JP2011083295A - Tiam2 (t-cell lymphoma invasion and metastasis 2) nucleotide exchange factor - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide nucleic acid sequences encoding TIAM2 (T-cell lymphoma invasion and metastasis 2) proteins. <P>SOLUTION: The nucleic acid sequences encoding TIAM2 proteins are provided. Diagnostic assays, expression vectors, antisense molecules, ribozymes and host cells for expressing the polypeptide encoded by the nucleic acid sequence are included. Claims to the polypeptide sequence encoded by the nucleic acid sequences are also included. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

(Field of Invention)
The present invention exists in the field of molecular biology. More particularly, the present invention relates to polynucleotide sequences and corresponding TIAM2 proteins.

(Background of the Invention)
Characterization of the TIAM1 gene and the encoded protein has been described by Habets et al., Cell 77: 537-549 (1994) [Non-patent Document 1]; J. et al. Et al. Biol. Chem. 269: 62-65 (1994) [Non-Patent Document 2]; Haslam et al., Nature 363: 309-310 (1993) [Non-Patent Document 3]; and Mayer, B. et al. J. et al. Cell 73: 629-630 (1993) [Non-Patent Document 4].

Havets et al., Cell 77: 537-549 (1994). Hart, M.M. J. et al. Et al. Biol. Chem. 269: 62-65 (1994) Haslam et al., Nature 363: 309-310 (1993). Mayer, B.M. J. et al. Cell 73: 629-630 (1993).

The present invention provides, for example, the following items:
(Item 1) Following:
(A) a polynucleotide encoding about 1 to about 626 of SEQ ID NO: 11;
(B) a polynucleotide encoding about 2 to about 626 of SEQ ID NO: 11;
(C) a polynucleotide encoding about 1 to about 626 of SEQ ID NO: 12;
(D) a polynucleotide encoding from about 2 to about 626 of amino acid SEQ ID NO: 12;
(E) a polynucleotide encoding from about 1 to about 626 of SEQ ID NO: 13;
(F) a polynucleotide encoding from about 2 to about 626 of SEQ ID NO: 13;
(G) a polynucleotide at least 80% identical to the polynucleotide of (a), (b), (c), (d), (e) or (f); and
(H) a polynucleotide complement of the polynucleotide of (a), (b), (c), (d), (e), (f), (g),
An isolated nucleic acid molecule comprising a polynucleotide selected from the group consisting of:
(Item 2) An isolated nucleic acid molecule comprising 10 consecutive nucleotides from the coding region of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.
(Item 3) The isolated nucleic acid molecule according to item 2, comprising 20 consecutive nucleotides derived from the coding region of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.
(Item 4) The isolated nucleic acid molecule according to item 3, comprising 50 consecutive nucleotides derived from the coding region of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.
(Item 5) An isolated nucleic acid molecule comprising a polynucleotide encoding a polypeptide, wherein, except for at least one conservative amino acid substitution, the polypeptide is:
(A) a polynucleotide encoding about 1 to about 626 amino acids of SEQ ID NO: 11;
(B) a polynucleotide encoding about 2 to about 626 amino acids of SEQ ID NO: 11;
(C) a polynucleotide encoding about 1 to about 626 amino acids of SEQ ID NO: 12;
(D) a polynucleotide encoding about 2 to about 626 amino acids of SEQ ID NO: 12;
(E) a polynucleotide encoding about 1 to about 626 amino acids of SEQ ID NO: 13; and
(F) a polynucleotide encoding about 2 to about 626 amino acids of SEQ ID NO: 13;
An isolated nucleic acid molecule having an amino acid sequence selected from the group consisting of:
(Item 6) A method for producing a recombinant vector comprising the step of inserting the nucleic acid molecule according to item 1 into a vector in an operable linkage to a promoter.
(Item 7) A recombinant vector produced by the method according to Item 6.
(Item 8) A method for producing a recombinant host cell, comprising the step of introducing the recombinant vector of Item 7 into the host cell.
(Item 9) A recombinant host cell produced by the method according to item 8.
(Item 10) A recombinant method for producing a polypeptide, comprising the steps of culturing the recombinant host cell according to item 9 and recovering the polypeptide under conditions such that the polypeptide is expressed. Including the method.
(Item 11) Following:
(A) about 1 to 626 amino acids of SEQ ID NO: 11;
(B) about 2 to 626 amino acids of SEQ ID NO: 11;
(C) about 1 to 626 amino acids of SEQ ID NO: 12;
(D) about 2 to 626 amino acids of SEQ ID NO: 12;
(E) about 1 to 626 amino acids of SEQ ID NO: 13; and
(F) about 2 to 626 amino acids of SEQ ID NO: 13,
An isolated polypeptide comprising at least 90% amino acids identical to an amino acid selected from the group consisting of:
(Item 12) An isolated polypeptide, excluding at least one conservative amino acid substitution, wherein the polypeptide:
(A) about 1 to 626 amino acids of SEQ ID NO: 11;
(B) about 2 to 626 amino acids of SEQ ID NO: 11;
(C) about 1 to 626 amino acids of SEQ ID NO: 12;
(D) about 2 to 626 amino acids of SEQ ID NO: 12;
(E) about 1 to 626 amino acids of SEQ ID NO: 13; and
(F) about 2 to 626 amino acids of SEQ ID NO: 13,
An isolated polypeptide having an amino acid sequence selected from the group consisting of:
(Item 13) The following:
(A) about 1 to 626 amino acids of SEQ ID NO: 11;
(B) about 2 to 626 amino acids of SEQ ID NO: 11;
(C) about 1 to 626 amino acids of SEQ ID NO: 12;
(D) about 2 to 626 amino acids of SEQ ID NO: 12;
(E) about 1 to 626 amino acids of SEQ ID NO: 13; and
(F) about 2 to 626 amino acids of SEQ ID NO: 13,
An isolated polypeptide comprising an amino acid selected from the group consisting of:
(Item 14) An epitope-bearing portion of the polypeptide of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.
(Item 15) The epitope-bearing portion according to item 14, comprising 10 consecutive amino acids of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.
(Item 16) The epitope-bearing portion according to item 15, comprising 20 consecutive amino acids of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.
(Item 17) An isolated antibody that specifically binds to the polypeptide of item 11.
(Item 18) An isolated antibody that specifically binds to the polypeptide of item 12.
(Item 19) An isolated antibody that specifically binds to the polypeptide of item 13.
(Item 20) (i) An antisense polynucleotide comprising a sequence capable of hybridizing under stringent conditions to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or a fragment thereof. Wherein the polynucleotide comprises an antisense polynucleotide capable of hybridizing to native human TIAM2 mRNA; and (ii) a polynucleotide comprising a sequence capable of initiating transcription of the antisense polynucleotide. vector.
(Item 21) The antisense vector according to item 20, wherein the sequence for initiating transcription is derived from a retrovirus, an adenovirus or an adeno-associated virus.
(Item 22) The antisense vector according to item 21, further comprising an origin of replication.
(Item 23) Following:
(A) an antisense polynucleotide comprising a nucleic acid sequence capable of hybridizing under stringent conditions to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof; Providing an antisense polynucleotide capable of hybridizing to native human TIAM2 mRNA; and
(B) contacting the antisense polynucleotide with the TIAM2;
A method of inhibiting the expression of TIAM2.
(Item 24) A method for detecting hyperproliferating cells in a sample, comprising:
(A) providing a probe polynucleotide comprising a sequence capable of hybridizing under stringent conditions to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof;
(B) contacting the polynucleotide of the sample cell with the probe under conditions that form a polynucleotide hybrid; and
(C) detecting the hybrid;
Including the method.
(Item 25) A method for detecting a TIAM2 polypeptide in a sample, comprising:
(A) an antibody that specifically binds to a TIAM2 polypeptide, wherein the TIAM2 polypeptide hybridizes to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof. Providing an antibody comprising an amino acid sequence encoded by a polynucleotide comprising a possible sequence;
(B) contacting the antibody with the sample under conditions that form an antibody / antigen complex; and
(C) detecting the complex;
Including the method.
(Item 26) A method for inhibiting cell replication, comprising:
(A) an antibody that specifically binds to a TIAM2 polypeptide, wherein the TIAM2 polypeptide hybridizes to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof. Providing an antibody comprising an amino acid sequence encoded by a polynucleotide comprising a possible sequence;
(B) contacting the sample with a sample under conditions that form an antibody / antigen complex;
Including the method.
(Summary)
The present invention relates to a polynucleotide comprising the polynucleotide of SEQ ID NO: 8.
The invention also relates to the polypeptide encoded by SEQ ID NO: 8.

  The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8.

  The present invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO: 8.

  The invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO: 8.

  The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 8.

  The present invention relates to a polynucleotide comprising the polynucleotide of SEQ ID NO: 9.

  The invention also relates to the polypeptide encoded by SEQ ID NO: 9.

  The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 9.

  The present invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO: 9.

  The invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO: 9.

  The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 9.

  The present invention relates to a polynucleotide comprising the polynucleotide of SEQ ID NO: 10.

  The invention also relates to the polypeptide encoded by SEQ ID NO: 10.

  The invention further relates to a polynucleotide having at least 80% sequence identity to SEQ ID NO: 10.

  The present invention still further relates to a polynucleotide having at least 85% sequence identity to SEQ ID NO: 10.

  The invention also relates to a polynucleotide having at least 90% sequence identity to SEQ ID NO: 10.

  The invention further relates to a polynucleotide having at least 95% sequence identity to SEQ ID NO: 10.

  The present invention relates to polypeptides having at least 80% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

  The invention also relates to polypeptides having at least 85% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

  The invention further relates to polypeptides having at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

  The present invention still further relates to polypeptides having at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

  The invention further relates to a polypeptide encoded by SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 or by a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 It relates to an antibody that can specifically bind.

  The present invention further relates to an antibody capable of specifically binding to a polypeptide having the amino acid sequence of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13.

  The present invention also relates to a method of detecting the expression of a TIMA2 expression product in a biological sample comprising obtaining a polypeptide from the biological sample, an antibody capable of specifically binding to TIAM2 and the polypeptide And a method of detecting the presence or absence of an antibody-polypeptide complex.

  The invention also relates to a method for obtaining a TIAM2 polypeptide comprising expressing a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

  The invention further relates to a vector comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.

  The present invention still further relates to a vector comprising SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 and a polynucleotide having at least 80% sequence identity to at least one regulatory region.

The invention also relates to a host cell comprising a polynucleotide having at least 80% sequence identity to SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10.
The invention further comprises comparing the polynucleotide sequence of SEQ ID NO: 8, SEQ ID NO: 9 or SEQ ID NO: 10 with the polypeptide sequence of the region of chromosome 6q25 of a potentially cancerous ovarian tissue sample, The present invention relates to a method for detecting a deletion of a region of chromosome 6q25 in ovarian cancer comprising detecting the presence or absence of a sequence in a polynucleotide.

2 [mu] g / lane of poly ^(A) - including mRNA, human brain (A) blotting and tissue-specific (B) blots, recognizes both long form of TIAM2 (TIAM _L) and short form (TIAM _S) TIAM Hybridized with specific probes. Upon brain-specific Northern, the probe from the 5 ′ end of the 4.4-Kb message hybridized only to the long form (C), whereas the 3′-specific probe was in both the long and short forms. Hybridized (D). FIG. 2 shows TIAM2 and mRNA expression in mouse brain. (A) Total amount of E13.5 fetal brain. TIAM2 transcripts are expressed throughout the developing telencephalon (T). (B) Parasagittal section through the E13.5 telencephalon, demonstrating that TIAM2 mRNA is located in cells near the buffy coat (P) surface; labeling is seen near the ventricular surface (V) I couldn't. (C) Coronal amputation through the adult mouse forebrain. TIAM2 transcripts are localized in the cerebral cortex (Ctx) and caudate putamen (CP) with strong labeling in the epithelium (small arrows) and gray layer (arrows). (D) Display of higher magnification of labeling in the epithelium (arrowhead) lining the lateral ventricle (LV) under the corpus callosum (CC). (E) TIAM2 transcription in the olfactory bulb, glomerular layer (arrowhead), and mitral cell layer (arrow). (F) Coronal cuts demonstrating labeling in the thalamus (arrowheads) and gray white bundles (arrows). (G) Hippocampal expression of TIAM2 showing expression in granule cells of dentate gyrus (DG) and pyramidal cells of CA2. FIG. 3 shows a comparison between the amino acid sequence of TIAM2 _{L and} the amino acid sequence at the carboxy terminus of the TIAM1 protein (amino acids 576 to 1591). The EX domain, alternative splice region, DHR domain, DH domain and PH domain are underlined and the starting methionine of TIAM2 _S (amino acid 452) is bold and is indicated by an arrow. FIG. 4 shows the results of the GDP-GTP exchange assay. Incompletely purified His-TIAM2 _S protein was assayed for the ability to stimulate GDP-GTP exchange activity with immunoprecipitated Rac (A) or Ras (B) protein. (A) Average of three separate reactions in which Rac was incubated with [ ³² P] GTP in the presence of His-TIAM2 _S (）), SOS (◯), or buffer alone (□). (B) Representative experiment in which Ras was incubated with [ ³² P] GTP in the presence of TIAM2 _S (●), SOS (▲) or buffer alone (x). FIG. 5 shows the expression of TIAM2 mRNA in tumor tissue and normal tissue.

(Detailed description of the invention)
TIAM2 (DP-75) (for T cell lymphoma invasion and metastasis 2) relates to a novel DNA and amino acid sequence that has some sequence homology with TIAM1. (Habets et al., Cell 77: 537-749 (1994), and Habets et al., Oncogene 10: 1371-1376 (1995)). Overexpression of full-length or truncated forms of TIAM1 increases the likelihood of lymphoma cell metastasis in mice. TIAM1 is a member of the family GDP dissociation stimulating factor (GDS), a protein that activates Rho-like and Rac-like GTPases. GDS, and Rho and Rac have oncogenic potential.

In accordance with the present invention, TIAM2, a novel protein with high homology to TIAM1, has been identified. TIAM2 is expressed as a message of about 4.4 kb and about 3.3 kb, which encodes a long form (TIAM2 _L ) and a short form (TIAM2 _S ) of the TIAM2 protein. TIAM2 _L starts in a region with identity to the coiled-coil region of TIAM1 and contains both the EX and PDZ domains found in TIAM1. Both TIAM2 _L and TIAM2 _S contain the same region for the DH and carboxy-terminal PH domains of TIAM1. An additional level of complexity is added by alternative splicing of the approximately 4.4 kb message, which leads to an insertion of 24 amino acids between the EX and DHR domains.

Analysis of the approximately 4.4 kb message identified an ATG at nucleotide 51 in good condition for translation, while further analysis extended the ORF from the 5 ′ of the ATG to the first 51 nucleotides It became clear that it could be done. This extended ORF may indicate that there is an additional 5 ′ sequence that extends TIAM _L. The initiation probably starts at nucleotide position 51, because the size of the cDNA clone (4586 nt) is equal to or greater than the approximate size of the cerebellar message (about 4.4 kb). And because, despite numerous attempts, no additional 5 'sequence was identified.

A His-tagged version of TIAM2 _S was expressed in a baculovirus system, a preferred system for expression of TIAM2, and purified on a nickel column. His-TIAM2 _S was compared to SOS and shown to have GEF activity that favors RAC over RAS.

