, 11, 12, or 13
6; aa400 to aa407 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa401 to aa408; SEQ ID NOs: 7, 11, 1
2, or 13 aa402-aa409; SEQ ID NO: 7, 11, 12, or 1
3; aa403 to aa410; aa40 of SEQ ID NO: 7, 11, 12, or 13
4-aa411; aa405-aa41 of SEQ ID NO: 7, 11, 12, or 13
2; aa406 to aa413 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
Aa407-aa414 of 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa408-aa415; SEQ ID NO: 7, 11, 12, or 1
Aa409 of 3; aa41 of SEQ ID NO: 7, 11, 12, or 13
0 to aa417; aa411 to aa4 of SEQ ID NO: 7, 11, 12, or 13
18; aa412 to aa419 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa413-aa420;
12, or 13 aa414-aa421; SEQ ID NOs: 7, 11, 12, or
13 aa 415 to aa 422; SEQ ID NO: 7, 11, 12, or 13 aa 4
16 to aa423; aa417 to aa4 of SEQ ID NO: 7, 11, 12, or 13
24; aa418 to aa425 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa419-aa426;
Aa420 to aa427 of 12, or 13; SEQ ID NO: 7, 11, 12, or
13; aa421 to aa428; aa4 of SEQ ID NO: 7, 11, 12, or 13
22 to aa429; aa423 to aa4 of SEQ ID NO: 7, 11, 12, or 13
30; aa424 to aa431 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa425-aa432;
Aa 426 to aa 433 of 12, or 13; SEQ ID NO: 7, 11, 12, or
13 aa427 to aa434; SEQ ID NO: 7, 11, 12, or 13 aa4
28 to aa435; aa429 to aa4 of SEQ ID NO: 7, 11, 12, or 13
36; aa430-aa437 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa431-aa438;
12, or 13 aa 432-aa 439; SEQ ID NO: 7, 11, 12, or
13 aa433 to aa440; SEQ ID NO: 7, 11, 12, or 13 aa4
34 to aa441; aa435 to aa4 of SEQ ID NO: 7, 11, 12, or 13
42; aa436 to aa443 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa437-aa444;
Aa438 to aa445 of 12, or 13; SEQ ID NO: 7, 11, 12, or
13 aa439 to aa446; SEQ ID NO: 7, 11, 12, or 13 aa4
40 to aa447; aa441 to aa4 of SEQ ID NO: 7, 11, 12, or 13
48; aa442 to aa449 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa443-aa450;
12, or 13 aa444-aa451; SEQ ID NO: 7, 11, 12, or
13 aa445 to aa452; SEQ ID NO: 7, 11, 12, or 13 aa4
46 to aa453; aa447 to aa4 of SEQ ID NO: 7, 11, 12, or 13
54; aa448 to aa455 of SEQ ID NO: 7, 11, 12, or 13;
SEQ ID NOs: 7,11, 12, or 13 aa449-aa456;
Aa450 to aa457 of 12, or 13; SEQ ID NO: 7, 11, 12, or
13 aa 451 to aa 458; SEQ ID NO: 7, 11, 12, or 13 aa 4
52 to aa459; aa453 to aa4 of SEQ ID NO: 7, 11, 12, or 13
60; aa454 to aa461 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa455-aa462;
Aa456 to aa463 of 12, or 13; SEQ ID NO: 7, 11, 12, or
13 aa457 to aa464; SEQ ID NO: 7, 11, 12, or 13 aa4
58 to aa465; aa459 to aa4 of SEQ ID NO: 7, 11, 12, or 13
66; aa460 to aa467 of SEQ ID NO: 7, 11, 12, or 13;
No. 7, 11, 12, or 13 aa461-aa468;
Aa462 to aa469 of 12, or 13; SEQ ID NO: 7, 11, 12, or
13 aa 463 to aa 470; SEQ ID NO: 7, 11, 12, or 13 aa 4
64-aa471; aa465-aa4 of SEQ ID NO: 7, 11, 12, or 13
72; aa466 to aa473 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa467-aa474;
Aa468 to aa475 of 12, or 13; SEQ ID NO: 7, 11, 12, or
13 aa469 to aa476; SEQ ID NO: 7, 11, 12, or 13 aa4
70 to aa477; aa471 to aa4 of SEQ ID NO: 7, 11, 12, or 13
78; aa472 to aa479 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12, or 13 aa473-aa480;
12, or 13 aa474-aa481; SEQ ID NOs: 7, 11, 17, or
13 aa 475 to aa 482; SEQ ID NO: 7, 11, 12, or 13 aa 4
76 to aa483; aa477 to aa4 of SEQ ID NO: 7, 11, 12, or 13
84; aa478 to aa484 of SEQ ID NO: 7, 11, 12, or 13;
Nos. 7, 11, 12 or 13 aa479-aa486;
12, or 13 aa 480 to aa 487; SEQ ID NO: 7, 11, 12, or
13 aa481-aa488; SEQ ID NO: 7, 11, 12 or 13 aa48
2-aa489; aa483-aa49 of SEQ ID NO: 7, 11, 12, or 13
0; aa484 to aa491 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
7, 11, 12, or 13 aa 485-aa 492; SEQ ID NOs: 7, 11, 1
2, or 13 aa486-aa493; SEQ ID NO: 7, 11, 12, or 1
3 aa487 to aa494; SEQ ID NO: 7, 11, 12, or 13 aa48
8-aa495; aa489-aa49 of SEQ ID NO: 7, 11, 12, or 13
6; aa490-aa497 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa491-aa498; SEQ ID NOs: 7, 11, 1
2, or 13 aa492-aa499; SEQ ID NO: 7, 11, 12, or 1
3 aa 493 to aa 500; SEQ ID NO: 7, 11, 12, or 13 aa 49
4-aa501; aa495-aa50 of SEQ ID NO: 7, 11, 12, or 13
2; aa496 to aa503 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
Aa497-aa504 of 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa498 to aa505; SEQ ID NO: 7, 11, 12, or 1
Aa499 to aa506 of 3; aa50 of SEQ ID NO: 7, 11, 12, or 13
0 to aa507; aa501 to aa50 of SEQ ID NO: 7, 11, 12, or 13
8; aa502 to aa509 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa503-aa510; SEQ ID NOs: 7, 11, 1
2, or 13 aa504-aa511; SEQ ID NO: 7, 11, 12, or 1
Aa50 of SEQ ID NO: 7, 11, 12, or 13
6 to aa513; aa507 to aa51 of SEQ ID NO: 7, 11, 12, or 13
4; aa508 to aa515 of SEQ ID NO: 7, 11, 12, or 13;
Aa509-aa516 of 7, 11, 12, or 13; SEQ ID NOs: 7, 11, 1
2, or 13 aa510-aa517; SEQ ID NO: 7, 11, 12, or 1
3 aa511 to aa518; aa51 of SEQ ID NO: 7, 11, 12, or 13
2 to aa519; aa513 to aa52 of SEQ ID NO: 7, 11, 12, or 13
0; aa514 to aa521 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa515 to aa522; SEQ ID NOs: 7, 11, 1
2, or 13 aa516 to aa523; SEQ ID NO: 7, 11, 12, or 1
Aa517 of SEQ ID NO: 7, 11, 12, or 13
8-aa525; aa519-aa52 of SEQ ID NO: 7, 11, 12, or 13
6; aa520 to aa527 of SEQ ID NO: 7, 11, 12, or 13;
7, 11, 12, or 13 aa521 to aa528; SEQ ID NOs: 7, 11, 1
2, or 13 aa522-aa529; SEQ ID NO: 7, 11, 12, or 1
Aa 523 to aa 530 of SEQ ID NO: 3, aa 52 of SEQ ID NO: 7, 11, 12, or 13
4-aa531; aa525-aa53 of SEQ ID NO: 7, 11, 12, or 13
2; aa526 to aa533 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO:
7, 11, 12, or 13 aa527-aa534; SEQ ID NOs: 7, 11, 1
2, or 13 aa528 to aa535; SEQ ID NO: 7, 11, 12, or 1
Aa529 to aa536 of 3; aa53 of SEQ ID NO: 7, 11, 12, or 13
0 to aa537; aa531 to aa53 of SEQ ID NO: 7, 11, 12, or 13
8; aa532 to aa539 of SEQ ID NO: 7, 11, 12, or 13;
Aa533 to aa540 of 7, 11, 12, or 13;
Aa 534 to aa 541; SEQ ID NO: 7, 11, 12, or
Aa 535 to aa 542; aa of SEQ ID NO: 7, 11, 12, or 13
536 to aa543; aa537 to aa of SEQ ID NO: 7, 11, 12, or 13
544; aa538 to aa545 of SEQ ID NO: 7, 11, 12, or 13;
Aa539 to aa546 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa540-aa547; SEQ ID NOs: 7, 11, 12,
Is 13 aa541-aa548; SEQ ID NO: 7, 11, 12, or 13 aa
542 to aa549; aa543 to aa of SEQ ID NO: 7, 11, 12, or 13
550; aa544-aa551 of SEQ ID NO: 7, 11, 12, or 13;
Aa 545 to aa 552 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa546-aa553; SEQ ID NOs: 7, 11, 12,
Is 13 aa547-aa554; SEQ ID NO: 7, 11, 12, or 13 aa
548-aa555; aa549-aa of SEQ ID NO: 7, 11, 12, or 13
556; aa550 to aa557 of SEQ ID NO: 7, 11, 12, or 13;
Aa551 to aa558 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa552-aa559; SEQ ID NOs: 7, 11, 12,
Is 13 aa553-aa560; SEQ ID NO: 7, 11, 12, or 13 aa
554-aa561; aa555-aa of SEQ ID NO: 7, 11, 12, or 13
562; aa556 to aa563 of SEQ ID NO: 7, 11, 12, or 13; sequence
Aa557 to aa564 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa558 to aa565; SEQ ID NOs: 7, 11, 12,
Is 13 aa559-aa566; SEQ ID NO: 7, 11, 12, or 13 aa
560 to aa567; aa561 to aa of SEQ ID NO: 7, 11, 12, or 13
568; aa562 to aa569 of SEQ ID NO: 7, 11, 12, or 13;
Aa563 to aa570 of Nos. 7, 11, 12, or 13;
, 12 or 13 aa564-aa571; SEQ ID NOs: 7, 11, 12;
Is 13 aa 565 to aa 572; SEQ ID NO: 7, 11, 12, or 13 aa
566 to aa 573; aa 567 to aa of SEQ ID NO: 7, 11, 12, or 13
574; aa568 to aa575 of SEQ ID NO: 7, 11, 12, or 13;
Aa569 to aa576 of Nos. 7, 11, 12, or 13;
, 12, or 13 aa 570-aa577; SEQ ID NOs: 7, 11, 12,
Is 13 aa571-aa578; SEQ ID NO: 7, 11, 12, or 13 aa
572-aa579; aa573-aa of SEQ ID NO: 7, 11, 12, or 13
580; aa574 to aa581 of SEQ ID NO: 7, 11, 12, or 13;
Aa 575 to aa 582 of column numbers 7, 11, 12, or 13;
Aa576 to aa583 of 1, 12, or 13; SEQ ID NOs: 7, 11, 12, or
Or 13 aa577 to aa584; SEQ ID NO: 7, 11, 12, or 13 a
a578 to aa585; aa579 to aa of SEQ ID NO: 7, 11, 12, or 13
a586; aa580 to aa587 of SEQ ID NO: 7, 11, 12, or 13;
Aa 581 to aa 588 of column numbers 7, 11, 12, or 13;
1, 12, or 13 aa582-aa589; SEQ ID NOs: 7, 11, 12, or
Or 13 aa583-aa590; SEQ ID NO: 7, 11, 12, or 13 a
a584 to aa591; aa585 to aa of SEQ ID NO: 7, 11, 12, or 13
a592; aa586 to aa593 of SEQ ID NO: 7, 11, 12, or 13;
Aa587 to aa594 of column numbers 7, 11, 12, or 13;
Aa588 to aa595 of 1, 12, or 13; SEQ ID NO: 7, 11, 12, or
Or 13 aa589 to aa596; SEQ ID NO: 7, 11, 12, or 13 a
a590-aa597; aa591-a of SEQ ID NO: 7, 11, 12, or 13
a598; aa592 to aa599 of SEQ ID NO: 7, 11, 12, or 13;
Aa593-aa600 of SEQ ID NO: 7, 11, 12, or 13;
1, 12, or 13 aa594 to aa601; SEQ ID NOs: 7, 11, 12, or
Or 13 aa595-aa602; SEQ ID NO: 7, 11, 12, or 13 a
a596 to aa603; aa597 to aa of SEQ ID NO: 7, 11, 12, or 13
a604; aa598 to aa605 of SEQ ID NO: 7, 11, 12, or 13;
Aa599-aa606 of SEQ ID NO: 7, 11, 12, or 13;
11, 12, or 13 aa600 to aa607;
Or 13 of aa601 to aa608; SEQ ID NO: 7, 11, 12, or 13
aa602 to aa609; aa603 to aa603 to SEQ ID NO: 7, 11, 12, or 13
aa610; aa604 to aa611 of SEQ ID NO: 7, 11, 12, or 13;
Aa605 to aa612 of SEQ ID NO: 7, 11, 12, or 13;
Aa606 to aa613 of 11, 12, or 13; SEQ ID NOs: 7, 11, 12,
Or 13 aa607 to aa614; SEQ ID NO: 7, 11, 12, or 13
aa608 to aa615; aa609 to aa609 to SEQ ID NO: 7, 11, 12, or 13
aa616; aa610 to aa617 of SEQ ID NO: 7, 11, 12, or 13;
Aa611 to aa618 of SEQ ID NO: 7, 11, 12, or 13;
Aa612 to aa619 of 11, 12, or 13; SEQ ID NOs: 7, 11, 12,
Or 13 of aa613 to aa620; SEQ ID NO: 7, 11, 12, or 13
aa614 to aa621; aa615 to SEQ ID NO: 7, 11, 12, or 13
aa622; aa616 to aa623 of SEQ ID NO: 7, 11, 12, or 13;
Aa617 to aa624 of SEQ ID NO: 7, 11, 12, or 13;
Aa618 to aa625 of 11, 12, or 13;
Or 13 aa619 to aa626; SEQ ID NO: 12 or 13 aa620 to aa620
aa627; aa621 to aa628 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa622-aa629; SEQ ID NO: 12 or 13 aa623-
aa630; aa624 to aa631 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa625-aa632; SEQ ID NO: 12 or 13 aa626-
aa633; aa627 to aa634 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa628-aa635; SEQ ID NO: 12 or 13 aa629-
aa636; aa630 to aa637 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa631-aa638; SEQ ID NO: 12 or 13 aa632-
aa639; aa633 to aa640 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa634 to aa641; SEQ ID NO: 12 or 13 aa635 to aa635
aa642; aa636 to aa643 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa637 to aa644; SEQ ID NO: 12 or 13 aa638 to
aa645; aa639 to aa646 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa640 to aa647; SEQ ID NO: 12 or 13 aa641
aa648; aa642-aa649 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa643-aa650; SEQ ID NO: 12 or 13 aa644-
aa651; aa645 to aa652 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa646-aa653; SEQ ID NO: 12 or 13 aa647-
aa654; aa648 to aa655 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa649 to aa656; SEQ ID NO: 12 or 13 aa650 to aa650
aa657; aa651-aa658 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa652-aa659; SEQ ID NO: 12 or 13 aa653-
aa660; aa654 to aa661 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa655-aa662; SEQ ID NO: 12 or 13 aa656-
aa663; aa657 to aa664 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa658 to aa665; SEQ ID NO: 12 or 13 aa659 to
aa666; aa660 to aa667 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa661 to aa668; SEQ ID NO: 12 or 13 aa662 to aa662
aa669; aa663-aa670 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa664 to aa671; SEQ ID NO: 12 or 13 aa665 to aa665
aa672; aa666 to aa673 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa667 to aa674; SEQ ID NO: 12 or 13 aa668 to
aa675; aa669 to aa676 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa670 to aa677; SEQ ID NO: 12 or 13 aa671
aa678; aa672 to aa679 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa673-aa680; SEQ ID NO: 12 or 13 aa674-
aa681; aa675 to aa682 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa676 to aa683; SEQ ID NO: 12 or 13 aa677 to
aa684; aa678 to aa684 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa679 to aa686; SEQ ID NO: 12 or 13 aa680 to aa680
aa687; aa681 to aa688 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa682 to aa689; SEQ ID NO: 12 or 13 aa683 to
aa690; aa684-aa691 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa 686-aa 692; SEQ ID NO: 12 or 13 aa 686-
aa693; aa687 to aa694 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa688 to aa695; SEQ ID NO: 12 or 13 aa689 to
aa696; aa690-aa697 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa 691-aa 698; SEQ ID NO: 12 or 13 aa 692-
aa699; aa693-aa700 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa694-aa701; SEQ ID NO: 12 or 13 aa695-
aa702; aa696 to aa703 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa697-aa704; SEQ ID NO: 12 or 13 aa698-
aa705; aa699 to aa706 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa700 to aa707; SEQ ID NO: 12 or 13 aa701 to
aa708; aa702 to aa709 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa703 to aa710; SEQ ID NO: 12 or 13 aa704 to
aa711; aa705 to aa712 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa76-aa713; SEQ ID NO: 12 or 13 aa707-a
a714; aa708 to aa715 of SEQ ID NO: 12 or 13;
Or 13 aa709 to aa716; SEQ ID NO: 12 or 13 aa710 to aa716
a717; aa711 to aa718 of SEQ ID NO: 12 or 13;
Or 13 aa712-aa719; SEQ ID NO: 12 or 13 aa713-a
a720; aa714 to aa721 of SEQ ID NO: 12 or 13;
Or 13 aa715-aa722; SEQ ID NO: 12 or 13 aa716-a
a723; aa717 to aa724 of SEQ ID NO: 12 or 13;
Or 13 aa718-aa725; SEQ ID NO: 12 or 13 aa719-a
a726; aa720 to aa727 of SEQ ID NO: 12 or 13;
Or 13 aa721 to aa728; SEQ ID NO: 12 or 13 aa722 to aa728
a729; aa723 to aa730 of SEQ ID NO: 12 or 13;
Or 13 aa724-aa731; SEQ ID NO: 12 or 13 aa725-a
a732; aa726 to aa733 of SEQ ID NO: 12 or 13;
Or 13 aa727-aa734; SEQ ID NO: 12 or 13 aa728-a
a735; aa729 to aa736 of SEQ ID NO: 12 or 13;
Or 13 aa730-aa737; SEQ ID NO: 12 or 13 aa731-a
a738; aa732 to aa739 of SEQ ID NO: 12 or 13;
Or 13 aa733 to aa740; SEQ ID NO: 12 or 13 aa734 to aa740
a741; aa735 to aa742 of SEQ ID NO: 12 or 13;
Or 13 aa736-aa743; SEQ ID NO: 12 or 13 aa737-a
a744; aa738 to aa745 of SEQ ID NO: 12 or 13;
Or 13 aa739-aa746; SEQ ID NO: 12 or 13 aa740-a
a747; aa741-aa748 of SEQ ID NO: 12 or 13;
Or 13 aa742-aa749; SEQ ID NO: 12 or 13 aa743-a
a750; aa744 to aa751 of SEQ ID NO: 12 or 13;
Or 13 aa 745-aa 752; SEQ ID NO: 12 or 13 aa 746-a
a753; aa747 to aa754 of SEQ ID NO: 12 or 13;
Or 13 aa748-aa755; SEQ ID NO: 12 or 13 aa749-a
a756; aa750-aa757 of SEQ ID NO: 12 or 13;
Or 13 aa751-aa758; SEQ ID NO: 12 or 13 aa752-a
a759; aa753-aa760 of SEQ ID NO: 12 or 13;
Or 13 aa754-aa761; SEQ ID NO: 12 or 13 aa755-a
a762; aa756 to aa763 of SEQ ID NO: 12 or 13;
Or aa 758 to aa 764 of SEQ ID NO: 12 or 13
a765; aa759 to aa766 of SEQ ID NO: 12 or 13;
Or 13 aa 760 to aa 767; SEQ ID NO: 12 or 13
a768; aa762 to aa769 of SEQ ID NO: 12 or 13;
Or 13 aa763-aa770; SEQ ID NO: 12 or 13 aa764-aa
a771; aa765 to aa772 of SEQ ID NO: 12 or 13;
Or 13 aa766-aa773; SEQ ID NO: 12 or 13 aa767-a
a774; aa768 to aa775 of SEQ ID NO: 12 or 13;
Or 13 aa770 to aa776; SEQ ID NO: 12 or 13 aa770 to aa776
a777; aa771 to aa778 of SEQ ID NO: 12 or 13;
Or 13 aa772-aa779; SEQ ID NO: 12 or 13 aa773-a
a780; SEQ ID NO: 12 or 13; an774 to aa781;
Or 13 aa775-aa782; SEQ ID NO: 12 or 13 aa776-a
a783; aa777 to aa784 of SEQ ID NO: 12 or 13;
Or 13 aa778-aa784; SEQ ID NO: 12 or 13 aa779-a
a786; aa780 to aa787 of SEQ ID NO: 12 or 13;
Or 13 aa781-aa788; SEQ ID NO: 12 or 13 aa782-a
a789; aa783-aa790 of SEQ ID NO: 12 or 13;
Or 13 aa784-aa791; SEQ ID NO: 12 or 13 aa785-a
a792: aa786 to aa793 of SEQ ID NO: 12 or 13;
Or 13 aa787-aa794; SEQ ID NO: 12 or 13 aa788-a
a795; aa789 to aa796 of SEQ ID NO: 12 or 13;
Or 13 aa790-aa797; SEQ ID NO: 12 or 13 aa791-a
a798; aa792 to aa799 of SEQ ID NO: 12 or 13;
Or 13 aa793-aa800; SEQ ID NO: 12 or 13 aa794-a
a801; aa795 to aa802 of SEQ ID NO: 12 or 13;
Or 13 aa796-aa803; SEQ ID NO: 12 or 13 aa797-a
a804; aa798 to aa805 of SEQ ID NO: 12 or 13;
Or 13 aa799-aa806; SEQ ID NO: 12 or 13 aa800-a
a807; aa801 to aa808 of SEQ ID NO: 12 or 13;
Or 13 aa802-aa809; SEQ ID NO: 12 or 13 aa803-a
a810: aa804 to aa811 of SEQ ID NO: 12 or 13;
Or 13 aa805-aa812; aa806-a of SEQ ID NO: 12 or 13
a813; aa807 to aa814 of SEQ ID NO: 12 or 13;
Or 13 aa808-aa815; SEQ ID NO: 12 or 13 aa809-a
a816; aa810 to aa817 of SEQ ID NO: 12 or 13;
Or 13 aa811-aa818; SEQ ID NO: 12 or 13 aa812-a
a819; aa813 to aa820 of SEQ ID NO: 12 or 13;
Or 13 aa814-aa821; aa815-a of SEQ ID NO: 12 or 13
a822; aa816 to aa823 of SEQ ID NO: 12 or 13;
Or 13 aa817-aa824; SEQ ID NO: 12 or 13 aa818-a
a825; aa819 to aa826 of SEQ ID NO: 12 or 13;
Or 13 aa820 to aa827; SEQ ID NO: 12 or 13 aa821 to aa821
a828; aa822 to aa829 of SEQ ID NO: 12 or 13;
Or 13 aa823-aa830; SEQ ID NO: 12 or 13 aa824-a
a831; aa825 to aa832 of SEQ ID NO: 12 or 13;
Or 13 aa826-aa833; SEQ ID NO: 12 or 13 aa827-a