  The high similarity, expression pattern, and GEF activity between the coding sequences of TIAM1 and TIAM2 proteins are similar to TIAM1 (Habets et al., Cell 77: 537-549, 1994; Hordijk et al., Science 278: 1464-1466, 1997 Ehler et al., Mol.Cell.Neurosci.9: 1-12, 1997; van Leeuwen et al., J. Cell Biol., 139: 797-807, 1997), suggesting that TIAM2 may play a role in neural development To do. The high level of TIAM2 expression throughout the E13.5 telencephalon suggests that TIAM2 may play an important role in forebrain development. At E13.5, post-mitotic neurons are produced; these cells migrate to their exact location in the developing brain and establish contact with their precise target In order to do so, the proliferative pituitary must be released. All of these processes require coordinating actin-based cytoskeletal rearrangements with environmental cues. There is strong evidence that Rac / cdc42 GTPase plays an important role in axon formation and target recognition in the nervous system (Albertinazzi et al., J. Cell. Biol. 142: 815-825, 1998). Hing et al., Cell 97: 853-863, 1999; van Leewen et al., Supra, 1997). Further analysis of TIAM2 expression during mouse embryogenesis may reveal correlation with specific morphogenic events, or with specific GTP-ase family members, regulators, or effectors. Some that are specifically established during neural development appear to be due to cell type-specific expression of components of the GTPase signaling pathway such as TIAM1, RAC3, and TIAM2.

  Unlike TIAM1, TIAM2 continues to be expressed at high levels in the adult forebrain. Regions of high expression in the adult are synapse-forming regions in the adult (cortex, hippocampus) or neurogenic (dentate gyrus, upper garment / upper garment) (Gould et al., Trends Cogn. Sci. 3: 186-192, 1999; Temple, Curr. Biol. 9: R397-399, 1999; Lowenstein and Parent. Science 283: 1126-1127, 1999).

  TIAM2 may play a role in metastasis or tumor suppression. Irradiation hybrid mapping of TIAM2 places it in the 4-cM region of chromosome 6q25 that is frequently deleted in ovarian cancer (Colitti et al., Oncogene 16: 555-559, 1998). It has been suggested that most ovarian cancers are epithelial in nature and that TIAM1 (21q22.1; Chen and Antonarakis, Genomics 30: 123-127, 1995) can act as a tumor suppressor in epithelial cells As such, this may suggest a role for TIAM2 in ovarian cancer.

The expression of another form of TIAM2 suggests a different role for TIAM2 _L and TIAM2 _S. Both the EX and PDZ domains found in TIAM2 _L have been suggested to play a role in protein-protein interactions and in the intracellular localization of proteins. Since TIAM2 _s lacks both the EX domain and PDZ domain of TIAM2 _L , the two forms can be localized to different regions of the cell. Understanding another form of TIAM2 expands the insights into the complexity of this emerging family of GEF and ultimately gives insight into the diverse role of TIAM1 as both an invasive promoter and tumor suppressor obtain.

  GDS is involved in a variety of cancers, and based on the discussions herein, TIAM2 may be useful for diagnosing cancerous cells. Many techniques can be used to diagnose whether a tissue sample carries tumor cells containing TIAM2. For example, reverse transcription and PCR amplification of RNA in tumor samples to identify the presence of TIAM2 mRNA sequences (Sambrook et al., Molecular Cloning; A Laboratory Manual, 2nd edition 1989), Chapter 14, or Gaugler et al., J. Biol. Exp. Med 179: 921-930 (1994)). Immunohistochemical techniques or ELISA assays can also be used to identify tumors that express TIAM-2. For example, TIAM2 protein can be expressed recombinantly and monoclonal antibodies can be prepared according to methods known in the art. See, for example, EP 174,204, Kohler and Milstein, Nature 256: 495-497 (1975), Fong et al. Immun. Meth. 70: 83-90 (1984), GB 2,086,937, 2,113,715, EP 57,107, 62,409, EP 118,893, EP 124,301 And the methods set forth in EP 131,878 are suitable for the present invention. Anti-TIAM2 monoclonal antibodies can then be used in the standard assays described above, or those assays that are otherwise known in the art.

  Monoclonal antibodies can also be used therapeutically. The anti-TIAM2 monoclonal antibody can be administered by means known in the art. Preferably, the antibodies are administered parenterally or subcutaneously, more preferably they are administered intravenously. Monoclonal antibodies can be administered in combination with other agents designed to promote the activity of the antibody or to treat an underlying condition associated with cells expressing TIAM2.

  In addition, branched DNA tests are as shown in US Pat. Nos. 5,124,246 and 4,868,105, which are incorporated herein by reference in their entirety. This can be done to assay for TIAM2 DNA. TIAM2 nucleic acid probe molecules for branched DNA testing are preferably 10-50 bases in length, more preferably 15-40 bases in length, most preferably 20-30 bases in length. It is.

  Ribozymes can be designed to act on TIAM2 sequences identified in SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or fragments thereof. (Kashani-Cabet and Scanlon, Cancer Gene Therapy, 2: 213-223 (1995), incorporated herein by reference in its entirety). To obtain cellular expression, the ribozyme gene is cloned into an available vector and transfected into selected cells. Different vectors can be selected based on the infected target cells. For example, respiratory cells can be targeted by adenovirus or adeno-associated virus (AAV) vectors. Appropriate promoters can be inserted into these vectors to ensure regulatable expression. (Kashani-Cabet, page 216).

  Antisense molecules can be developed based on the TIAM2 sequence shown in SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10. See, for example, US Pat. Nos. 5,491,133 and 5,271,941. These are hereby incorporated by reference in their entirety.

  Antisense RNA sequences are prokaryotic (Mizuno, T., Chou, MY, and Inouye. M. (1984), Proc. Natl. Acad. Sci. USA 81. (1966-1970)) and true. Have been described as naturally occurring biological inhibitors of gene expression in both nuclei (Heywood, SM, Nucleic Acids Res., 14, 6771-6772 (1986)) and their sequences Functions by hybridizing to complementary mRNA sequences, thereby resulting in blocking by translational hybridization (Patterson. B.M., Roberts. B.E. and Kuff. E.L. 1977) Proc. Natl. Acad. Sci USA 74,4370-4374).

  Antisense oligodeoxynucleotides are short synthetic nucleotide sequences formed to be complementary to a specific gene or RNA message. Through the binding of these oligomers to the target DNA sequence or target mRNA sequence, transcription or translation of the gene can be selectively blocked and the disease process produced by the gene can be stopped. The cytoplasmic arrangement of mRNA provides a target that is thought to be readily accessible to antisense oligonucleotides that invade cells; therefore, much work in this field has been directed against RNA as a target. Focused.

  Antisense therapy is the administration of an oligonucleotide that binds to a target polynucleotide placed within a cell. These oligonucleotides are usually exogenous, but they can be expressed endogenously. The term “antisense” refers to the fact that such oligonucleotides are complementary to their intracellular target (eg, TIAM2). For example, Jack Cohen, Oligonucleotides. See Antisense Inhibitors of Gene Expression, CRC Press, 1989; and Synthesis 1: 1-5 (1988).

  TIAM2 antisense oligonucleotides of the present invention, such as S-oligonucleotides (phosphorothioate derivatives or S-oligos, Jack Cohen, supra), which show enhanced cancer cell growth inhibitory activity. Derivatives. The TIAM2 antisense oligonucleotide of the invention can be RNA or DNA. This RNA or DNA is complementary to and stably hybridizes to the TIAM2 genome or corresponding mRNA. The use of an oligonucleotide complementary to this region allows selective hybridization to TIAM2 mRNA and does not allow hybridization to other mRNAs.

  Preferably, the antisense oligonucleotide of TIAM2 of the present invention is a 15-40 mer fragment of an antisense DNA molecule that hybridizes to TIAM2 mRNA. Alternatively, preferred TIAM2 antisense oligonucleotides are 20-30 mer oligonucleotides that hybridize to regions in RIAM2. Included in the invention are pharmaceutical compositions containing an effective amount of at least one TIAM2 antisense oligonucleotide of the invention in combination with a pharmaceutically acceptable carrier. In one embodiment, a single TIAM2 antisense oligonucleotide is utilized. In another embodiment, two TIAM2 antisense oligonucleotides are utilized, which are complementary to adjacent regions of the TIAM2 genome.

  Administration of two TIAM2 antisense oligonucleotides, which are complementary to adjacent regions of the TIAM2 genome, or the corresponding mRNA, results in more efficient inhibition of transcription of the TIAM2 genome or translation of the mRNA Which can result in a more effective inhibition of cancer cell growth. Preferably, the TIAM2 antisense oligonucleotide is administered simultaneously with an agent that enhances uptake of the antisense molecule by the cell. For example, TIAM2 antisense oligonucleotides can be combined with lipophilic cationic compounds that can be in the form of liposomes.

  The use of liposomes to introduce nucleotides into cells is taught, for example, in US Pat. Nos. 4,897,355 and 4,394,448. These disclosures are incorporated herein by reference in their entirety. US Pat. Nos. 4,235,871, 4,231,877, 4,224, for general methods for preparing liposomes containing biological materials. 179, 4,753,788, 4,673,567, 4,247,411, 4,814,270.

  Alternatively, the TIAM2 antisense oligonucleotide can be combined with a lipophilic carrier, such as any one of a number of sterols, including cholesterol, cholate and deoxycholic acid. A preferred sterol is cholesterol. Furthermore, TIAM2 antisense oligonucleotides can be conjugated to peptides that are taken up by cells. Examples of useful peptides include peptide hormones, antigens or antibodies, and peptide toxins. By selecting peptides that are selectively taken up by neoplastic cells, specific delivery of antisense agents can be provided.

  The TIAM2 antisense oligonucleotide can be covalently linked through the 5'H group by formation of an activated aminoalkyl derivative. The selected peptide can then be covalently attached to the activated TIAM2 antisense oligonucleotide via amino and sulfhydryls that react with heterobifunctional reagents. The latter is attached to a cysteine residue present in the peptide. Upon exposure of the cells to the peptide-bound TIAM2 antisense oligonucleotide, the peptidyl antisense agent is endocytosed and the TIAM2 antisense oligonucleotide binds to the target TIAM2 mRNA to translate. Inhibit. See PCT Application Publication Number PCT / US89 / 02363.1.

  The TIAM2 antisense oligonucleotides and pharmaceutical compositions of the invention can be administered by any means to achieve their intended purpose. For example, administration of the antisense compounds or other compounds of the invention can be by parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, or transdermal routes.

  The dosage administered will depend on the age, health, and weight of the recipient, the type of treatment being performed in parallel, the frequency of treatment, if necessary, and the nature of the effect desired. Compositions within the scope of the present invention include all compositions, wherein the TIAM2 antisense oligonucleotide is used to achieve inhibition of cancer cell growth and / or stimulate differentiation of a subject. In an amount that is effective.

  Although individuals will require modification, determination of the optimal range of effective amounts of each composition is within the skill of the art. Typically, a TIAM2 antisense oligonucleotide is equivalent to a mammal (eg, human) at a dose of 0.005 to 1 mg / kg / day, or equivalent to the daily weight of the mammal being treated. Can be administered in any amount of their pharmaceutically acceptable salts.

  In addition to administering TIAM2 antisense oligonucleotides as raw chemicals in solution, TIAM2 antisense oligonucleotides enhance the processing of TIAM2 antisense oligonucleotides into preparations that can be used pharmaceutically. It can be administered as part of a pharmaceutical preparation containing a suitable pharmaceutically acceptable carrier containing dosage forms and additives. The term pharmaceutically acceptable refers to compounds and compositions that can be administered to a mammal without undue toxicity. Exemplary pharmaceutically acceptable salts include inorganic acid salts, such as hydrochloride, hydrobromide, phosphate, sulfate, and the like; and acetate, propionate, malonate, benzoate Organic acid salts such as acid salts can be mentioned.

  Formulations suitable for parenteral administration include aqueous solutions of TIAM2 antisense oligonucleotides in water-soluble form, such as water-soluble salts. In addition, suspensions of the active compounds as appropriate oily injection suspensions can be administered. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances containing, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. If desired, the suspension may also contain stabilizers.

  The antisense oligonucleotides of the present invention can be prepared according to any method well known to those skilled in the art. Preferably, antisense oligonucleotides are prepared by solid phase synthesis. For a review of oligonucleotide chemical synthesis, see Goodchild, J. et al. See Bioconjugate Chemistry, 1: 165-167 (1990). Alternatively, antisense oligonucleotides can be obtained from a number of companies that specialize in custom synthesis of oligonucleotides.

  A TIAM2 polypeptide, polynucleotide, or antibody can be administered orally, topically, or by parenteral means including subcutaneous and intramuscular injection, implantation of sustained release depot formulations, intravenous injection, intranasal administration, etc. . When used to treat a tumor, it may be advantageous to apply a TIAM2 polypeptide or antibody directly to the site, eg, during surgery to remove a tumor mass. Thus, a TIAM2 polypeptide, polynucleotide, or antibody can be administered as a pharmaceutical composition containing a pharmaceutically acceptable excipient. Such compositions can be aqueous solutions, emulsions, creams, ointments, suspensions, gels, liposome suspensions, and the like. Suitable excipients include water, saline, Ringer's solution, dextrose solution, and ethanol, glucose, sucrose, dextran, mannose, mannitol, sorbitol, polyethylene glycol (PEG), phosphate, acetate, gelatin, Examples include collagen, Carbopol (registered trademark), vegetable oil solutions, and the like. One can further include appropriate preservatives, stabilizers, antioxidants, antibacterial agents, and buffering agents (eg, BHA, BHT, citric acid, ascorbic acid, tetracycline, etc.). Cream or ointment bases useful in the formulation include lanolin, Silvadene (R) (Marion), Aquaphor (R) (Duke Laboratories), and the like. Other topical formulations include aerosols, band aids, and other wound dressings.

  Alternatively, one can incorporate or encapsulate a TIAM2 polypeptide, polynucleotide, or antibody in a suitable polymer matrix or membrane, which is suitable for implantation near the site to be treated locally. Provide Xu Broadcasting Device. Other devices include intrinsic catheters and devices, such as Alzet® minipumps. Can ophthalmic preparations be formulated using commercial vehicles such as Sorbi-care® (Allergan), Neodecadron® (Merck, Sharp & Dohme), Lacrilube®, etc. Or topical preparations such as those described in US Pat. No. 5,124,155, incorporated herein by reference. In addition, one may provide TIAM2 polypeptide, polynucleotide, or antibody in solid form, particularly as a lyophilized powder. Lyophilized formulations typically contain stabilizers and bulking agents (eg, human serum albumin, sucrose, mannitol, etc.). A thorough discussion of pharmaceutically acceptable excipients is available at Remington's Pharmaceutical Sciences (Markck Pub. Co).

  The amount of TIAM2 polypeptide, polynucleotide, or antibody required for the treatment of any particular disorder will, of course, be readily determined by the nature and severity of the disorder, the age and condition of the subject, and the person skilled in the art. Varies depending on other factors to be determined. Appropriate dosages can be determined by one skilled in the art.

  In gene therapy methods, it may be useful to administer the nucleic acid molecule described above (ie, ribozyme or antisense molecule). Therefore, the vectors and techniques described below are useful. The following expression systems describe vectors, promoters, and regulatory elements that are useful in gene therapy applications for delivery of the above polynucleotides.

  Vectors and expression systems useful in the present invention include viral and non-viral systems. Exemplary viral delivery systems include retroviruses, adenoviruses, adeno-associated viruses (AAV), Sindbis and helper viruses. In one aspect of the invention, the viral vector can integrate the nucleic acid sequence described above into the host cell genome for long term expression.

  One preferred retrovirus is the murine leukemia virus. However, it may be preferred to avoid integration into the genome of the host cell. Non-viral vectors include naked DNA and DNA formulated with cationic lipids or liposomes. A non-viral system that can be used is the T7 / T7 system.

  In addition, it is useful to produce TIAM2 protein from the nucleic acid sequences disclosed herein, for example, in assays to test for inhibitors or for the preparation of monoclonal antibodies. TIAM2 can be expressed by a baculovirus that has been transformed with a native or modified TIAM2 nucleic acid sequence. A TIAM2 nucleic acid sequence useful in the present invention encodes a protein having an amino acid sequence that is substantially identical to the amino acid sequence of native TIAM2.

  Preferably, the TIAM2 nucleic acid or protein sequence is homologous to the partial sequences listed below. Preferably, the above sequence is more than 80% homologous to SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or a fragment thereof, more preferably it is 85% More than 90% homologous, more preferably more than 91%, 92%, 93%, 94%, or 95% homologous. Most preferably it is more than 96%, 97%, 98%, or 99% homologous. Substantially identical means that the sequences are identical or differ by one or more changes (deletions, additions, substitutions) that do not deleteriously affect the activity of the protein. It is preferred that the protein sequences are homologous in the same proportions as described above. Percent identity or homology can be calculated using methods and algorithms known in the art. A suitable but non-limiting method is the Smith-Waterman homology search algorithm, as performed in the MPSRCH program (Oxford Biomolecular) using an affine gap search with the following search parameters: : 12 gap open penalty and 1 gap extension penalty.

  The exact chemical structure of the TIAM2 sequence can depend on a number of factors. If ionized amino and carboxyl groups are present in the molecule, certain proteins can be obtained as acidic or basic salts, or in natural form. All such preparations, which retain their activity when placed under appropriate environmental conditions, are included in the definition of protein herein. Furthermore, the primary amino acid sequence of the protein can be increased by derivatization using a sugar moiety or by other additional molecules such as lipids, phosphates, acetyl groups, and the like. Certain aspects of such augmentation are achieved through the post-translational processing system of the production host; other such modifications can be introduced in vitro. In any event, such modifications are included in the definition of protein herein as long as the activity of the protein is not destroyed. It is expected that such modifications can affect the activity quantitatively or qualitatively by either increasing or decreasing the activity of the protein in various assays. Furthermore, individual amino acid residues in the chain can be modified by oxidation, reduction, derivatization, and the protein can be cleaved to obtain fragments that retain activity. Such changes that do not destroy activity do not remove the protein sequence from the definition of TIAM2 herein.

  Modifications to the primary sequence itself by deletion, addition or modification of amino acids incorporated into the sequence during translation can be made without disrupting the activity of the protein. For example, site-directed mutagenesis may be capable of specific changes in the DNA structure that result in changes in the polypeptide structure. See Mark et al., US Pat. No. 4,959,314, and Sambrook et al., Supra, Volume 2, Chapter 15, which are hereby incorporated by reference in their entirety. ).

  TIAM2 proteins include variants, fragments, fusions, and proteins encoded by SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, or sequences listed therein. Native TIAM2 protein is a naturally occurring protein. The amino acid sequence of the native polypeptide varies slightly (typically less than 10-20 amino acids encoded by SEQ ID NO: 1, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, or SEQ ID NO: 10). Contains an array.

  The term “polynucleotide” or “nucleic acid sequence” as used herein refers to a polymer of nucleotides of any length, preferably deoxyribonucleotides, and the terms “oligonucleotide” and “oligomer”. Are used interchangeably herein. This term refers only to the primary structure of the molecule. The term thus includes double- and single-stranded DNA, and antisense polynucleotides. Also included are known types of modifications such as: presence of a label known in the art, methylation, terminal “cap”, substitution of one or more naturally occurring nucleotides with analogs, Internucleotide modifications (eg, certain types of uncharged bonds (eg, methylphosphonates, phosphorotriesters, phosphoramidates, carbamates, etc.) or charged bonds (eg, phosphorothioates, phosphorodithioates, etc.) ), Pendant moieties (eg, proteins (nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), intercalators (eg, acridine, psoralen, etc.), chelating agents (eg, metal radiation) Active species, boron, oxidant moieties, etc.), alkylating agents (eg alpha anomeric nucleic acids, etc.) Input.

  A polynucleotide sequence encoding a native TIAM2 protein can be readily modified to encode other classes of TIAM2 proteins. It is recognized in the art that some amino acid sequences of TIAM2 polypeptides can be altered without significant effects on the structure or function of the protein. If such changes in the sequence are intended, it should be recalled that there are important regions on the protein that determine activity. In general, it is possible to substitute residues that form a quaternary structure, as long as residues that perform similar functions are used. In other instances, this type of residue can be trivial if changes occur in non-critical regions of the protein. Amino acid substitutions can also alter the selectivity of binding to cell surface receptors. Ostade et al., Nature 361: 266-268 (1993) describe specific mutations that result in selective binding of TNF-α to only one of the two known types of TNF receptors. Thus, the polypeptides of the present invention may include one or more amino acid substitutions, deletions or additions, either by natural mutation or human manipulation.

  Accordingly, the present invention further includes variations of TIAM2 polypeptides that exhibit substantial TIAM2 polypeptide activity or that include regions of TIAM2 protein, such as the protein portions discussed below. Such variants include deletions, insertions, conversions, repeats, and type substitutions. As indicated above, guidance regarding that amino acid changes are probably phenotypically silent can be found in Bowie, J. et al. U. Et al., “Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substations”, Science 247: 1306-1310 (1990).

  A particular purpose is the replacement of a charged amino acid with another charged amino acid and with a neutral or negatively charged amino acid. The latter results in a protein with a reduced positive charge to improve the characteristics of the TIAM2 protein. It is highly desirable to prevent agglomeration. Protein aggregation not only results in a loss of activity, but can also be a problem when preparing pharmaceutical formulations because they can be immunogenic. (Pincard et al., Clin Exp. Immunol. 2: 331-340 (1967); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carriers 77 (19:30). ).

  Amino acids in the polypeptides of the present invention that are essential for function can be obtained by methods known in the art, such as site-directed mutagenesis or alanine scan mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). Can be identified by The latter procedure introduces a single alanine mutation at each residue in the molecule. The resulting mutant molecules are then tested for biological activity, such as receptor binding or in vitro, ie, an in vitro proliferation assay. Sites important for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance, or photoaffinity labeling (Smith et al., J. Mol. Biol. 244: 899-904). (1992) and de Vos et al., Science 255: 306-312 (1992)).

  For example, variants can be constructed by making conservative amino acid substitutions. The following are examples of conservative substitutions:

. A subset of variants called muteins are groups of polypeptides having cysteines involved in non-disulfide bonds substituted with neutral amino acids (generally serine). These mutants are more stable over a wider range of temperatures than the native TIAM2 protein. As indicated, the alteration is preferably a minor property (eg, conservative amino acid substitutions that do not significantly affect protein folding or activity). Of course, the number of amino acid substitutions made by those skilled in the art depends on a number of factors, including those described above. Generally speaking, the number of substitutions for any given TIAM2 polypeptide will not exceed 50, 40, 30, 25, 20, 15, 10, 5, or 3. A variant coding sequence may be constructed by in vitro mutagenesis of a sequence encoding a native TIAM2 polypeptide.

  As used herein, the term “protein” or “polypeptide” refers to a polymer of amino acids and does not refer to a specific length of the product; thus, a peptide, oligopeptide, polypeptide, Proteins and polyproteins, and fragments thereof are included in this definition. The term also does not refer to or exclude modifications after expression of the protein (eg, glycosylation, acetylation, phosphorylation, etc.). For example, proteins containing one or more analogs of amino acids (including, for example, unnatural amino acids, etc.), proteins with substituted bonds, and other modifications known in the art (naturally occurring) Both non-naturally occurring and non-naturally occurring) are included in this definition.

  A polypeptide or protein or amino acid sequence "derived from" or thereby "encoded by" or thereby "encoded by" a specified nucleic acid sequence is a polypeptide encoded in the sequence. The amino acid sequence or part of the peptide is composed of at least 3 to 5 consecutive amino acids, and more preferably at least 8 to 10 amino acids, and even more preferably at least 11 to 15 amino acids It refers to a polypeptide having an amino acid sequence that is identical to a portion thereof, or a polypeptide that can be immunologically identified using a polypeptide encoded in the sequence. The term also includes a polypeptide expressed from a designated nucleic acid sequence.

  “Purified” and “isolated” when referring to a polypeptide or nucleotide sequence means that the indicated molecule is in the substantial absence of other biological macromolecules of the same type. It means to exist. The term “purified”, as used herein, is at least 75%, more preferably at least 85%, more preferably still, of the same type of biological macromolecule present. It means at least 95% by weight, and most preferably at least 98% by weight (but water, buffers, and other small molecules (especially molecules having a molecular weight of less than 1000) may be present).

  Fragments of polynucleotides encoding the TIAM2 polypeptides disclosed herein are also within the scope of the invention. Such a fragment may encode an antigenic region of the protein, or a region that is biologically functional of the proteins described herein. Such fragments also encode the polypeptide component of the fusion proteins disclosed herein. The fragment is also suitable for use as a probe to identify polynucleotides that can hybridize to SEQ ID NOs: 8, 9, and / or 10. The fragment is approximately 10 base pairs in length to a full length polynucleotide that is 3344 base pairs for SEQ ID NO: 8, 4590 base pairs for SEQ ID NO: 9, and 4514 base pairs for SEQ ID NO: 10 Range. Preferred fragments are 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 for SEQ ID NO: 8, 9, or 10. 125, 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, or 3300 base pairs; for SEQ ID NO: 9 or 10, 3400, 3500, 3600, 3700, 3800, 4000, 4100, 4200, 4300, 4400, 4500, and 4510 base pairs; about and SEQ ID NO: 10, 4520,4550,4575, or 4580 base pairs. A particularly preferred fragment comprises nucleotides 1 to 104 of SEQ ID NO: 8.

A polypeptide fragment is an amino-terminal and / or carboxyl-terminal amino acid deletion of a mutant or native T1AM2 protein. The number of amino acids shortened is not critical as long as the polypeptide fragment exhibits the desired sequence homology, immunological activity, or biological activity. Preferred fragments are 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 of SEQ ID NO: 7, 11, 12, or 13. , 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600 or 625 amino acids; SEQ ID NO: 12 or 13, 650, 675, 750, 800, 825, 900, 950, 1000, 1025, or 1050 amino acids; and 1060, 1065, 1070, or 1075 amino acids of SEQ ID NO: 13. Immunologically important polypeptide fragments comprise, for example, at least one epitope shared by native TIAM2 proteins. Such TIAM2 protein can only be 5-15 amino acids long. Examples of amino acid sequences of the fragments include: amino acid numbers 1-8 (aa1-aa8) of SEQ ID NO: 7, 11, 12, or 13; aa2-aa9 of SEQ ID NO: 7, 11, 12, or 13; Aa3 to aa10 of SEQ ID NO: 7, 11, 12, or 13; aa4 to aa11 of SEQ ID NO: 7, 11, 12, or 13; aa5 to aa12 of SEQ ID NO: 7, 11, 12, or 13; , 12, or 13 aa6-aa13; SEQ ID NO: 7, 11, 12, or 13 aa7-aa14; SEQ ID NO: 7, 11, 12, or 13 aa8-aa15; SEQ ID NO: 7, 11, 12, or 13 Aa9 to aa16; aa10 to aa17 of SEQ ID NO: 7, 11, 12, or 13; aa11 to aa18 of SEQ ID NO: 7, 11, 12, or 13 Aa12 to aa19 of SEQ ID NO: 7, 11, 12, or 13; aa13 to aa20 of SEQ ID NO: 7, 11, 12, or 13; aa14 to aa21 of SEQ ID NO: 7, 11, 12, or 13; , 12, or 13 aa15-aa22; SEQ ID NO: 7, 11, 12, or 13 aa16-aa23; SEQ ID NO: 7, 11, 12, or 13 aa17-aa24; SEQ ID NO: 7, 11, 12, or 13 Aa18 to aa25; SEQ ID NO: 7, 11, 12, or 13 aa19 to aa26; SEQ ID NO: 7, 11, 12, or 13 aa20 to aa27; SEQ ID NO: 7, 11, 12, or 13 aa21 to aa28; Aa22 to aa29 of SEQ ID NO: 7, 11, 12, or 13; aa23 to a of SEQ ID NO: 7, 11, 12, or 13 30; aa24 to aa31 of SEQ ID NO: 7, 11, 12, or 13; aa25 to aa32 of SEQ ID NO: 7, 11, 12, or 13; aa26 to aa33 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa27-aa34; SEQ ID NO: 7, 11, 12, or 13 aa28-aa35; SEQ ID NO: 7, 11, 12, or 13 aa29-aa36; SEQ ID NO: 7, 11, 12, Or aa30 to aa37 of SEQ ID NO: 7, 11, 12, or 13 aa31 to aa38; aa32 to aa39 of SEQ ID NO: 7, 11, 12, or 13; aa33 to SEQ ID NO: 7, 11, 12, or 13 aa40; aa34 to aa41 of SEQ ID NO: 7, 11, 12, or 13; aa35 of SEQ ID NO: 7, 11, 12, or 13 ~ Aa42; aa36 to aa43 of SEQ ID NO: 7, 11, 12, or 13; aa37 to aa44 of SEQ ID NO: 7, 11, 12, or 13; aa38 to aa45 of SEQ ID NO: 7, 11, 12, or 13; 7, 11, 12, or 13 aa39-aa46; SEQ ID NO: 7, 11, 12, or 13 aa40-aa47; SEQ ID NO: 7, 11, 12, or 13 aa41-aa48; SEQ ID NO: 7, 11, 12 Or aa42 to aa49 of SEQ ID NO: 7, 11, 12, or 13 aa43 to aa50; aa44 to aa51 of SEQ ID NO: 7, 11, 12, or 13; aa45 of SEQ ID NO: 7, 11, 12, or 13 Aa52; aa46 to aa53 of SEQ ID NO: 7, 11, 12, or 13; a of SEQ ID NO: 7, 11, 12, or 13 47-aa54; aa48-aa55 of SEQ ID NO: 7, 11, 12, or 13; aa49-aa56 of SEQ ID NO: 7, 11, 12, or 13; aa50-aa57 of SEQ ID NO: 7, 11, 12, or 13; Aa51-aa58 of SEQ ID NO: 7, 11, 12, or 13; aa52-aa59 of SEQ ID NO: 7, 11, 12, or 13; aa53-aa60 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7, 11, 12 or 13 aa54 to aa61; SEQ ID NO: 7, 11, 12, or 13 aa55 to aa62; SEQ ID NO: 7, 11, 12, or 13 aa56 to aa63; SEQ ID NO: 7, 11, 12, or 13 aa57 to aa64; aa58 to aa65 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7, 11, 12, or 1 Aa59-aa66; SEQ ID NO: 7, 11, 12, or 13 aa60-aa67; SEQ ID NO: 7, 11, 12, or 13 aa61-aa68; SEQ ID NO: 7, 11, 12, or 13 aa62-aa69; Aa63 to aa70 of SEQ ID NO: 7, 11, 12, or 13; aa64 to aa71 of SEQ ID NO: 7, 11, 12, or 13; aa65 to aa72 of SEQ ID NO: 7, 11, 12, or 13; , 12, or 13 aa66 to aa73; SEQ ID NO: 7, 11, 12, or 13 aa67 to aa74; SEQ ID NO: 7, 11, 12, or 13 aa68 to aa75; SEQ ID NO: 7, 11, 12, or 13 Aa69 to aa76; SEQ ID NO: 7, 11, 12, or 13 aa70 to aa77; SEQ ID NO: 7, 11, 12, or 13 aa71-aa78; SEQ ID NO: 7, 11, 12, or 13 aa72-aa79; SEQ ID NO: 7, 11, 12, or 13 aa73-aa80; SEQ ID NO: 7, 11, 12, or 13 aa74- aa81; aa75 to aa82 of SEQ ID NO: 7, 11, 12, or 13; aa76 to aa83 of SEQ ID NO: 7, 11, 12, or 13; aa77 to aa84 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa78-aa84; SEQ ID NO: 7, 11, 12, or 13 aa79-aa86; SEQ ID NO: 7, 11, 12, or 13 aa80-aa87; SEQ ID NO: 7, 11, 12, Or 13 aa81-aa88; SEQ ID NO: 7, 11, 12, or 13 aa82-aa89; SEQ ID NO: 7, 11, 12 Or aa83 to aa90 of SEQ ID NO: 7, 11, 12, or 13 aa84 to aa91; aa85 to aa92 of SEQ ID NO: 7, 11, 12, or 13; aa86 to SEQ ID NO: 7, 11, 12, or 13 aa93; aa87 to aa94 of SEQ ID NO: 7, 11, 12, or 13; aa88 to aa95 of SEQ ID NO: 7, 11, 12, or 13; aa89 to aa96 of SEQ ID NO: 7, 11, 12, or 13; , 11, 12, or 13 aa90 to aa97; SEQ ID NO: 7, 11, 12, or 13 aa91 to aa98; SEQ ID NO: 7, 11, 12, or 13 aa92 to aa99; SEQ ID NO: 7, 11, 12, Or 13 aa93 to aa100; SEQ ID NO: 7, 11, 12, or 13 aa94 to aa101; SEQ ID NO: 7, 1, 12, or 13 aa95-aa102; SEQ ID NO: 7, 11, 12, or 13 aa96-aa103; SEQ ID NO: 7, 11, 12, or 13 aa97-aa104; SEQ ID NO: 7, 11, 12, or 13 aa98 to aa105; SEQ ID NO: 7, 11, 12, or 13 aa99 to aa106; SEQ ID NO: 7, 11, or 13 aa100 to aa107; SEQ ID NO: 7, 11, 12, or 13 aa101 to aa108; Aa102 to aa109 of No. 7, 11, 12, or 13; aa103 to aa110 of SEQ ID No. 7, 11, 12, or 13; aa104 to aa111 of SEQ ID No. 7, 11, 12, or 13; 12 or 13 aa105 to aa112; SEQ ID NO: 7, 11, 12, or 13 aa106 to aa113; aa107 to aa114 of SEQ ID NO: 7, 11, 12, or 13; aa108 to aa115 of SEQ ID NO: 7, 11, 12, or 13; aa109 to aa116 of SEQ ID NO: 7, 11, 12, or 13; Aa110 to aa117 of SEQ ID NO: 7, 11, 12, or 13; aa111 to aa118 of SEQ ID NO: 7, 11, 12, or 13; aa112 to aa119 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa113 to aa120; SEQ ID NO: 7, 11, 12, or 13 aa114 to aa121; SEQ ID NO: 7, 11, 12, or 13 aa115 to aa122; SEQ ID NO: 7, 11, 12, or 13 aa116 to aa123; aa1 of SEQ ID NO: 7, 11, 12, or 13 7 to aa124; aa118 to aa125 of SEQ ID NO: 7, 11, 12, or 13; aa119 to aa126 of SEQ ID NO: 7, 11, 12, or 13; aa120 to aa127 of SEQ ID NO: 7, 11, 12, or 13; Aa121 to aa128 of SEQ ID NO: 7, 11, 12, or 13; aa122 to aa129 of SEQ ID NO: 7, 11, 12, or 13; aa123 to aa130 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa124 to aa131; SEQ ID NO: 7, 11, 12, or 13 aa125 to aa132; SEQ ID NO: 7, 11, 12, or 13 aa126 to aa133; SEQ ID NO: 7, 11, 12, or 13 aa127 to aa134; aa128 to SEQ ID NO: 7, 11, 12, or 13 a135; aa129 to aa136 of SEQ ID NO: 7, 11, 12, or 13; aa130 to aa137 of SEQ ID NO: 7, 11, 12, or 13; aa131 to aa138 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa132-aa139; SEQ ID NO: 7, 11, 12, or 13 aa133-aa140; SEQ ID NO: 7, 11, 12, or 13 aa134-aa141; SEQ ID NO: 7, 11, 12, Or aa135-aa142 of SEQ ID NO: 7, 11, 12, or 13 aa136-aa143; aa137-aa144 of SEQ ID NO: 7, 11, 12, or 13; aa138- of SEQ ID NO: 7, 11, 12, or 13 aa145; aa139 to aa14 of SEQ ID NO: 7, 11, 12, or 13 6; aa140 to aa147 of SEQ ID NO: 7, 11, 12, or 13; aa141 to aa148 of SEQ ID NO: 7, 11, 12, or 13; aa142 to aa149 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa143-aa150; SEQ ID NO: 7, 11, 12, or 13 aa144-aa151; SEQ ID NO: 7, 11, 12, or 13 aa145-aa152; SEQ ID NO: 7, 11, 12, Or aa146 to aa153 of SEQ ID NO: 7, 11, 12, or 13 aa147 to aa154; aa148 to aa155 of SEQ ID NO: 7, 11, 12, or 13; aa149 to SEQ ID NO: 7, 11, 12, or 13 aa156; aa150 to aa157 of SEQ ID NO: 7, 11, 12, or 13; Aa151-aa158 of number 7, 11, 12, or 13; aa152-aa159 of SEQ ID NO: 7, 11, 12, or 13; aa153-aa160 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa154 to aa161; SEQ ID NO: 7, 11, 12, or 13 aa155 to aa162; SEQ ID NO: 7, 11, 12, or 13 aa156 to aa163; SEQ ID NO: 7, 11, 12, or 13 aa157 to aa164; aa158 to aa165 of SEQ ID NO: 7, 11, 12, or 13; aa159 to aa166 of SEQ ID NO: 7, 11, 12, or 13; aa160 to aa167 of SEQ ID NO: 7, 11, 12, or 13; Number 7