a834; aa828 to aa835 of SEQ ID NO: 12 or 13;
Or 13 aa829 to aa836; SEQ ID NO: 12 or 13 aa830 to aa830
a837; aa831 to aa838 of SEQ ID NO: 12 or 13;
Or 13 aa832-aa839; SEQ ID NO: 12 or 13 aa833-a
a840; aa834 to aa841 of SEQ ID NO: 12 or 13;
Or 13 aa835-aa842; SEQ ID NO: 12 or 13 aa836-a
a843; aa837 to aa844 of SEQ ID NO: 12 or 13;
Or 13 aa838-aa845; SEQ ID NO: 12 or 13 aa839-a
a846; aa840 to aa847 of SEQ ID NO: 12 or 13;
Or 13 aa841-aa848; SEQ ID NO: 12 or 13 aa842-a
a849; aa843-aa850 of SEQ ID NO: 12 or 13;
Or 13 aa844 to aa851; SEQ ID NO: 12 or 13 aa845 to aa845
a852; aa846 to aa853 of SEQ ID NO: 12 or 13;
Or 13 aa847-aa854; SEQ ID NO: 12 or 13 aa848-a
a855; aa849 to aa856 of SEQ ID NO: 12 or 13;
Or 13 aa850 to aa857; SEQ ID NO: 12 or 13
a858; aa852 to aa859 of SEQ ID NO: 12 or 13;
Or 13 aa853-aa860; SEQ ID NO: 12 or 13 aa854-a
a861; an855 to aa862 of SEQ ID NO: 12 or 13;
Or 13 aa856-aa863; SEQ ID NO: 12 or 13 aa857-a
a864; aa858 to aa865 of SEQ ID NO: 12 or 13;
Or 13 aa859-aa866; SEQ ID NO: 12 or 13 aa860-a
a867; aa861 to aa868 of SEQ ID NO: 12 or 13;
Or 13 aa862-aa869; SEQ ID NO: 12 or 13 aa863-aa
a870; aa864 to aa871 of SEQ ID NO: 12 or 13;
Or 13 aa865-aa872; SEQ ID NO: 12 or 13 aa866-a
a873; aa867 to aa874 of SEQ ID NO: 12 or 13;
Or 13 aa868-aa875; SEQ ID NO: 12 or 13 aa869-a
a876; aa870 to aa877 of SEQ ID NO: 12 or 13;
Or 13 aa871-aa878; SEQ ID NO: 12 or 13 aa872-a
a879; aa873 to aa880 of SEQ ID NO: 12 or 13;
Or 13 aa874-aa881; SEQ ID NO: 12 or 13 aa875-a
a882; aa876 to aa883 of SEQ ID NO: 12 or 13;
Or 13 aa877-aa884; SEQ ID NO: 12 or 13 aa878-a
a884; aa879 to aa886 of SEQ ID NO: 12 or 13;
Or 13 aa880-aa887; SEQ ID NO: 12 or 13 aa881-a
a888; aa882 to aa889 of SEQ ID NO: 12 or 13;
Or 13 aa883-aa890; SEQ ID NO: 12 or 13 aa884-a
a891; aa885 to aa892 of SEQ ID NO: 12 or 13;
Or 13 aa886-aa893; SEQ ID NO: 12 or 13 aa887-a
a894: aa888 to aa895 of SEQ ID NO: 12 or 13;
Or 13 aa889 to aa896; SEQ ID NO: 12 or 13 aa890 to aa896
a897; aa891 to aa898 of SEQ ID NO: 12 or 13;
Or 13 aa892-aa899; SEQ ID NO: 12 or 13 aa893-a
a900; aa894 to aa901 of SEQ ID NO: 12 or 13;
Or 13 aa895-aa902; SEQ ID NO: 12 or 13 aa896-a
a903; aa897 to aa904 of SEQ ID NO: 12 or 13;
Or 13 aa898-aa905; SEQ ID NO: 12 or 13 aa899-a
a906; aa900 to aa907 of SEQ ID NO: 12 or 13;
Or 13 aa901 to aa908; SEQ ID NO: 12 or 13 aa902 to aa908
a909; aa903 to aa910 of SEQ ID NO: 12 or 13;
Or 13 aa904 to aa911; SEQ ID NO: 12 or 13 aa905 to aa911
a912; aa906 to aa913 of SEQ ID NO: 12 or 13;
Or 13 aa907-aa914; SEQ ID NO: 12 or 13 aa908-a
a915; aa909 to aa916 of SEQ ID NO: 12 or 13;
Or 13 aa910-aa917; SEQ ID NO: 12 or 13 aa911-a
a918; aa912 to aa919 of SEQ ID NO: 12 or 13;
Or 13 aa913-aa920; SEQ ID NO: 12 or 13 aa914-a
a921; aa915 to aa922 of SEQ ID NO: 12 or 13;
Or 13 aa916-aa923; SEQ ID NO: 12 or 13 aa917-a
a924; aa918 to aa925 of SEQ ID NO: 12 or 13;
Or 13 aa919-aa926; SEQ ID NO: 12 or 13 aa920-a
a927; aa921 to aa928 of SEQ ID NO: 12 or 13;
Or 13 aa922-aa929; SEQ ID NO: 12 or 13 aa923-a
a930; aa924 to aa931 of SEQ ID NO: 12 or 13;
Or 13 aa925 to aa932; SEQ ID NO: 12 or 13 aa926 to aa926
a933; aa927 to aa934 of SEQ ID NO: 12 or 13;
Or 13 aa929-aa935; SEQ ID NO: 12 or 13 aa929-a
a936; aa930 to aa937 of SEQ ID NO: 12 or 13;
Or 13 aa931-aa938; SEQ ID NO: 12 or 13 aa932-a
a939: aa933 to aa940 of SEQ ID NO: 12 or 13;
Or 13 aa934-aa941; SEQ ID NO: 12 or 13 aa935-a
a942; aa936 to aa943 of SEQ ID NO: 12 or 13;
Or 13 aa937-aa944; SEQ ID NO: 12 or 13 aa938-a
a945; aa939 to aa946 of SEQ ID NO: 12 or 13;
Or 13 aa940 to aa947; SEQ ID NO: 12 or 13 aa941 to aa947
a948; aa942 to aa949 of SEQ ID NO: 12 or 13;
Or 13 aa943-aa950; SEQ ID NO: 12 or 13 aa944-a
a951; aa945 to aa952 of SEQ ID NO: 12 or 13;
Or 13 aa946-aa953; SEQ ID NO: 12 or 13 aa947-a
a954; aa948 to aa955 of SEQ ID NO: 12 or 13;
Or 13 aa949-aa956; SEQ ID NO: 12 or 13 aa950-a
a957; aa951 to aa958 of SEQ ID NO: 12 or 13;
Or 13 aa952-aa959; SEQ ID NO: 12 or 13 aa953-aa
a960; aa954 to aa961 of SEQ ID NO: 12 or 13;
Or 13 aa 955-aa 962; SEQ ID NO: 12 or 13 aa 956-a
a963; aa957 to aa964 of SEQ ID NO: 12 or 13;
Or 13 aa958-aa965; SEQ ID NO: 12 or 13 aa959-a
a966; aa960 to aa967 of SEQ ID NO: 12 or 13;
Or 13 aa961-aa968; SEQ ID NO: 12 or 13 aa962-a
a969; aa963-aa970 of SEQ ID NO: 12 or 13;
Or 13 aa964 to aa971; SEQ ID NO: 12 or 13 aa965 to aa965
a976; aa966 to aa973 of SEQ ID NO: 12 or 13;
Or 13 aa968 to aa974; SEQ ID NO: 12 or 13 aa968 to aa974
a975; aa969 to aa976 of SEQ ID NO: 12 or 13;
Or 13 aa 970-aa 977; SEQ ID NO: 12 or 13 aa 971-a
a978; aa972 to aa979 of SEQ ID NO: 12 or 13;
Or 13 aa973-aa980; SEQ ID NO: 12 or 13 aa974-a
a981; aa975 to aa982 of SEQ ID NO: 12 or 13;
Or 13 aa976-aa983; SEQ ID NO: 12 or 13 aa977-a
a984; aa978 to aa984 of SEQ ID NO: 12 or 13;
Or 13 aa979 to aa986; SEQ ID NO: 12 or 13 aa980 to aa980
a987; aa981 to aa988 of SEQ ID NO: 12 or 13;
Or 13 aa982-aa989; SEQ ID NO: 12 or 13 aa983-a
a990; aa984 to aa991 of SEQ ID NO: 12 or 13;
Or aa985-aa992 of SEQ ID NO: 12 or 13
a993; aa987 to aa994 of SEQ ID NO: 12 or 13;
Or 13 aa988-aa995; SEQ ID NO: 12 or 13 aa989-a
a996; aa990 to aa997 of SEQ ID NO: 12 or 13;
Or 13 aa991-aa998; SEQ ID NO: 12 or 13 aa992-a
a999; aa993-aa1000 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa994 to aa1001; SEQ ID NO: 12 or 13 aa995
To aa1002; aa996 to aa1003 of SEQ ID NO: 12 or 13;
No. 12 or 13 aa997 to aa1004; SEQ ID NO. 12 or 13 aa
998 to aa1005; aa999 to aa1006 of SEQ ID NO: 12 or 13;
Aa1000 to aa1007 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 1
Aa1001 to aa1008 of 3; aa1002 to aa of SEQ ID NO: 12 or 13
a1009; aa1003 to aa1010 of SEQ ID NO: 12 or 13;
12 or 13 aa1004 to aa1011; SEQ ID NO: 12 or 13 aa
1005 to aa1012; aa1006 to aa101 of SEQ ID NO: 12 or 13
3; aa1007 to aa1014 of SEQ ID NO: 12 or 13;
Is aa1008 to aa1015 of 13; aa1009 of SEQ ID NO: 12 or 13
~ Aa1016; aa1010 to aa1017 of SEQ ID NO: 12 or 13; sequence
Aa1011 to aa1018 of SEQ ID NO: 12 or 13;
aa1012 to aa1019; aa1013 to aa1 of SEQ ID NO: 12 or 13
020; aa1014 to aa1021 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa1015 to aa1022; SEQ ID NO: 12 or 13 aa10
16 to aa1023; aa1017 to aa1024 of SEQ ID NO: 12 or 13;
Aa1018 to aa1025 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 1
Aa1019 to aa1026 of 3; aa1020 to aa of SEQ ID NO: 12 or 13
a1027; aa1021 to aa1028 of SEQ ID NO: 12 or 13; SEQ ID NO:
12 or 13 aa1022 to aa1029; SEQ ID NO: 12 or 13 aa
1023 to aa1030; aa1024 to aa103 of SEQ ID NO: 12 or 13
1; aa1025 to aa1032 of SEQ ID NO: 12 or 13;
Is aa1026 to aa1033 of 13; aa1027 of SEQ ID NO: 12 or 13
To aa1034; aa1028 to aa1035 of SEQ ID NO: 12 or 13; sequence
Aa1029 to aa1036 of SEQ ID NO: 12 or 13;
aa1030 to aa1037; aa1031 to aa1 of SEQ ID NO: 12 or 13
038; aa1032-aa1039 of SEQ ID NO: 12 or 13; SEQ ID NO: 12
Or 13 aa1033-aa1040; SEQ ID NO: 12 or 13 aa10
34 to aa1041; aa1035 to aa1042 of SEQ ID NO: 12 or 13;
Aa1036 to aa1043 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 1
3 aa1037 to aa1044; SEQ ID NO: 12 or 13 aa1038 to aa
a1045; aa1039 to aa1046 of SEQ ID NO: 12 or 13; SEQ ID NO:
12 or 13 aa1040 to aa1047; SEQ ID NO: 12 or 13 aa
1041 to aa1048; aa1042 to aa104 of SEQ ID NO: 12 or 13
9; aa1043 to aa1050 of SEQ ID NO: 12 or 13;
Is aa1044 to aa1051 of 13; aa1045 of SEQ ID NO: 12 or 13
~ Aa1052; aa1046 to aa1053 of SEQ ID NO: 12 or 13; sequence
Aa1047 to aa1054 of SEQ ID NO: 12 or 13; aa104 of SEQ ID NO: 13
8 to aa1055; aa1049 to aa1056 of SEQ ID NO: 13; SEQ ID NO: 13
Aa1050 to aa1057; SEQ ID NO: 13 aa1051 to aa1058;
Aa1052 to aa1059 of SEQ ID NO: 13; aa1053 to aa of SEQ ID NO: 13
a1060; aa1054 to aa1061 of SEQ ID NO: 13; aa of SEQ ID NO: 13
1055 to aa1062; aa1056 to aa1063 of SEQ ID NO: 13;
No. 13 aa1057 to aa1064; SEQ ID NO: 13 aa1058 to aa10
65; aa1059 to aa1066 of SEQ ID NO: 13; aa106 of SEQ ID NO: 13
0 to aa1067; aa1061 to aa1068 of SEQ ID NO: 13; SEQ ID NO: 13
Aa1062 to aa1069; SEQ ID NO: 13 aa1063 to aa1070;
Aa1064 to aa1071 of SEQ ID NO: 13;
a1072; aa1066 to aa1073 of SEQ ID NO: 13; aa of SEQ ID NO: 13
1067 to aa1074; aa1068 to aa1075 of SEQ ID NO: 13; SEQ ID NO:
No. 13 aa1069 to aa1076; SEQ ID NO: 13 aa1070 to aa10
77; and aa1071 to aa1078 of SEQ ID NO: 13. Fragment
The coding sequence is derived from the mutant or native TIAM2 protein coding sequence.
It can be constructed by cutting unnecessary nucleotides.