, 11, 12, or 13 aa161-aa168; SEQ ID NO: 7, 11, 12, or 13 aa162-aa169; SEQ ID NO: 7, 11, 12, or 13 aa163-aa170; SEQ ID NO: 7, 11, 12, Or aa164 to aa171 of SEQ ID NO: 7, 11, 12, or 13 aa165 to aa172; aa166 to aa173 of SEQ ID NO: 7, 11, 12, or 13; aa167 to SEQ ID NO: 7, 11, 12, or 13 aa174; aa168 to aa175 of SEQ ID NO: 7, 11, 12, or 13; aa169 to aa176 of SEQ ID NO: 7, 11, 12, or 13; aa170 to aa177 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa171-aa178; SEQ ID NO: 7, 11 12 or 13 aa172 to aa179; SEQ ID NO: 7, 11, 12, or 13 aa173 to aa180; SEQ ID NO: 7, 11, 12, or 13 aa174 to aa181; SEQ ID NO: 7, 11, 12, or 13 aa175 to aa182; aa176 to aa183 of SEQ ID NO: 7, 11, 12, or 13; aa177 to aa184 of SEQ ID NO: 7, 11, 12, or 13; aa178 to aa185 of SEQ ID NO: 7, 11, 12, or 13; Aa179-aa186 of SEQ ID NO: 7, 11, 12, or 13; aa180-aa187 of SEQ ID NO: 7, 11, 12, or 13; aa181-aa188 of SEQ ID NO: 7, 11, 12, or 13; 12, or 13 aa182 to aa189; SEQ ID NOs: 7, 11, 12 Or aa183 to aa190 of SEQ ID NO: 7, 11, 12, or 13; aa184 to aa191 of 13; aa185 to aa192 of SEQ ID NO: 7, 11, 12, or 13; aa186 to SEQ ID NO: 7, 11, 12, or 13 aa 193; aa 187 to aa 194 of SEQ ID NO: 7, 11, 12, or 13; aa 188 to aa 195 of SEQ ID NO: 7, 11, 12, or 13; aa 189 to aa 196 of SEQ ID NO: 7, 11, 12, or 13; , 11, 12, or 13 aa190-aa197; SEQ ID NO: 7, 11, 12, or 13 aa191-aa198; SEQ ID NO: 7, 11, 12, or 13 aa192-aa199; SEQ ID NO: 7, 11, 12, Or 13 aa193 to aa200; SEQ ID NO: 7, 11, 12, or 13 aa194-aa201; SEQ ID NO: 7, 11, 12, or 13 aa195-aa202; SEQ ID NO: 7, 11, 12, or 13 aa196-aa203; SEQ ID NO: 7, 11, 12, or 13 aa197-aa204 Aa198 to aa205 of SEQ ID NO: 7, 11, 12, or 13; aa199 to aa206 of SEQ ID NO: 7, 11, 12, or 13; aa200 to aa207 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa201 to aa208; SEQ ID NO: 7, 11, 12, or 13 aa202 to aa209; SEQ ID NO: 7, 11, 12, or 13 aa203 to aa210; SEQ ID NO: 7, 11, 12, or 13 aa204-aa211; SEQ ID NO: 7, 11, 12, or 13 a205 to aa212; aa206 to aa213 of SEQ ID NO: 7, 11, 12, or 13; aa207 to aa214 of SEQ ID NO: 7, 11, 12, or 13; aa208 to aa215 of SEQ ID NO: 7, 11, 12, or 13; Aa209 to aa216 of SEQ ID NO: 7, 11, 12, or 13; aa210 to aa217 of SEQ ID NO: 7, 11, 12, or 13; aa211 to aa218 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa212 to aa219; SEQ ID NO: 7, 11, 12, or 13 aa213 to aa220; SEQ ID NO: 7, 11, 12, or 13 aa214 to aa221; SEQ ID NO: 7, 11, 12, or 13 aa215-aa222; aa2 of SEQ ID NO: 7, 11, 12, or 13 6 to aa223; aa217 to aa224 of SEQ ID NO: 7, 11, 12, or 13; aa218 to aa225 of SEQ ID NO: 7, 11, 12, or 13; aa219 to aa226 of SEQ ID NO: 7, 11, 12, or 13; Aa220 to aa227 of number 7, 11, 12, or 13; aa221 to aa228 of SEQ ID NO: 7, 11, 12, or 13; aa222 to aa229 of SEQ ID NO: 7, 11, 12, or 13; Aa223-aa230 of 12, or 13; aa224-aa231 of SEQ ID NO: 7, 11, 12, or 13; aa225-aa232 of SEQ ID NO: 7, 11, 12, or 13; and SEQ ID NO: 7, 11, 12, or 13 Aa226 to aa233; aa22 of SEQ ID NO: 7, 11, 12, or 13 7 to aa234; aa228 to aa235 of SEQ ID NO: 7, 11, 12, or 13; aa229 to aa236 of SEQ ID NO: 7, 11, 12, or 13; aa230 to aa237 of SEQ ID NO: 7, 11, 12, or 13; Aa 231 to aa 238 of No. 7, 11, 12, or 13; aa 222 to aa 239 of SEQ ID No. 7, 11, 12, or 13; aa 233 to aa 240 of SEQ ID No. 7, 11, 12, or 13; 12 or 13 aa234 to aa41; SEQ ID NO: 7, 11, 12, or 13 aa235 to aa242; SEQ ID NO: 7, 11, 12, or 13 aa236 to aa243; SEQ ID NO: 7, 11, 12, or 13 aa237 to aa244; aa238 to aa of SEQ ID NO: 7, 11, 12, or 13 45; aa239 to aa246 of SEQ ID NO: 7, 11, 12, or 13; aa240 to aa247 of SEQ ID NO: 7, 11, 12, or 13; aa241 to aa248 of SEQ ID NO: 7, 11, 12, or 13; , 11, 12, or 13 aa242-aa249; SEQ ID NO: 7, 11, 12, or 13 aa243-aa250; SEQ ID NO: 7, 11, 12, or 13 aa244-aa251; SEQ ID NO: 7, 11, 12, Or aa245-aa252 of SEQ ID NO: 7, 11, 12, or 13 aa246-aa253; aa247-aa254 of SEQ ID NO: 7, 11, 12, or 13; aa248- of SEQ ID NO: 7, 11, 12, or 13 aa255; aa249 to aa256 of SEQ ID NO: 7, 11, 12, or 13 Aa250 to aa257 of SEQ ID NO: 7, 11, 12, or 13; aa251 to aa258 of SEQ ID NO: 7, 11, 12, or 13; aa252 to aa259 of SEQ ID NO: 7, 11, 12, or 13; , 12, or 13 aa253 to aa260; SEQ ID NO: 7, 11, 12, or 13 aa254 to aa261; SEQ ID NO: 7, 11, 12, or 13 aa255 to aa262; SEQ ID NO: 7, 11, 12, or 13 Aa256 to aa263 of SEQ ID NO: 7, 11, 12, or 13; aa257 to aa264 of SEQ ID NO: 7, 11, 12, or 13; aa258 to aa265 of SEQ ID NO: 7, 11, 12, or 13; aa259 to aa266 of SEQ ID NO: 7, 11, 121, or 13; Aa260 to aa267 of SEQ ID NO: 7, 11, 12, or 13; Aa261 to aa268 of SEQ ID NO: 7, 11, 12, or 13; aa262 to aa269 of SEQ ID NO: 7, 11, 12, or 13; aa263 to aa270 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa264-aa271; SEQ ID NO: 7, 11, 12, or 13 aa265-aa272; SEQ ID NO: 7, 11, 12, or 13 aa266-aa273; SEQ ID NO: 7, 11, 12, or 13 aa 267 to aa 274; SEQ ID NO: 7, 11, 12, or 13 aa 268 to aa 275; SEQ ID NO: 7, 11, 12, or 13 aa 269 to aa 276; SEQ ID NO: 7, 11, 12, or 13 aa 270 to aa 277; No. 7, 11, 12, or 13 aa271-aa278; SEQ ID NO: 7 11, 12, or 13 aa272-aa279; SEQ ID NO: 7, 11, 12, or 13 aa273-aa280; SEQ ID NO: 7, 11, 12, or 13 aa274-aa281; SEQ ID NO: 7, 11, 12, or 13 aa275-aa282; SEQ ID NO: 7, 11, 12, or 13 aa276-aa283; SEQ ID NO: 7, 11, 12, or 13 aa277-aa284; SEQ ID NO: 7, 11, 12, or 13 aa278-aa284 Aa279-aa286 of SEQ ID NO: 7, 11, 12, or 13; aa280-aa287 of SEQ ID NO: 7, 11, 12, or 13; aa281-aa288 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa282 to aa289; SEQ ID NO: 7, 11 12 or 13; aa283-aa290; aa284-aa291 of SEQ ID NO: 7, 11, 12, or 13; aa285-aa292 of SEQ ID NO: 7, 11, 12, or 13; aa286 to aa293; SEQ ID NO: 7, 11, 12 or 13; aa287 to aa294; aa288 to aa295 of SEQ ID NO: 7, 11, 12, or 13; aa289 to aa296 of SEQ ID NO: 7, 11, 12, or 13; 7, 11, 12, or 13 aa 290-aa 297; SEQ ID NO: 7, 11, 12, or 13 aa 291-aa 298; SEQ ID NO: 7, 11, 12, or 13 aa 292-aa 299; SEQ ID NO: 7, 11, 12 Or aa293 to aa300 of 13; SEQ ID NO: 7, 11, 12, or Or aa294 to aa101 of SEQ ID NO: 7, 11, 12, or 13 aa295 to aa102; aa296 to aa103 of SEQ ID NO: 7, 11, 12, or 13; aa297 of SEQ ID NO: 7, 11, 12, or 13 ~ Aa104; aa298 to aa105 of SEQ ID NO: 7, 11, 12, or 13; aa299 to aa106 of SEQ ID NO: 7, 11, 12, or 13; aa300 to aa307 of SEQ ID NO: 7, 11, 12, or 13; 7, 11, 12, or 13 aa301 to aa308; SEQ ID NO: 7, 11, 12, or 13 aa302 to aa309; SEQ ID NO: 7, 11, 12, or 13 aa303 to aa310; SEQ ID NO: 7 aa304 to aa311 Aa305 to aa31 of SEQ ID NO: 7, 11, 12, or 13 Aa 306 to aa 313 of SEQ ID NO: 7, 11, 12, or 13; aa 307 to aa 314 of SEQ ID NO: 7, 11, 12, or 13; aa 308 to aa 315 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa309-aa316; SEQ ID NO: 7, 11, 12, or 13 aa310-aa317; SEQ ID NO: 7, 11, 12, or 13 aa311-aa318; SEQ ID NO: 7, 11, 12, or 13 aa 312 to aa 319; SEQ ID NO: 7, 11, 12, or 13 aa 313 to aa 320; SEQ ID NO: 7, 11, 12, or 13 aa 314 to aa 321; SEQ ID NO: 7, 11, 12, or 13 aa 315 to aa 322 Aa316 to aa323 of SEQ ID NO: 7, 11, 12, or 13; Aa317 to aa324 of number 7, 11, 12, or 13; aa318 to aa325 of SEQ ID NO: 7, 11, 12, or 13; aa319 to aa326 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13; aa320 to aa327; aa321 to aa328 of SEQ ID NO: 7, 11, 12, or 13; aa322 to aa329 of SEQ ID NO: 7, 11, 12, or 13; of SEQ ID NO: 7, 11, 12, or 13 aa324 to aa331; SEQ ID NO: 7, 11, 12, or 13 aa324 to aa331; SEQ ID NO: 7, 11, 12, or 13 aa325 to aa332; SEQ ID NO: 7, 11, 12, or 13; aa326 to aa333; Aa327 to aa334 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: 7, 11, 12, or 13 aa328 to aa335; SEQ ID NO: 7, 11, 12, or 13; aa329 to aa336; SEQ ID NO: 7, 11, 12, or 13 aa330 to aa337; SEQ ID NO: 7, 11, 12, or 13 aa331 to aa338; SEQ ID NO:

7, 11, 12, or 13 aa 332-aa 339; SEQ ID NO: 7, 11, 12, or 13 aa 333-aa 340; SEQ ID NO: 7, 11, 12, or 13 aa 334-aa 341; SEQ ID NO: 7, 11, 12 Or aa335 to aa342 of SEQ ID NO: 7, 11, 12, or 13 aa336 to aa343; aa337 to aa344 of SEQ ID NO: 7, 11, 12, or 13; aa338 of SEQ ID NO: 7, 11, 12, or 13 ~ Aa345; aa339 to aa346 of SEQ ID NO: 7, 11, 12, or 13; aa340 to aa347 of SEQ ID NO: 7, 11, 12, or 13; aa341 to aa348 of SEQ ID NO: 7, 11, 12, or 13; 7, 11, 12, or 13 aa342 to aa349; SEQ ID NO: 7, 1 , 12, or 13 aa343 to aa350; SEQ ID NO: 7, 11, 12, or 13 aa344 to aa351; SEQ ID NO: 7, 11, 12, or 13 aa345 to aa352; SEQ ID NO: 7, 11, 12, or 13 Aa346 to aa353; SEQ ID NO: 7, 11, 12, or 13 aa347 to aa354; SEQ ID NO: 7, 11, 12, or 13 aa348 to aa355; SEQ ID NO: 7, 11, 12, or 13 aa349 to aa356; Aa350 to aa357 of SEQ ID NO: 7, 11, 12, or 13; aa351 to aa358 of SEQ ID NO: 7, 11, 12, or 13; aa352 to aa359 of SEQ ID NO: 7, 11, 12, or 13; , 12, or 13 aa353 to aa360; SEQ ID NOS: 7, 11, 1 Or aa354 to aa361 of SEQ ID NO: 7, 11, 12, or 13 aa355 to aa362; aa356 to aa363 of SEQ ID NO: 7, 11, 12, or 13; aa357 of SEQ ID NO: 7, 11, 12, or 13 Aa 364; aa 358 to aa 365 of SEQ ID NO: 7, 11, 12, or 13; aa 359 to aa 366 of SEQ ID NO: 7, 11, 12, or 13; aa 360 to aa 367 of SEQ ID NO: 7, 11, 12, or 13; Aa361 to aa368 of 7, 11, 12, or 13; aa362 to aa369 of SEQ ID NO: 7, 11, 12, or 13; aa363 to aa370 of SEQ ID NO: 7, 11, 12, or 13; , Or 13 aa364-aa371; SEQ ID NO: 7, 11, 12, or 13 aa365-aa372; SEQ ID NO: 7, 11, 12, or 13 aa366-aa373; SEQ ID NO: 7, 11, 12, or 13 aa367-aa374; SEQ ID NO: 7, 11, 12, or 13 aa368- aa 375; aa 369 to aa 376 of SEQ ID NO: 7, 11, 12, or 13; aa 370 to aa 377 of SEQ ID NO: 7, 11, 12, or 13; aa 371 to aa 378 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa372-aa379; SEQ ID NO: 7, 11, 12, or 13 aa373-aa380; SEQ ID NO: 7, 11, 12, or 13 aa374-aa381; SEQ ID NO: 7, 11, 12, Or 13 aa 375-aa 382; SEQ ID NO: 7, 11, 12, or 13 aa376 to aa383; aa377 to aa384 of SEQ ID NO: 7, 11, 12, or 13; aa378 to aa385 of SEQ ID NO: 7, 11, 12, or 13; aa379 to aa386 of SEQ ID NO: 7, 11, 12, or 13; Aa380 to aa387 of number 7, 11, 12, or 13; aa381 to aa388 of SEQ ID NO: 7, 11, 12, or 13; aa382 to aa389 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa383 to aa390; SEQ ID NO: 7, 11, 12, or 13 aa384 to aa391; SEQ ID NO: 7, 11, 12, or 13 aa385 to aa392; SEQ ID NO: 7, 11, 12, or 13 aa386-aa393; aa of SEQ ID NO: 7, 11, 12, or 13 87-aa394; aa388-aa395 of SEQ ID NO: 7, 11, 12, or 13; aa389-aa396 of SEQ ID NO: 7, 11, 12, or 13; aa390-aa397 of SEQ ID NO: 7, 11, 12, or 13; Aa391 to aa398 of number 7, 11, 12, or 13; aa392 to aa399 of SEQ ID NO: 7, 11, 12, or 13; aa393 to aa400 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa 394 to aa 401; SEQ ID NO: 7, 11, 12, or 13 aa 395 to aa 402; SEQ ID NO: 7, 11, 12, or 13 aa 396 to aa 403; SEQ ID NO: 7, 11, 12, or 13 aa397-aa404; SEQ ID NO: 7, 11, 12, or 13; aa398- aa405; aa399 to aa406 of SEQ ID NO: 7, 11, 12, or 13; aa400 to aa407 of SEQ ID NO: 7, 11, 12, or 13; aa401 to aa408 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa402-aa409; SEQ ID NO: 7, 11, 12, or 13; aa403-aa410; SEQ ID NO: 7, 11, 12, or 13 aa404-aa411; SEQ ID NO: 7, 11, 12, Or aa405 to aa412 of SEQ ID NO: 7, 11, 12, or 13; aa406 to aa413 of SEQ ID NO: 7, 11, 12, or 13; aa407 to aa414 of SEQ ID NO: 7, 11, 12, or 13; aa415; aa409 to aa4 of SEQ ID NO: 7, 11, 12, or 13 6; aa410-aa417 of SEQ ID NO: 7, 11, 12, or 13; aa411-aa418 of SEQ ID NO: 7, 11, 12, or 13; aa412-aa419 of SEQ ID NO: 7, 11, 12, or 13; 7, 11, 12, or 13 aa 413 to aa 420; SEQ ID NO: 7, 11, 12, or 13 aa 414 to aa 421; SEQ ID NO: 7, 11, 12, or 13 aa 415 to aa 422; SEQ ID NO: 7, 11, 12 Or aa416 to aa423; SEQ ID NO: 7, 11, 12, or 13 aa417 to aa424; SEQ ID NO: 7, 11, 12, or 13 aa418 to aa425; SEQ ID NO: 7, 11, 12, or 13 aa419 Aa426; aa420 to aa427 of SEQ ID NO: 7, 11, 12, or 13 SEQ ID NO: 7, 11, 12, or 13; aa421-aa428; SEQ ID NO: 7, 11, 12, or 13 aa422-aa429; SEQ ID NO: 7, 11, 12, or 13 aa423-aa430; SEQ ID NO: 7, 11 , 12, or 13 aa424-aa431; SEQ ID NO: 7, 11, 12, or 13 aa425-aa432; SEQ ID NO: 7, 11, 12, or 13 aa426-aa433; SEQ ID NO: 7, 11, 12, or 13 Aa427 to aa434; SEQ ID NO: 7, 11, 12, or 13 aa428 to aa435; SEQ ID NO: 7, 11, 12, or 13 aa429 to aa436; SEQ ID NO: 7, 11, 12, or 13 aa430 to aa437; Aa431 to aa438 of SEQ ID NO: 7, 11, 12, or 13; SEQ ID NO: No. 7, 11, 12, or 13 aa 432-aa 439; SEQ ID NO: 7, 11, 12, or 13 aa 433-aa 440; SEQ ID NO: 7, 11, 12, or 13 aa 434-aa 441; SEQ ID NO: 7, 11, 12 or 13 aa435 to aa442; SEQ ID NO: 7, 11, 12, or 13 aa436 to aa443; SEQ ID NO: 7, 11, 12, or 13 aa437 to aa444; SEQ ID NO: 7, 11, 12, or 13 aa439 to aa446 in SEQ ID NO: 7, 11, 12, or 13; aa440 to aa447 in SEQ ID NO: 7, 11, 12, or 13; aa441 to aa448 in SEQ ID NO: 7, 11, 12, or 13; Aa442-aa449 of No. 7, 11, 12, or 13; SEQ ID NO: 7, 1, 12, or 13 aa443-aa450; SEQ ID NO: 7, 11, 12, or 13 aa444-aa451; SEQ ID NO: 7, 11, 12, or 13 aa445-aa452; SEQ ID NO: 7, 11, 12, or 13 aa446 to aa453; SEQ ID NO: 7, 11, 12, or 13 aa447 to aa454; SEQ ID NO: 7, 11, 12, or 13 aa448 to aa455; SEQ ID NO: 7, 11, 12, or 13 aa449 to aa456 Aa450 to aa457 of SEQ ID NO: 7, 11, 12, or 13; aa451 to aa458 of SEQ ID NO: 7, 11, 12, or 13; aa452 to aa459 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa453-aa460; SEQ ID NO: 7, 11, 2 or 13 aa454-aa461; SEQ ID NO: 7, 11, 12, or 13 aa455-aa462; SEQ ID NO: 7, 11, 12, or 13 aa456-aa463; SEQ ID NO: 7, 11, 12, or 13 aa457 to aa464; aa458 to aa465 of SEQ ID NO: 7, 11, 12, or 13; aa459 to aa466 of SEQ ID NO: 7, 11, 12, or 13; aa460 to aa467 of SEQ ID NO: 7, 11, 12, or 13; Aa461 to aa468 of No. 7, 11, 12, or 13; aa462 to aa469 of SEQ ID No. 7, 11, 12, or 13; aa463 to aa470 of SEQ ID No. 7, 11, 12, or 13; 12, or 13 aa464 to aa471; SEQ ID NOs: 7, 11, 12, or Or aa466 to aa473 of SEQ ID NO: 7, 11, 12, or 13; aa467 to aa474 of SEQ ID NO: 7, 11, 12, or 13; aa468 of SEQ ID NO: 7, 11, 12, or 13 Aa469 to aa476 of SEQ ID NO: 7, 11, 12, or 13; aa470 to aa477 of SEQ ID NO: 7, 11, 12, or 13; aa471 to aa478 of SEQ ID NO: 7, 11, 12, or 13; 7, 11, 12, or 13 aa472 to aa479; SEQ ID NO: 7, 11, 12, or 13 aa473 to aa480; SEQ ID NO: 7, 11, 12, or 13 aa474 to aa481; SEQ ID NO: 7, 11, 17 Or 13 aa475 to aa482; SEQ ID NO: 7, 11, 12, or 1 Aa476 to aa484 of SEQ ID NO: 7, 11, 12, or 13; aa477 to aa484 of SEQ ID NO: 7, 11, 12, or 13; aa479 to aa486 of SEQ ID NO: 7, 11, 12, or 13; Aa 480-aa 487 of SEQ ID NO: 7, 11, 12, or 13; aa 481-aa 488 of SEQ ID NO: 7, 11, 12, or 13; aa 482-aa 489 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa483-aa490; SEQ ID NO: 7, 11, 12, or 13 aa484-aa491; SEQ ID NO: 7, 11, 12, or 13 aa485-aa492; SEQ ID NO: 7, 11, 12, or 13 aa486-aa493; aa of SEQ ID NO: 7, 11, 12, or 13 87-aa494; aa488-aa495 of SEQ ID NO: 7, 11, 12, or 13; aa489-aa496 of SEQ ID NO: 7, 11, 12, or 13; aa490-aa497 of SEQ ID NO: 7, 11, 12, or 13; Aa 491-aa 498 of SEQ ID NO: 7, 11, 12, or 13; aa 492-aa 499 of SEQ ID NO: 7, 11, 12, or 13; aa 493-aa 500 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa494-aa501; SEQ ID NO: 7, 11, 12, or 13 aa495-aa502; SEQ ID NO: 7, 11, 12, or 13 aa496-aa503; SEQ ID NO: 7, 11, 12, or 13 aa497 to aa504; aa498 to SEQ ID NO: 7, 11, 12, or 13 aa 505; aa 499 to aa 506 of SEQ ID NO: 7, 11, 12, or 13; aa 500 to aa 507 of SEQ ID NO: 7, 11, 12, or 13; aa 501 to aa 508 of SEQ ID NO: 7, 11, 12, or 13; , 11, 12, or 13 aa502-a