[0084] Fusions are fragments, variants, or native TIAM2 proteins having additional amino acids at either or both termini. The additional amino acid sequence is generally not homologous to the sequence found in the native TIAM2 polypeptide. Additional amino acid residues can, for example, enhance expression, detection, or activity of the polypeptide. Additional amino acid sequences can also be used as linkers for constructing multimers of the TIAM2 protein. All fusion polypeptides will exhibit the desired sequence homology, immunological activity, or biological activity.
Recombinant TIAM2 fusion proteins can be produced using the preferred cell line, baculovirus.

After inserting the TIAM2 DNA sequence into the transfer vector, the vector and the genome of the wild-type virus are transfected into insect host cells. here,
The vector and the viral genome are recombined. The packaged recombinant virus is expressed, and the recombinant plaque is identified and purified. Materials and methods for baculovirus / insect cell expression systems are described, inter alia, in Invi.
It is commercially available in kit form from trogen, San Diego CA ("MaxBac" kit). These techniques are generally known to those skilled in the art, and are discussed in Summers and Smith, Texas Agricultur.
al Experiment Station Bulletin No. Fifteen
55 (1987).

Prior to insertion of the DNA sequence encoding the protein into the baculovirus genome, the above-described components, including the promoter, leader (if desired), coding sequence of interest, and transcription termination sequence, are , Usually assembled into an intermediate construct (transfer vector).