a509; aa503 to aa510 of SEQ ID NO: 7, 11, 12, or 13; aa504 to aa511 of SEQ ID NO: 7, 11, 12, or 13; aa505 to aa512 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa 506 to aa 513; SEQ ID NO: 7, 11, 12, or 13 aa 507 to aa 514; SEQ ID NO: 7, 11, 12, or 13 aa 508 to aa 515; SEQ ID NO: 7, 11, 12, Or aa509-aa516 of SEQ ID NO: 7, 11, 12, or 13 aa510-aa517; aa511-aa518 of SEQ ID NO: 7, 11, 12, or 13; aa512 of SEQ ID NO: 7, 11, 12, or 13 aa519; aa513 to aa52 of SEQ ID NO: 7, 11, 12, or 13 Aa514 to aa521 of SEQ ID NO: 7, 11, 12, or 13; aa515 to aa522 of SEQ ID NO: 7, 11, 12, or 13; aa516 to aa523 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa 517 to aa 524; SEQ ID NO: 7, 11, 12, or 13 aa 518 to aa 525; SEQ ID NO: 7, 11, 12, or 13 aa 519 to aa 526; SEQ ID NO: 7, 11, 12, or 13 aa 520-aa 527; SEQ ID NO: 7, 11, 12, or 13 aa 521-aa 528; SEQ ID NO: 7, 11, 12, or 13 aa 522-aa 529; SEQ ID NO: 7, 11, 12, or 13 aa 523-aa 530 Aa524 to aa531 of SEQ ID NO: 7, 11, 12, or 13; Aa 525 to aa 532 of SEQ ID NO: 7, 11, 12, or 13; aa 526 to aa 533 of SEQ ID NO: 7, 11, 12, or 13; aa 527 to aa 534 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa 528 to aa 535; SEQ ID NO: 7, 11, 12, or 13 aa 529 to aa 536; SEQ ID NO: 7, 11, 12, or 13 aa 530 to aa 537; SEQ ID NO: 7, 11, 12, or 13 aa531-aa538; aa532-aa539 of SEQ ID NO: 7, 11, 12, or 13; aa533-aa540 of SEQ ID NO: 7, 11, 12, or 13; aa534-aa541; of SEQ ID NO: 7, 11, 12, or 13; Of SEQ ID NO: 7, 11, 12, or 13; aa535-aa542; SEQ ID NO: No. 7, 11, 12, or 13 aa536-aa543; SEQ ID NO: 7, 11, 12, or 13 aa537-aa544; SEQ ID NO: 7, 11, 12, or 13 aa538-aa545; SEQ ID NO: 7, 11, 12 or 13 aa539 to aa546; SEQ ID NO: 7, 11, 12, or 13 aa540 to aa547; SEQ ID NO: 7, 11, 12, or 13 aa541 to aa548; SEQ ID NO: 7, 11, 12, or 13 aa 542 to aa 549; aa 543 to aa 550 of SEQ ID NO: 7, 11, 12, or 13; aa 544 to aa 551 of SEQ ID NO: 7, 11, 12, or 13; aa 545 to aa 552 of SEQ ID NO: 7, 11, 12, or 13; Aa546 to aa553 of No. 7, 11, 12, or 13; SEQ ID NO: 7, 1, 12, or 13 aa 547 to aa 554; SEQ ID NO: 7, 11, 12, or 13 aa 548 to aa 555; SEQ ID NO: 7, 11, 12, or 13 aa 549 to aa 556; SEQ ID NO: 7, 11, 12, or 13 aa550 to aa557; SEQ ID NO: 7, 11, 12, or 13 aa551 to aa558; SEQ ID NO: 7, 11, 12, or 13 aa552 to aa559; SEQ ID NO: 7, 11, 12, or 13 aa553 to aa560 Aa554 to aa561 of SEQ ID NO: 7, 11, 12, or 13; aa555 to aa562 of SEQ ID NO: 7, 11, 12, or 13; aa556 to aa563 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa557-aa564; SEQ ID NO: 7, 11, 2 or 13 aa558 to aa565; SEQ ID NO: 7, 11, 12, or 13 aa559 to aa566; SEQ ID NO: 7, 11, 12, or 13 aa560 to aa567; SEQ ID NO: 7, 11, 12, or 13 aa561 to aa568; aa562 to aa569 of SEQ ID NO: 7, 11, 12, or 13; aa563 to aa570 of SEQ ID NO: 7, 11, 12, or 13; aa564 to aa571 of SEQ ID NO: 7, 11, 12, or 13; Aa 565 to aa 572 of SEQ ID NO: 7, 11, 12, or 13; aa 567 to aa 573 of SEQ ID NO: 7, 11, 12, or 13; aa 567 to aa 574 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa568 to aa575; SEQ ID NOS: 7, 11, 12, or Or aa569 to aa576 of SEQ ID NO: 7, 11, 12, or 13 aa570 to aa577; aa571 to aa578 of SEQ ID NO: 7, 11, 12, or 13; aa572 of SEQ ID NO: 7, 11, 12, or 13 ~ Aa579; aa573 to aa580 of SEQ ID NO: 7, 11, 12, or 13; aa574 to aa581; SEQ ID NO: 7, 11, 12, or 13; aa575 to aa582 of SEQ ID NO: 7, 11, 12, or 13; Aa576 to aa583 of No. 7, 11, 12, or 13; aa577 to aa584 of SEQ ID No. 7, 11, 12, or 13; aa578 to aa585 of SEQ ID No. 7, 11, 12, or 13; 12, or 13 aa579 to aa586; SEQ ID NO: 7, 11, 12, or 3 aa580 to aa587; SEQ ID NO: 7, 11, 12, or 13 aa581 to aa588; SEQ ID NO: 7, 11, 12, or 13 aa582 to aa589; SEQ ID NO: 7, 11, 12, or 13 aa583 to aa590 Aa584-aa591 of SEQ ID NO: 7, 11, 12, or 13; aa585-aa592 of SEQ ID NO: 7, 11, 12, or 13; aa586-aa593 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa 587 to aa 594; SEQ ID NO: 7, 11, 12, or 13 aa 588 to aa 595; SEQ ID NO: 7, 11, 12, or 13 aa 589 to aa 596; SEQ ID NO: 7, 11, 12, or 13 aa590 to aa597; SEQ ID NO: 7, 11, 12, or 13 aa592-aa598 of SEQ ID NO: 7, 11, 12, or 13; aa593-aa600 of SEQ ID NO: 7, 11, 12, or 13; aa594-aa601 of SEQ ID NO: 7, 11, 12, or 13; Aa 595 to aa 602 of SEQ ID NO: 7, 11, 12, or 13; aa 596 to aa 603 of SEQ ID NO: 7, 11, 12, or 13; aa 597 to aa 604 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa598 to aa605; SEQ ID NO: 7, 11, 12, or 13; aa599 to aa606; SEQ ID NO: 7, 11, 12, or 13 aa600 to aa607; SEQ ID NO: 7, 11, 12, or 13 Aa601-aa608; aa6 of SEQ ID NO: 7, 11, 12, or 13 Aa603-aa610 of SEQ ID NO: 7, 11, 12, or 13; aa604-aa611 of SEQ ID NO: 7, 11, 12, or 13; aa605-aa612 of SEQ ID NO: 7, 11, 12, or 13; Aa606 to aa613 of number 7, 11, 12, or 13; aa607 to aa614 of SEQ ID NO: 7, 11, 12, or 13; aa608 to aa615 of SEQ ID NO: 7, 11, 12, or 13; 12 or 13 aa609-aa616; SEQ ID NO: 7, 11, 12, or 13 aa610-aa617; SEQ ID NO: 7, 11, 12, or 13 aa611-aa618; SEQ ID NO: 7, 11, 12, or 13 aa612-aa619; aa613- of SEQ ID NO: 7, 11, 12, or 13 a620; aa614 to aa621 of SEQ ID NO: 7, 11, 12, or 13; aa615 to aa622 of SEQ ID NO: 7, 11, 12, or 13; aa616 to aa623 of SEQ ID NO: 7, 11, 12, or 13; 11, 12, or 13 aa617 to aa624; SEQ ID NO: 7, 11, 12, or 13 aa618 to aa625; SEQ ID NO: 7, 11, 12, or 13 aa619 to aa626; SEQ ID NO: 12 or 13 aa620 to aa 627; aa 621 to aa 628 of SEQ ID NO: 12 or 13; aa 622 to aa 629 of SEQ ID NO: 12 or 13; aa 623 to aa 630 of SEQ ID NO: 12 or 13; aa 624 to aa 631 of SEQ ID NO: 12 or 13; aa632; SEQ ID NO: 12 or 13 aa626 to aa633; SEQ ID NO: 12 or 13 aa627 to aa634; SEQ ID NO: 12 or 13 aa628 to aa635; SEQ ID NO: 12 or 13 aa629 to aa636; SEQ ID NO: 12 or 13 aa630 to aa636; SEQ ID NO: 12 or 13 aa631-aa638; SEQ ID NO: 12 or 13 aa632-aa639; SEQ ID NO: 12 or 13 aa633-aa640; SEQ ID NO: 12 or 13 aa634-aa641; SEQ ID NO: 12 or 13 aa635-aa642; SEQ ID NO: 12 or 13 aa636 to aa643; SEQ ID NO: 12 or 13 aa637 to aa644; SEQ ID NO: 12 or 13 aa638 to aa645; SEQ ID NO: 12 or 13 aa639 to aa646; Aa 640 to aa 647 of SEQ ID NO: 12 or 13; aa 641 to aa 648 of SEQ ID NO: 12 or 13; aa 642 to aa 649 of SEQ ID NO: 12 or 13; aa 644 to aa 650 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 13 aa645-aa652; SEQ ID NO: 12 or 13 aa646-aa653; SEQ ID NO: 12 or 13 aa647-aa654; SEQ ID NO: 12 or 13 aa648-aa655; SEQ ID NO: 12 or 13 aa649-aa656; Aa650 to aa657 of SEQ ID NO: 12 or 13; aa651 to aa658 of SEQ ID NO: 12 or 13; aa652 to aa659 of SEQ ID NO: 12 or 13; aa653 to aa66 of SEQ ID NO: 12 or 13 Aa655 to aa661 of SEQ ID NO: 12 or 13; aa656 to aa663 of SEQ ID NO: 12 or 13; aa657 to aa664 of SEQ ID NO: 12 or 13; aa658 to aa665 of SEQ ID NO: 12 or 13; Aa659 to aa666 of SEQ ID NO: 12 or 13; aa660 to aa667 of SEQ ID NO: 12 or 13; aa661 to aa668 of SEQ ID NO: 12 or 13; aa661 to aa669 of SEQ ID NO: 12 or 13; aa663 to aa670 of SEQ ID NO: 12 or 13; Aa664 to aa671 in SEQ ID NO: 12 or 13; aa665 to aa672 in SEQ ID NO: 12 or 13; aa666 to aa673 in SEQ ID NO: 12 or 13; aa667 to a in SEQ ID NO: 12 or 13; 674; aa668 to aa675 of SEQ ID NO: 12 or 13; aa669 to aa676 of SEQ ID NO: 12 or 13; aa670 to aa677 of SEQ ID NO: 12 or 13; aa671 to aa678 of SEQ ID NO: 12 or 13; aa672 to SEQ ID NO: 12 or 13 aa673-aa680 of SEQ ID NO: 12 or 13; aa674-aa681 of SEQ ID NO: 12 or 13; aa675-aa682 of SEQ ID NO: 12 or 13; aa676-aa683 of SEQ ID NO: 12 or 13; aa677 of SEQ ID NO: 12 or 13 aa 684; aa 679 to aa 686 of SEQ ID NO: 12 or 13; aa 680 to aa 687 of SEQ ID NO: 12 or 13; aa 681 of SEQ ID NO: 12 or 13 ~ Aa688; aa682 to aa689 of SEQ ID NO: 12 or 13; aa683 to aa690 of SEQ ID NO: 12 or 13; aa684 to aa691 of SEQ ID NO: 12 or 13; aa685 to aa692 of SEQ ID NO: 12 or 13; ~

aa687 to aa694 of SEQ ID NO: 12 or 13, aa688 to aa695 of SEQ ID NO: 12 or 13, aa689 to aa696 of SEQ ID NO: 12 or 13, aa690 to aa697 of SEQ ID NO: 12 or 13, aa691 of SEQ ID NO: 12 or 13 aa 698; aa 692-aa 699 of SEQ ID NO: 12 or 13; aa 693-aa 700 of SEQ ID NO: 12 or 13; aa 694-aa 701 of SEQ ID NO: 12 or 13; aa 695-aa 702 of SEQ ID NO: 12 or 13; aa703; aa697 to aa704 of SEQ ID NO: 12 or 13; aa698 to aa705 of SEQ ID NO: 12 or 13; aa699 to aa706 of SEQ ID NO: 12 or 13; aa7 of SEQ ID NO: 12 or 13 0 to aa707; aa701 to aa708 of SEQ ID NO: 12 or 13; aa702 to aa709 of SEQ ID NO: 12 or 13; aa703 to aa710 of SEQ ID NO: 12 or 13; aa704 to aa711 of SEQ ID NO: 12 or 13; aa 705 to aa 712; SEQ ID NO: 12 or 13 aa 76 to aa 713; SEQ ID NO: 12 or 13 aa 707 to aa 714; SEQ ID NO: 12 or 13 aa 708 to aa 715; SEQ ID NO: 12 or 13 aa 709 to aa 716; aa 710 to aa 717; aa 711 to aa 718 of SEQ ID NO: 12 or 13; aa 712 to aa 719 of SEQ ID NO: 12 or 13; aa 713 to aa 720 of SEQ ID NO: 12 or 13; a of SEQ ID NO: 12 or 13 714-aa721; aa715-aa722 of SEQ ID NO: 12 or 13; aa716-aa723 of SEQ ID NO: 12 or 13; aa717-aa724 of SEQ ID NO: 12 or 13; aa718-aa725 of SEQ ID NO: 12 or 13; aa720 to aa727 of SEQ ID NO: 12 or 13; aa721 to aa728 of SEQ ID NO: 12 or 13; aa722 to aa729 of SEQ ID NO: 12 or 13; aa723 to aa730 of SEQ ID NO: 12 or 13; aa724 to aa731; aa725 to aa732 of SEQ ID NO: 12 or 13; aa726 to aa733 of SEQ ID NO: 12 or 13; aa727 to aa734 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 13 Aa 728 to aa 735; SEQ ID NO: 12 or 13 aa 729 to aa 736; SEQ ID NO: 12 or 13 aa 730 to aa 737; SEQ ID NO: 12 or 13 aa 731 to aa 738; SEQ ID NO: 12 or 13 aa 732 to aa 739; Aa 733 to aa 740; SEQ ID NO: 12 or 13 aa 734 to aa 741; SEQ ID NO: 12 or 13 aa 735 to aa 742; SEQ ID NO: 12 or 13 aa 736 to aa 743; SEQ ID NO: 12 or 13 aa 737 to aa 744; Aa738-aa745 of SEQ ID NO: 12 or 13; aa740-aa747 of SEQ ID NO: 12 or 13; aa741-aa748 of SEQ ID NO: 12 or 13; 13 aa742-aa749; SEQ ID NO: 12 or 13 aa743-aa750; SEQ ID NO: 12 or 13 aa744-aa751; SEQ ID NO: 12 or 13 aa745-aa752; SEQ ID NO: 12 or 13 aa746-aa753; SEQ ID NO: 12 or 13 aa747 to aa754; SEQ ID NO: 12 or 13 aa748 to aa755; SEQ ID NO: 12 or 13 aa749 to aa756; SEQ ID NO: 12 or 13 aa750 to aa757; SEQ ID NO: 12 or 13 aa751 to aa758; SEQ ID NO: 12 or 13 aa 752-aa 759; SEQ ID NO: 12 or 13 aa 753-aa 760; SEQ ID NO: 12 or 13 aa 754-aa 761; SEQ ID NO: 12 or 13 aa 755-aa 762; SEQ ID NO: 1 Or aa756 to aa763; SEQ ID NO: 12 or 13 aa757 to aa764; SEQ ID NO: 12 or 13 aa758 to aa765; SEQ ID NO: 12 or 13 aa759 to aa766; SEQ ID NO: 12 or 13 aa760 to aa767; SEQ ID NO: 12 Or aa761 to aa768 of SEQ ID NO: 12 or 13; aa763 to aa770 of SEQ ID NO: 12 or 13; aa764 to aa771 of SEQ ID NO: 12 or 13; aa765 to aa772 of SEQ ID NO: 12 or 13; Or 13 aa766 to aa773; SEQ ID NO: 12 or 13 aa767 to aa774; SEQ ID NO: 12 or 13 aa768 to aa775; SEQ ID NO: 12 or 13 aa769 to aa777; SEQ ID NO: SEQ ID NO: 12 or 13, aa 771-aa 778; SEQ ID NO: 12 or 13, aa 772-aa 779; SEQ ID NO: 12 or 13, aa 773-aa 780; SEQ ID NO: 12 or 13; an 774-aa 781; SEQ ID NO: 12 or 13 aa777 to aa784; SEQ ID NO: 12 or 13 aa777 to aa784; SEQ ID NO: 12 or 13 aa778 to aa784; SEQ ID NO: 12 or 13 aa778 to aa786; SEQ ID NO: 12 or 13, aa 780-aa 787; SEQ ID NO: 12 or 13, aa 781-aa 788; SEQ ID NO: 12 or 13, aa 782-aa 789; SEQ ID NO: 12 or 13, aa 783-aa 790; Aa784 to aa791 of SEQ ID NO: 12 or 13; aa786 to aa793 of SEQ ID NO: 12 or 13; aa787 to aa794 of SEQ ID NO: 12 or 13; aa788 to aa795 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 13 aa 789-aa 796; SEQ ID NO: 12 or 13 aa 790-aa 797; SEQ ID NO: 12 or 13 aa 791-aa 798; SEQ ID NO: 12 or 13 aa 792-aa 799; SEQ ID NO: 12 or 13 aa 793-aa 800; Aa794 to aa801 of SEQ ID NO: 12 or 13; aa795 to aa802 of SEQ ID NO: 12 or 13; aa796 to aa803 of SEQ ID NO: 12 or 13; aa797 to aa8 of SEQ ID NO: 12 or 13 4; aa 798 to aa 805 of SEQ ID NO: 12 or 13; aa 799 to aa 806 of SEQ ID NO: 12 or 13; aa 800 to aa 807 of SEQ ID NO: 12 or 13; aa 801 to aa 808 of SEQ ID NO: 12 or 13; aa 809; aa 803 to aa 810 of SEQ ID NO: 12 or 13; aa 804 to aa 811 of SEQ ID NO: 12 or 13; aa 805 to aa 812 of SEQ ID NO: 12 or 13; aa 806 to aa 813 of SEQ ID NO: 12 or 13; aa 814; aa 808 to aa 815 of SEQ ID NO: 12 or 13; aa 809 to aa 816 of SEQ ID NO: 12 or 13; aa 810 to aa 817 of SEQ ID NO: 12 or 13; aa 811 to a of SEQ ID NO: 12 or 13 a818; aa812-aa819 of SEQ ID NO: 12 or 13; aa814-aa821 of SEQ ID NO: 12 or 13; aa815-aa822 of SEQ ID NO: 12 or 13; aa816- of SEQ ID NO: 12 or 13 aa 823; SEQ ID NO: 12 or 13 aa 817 to aa 824; SEQ ID NO: 12 or 13 aa 818 to aa 825; SEQ ID NO: 12 or 13 aa 819 to aa 826; SEQ ID NO: 12 or 13 aa 820 to aa 827; aa828; aa822-aa829 of SEQ ID NO: 12 or 13; aa823-aa830 of SEQ ID NO: 12 or 13; aa824-aa831 of SEQ ID NO: 12 or 13; aa82 of SEQ ID NO: 12 or 13 ~ Aa832; aa826 to aa833 of SEQ ID NO: 12 or 13; aa837 to aa834 of SEQ ID NO: 12 or 13; aa828 to aa835 of SEQ ID NO: 12 or 13; aa829 to aa836 of SEQ ID NO: 12 or 13; ~ Aa837; aa831-aa838 of SEQ ID NO: 12 or 13; aa832-aa839 of SEQ ID NO: 12 or 13; aa833-aa840 of SEQ ID NO: 12 or 13; aa834-aa841 of SEQ ID NO: 12 or 13; aa835 of SEQ ID NO: 12 or 13 ~ Aa842; aa836 to aa843 of SEQ ID NO: 12 or 13; aa837 to aa844 of SEQ ID NO: 12 or 13; aa838 to aa845 of SEQ ID NO: 12 or 13; a of SEQ ID NO: 12 or 13 839 to aa846; aa840 to aa847 of SEQ ID NO: 12 or 13; aa841 to aa848 of SEQ ID NO: 12 or 13; aa842 to aa848 of SEQ ID NO: 12 or 13; aa843 to aa850 of SEQ ID NO: 12 or 13; aa844 to aa851; aa845 to aa852 of SEQ ID NO: 12 or 13; aa846 to aa853 of SEQ ID NO: 12 or 13; aa847 to aa854 of SEQ ID NO: 12 or 13; aa848 to aa855 of SEQ ID NO: 12 or 13; aa850 to aa856; aa850 to aa857 of SEQ ID NO: 12 or 13; aa851 to aa858 of SEQ ID NO: 12 or 13; aa852 to aa858 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 13 Aa853 to aa860 of SEQ ID NO: 12 or 13; an855 to aa862 of SEQ ID NO: 12 or 13; aa856 to aa863 of SEQ ID NO: 12 or 13; aa857 to aa864 of SEQ ID NO: 12 or 13; Aa858 to aa865; SEQ ID NO: 12 or 13 aa859 to aa866; SEQ ID NO: 12 or 13 aa860 to aa867; SEQ ID NO: 12 or 13 aa861 to aa868; SEQ ID NO: 12 or 13 aa862 to aa869; SEQ ID NO: 12 or 13 Aa863 to aa870 of SEQ ID NO: 12 or 13; aa864 to aa871 of SEQ ID NO: 12 or 13; aa866 to aa873 of SEQ ID NO: 12 or 13; 13 aa867 to aa874; SEQ ID NO: 12 or 13 aa868 to aa875; SEQ ID NO: 12 or 13 aa869 to aa877; SEQ ID NO: 12 or 13 aa870 to aa877; SEQ ID NO: 12 or 13 aa871 to aa878; SEQ ID NO: 12 or 13 aa872-aa879; SEQ ID NO: 12 or 13 aa873-aa880; SEQ ID NO: 12 or 13 aa874-aa881; SEQ ID NO: 12 or 13 aa875-aa882; SEQ ID NO: 12 or 13 aa876-aa883; SEQ ID NO: 12 or 13 aa877-aa884; SEQ ID NO: 12 or 13 aa878-aa884; SEQ ID NO: 12 or 13 aa879-aa886; SEQ ID NO: 12 or 13 aa880-aa887; SEQ ID NO: 1 Or aa881 to aa888 of SEQ ID NO: 12 or 13; aa883 to aa890 of SEQ ID NO: 12 or 13; aa884 to aa891 of SEQ ID NO: 12 or 13; aa885 to aa892 of SEQ ID NO: 12 or 13; Or aa886 to aa893 of SEQ ID NO: 12 or 13; aa888 to aa895 of SEQ ID NO: 12 or 13; aa888 to aa896 of SEQ ID NO: 12 or 13; aa890 to aa896 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 Or aa891-aa898 of SEQ ID NO: 12 or 13, aa892-aa899 of SEQ ID NO: 12 or 13, aa893-aa900 of SEQ ID NO: 12 or 13, aa894-aa901 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 or 13, aa 896 to aa 903; SEQ ID NO: 12 or 13, aa 897 to aa 904; SEQ ID NO: 12 or 13, aa 898 to aa 905; SEQ ID NO: 12 or 13, aa 899 to aa 906; number