[0087] The currently most commonly used transfer vector for introducing foreign genes into AcNPV is pAc373. Many other vectors (known in the art) have also been designed. These include, for example, pVL985. This has changed the polyhedrin start codon from ATG to ATT and introduced a BamHI cloning site 32 base pairs downstream of ATT; Lu.
See cow and Summers, Virology 17:31 (1989).

Plasmids also usually contain a polyhedron polyadenylation signal (Mill
er et al., Ann. Rev .. Microbiol. , 42: 177 (1988)).
And the prokaryotic ampicillin resistance (amp) gene; Contains an origin of replication for selection and propagation in E. coli.

[0089] Baculovirus transfer vectors usually contain a baculovirus promoter. Promoters usually have a transcription initiation region, located proximal to the 5 'end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site. Baculovirus transfer vectors may also have a second domain called an enhancer. This, if present, is usually distal to the structural gene. Expression can be either regulated or constitutive.

Structural genes that are abundantly transcribed late in the viral infection cycle provide particularly useful promoter sequences. Examples include the gene encoding the polyhedron protein of the virus (Friesen et al. (1986) "The Reg"
ulation of Baculovirus Gene Expressi
on ": The Molecular Biology of Baculov
irus (edited by Walter Doerfler); EPO Publication Nos. 127839 and 155476; and sequences derived from the gene encoding the p10 protein (Vlak et al., J. Gen. Virol. 69: 765 (1988)). Can be

The DNA encoding the appropriate signal sequence may be a secreted insect or baculovirus protein (eg, the baculovirus polyhedrin gene (Car
Bonell et al., Gene, 73: 409 (1988)). Alternatively, post-translational modifications of mammalian cells (eg, signal peptide cleavage,
Proteolytic cleavage, and phosphorylation) are likely to be recognized by insect cells, and the signals and nuclear accumulation required for secretion are also conserved between invertebrate and vertebrate cells. It seems to be. Leaders of non-insect origin (eg, those derived from the gene encoding human α-interferon, Maeda et al., Nature 315: 592 (1985)); those derived from the gene encoding the human gastrin-releasing peptide, Lebacq -V
erheyden et al., Molec. Cell. Biol. 8: 3129 (198
8); Human IL-2, Smith et al., Proc. Natl. Acad. Sci.
USA 82: 8404 (1985); derived from the gene encoding mouse IL-3 (Miyajima et al., Gene 58: 273 (1987); and derived from the gene encoding human glucocerebrosidase). Martin et al., DNA 7:99 (198
8)) can also be used to provide secretion in insects.

After insertion of the DNA sequence and / or the gene encoding the precursor of the protein expression product, the insect cell host can use the heterologous DNA of the transfer vector and the genomic DNA of the wild-type baculovirus, generally by co-transfection. By co-transformation. Methods for introducing heterologous DNA into a desired site of a baculovirus are known in the art (Summers and Smith; Ju et al. (1987); Smith et al., Mol. Cell. Biol. 3: 2156 (1).
983); and Luckow and Summers (1989)). For example, the insertion may be in a gene such as the polyhedrin gene by homologous double crossover recombination; the insertion may also be in a restriction enzyme site engineered into the desired baculovirus gene. Miller et al., Bioessays 4
: 91 (1989).

[0093] The newly formed baculovirus expression vector is then packaged into an infectious recombinant baculovirus. Methods for identifying recombinant viruses are described in Current Protocols in Microbiology.
Vol. 2 (edited by Ausubel et al.), 16.8 (supplement 10, 1990);
ers and Smith; Miller et al. (1989).

[0094] Recombinant baculovirus expression vectors have been developed for infection into several insect cells. For example, recombinant baculoviruses have been developed, inter alia, for: Aedes aegypti, Autographac.
Alifornica, Bombyx mori, Drosophila me
lanogaster, Spodoptera frugiperda, and Trichoplusia ni (PCT International Publication No. WO 89/046699)
Carbonell et al., J .; Virol. 56: 153 (1985); Wri
gh Nature 321: 718 (1986); Smith et al., Mol.
Cell. Biol. 3: 2156 (1983); and, generally, Fras
er et al., In Vitro Cell Dev. Biol. 25: 225 (19
89)).

The TIAM2 protein can be used in assays for inhibitors and for preparing antibodies directed against TIAM2. TIAM
The two proteins may also be useful as factors that promote the growth of cancer cells in culture. A TIAM2 protein can be combined with the pharmaceutically acceptable carriers described above for use with a TIAM2 antisense molecule.

The present invention is described herein with reference to the following examples, which show particularly advantageous embodiments. However, it should be noted that the following examples illustrate these embodiments and are not to be construed as limiting the invention in any manner.

EXAMPLES Example 1 Identification of the TIAM2 Gene In a screening based on degenerate PCR of a new gene, a single 377 nucleotide clone (DP-75) was identified. It had high homology to the mouse and human TIAM1 genes. Due to its similarity to TIAM1, this novel gene and its putative protein product have been named T-cell lymphoma invasion and metastasis 2 (TIAM2).

[0098] Northern analysis with the DP-75 probe showed about 3.3 kb transcripts in the cerebral cortex, occipital pole, frontal and temporal lobes, and about 4.4 in the testis and cerebellum.
A transcript of kb was revealed (FIGS. 1A and 1B). Duplicate clones were isolated by screening a cDNA library and RACE cloning and followed the full-length sequence showing a message of about 4.4 kb and about 3.3 kb, respectively. To perform a Northern analysis, a Human Multiple T
issue Northern Blots (Clontech), Speed
Hybridized at 65 ° C. with a DP75 probe in Hyb solution (BIOS lab). The blot is washed twice with 0.5 × SSC, 0.5% SDS for 10 minutes at room temperature, and 65 ° C. in 0.1 × SSC, 0.5% SDS.
For 1 hour.

The cDNA according to the approximately 4.4 kb message is 4586 nucleotides in length, without polyadenylation, and is predicted to encode a 1077 amino acid long form of the TIAM2 protein (TIAM2 _L ). The first ATG is at nucleotide position 51 and is in good position for translation. Alignment of the putative protein to TIAM1 (FIG. 3) shows significant identity starting at the first methionine of TIAM2 and the methionine at position 576 of TIAM2,
This region corresponds to the last 14 amino acids of the coiled-coil domain of TIAM1 (aa548-590). This identity is consistent with amino acids 59 of human TIAM1.
Continue from 9 to the EX domain extending to amino acid 691. TIAM1 / TIAM
Comparison of the 2 _L EX domains shows an overall 62% identity, but 85% identity in the 60 aa subdomain. Alternative splicing of the 72 nucleotide miniexon following the EX domain leads to the presence or absence of a 24 amino acid sequence with no significant identity to the TIAM1 or SIF sequence. Behind the alternatively spliced region is a sequence with weak identity (18%) to TIAM1, which contains conserved residues in the PDZ or DHR domains (Michels et al., Nature 375). : 33
8-340, 1995). The remaining sequence contains identity to the DH catalytic domain (
70%) and the identity to the carboxy-terminal PH domain (54%).

The sequence following the approximately 3.3 kb message is 3344 nucleotides long and is predicted to encode the short form of TIAM2 (TIAM _S ) (626aa). The about 3.3 kb message differs from the about 4.4 kb message in that the first 104 nucleotides are unique. This suggests that the approximately 3.3 kb message results from initiation at a promoter different from the promoter of the approximately 4.4 kb message. The starting methionine at position 162 is 4.
Consistent with a methionine at amino acid 428 of the 4 kb TIAM2 putative protein,
And the remaining protein, showing complete identity and TIAM2 _L. Similar to that found in the TIAM1 gene (Havets et al., Cell 77: 537-549, 1994), there are two upstream ATGs in the approximately 3.3 kb message;
These precede the long open reading frame (nucleotide 162) and only the start codon at nucleotide 162 is in good position for translation. TIA
Comparison with M shows that TIAM2 _S starts just upstream (24 aa) of the DH domain.

Only long TIAM2 transcripts were identified by Northern analysis using probes isolated from the 5 ′ end of the approximately 4.4 kb message (FIG. 1C), while TIAM
Both transcripts were identified by a probe isolated from the 3 'end of 2 (FIG. 1D).
.

An irradiation hybrid mapping experiment was performed as follows. TIAM2-specific oligo AGTCCTACCTCATCAAGCCG (SEQ ID NO: (SEQ ID NO:
NO) 14) and TTAGTGCTTCCGTCAGGTGGG (SEQ ID NO: 15)
) And G3 panels (Research) according to the manufacturer's instructions.
Genetics). The resulting PCR product was analyzed by gel electrophoresis, and the resulting data was analyzed by Stewart and Cox, "Gen
Ome Mapping: A Practical Approach "(P.
Dear et al., Pp. 73-93, Oxford Univ. Press. Oxfo
rd, 1997. Two-point maximum possibility (two-point
maximum-likelihood analysis showed that the marker was associated with D6S1556 (6q25) with a rod score of 100.

Example 2 In Situ Hybridization Nucleotides 566-586 (A of human 3.3 kb TIAM2 cDNA
GTACAGAGGTTCTGGGAGCG) and nucleotide 134
Oligos designed from 8-1367 (TACCAGGCGATCCTTTACACG) were used to perform PCR on mouse brain cDNA (Clonetech). 30 cycles of PC performed using an annealing temperature of 40 ° C.
R led to the production of a product (MDP75) of the expected length (802 nt). Cloning and sequencing confirmed that MDP75 was 90% identical to human TIAM2 over the entire length of the clone. Mouse embryos (CD-1) were used for in-situ hybridization of whole-mount RNA by Nieto et al., Methods.
in Avian Embryology "(M. Bronner-Fras
ed.), Academic Press. Processing was performed according to the protocol of San Diego (1995). Adult brain sections were processed using the protocol for frozen sections as described (Schaeren-Wieme).
rs and Gerfin-Moser, Histochemistry 100
: 431-440 (1993)).

TIAM2 mRNA in embryo 13.5 days (E13.5) and adult mouse brain
Was tested by in situ hybridization using a riboprobe labeled with digoxigenin. Discrete and reproducible labels were observed at both ages using antisense probes; no labels were detected with sense probes. The cellular localization of TIAM2 transcripts in both E13.5 and adult brain is consistent with TIAM2 expression in neuronal rather than glial cells. At E13.5, TIAM2 transcripts are present throughout the telencephalon (FIG. 2A). Sections of the collateral plane throughout the telencephalon demonstrate that expression is localized to the buffy coat surface where early-onset post-mitotic neurons are localized (
(FIG. 2B). TIAM2 is not expressed in proliferating neural progenitor cells along the ventricles.

In the adult mouse brain, TIAM2 continues to be expressed primarily in regions derived from telencephalon (FIGS. 2C-2G, Table 1). The regions of strong expression include the olfactory bulb,
Includes cerebral cortex, caudate putamen, and hippocampus. Expression in the hippocampus is highly specific in cells of the dentate gyrus and regions derived therefrom, the gray sheath and gray zone; and pyramidal cells (py) in one subregion of the CA region (CA2).
radial cells) are very strongly labeled, whereas CA1 and CA3 show very little expression. TIAM2 is also strongly expressed in ependymal cells on the lateral surface of the lateral ventricle (FIG. 2D). This region is the region of the embryo where neurons are generated throughout the life of an adult. Most of the neurons generated in this area
It is thought to move to the olfactory bulb.