12 or 13 aa900 to aa907; SEQ ID NO: 12 or 13 aa901 to aa908; SEQ ID NO: 12 or 13 aa902 to aa909; SEQ ID NO: 12 or 13 aa903 to aa910; SEQ ID NO: 12 or 13 aa904 to aa911; SEQ ID NO: 12 or 13 aa905-aa912; SEQ ID NO: 12 or 13 aa906-aa913; SEQ ID NO: 12 or 13 aa907-aa914; SEQ ID NO: 12 or 13 aa908-aa915; SEQ ID NO: 12 or 13 aa909-aa916; SEQ ID NO: 12 or 13 aa910-aa917; SEQ ID NO: 12 or 13 aa911-aa918; SEQ ID NO: 12 or 13 aa912-aa919; SEQ ID NO: 12 or 13 aa913-aa920; SEQ ID NO: 12 or 13, aa 915 to aa 922; SEQ ID NO: 12 or 13, aa 916 to aa 923; SEQ ID NO: 12 or 13, aa 917 to aa 924; SEQ ID NO: 12 or 13, aa 918 to aa 925; SEQ ID NO: 12 or 13, aa 919-aa 926; SEQ ID NO: 12 or 13, aa 920-aa 927; SEQ ID NO: 12 or 13, aa 921-aa 928; SEQ ID NO: 12 or 13, aa 922-aa 929; SEQ ID NO: 12 or 13, aa 923-aa 930; SEQ ID NO: 12 or 13 aa 924 to aa 931; SEQ ID NO: 12 or 13 aa 925 to aa 932; SEQ ID NO: 12 or 13 aa 926 to aa 933; SEQ ID NO: 12 or 13 aa 927 to aa 93 Aa929-aa935 of SEQ ID NO: 12 or 13; aa929-aa936 of SEQ ID NO: 12 or 13; aa930-aa937 of SEQ ID NO: 12 or 13; aa931-aa938 of SEQ ID NO: 12 or 13; aa932-aa939 of SEQ ID NO: 12 or 13; Aa 933 to aa 940 of SEQ ID NO: 12 or 13; aa 935 to aa 941 of SEQ ID NO: 12 or 13; aa 936 to aa 943 of SEQ ID NO: 12 or 13; aa 937 to aa 944 of SEQ ID NO: 12 or 13; Aa939 to aa945 of SEQ ID NO: 12 or 13; aa939 to aa946 of SEQ ID NO: 12 or 13; aa940 to aa947 of SEQ ID NO: 12 or 13; aa941 to aa of SEQ ID NO: 12 or 13; 948; aa942-aa949 of SEQ ID NO: 12 or 13; aa943-aa950 of SEQ ID NO: 12 or 13; aa944-aa951 of SEQ ID NO: 12 or 13; aa945-aa952 of SEQ ID NO: 12 or 13; aa946- of SEQ ID NO: 12 or 13 aa947 to aa954 of SEQ ID NO: 12 or 13; aa948 to aa955 of SEQ ID NO: 12 or 13; aa949 to aa956 of SEQ ID NO: 12 or 13; aa950 to aa957 of SEQ ID NO: 12 or 13; aa951 to SEQ ID NO: 12 or 13 aa958; aa952-aa959 of SEQ ID NO: 12 or 13; aa953-aa960 of SEQ ID NO: 12 or 13; aa954-aa961 of SEQ ID NO: 12 or 13; aa955 of SEQ ID NO: 12 or 13 aa952; aa957 to aa963 of SEQ ID NO: 12 or 13; aa958 to aa965 of SEQ ID NO: 12 or 13; aa959 to aa966 of SEQ ID NO: 12 or 13; aa960 to aa960 of SEQ ID NO: 12 or 13; aa967; aa961-aa968 of SEQ ID NO: 12 or 13; aa962-aa969 of SEQ ID NO: 12 or 13; aa963-aa970 of SEQ ID NO: 12 or 13; aa964-aa971 of SEQ ID NO: 12 or 13; aa965- of SEQ ID NO: 12 or 13 aa966 to aa973 of SEQ ID NO: 12 or 13; aa967 to aa974 of SEQ ID NO: 12 or 13; aa968 to aa975 of SEQ ID NO: 12 or 13; aa of SEQ ID NO: 12 or 13 69 to aa976; aa970 to aa977 of SEQ ID NO: 12 or 13; aa971 to aa978 of SEQ ID NO: 12 or 13; aa972 to aa979 of SEQ ID NO: 12 or 13; aa973 to aa980 of SEQ ID NO: 12 or 13; aa975 to aa982 of SEQ ID NO: 12 or 13; aa976 to aa983 of SEQ ID NO: 12 or 13; aa977 to aa984 of SEQ ID NO: 12 or 13; aa978 to aa984 of SEQ ID NO: 12 or 13; aa 989 to aa 986 of SEQ ID NO: 12 or 13; aa 981 to aa 988 of SEQ ID NO: 12 or 13; aa 982 to aa 989 of SEQ ID NO: 12 or 13; aa984 to aa991 of SEQ ID NO: 12 or 13; aa985 to aa992 of SEQ ID NO: 12 or 13; aa986 to aa993 of SEQ ID NO: 12 or 13; aa987 to aa994 of SEQ ID NO: 12 or 13; aa998 to aa996 of SEQ ID NO: 12 or 13; aa990 to aa997 of SEQ ID NO: 12 or 13; aa991 to aa998 of SEQ ID NO: 12 or 13; aa992 to aa999 of SEQ ID NO: 12 or 13; aa993 to aa1000; aa994 to aa1001 of SEQ ID NO: 12 or 13; aa995 to aa1002 of SEQ ID NO: 12 or 13; aa996 to aa1003 of SEQ ID NO: 12 or 13; Or aa997 to aa1004; SEQ ID NO: 12 or 13 aa998 to aa1005; SEQ ID NO: 12 or 13 aa999 to aa1006; SEQ ID NO: 12 or 13 aa1000 to aa1007; SEQ ID NO: 12 or 13 aa1001 to aa1008; SEQ ID NO: 12 Or aa1002-aa1009 of SEQ ID NO: 12 or 13; aa1004-aa1011 of SEQ ID NO: 12 or 13; aa1005-aa1012 of SEQ ID NO: 12 or 13; aa1006-aa1013 of SEQ ID NO: 12 or 13; SEQ ID NO: 12 Or aa1007 to aa1014 of SEQ ID NO: 12 or 13; aa1008 to aa1015 of SEQ ID NO: 12 or 13; aa1009 to aa1016 of SEQ ID NO: 12 or 13; 12 or 13 aa1010 to aa1017; SEQ ID NO: 12 or 13 aa1011 to aa1018; SEQ ID NO: 12 or 13 aa1012 to aa1019; SEQ ID NO: 12 or 13 aa1013 to aa1020; SEQ ID NO: 12 or 13 aa1014 to aa1021; 12 or 13 aa1015 to aa1022; SEQ ID NO: 12 or 13 aa1016 to aa1023; SEQ ID NO: 12 or 13 aa1017 to aa1024; SEQ ID NO: 12 or 13 aa1018 to aa1025; SEQ ID NO: 12 or 13 aa1019 to aa1026; SEQ ID NO: 12 or 13 aa1020 to aa1027; SEQ ID NO: 12 or 13 aa1021 to aa1028; SEQ ID NO: 12 or 13 aa1022 to aa1029 Aa1023-aa1030 of SEQ ID NO: 12 or 13; aa1024-aa1031 of SEQ ID NO: 12 or 13; aa1025-aa1032 of SEQ ID NO: 12 or 13; aa1026-aa1033 of SEQ ID NO: 12 or 13; Aa1028 to aa1035 of SEQ ID NO: 12 or 13; aa1029 to aa1036 of SEQ ID NO: 12 or 13; aa1030 to aa1037 of SEQ ID NO: 12 or 13; aa1031 to aa1038 of SEQ ID NO: 12 or 13; Aa 1033 to aa 1040 of SEQ ID NO: 12 or 13; aa 1034 to aa 1041 of SEQ ID NO: 12 or 13; aa 1035 to a of SEQ ID NO: 12 or 13; 1042; aa1036 to aa1043 of SEQ ID NO: 12 or 13; aa1037 to aa1044 of SEQ ID NO: 12 or 13; aa1038 to aa1045 of SEQ ID NO: 12 or 13; aa1039 to aa1046 of SEQ ID NO: 12 or 13; aa1041-aa1048 of SEQ ID NO: 12 or 13; aa1042-aa1049 of SEQ ID NO: 12 or 13; aa1043-aa1050 of SEQ ID NO: 12 or 13; aa1044-aa1051 of SEQ ID NO: 12 or 13; aa1045 of SEQ ID NO: 12 or 13 aa1052; aa1046 to aa1053 of SEQ ID NO: 12 or 13; aa1047 to aa1054 of SEQ ID NO: 12 or 13; aa1048 to aa of SEQ ID NO: 13 1055; aa 1049 to aa 1056 of SEQ ID NO: 13; aa 1050 to aa 1057 of SEQ ID NO: 13; aa 1051 to aa 1058 of SEQ ID NO: 13; aa 1052 to aa 1059 of SEQ ID NO: 13; SEQ ID NO: 13 aa1055 to aa1062; SEQ ID NO: 13 aa1056 to aa1063; SEQ ID NO: 13 aa1057 to aa1064; SEQ ID NO: 13 aa1058 to aa1065; SEQ ID NO: 13 aa1059 to aa1066; SEQ ID NO: 13 aa1060 to aa1067; 13 aa1061 to aa1068; aa1062 to aa1069 of SEQ ID NO: 13; aa1063 to aa1070 of SEQ ID NO: 13; aa1064 of SEQ ID NO: 13 ~ Aa1071; aa1065 to aa1072 of SEQ ID NO: 13; aa1066 to aa1073 of SEQ ID NO: 13; aa1067 to aa1074 of SEQ ID NO: 13; aa1068 to aa1075 of SEQ ID NO: 13; As well as aa1071-aa1078 of SEQ ID NO: 13. The coding sequence of the fragment can be constructed by cleaving unnecessary nucleotides from the mutant or native TIAM2 protein coding sequence.

  The fusion is a fragment, variant, or native TIAM2 protein with additional amino acids at either or both ends. The additional amino acid sequence is generally not homologous to the sequence found in the native TIAM2 polypeptide. Additional amino acid residues can facilitate, for example, expression, detection, or activity of the polypeptide. Additional amino acid sequences can also be used as linkers to construct multimers of TIAM2 protein. All fusion polypeptides exhibit the desired sequence homology, immunological activity, or biological activity. Recombinant TIAM2 fusion proteins can be produced using the preferred cell line baculovirus.