[0106]

[Table 1] (Example 3: GDP-GTP exchange activity) Amino-terminal HIS-tagged version of 3.3 kb TIAMs protein (
His-TIAM2) was expressed in the baculovirus system. Molecular weight (
The protein of 75.661 Da) was partially purified on a nickel column and the identity of the protein was confirmed by amino-terminal sequencing and mass spectrometry. H
To generate an is-tagged TIAM2s expression construct, a linker-adapter was generated to add an EcoRI site to the first 29 bp 5 ′ end of the TIAM2s sequence (GAATTCATGGGAAGGACCGCGGGA-GAATCA).
GGATCC). This phosphorylated linker / adapter terminating at the BamHI site (bases 23-29 of the TIAM2 sequence) was replaced with the cDNA clone DP-7 linearized by the BamHI fragment, containing the entire coding region of TIAM2s.
5 # 1. Subsequent SalI digestion released an approximately 2000 bp EcoRI-SalI fragment containing the entire coding region of TIAM2s. This fragment was isolated, purified, and EcoRI-SalI digested pBlueBa
Ligation into the cHis2B vector (Invitrogen). The resulting clone (pHIS-TIAM2s) was confirmed by sequence analysis.

[0107] pHIS-TIAM2s was introduced into SF9 cells and high levels of pHIS
Clones expressing -TIAM2s were identified by Western blot. After clonal expansion, pHIS-TIAM2s expressing cells were concentrated, lysed, and applied to a nickel column (Invitrogen). pHIS-TIAM2
s protein was directly washed after 50 mM imidazole washing with 500 mM
Was purified from the column according to the manufacturer's recommendations except that it was eluted directly in imidazole. The fraction containing pHIS-TIAM2s was centrifuged to Centricon (Am
icon) 30 column and concentrated by centrifugation at 5000 g for 30 minutes.

[0108] His-TIAM2s can be converted to GDP-G using Rac or Ras proteins.
It was tested for its ability to stimulate TP exchange activity and SOS (known Ras
GEF (Jefferson et al., Oncogene 16: 2303-231).
0, 1998)). In these experiments (FIG. 4), the immunoprecipitated Rac or Ras protein was pre-loaded with GDP and either in [ ³² P] GTP containing buffer alone or in His-TIAM2s or purified SOS.
Were incubated in a buffer containing either In several experiments, His
-TIAM2s shows approximately 5 times higher Rac at 30 minutes compared to buffer alone.
SOS showed at most mild stimulation (× 1.6), while showing stimulation of exchange activity (FIG. 4A). Conversely, when His-TIAM2s and SOS were incubated with RAS, SOS showed a 4-5 fold stimulation of exchange activity, while His-T
IAM2s had little or no effect (FIG. 4B).

Example 4 Use of Polynucleotides for Diagnosis of Cancer In a dot blot analysis, TIAM2 hybridized with RNA from both cancerous and normal tissues. Sources of cancerous tissue include kidney, thyroid, breast, colon, ureter, lung, nose, stomach, esophagus, liver, lymphoma, uterus, bladder, rectum and brain.

[0110] Blots were obtained from BioChain Institute, Inc. , San L
Eandro, California, USA. ExpressH
yb ^™ hybridization buffer (Clontech, Palo Alto)
, California, USA) at 1 × 10 ⁶ cpm / ml for 2 hours with TI
Used for blotting at 68 ° C. with AM2 (SEQ ID NO: 1).

As shown in FIG. 5, in four of the four thyroid samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissues than in normal tissues. In two of the four colon samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissues than in normal tissues. In one of the two ureter samples, the mRNA level of SEQ ID NO: 1 (TIAM2) was higher in cancer tissues than in normal tissues. In one of the four breast samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissues than in normal tissues. In one of the four kidney samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissues than in normal tissues.
In all other tested tissue types, the mRNA level of SEQ ID NO: 1 was identical or higher in normal samples than in cancer samples.

[0112]

Embedded image (Example 5: Isolation of SEQ ID NO: 6) SEQ ID NO: 6 was converted to a phage vector (Stratagene, La Jolla).
, California, USA). This library was probed with SEQ ID NO: 1 generated by random prime labeling with a final radioactivity count of about 1 × 10 ⁶ cpm / ml. This probe is used in a RediPrime ^™ DNA labeling kit (Amers
ham, Arlington Heights, Illinois, USA) according to the manufacturer's instructions.

The phage library is expanded and 3.0-5.0 according to the manufacturer's instructions.
Plated on 20 plates at × 10 ⁵ plaques / plate. The plaque was transferred to a nitrocellulose membrane. Clontech each membrane
2 hours 6 purchased from (Palo Alto, California, USA)
Incubated with the SEQ ID NO: 1 probe in ExpressHyb ^™ hybridization solution at 5 ° C. The filters were washed according to Clontech instructions. The film was exposed to the membrane to identify putative positive plaques containing the desired TIAM2 polynucleotide.

[0114] A second round of plating and hybridization was performed to identify a single positive plaque. The first positive plaque was expanded and Strata
Plated on agar medium according to instructions provided by gene. The plaque was transferred to the filter. These filters were incubated with the SEQ ID NO: 1 probe. Probe and hybridization conditions were the same as above. Positive plaques were identified and expanded.

[0115] BlueScript plasmid was recovered from the phage vector according to the manufacturer's instructions. The EcoRI insert from the plasmid was sequenced. The polynucleotide sequence is shown in SEQ ID NO: 6.

The present invention has been described with reference to specific embodiments. However, it is intended that this application include changes and substitutions that can be made by those skilled in the art without departing from the spirit and scope of the appended claims.

(Deposit Information) The following materials were purchased from the American Type Culture Collec
deposited with Tion.

[0118]

[Table 2] The above materials are available from American Type Culture Collec.
deposit (Manassas, Virginia) under the indicated accession number. This deposit is maintained under the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Patent Procedure. This deposit will be maintained for a period of thirty years after issuance of this patent, or for the effective period of this patent, whichever is longer. Upon issuance of the patent, this deposit will be made available to the public without restriction from the ATCC.

[0119] These deposits are provided solely for the confirmation of those skilled in the art, and the deposits are 35 U.S.C. S. C. It is not an admission that it is required under section 112.
The polynucleotide sequence contained in the deposited material, as well as the amino acid sequence of the polypeptide encoded by the polynucleotide, is incorporated herein by reference and in case of any inconsistency with the sequences described herein. Also, priority is given to A license may be required for the production, use, or sale of the deposited material, but such license is not provided herein.

[Sequence list]

[Brief description of the drawings]

FIG. 1. Human brain (A) and tissue-specific (B) blots containing 2 μg / lane of poly (A) ⁻ mRNA show both long (TIAM _L ) and short (TIAM _S ) forms of TIAM2. Hybridized with a TIAM-specific probe that recognizes Upon brain-specific Northern, probes from the 5 'end of the 4.4-Kb message hybridized only to the long form (C), while the 3'-specific probe showed both long and short forms. Hybridized (D).

FIG. 2 shows the expression of TIAM2 and mRNA in mouse brain. (A) E13
. 5 Total amount of fetal brain. TIAM2 transcripts are expressed throughout the developing telencephalon (T). (B) Parasagittal section through the E13.5 telencephalon, demonstrating that TIAM2 mRNA is located in cells near the buffy coat (P) surface;
) Was not seen near. (C) Coronal transection through the adult mouse forebrain. TIAM2
The transcript is strongly labeled in the epithelium (small arrow) and gray layer (arrow),
It is localized in the cerebral cortex (Ctx) and caudate putamen (CP). (D) corpus callosum (CC
Display of higher magnification of labeling in the epithelium (arrowhead) lining the lateral ventricle (LV) below). (E) TIAM2 transcription in the olfactory bulb, glomerular layer (arrowhead), mitral cell layer (arrow). (F) Coronal section demonstrating labeling in the thalamus (arrowhead) and gray small bundles (arrow). (G) Hippocampal expression of TIAM2 showing expression in granule cells of the dentate gyrus (DG) and pyramidal cells of CA2.

Figure 3 shows a comparison of the TIAM2 _L amino acid sequence TIAM1 protein amino acid sequence of the carboxy terminus of the (amino acids 576-1591). The EX domain, alternative splice regions, DHR domain, DH domain and PH domain are underlined, and the starting methionine of TIAM2 _S (amino acid 452) is in bold and indicated by an arrow.

FIG. 4 shows the results of a GDP-GTP exchange assay. Incompletely purified His
-TIAM2 _S protein is immunoprecipitated Rac (A) protein or Ra
The s (B) protein was assayed for its ability to stimulate GDP-GTP exchange activity. (A) Average of three separate reactions where Rac was incubated with [ ³² P] GTP in the presence of His-TIAM2 _S (◇), SOS (○), or buffer alone (□). (B) Representative experiments in which Ras was incubated with [ ³² P] GTP in the presence of TIAM2 _S (●), SOS (▲), or buffer alone (×).

FIG. 5 shows the expression of TIAM2 mRNA in tumor and normal tissues.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 1/15 C12N 1/19 4H045 1/19 1/21 1/21 C12P 21/02 C 5/10 C12Q 1/68 A C12P 21/02 G01N 33/53 M C12Q 1/68 33/566 G01N 33/53 C12N 15/00 ZNAA 33/566 5/00 A (81) Designated countries EP (AT, BE, CH, CY , DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW) , ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, D, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT , LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZWF terms (reference) 4B024 AA01 AA12 BA36 CA04 CA09 CA12 DA02 DA06 EA02 EA03 HA11 HA14 HA17 4B063 QA01 QA08 QA13 QQ08 QQ43 QQ46 QQ53 Q58 QR55 QR62 QR77 QS25 QS34 QX02 4B064 AG31 CA19 DA05 DA14 4B065 AA93Y AB01 BA02 CA24 CA44 CA 46 4C085 AA13 AA14 BB01 BB11 CC21 DD62 EE01 4H045 AA10 AA11 AA20 AA30 BA10 CA41 DA75 DA86 EA28 EA51 FA74

Claims (26)

[Claims] 1. A polynucleotide encoding amino acids from about 1 to about 626 of SEQ ID NO: 11; (b) a polynucleotide encoding amino acids from about 2 to about 626 of SEQ ID NO: 11; (D) a polynucleotide encoding amino acids from about 2 to about 626 of SEQ ID NO: 12; (e) a polynucleotide encoding amino acids of from about 1 to about 626 of SEQ ID NO: 13 (F) a polynucleotide encoding amino acids from about 2 to about 626 of SEQ ID NO: 13; (g) a polynucleotide of (a), (b), (c), (d), (e) or (f) And (h) a polynucleotide of (a), (b), (c), (d), (e), (f), or (g). Fault complement, comprising a polynucleotide selected from the group consisting of isolated nucleic acid molecules. 2. An isolated nucleic acid molecule comprising 10 consecutive nucleotides from the coding region of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10. 3. The isolated nucleic acid molecule of claim 2, comprising 20 consecutive nucleotides from the coding region of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10. 4. The isolated nucleic acid molecule of claim 3, comprising 50 contiguous nucleotides from the coding region of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10. 5. An isolated nucleic acid molecule comprising a polynucleotide encoding a polypeptide, wherein, except for at least one conservative amino acid substitution, the polypeptide comprises the following: A polynucleotide encoding from about 1 to about 626 amino acids; (b) a polynucleotide encoding from about 2 to about 626 amino acids of SEQ ID NO: 11; (c) a polynucleotide encoding from about 1 to about 626 amino acids of SEQ ID NO: 12 (D) a polynucleotide encoding from about 2 to about 626 amino acids of SEQ ID NO: 12; (e) a polynucleotide encoding from about 1 to about 626 amino acids of SEQ ID NO: 13; A polynucleotide encoding about 2 to about 626 amino acids; having an amino acid sequence selected from the group consisting of: Nucleic acid molecule. 6. A method for producing a recombinant vector, comprising the step of inserting the nucleic acid molecule according to claim 1 into a vector by operable linkage to a promoter. 7. A recombinant vector produced by the method according to claim 6. 8. A method for producing a recombinant host cell, comprising the step of introducing the recombinant vector according to claim 7 into a host cell. 9. A recombinant host cell produced by the method of claim 8. 10. A recombinant method for producing a polypeptide, which comprises culturing the recombinant host cell according to claim 9 under conditions such that the polypeptide is expressed, and recovering the polypeptide. A method comprising the step of: 11. The following: (a) about 1 to 626 amino acids of SEQ ID NO: 11; (b) about 2 to 626 amino acids of SEQ ID NO: 11; (c) about 1 to 626 amino acids of SEQ ID NO: 12; d) about 2 to 626 amino acids of SEQ ID NO: 12; (e) about 1 to 626 amino acids of SEQ ID NO: 13; and (f) about 2 to 626 amino acids of SEQ ID NO: 13. An isolated polypeptide comprising an amino acid that is at least 90% identical to 12. An isolated polypeptide, which, with the exception of at least one conservative amino acid substitution, comprises: (a) about 1 to 626 amino acids of SEQ ID NO: 11; (C) about 1 to 626 amino acids of SEQ ID NO: 12; (d) about 2 to 626 amino acids of SEQ ID NO: 12; (e) about 1 to 626 amino acids of SEQ ID NO: 13 An isolated polypeptide having an amino acid sequence selected from the group consisting of: amino acids; and (f) about 2-626 amino acids of SEQ ID NO: 13. 13. The following: (a) about 1 to 626 amino acids of SEQ ID NO: 11; (b) about 2 to 626 amino acids of SEQ ID NO: 11; (c) about 1 to 626 amino acids of SEQ ID NO: 12; d) about 2 to 626 amino acids of SEQ ID NO: 12; (e) about 1 to 626 amino acids of SEQ ID NO: 13; and (f) about 2 to 626 amino acids of SEQ ID NO: 13. An isolated polypeptide comprising: 14. An epitope-bearing portion of the polypeptide of SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. 15. The epitope-bearing portion according to claim 14, which comprises 10 consecutive amino acids of SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. 16. The epitope-bearing portion according to claim 15, comprising 20 consecutive amino acids of SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. 17. An isolated antibody that specifically binds to the polypeptide of claim 11. 18. An isolated antibody that specifically binds to the polypeptide of claim 12. 19. An isolated antibody that specifically binds to the polypeptide of claim 13. (I) SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 1
0 or a fragment thereof that is capable of hybridizing under stringent conditions to at least one of said fragments, wherein said polynucleotide is capable of hybridizing to native human TIAM2 mRNA. An antisense vector comprising: a sense polynucleotide; and (ii) a polynucleotide comprising a sequence capable of initiating transcription of the antisense polynucleotide. 21. The antisense vector according to claim 20, wherein said sequence for initiating transcription is derived from a retrovirus, an adenovirus or an adeno-associated virus. 22. The antisense vector according to claim 21, further comprising an origin of replication. 23. An antisense polyprotein comprising a nucleic acid sequence capable of hybridizing under stringent conditions to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or a fragment thereof. Providing an antisense polynucleotide that is nucleotide and capable of hybridizing to native human TIAM2 mRNA; and (b) contacting the antisense polynucleotide with the TIAM2. A method of inhibiting expression. 24. A method for detecting hyperproliferative cells in a sample, comprising: (a) adding a string to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or a fragment thereof. Providing a probe polynucleotide comprising a sequence capable of hybridizing under mild conditions; (b) contacting the polynucleotide of a sample cell with the probe under conditions that allow the formation of a polynucleotide hybrid; and (c). Detecting a hybrid. 25. A method for detecting a TIAM2 polypeptide in a sample, comprising: (a) an antibody that specifically binds a TIAM2 polypeptide, wherein the TAM2 polypeptide is
The IAM2 polypeptide has SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10.
Or providing an antibody comprising an amino acid sequence encoded by a polynucleotide comprising a sequence capable of hybridizing to at least one of its fragments; (b) providing the antibody under conditions that allow the antibody to form an antibody / antigen complex. Contacting the sample; and (c) detecting the complex. 26. A method for inhibiting cell replication, comprising: (a) an antibody that specifically binds to a TIAM2 polypeptide, wherein said T
The IAM2 polypeptide has SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10.
Or providing an antibody comprising an amino acid sequence encoded by a polynucleotide comprising a sequence capable of hybridizing to at least one of its fragments; (b) a sample under conditions which allow said antibody to form an antibody / antigen complex Contacting the method.