  After inserting the TIAM2 DNA sequence into the transfer vector, the vector and wild-type viral genome are transfected into an insect host cell. Here, the vector and viral genome are recombined. Packaged recombinant viruses are expressed and recombinant plaques are identified and purified. Materials and methods for baculovirus / insect cell expression systems are commercially available in kit form from, inter alia, Invitrogen, San Diego CA ("MaxBac" kit). These techniques are generally known to those skilled in the art and are described in Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987).

  Prior to insertion of the DNA sequence encoding the protein into the genome of the baculovirus, the above components containing the promoter, leader (if desired), the coding sequence of interest, and the transcription termination sequence are usually , Assembled into an intermediate construct (transfer vector).

  Currently, the most commonly used transfer vector for introducing foreign genes into AcNPV is pAc373. Many other vectors (known in the art) have also been designed. Examples of these include pVL985. This is that the polyhedrin start codon has been changed from ATG to ATT and a BamHI cloning site has been introduced 32 base pairs downstream of ATT; see Luckow and Summers, Virology 17:31 (1989).

  Plasmids are also typically polyhedron polyadenylation signals (Miller et al., Ann. Rev. Microbiol., 42: 177 (1988)), and the prokaryotic ampicillin resistance (amp) gene, and E. coli. Contains an origin of replication for selection and propagation in E. coli.

  A baculovirus transfer vector usually contains a baculovirus promoter. A promoter will have a transcription initiation region which is usually placed proximal to the 5 'end of the coding sequence. This transcription initiation region usually includes an RNA polymerase binding site and a transcription initiation site. A baculovirus transfer vector may also have a second domain called an enhancer. This, if present, is usually distal to the structural gene. Expression can be either regulated or constitutive.

  Structural genes that are abundantly transcribed late in the viral infection cycle provide particularly useful promoter sequences. Examples include the gene encoding the viral polyhedron protein (Friesen et al. (1986) “The Regulation of Baculovirus Gene Expression”: The Molecular Biology of Baculovirus (Ed. No. 54, Walter Doer 76, published in 15) And sequences derived from the gene encoding the p10 protein (Vlak et al., J. Gen. Virol. 69: 765 (1988)).

  DNA encoding the appropriate signal sequence can be derived from the secreted insect or baculovirus protein (eg, the baculovirus polyhedrin gene (Carbonell et al., Gene, 73: 409 (1988)) or from mammals. Post-translational modifications of animal cells (eg, signal peptide cleavage, proteolytic cleavage, and phosphorylation) appear to be recognized by insect cells and accumulate signal and nucleus required for secretion Also appear to be conserved between invertebrate cells and vertebrate cells, leaders from sources other than insects (eg, those derived from genes encoding human α-interferon, Maeda et al., Nature 315: 592 (1985)); human gastrin-releasing peptide Derived from the gene coding for, Lebacq-Verheyden et al., Molec. Cell. Biol. 8: 3129 (1988); human IL-2, Smith et al., Proc. Natl. Acad. Sci. USA 82: 8404 (1985) Derived from the gene encoding mouse IL-3 (Miyajima et al., Gene 58: 273 (1987); and derived from the gene encoding human glucocerebrosidase, Martin et al., DNA 7:99; (1988)) can also be used to provide secretion in insects.

  After insertion of the DNA sequence and / or gene encoding the protein expression product precursor, the insect cell host uses the heterologous DNA of the transfer vector and the wild-type baculovirus genomic DNA, commonly co-transfected by co-transfection. Converted. Methods for introducing heterologous DNA into the desired site of baculovirus are known in the art (Summers and Smith; Ju et al. (1987); Smith et al., Mol. Cell. Biol. 3: 2156 (1983). And Luckow and Summers (1989)). For example, the insertion can be in a gene such as a polyhedrin gene by homologous double crossover recombination; the insertion can also be in a restriction enzyme site engineered into the desired baculovirus gene. Miller et al., Bioessays 4:91 (1989).

  The newly formed baculovirus expression vector is then packaged into an infectious recombinant baculovirus. Methods for identifying recombinant viruses are described in “Current Protocols in Microbiology”, Volume 2 (Ausubel et al., Ed.), 16.8 (Supplement 10, 1990); Summers and Smith; Miller et al. (1989). Yes.

  Recombinant baculovirus expression vectors have been developed for infection into several insect cells. For example, recombinant baculoviruses have been developed, inter alia, for: Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Tripop. 56: 153 (1985); Wright Nature 321: 718 (1986); Smith et al., Mol. Cell. Biol.3: 2156 (1983); and generally Fraser et al., In Vitro Cell Dev. Biol.25. : 225 (1989)).

  TIAM2 protein can be used in assays for inhibitors and to prepare antibodies directed against TIAM2. TIAM2 protein may also be useful as a factor that promotes the growth of cancer cells in culture. The TIAM2 protein can be combined with the pharmaceutically acceptable carriers described above for use with TIAM2 antisense molecules.

  The invention is described herein with reference to the following examples, which illustrate particularly advantageous embodiments. However, it should be noted that the following examples illustrate these embodiments and are not to be construed as limiting the invention in any manner.

(Example)
Example 1
(TIAM2 gene identification)
A single 377 nucleotide clone (DP-75) was identified in a degenerate PCR-based screen for a novel gene. This had high homology to the mouse and human TIAM1 genes. Due to its similarity to TIAM1, this novel gene and its putative protein product were named T cell lymphoma invasion and metastasis 2 (TIAM2).

  Northern analysis with DP-75 probe reveals about 3.3 kb transcript in cerebral cortex, cerebral occipital pole, frontal lobe and temporal lobe, and about 4.4 kb transcript in testis and cerebellum (FIGS. 1A and 1B). Overlapping clones were isolated by screening of the cDNA library and RACE cloning, and followed the full length sequence showing messages of about 4.4 kb and about 3.3 kb, respectively. To perform Northern analysis, Human Multiple Tissue Northern Blots (Clontech) was hybridized with DP75 probe at 65 ° C. in SpeedHyb solution (BIOS lab). Blots were washed twice with 0.5 × SSC, 0.5% SDS for 10 minutes at room temperature and 1 × 1 at 65 ° C. in 0.1 × SSC, 0.5% SDS. Washed twice.

The cDNA according to the approximately 4.4 kb message is 4586 nucleotides in length, is not polyadenylated, and is presumed to encode a 1077 amino acid long form of the TIAM2 protein (TIAM2 _L ). The first ATG is at nucleotide position 51 and is in good condition for translation. The putative protein alignment to TIAM1 (FIG. 3) shows significant identity starting with the first methionine of TIAM2 and the methionine at position 576 of TIAM2, this region of the coiled-coil domain of TIAM1 (aa548-590). Corresponds to the last 14 amino acids. This identity continues to the EX domain extending from amino acid 599 to amino acid 691 of human TIAM1. A comparison of TIAM1 / TIAM2 _L EX domains shows 62% identity overall, but 85% identity in the 60aa subdomain. Alternative splicing of the 72 nucleotide mini-exon following the EX domain leads to the presence or absence of a 24 amino acid sequence that has no significant identity to the TIAM1 or SIF sequence. Behind the alternatively spliced region is a sequence with weak identity (18%) to TIAM1, which contains conserved residues of the PDZ or DHR domain (Michels et al., Nature 375). : 338-340, 1995). The remaining sequence contains identity to the DH catalytic region (70%) and identity to the carboxy terminal PH domain (54%).

The sequence according to the message of approximately 3.3 kb is 3344 nucleotides in length and is presumed to encode a short form (626aa) of TIAM2 (TIAM _S ). The approximately 3.3 kb message differs from the approximately 4.4 kb message in that the first 104 nucleotides are unique. This suggests that the approximately 3.3 kb message is caused by initiation at a different promoter from that of the approximately 4.4 kb message. Initiator methionine at position 162 is consistent with methionine at amino acid 428 of TIAM2 putative protein of 4.4 kb, and the remaining protein, showing complete identity and TIAM2 _L. Similar to that found in the TIAM1 gene (Habets et al., Cell 77: 537-549, 1994), there are two upstream ATGs in the approximately 3.3 kb message, which are long open reading frames (nucleotide 162). Only the start codon at nucleotide position 162 is in good condition for translation. Comparison with TIAM shows that TIAM2 _S starts immediately upstream (24aa) of the DH domain.

  Northern analysis with a probe isolated from the 5 ′ end of the approximately 4.4 kb message identified only the long TIAM2 transcript (FIG. 1C), while both transcripts were isolated by the probe isolated from the 3 ′ end of TIAM2. The thing was identified (FIG. 1D).

  Irradiation hybrid mapping experiments were performed as follows. TIAM2-specific oligos AGTCCTACCTCATCAAGCCG (SEQ ID NO: 14) and TTAGTGCTTCCGTCAGGTGG (SEQ ID NO: 15) were synthesized and used with the G3 panel (Research Genetics) according to the manufacturer's instructions. The resulting PCR products were analyzed by gel electrophoresis, and the data obtained was analyzed by Stewart and Cox, “Genome Mapping: A Practical Approach” (P. Dear et al.) Pages 73-93, Oxford Univ. Press. Analysis was performed according to the method of Oxford, 1997. A two-point maximum-likelihood analysis indicated that the marker was associated with D6S1556 (6q25) with a rod score of 100.

(Example 2)
(In situ hybridization)
Oligos designed from nucleotides 563-586 of human 3.3 kb TIAM2 cDNA (AGTACAGAAGGTTCTGGAGGCG) and from nucleotides 1348-1367 (TACCAGGCGGATCCTTACACG) were used to perform PCR on mouse brain cDNA (Clonetech). . 30 cycles of PCR performed using an annealing temperature of 40 ° C. led to the production of the expected length (802 nt) of product (MDP75). Cloning and sequencing confirmed that MDP75 was 90% identical to human TIAM2 throughout the length of the clone. Mouse embryos (CD-1) were obtained from Nieto et al., “Methods in Avian Embryology” (edited by M. Bronner-Fraser), Academic Press. Processed according to the protocol of San Diego (1995). Adult brain sections were processed using the protocol for frozen sections as described (Schaeren-Wiemers and Gerfin-Moser, Histochemistry 100: 431-440 (1993)).

  Expression of TIAM2 mRNA in embryonic day 13.5 (E13.5) and adult mouse brain was examined by in situ hybridization using a riboprobe labeled with digoxigenin. Discrete and reproducible labels were observed at both ages with an antisense probe; no label was detected with the sense probe. The cellular localization of TIAM2 transcripts in both E13.5 and adult brain is consistent with the expression of TIAM2 in neuronal cells rather than glial cells. At E13.5, the TIAM2 transcript is present throughout the telencephalon (FIG. 2A). A collateral plane section across the telencephalon demonstrates that expression is localized to the buffy coat surface where early post-mitotic neurons are localized (FIG. 2B). TIAM2 is not expressed in proliferative neural progenitor cells along the ventricle.

  In the adult mouse brain, TIAM2 continues to be expressed primarily in regions derived from the telencephalon (FIGS. 2C-2G, Table 1). Regions of strong expression include the olfactory bulb, cerebral cortex, caudate putamen, and hippocampus. Expression in the hippocampus is highly specific in cells of the dentate gyrus and regions derived from it, gray sheath, and gray belt; and pyramidal cells of one partial region of the CA region (CA2) ) Is very strongly labeled, whereas CA1 and CA3 show very little expression. TIAM2 is also strongly expressed in ependymal cells on the lateral surface of the lateral ventricle (FIG. 2D). This region is the region of the embryo where neurons are generated throughout the adult life. Most of the neurons generated in this region are thought to move to the olfactory bulb.

(Example 3: GDP-GTP exchange activity)
An amino terminal HIS-tagged version of the 3.3 kb TIAMs protein (His-TIAM2) was expressed in the baculovirus system. A protein with a predicted molecular weight (75.661 Da) was partially purified on a nickel column and the identity of the protein was confirmed by amino-terminal sequencing and mass spectrometry. To generate a His-tagged TIAM2s expression construct, a linker-adapter was generated to add an EcoRI site to the first 29 bp 5 'end of the TIAM2s sequence (GAATTCATGGGAAGGACCGCGGGA-GAATCAGGATCC). This phosphorylated linker / adapter ending at the BamHI site (bases 23-29 of the TIAM2 sequence) was ligated with cDNA clone DP-75 # 1 linearized by the BamHI fragment containing the entire coding region of TIAM2s. . Subsequent SalI digestion released an approximately 2000 bp EcoRI-SalI fragment containing the entire coding region of TIAM2s. This fragment was isolated, purified and ligated into EcoRI-SalI digested pBlueBacHis2B vector (Invitrogen). The resulting clone (pHIS-TIAM2s) was confirmed by sequence analysis.

  pHIS-TIAM2s was introduced into SF9 cells and clones expressing high levels of pHIS-TIAM2s were identified by Western blot. After clone growth, pHIS-TIAM2s expressing cells were concentrated, lysed and applied to a nickel column (Invitrogen). The pHIS-TIAM2s protein was purified from the column as recommended by the manufacturer, except that the protein was eluted directly in 500 mM imidazole after a 50 mM imidazole wash. Fractions containing pHIS-TIAM2s were concentrated by centrifugation at 5000 g for 30 minutes on a Centricon (Amicon) 30 column.

His-TIAM2s was tested for its ability to stimulate GDP-GTP exchange activity using Rac or Ras proteins and compared to the activity of SOS (known Ras GEF (Jefferson et al., Oncogene 16: 2303-2310, 1998)) did. In these experiments (FIG. 4), the immunoprecipitated Rac or Ras protein was preloaded with GDP and contained either in [ ³² P] GTP-containing buffer alone or with His-TIAM2s or purified SOS. Incubated in buffer. In several experiments, His-TIAM2s showed a stimulation of Rac exchange activity approximately 5 times at 30 minutes compared to buffer alone, whereas SOS was at most a mild stimulation (× 1.6). (FIG. 4A). Conversely, when His-TIAM2s and SOS were incubated with RAS, SOS showed 4-5 fold stimulation of exchange activity, whereas His-TIAM2s had little or no effect. (FIG. 4B).

Example 4: Use of polynucleotides for cancer diagnosis
In dot blot analysis, TIAM2 was hybridized with RNA from both cancer and normal tissues. Sources of cancer tissue include kidney, thyroid, breast, colon, ureter, lung, nose, stomach, esophagus, liver, lymphoma, uterus, bladder, rectum and brain.

Blots were obtained from BioChain Institute, Inc. From San Leandro, California, USA. ExpressHyb ^™ hybridization buffer (Clontech, Palo Alto, California, USA) was used to blot at 68 ° C. with TIAM2 (SEQ ID NO: 1) for 2 hours at 1 × 10 ⁶ cpm / ml.

  As shown in FIG. 5, in 4 of the 4 thyroid samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissue than in normal tissue. In two of the four colon samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissue than in normal tissue. In one of the two ureter samples, the mRNA level of SEQ ID NO: 1 (TIAM2) was higher in cancer tissue than in normal tissue. In one of the four breast samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissue than in normal tissue. In one of the four kidney samples, the mRNA level of SEQ ID NO: 1 was higher in cancer tissue than in normal tissue. In all other tested tissue types, the mRNA level of SEQ ID NO: 1 was the same or higher in normal samples than in cancer samples.

(Example 5: Isolation of SEQ ID NO: 6)
SEQ ID NO: 6 was isolated from a frontal cortex library using a phage vector (Stratagene, La Jolla, California, USA). This library was probed with SEQ ID NO: 1 generated by random prime labeling with a final radioactivity count of approximately 1 × 10 ⁶ cpm / ml. The probe was labeled using the RediPrime ^™ DNA labeling kit (Amersham, Arlington Heights, Illinois, USA) according to the manufacturer's instructions.

The phage library was grown and plated on 20 plates at 3.0-5.0 × 10 ⁵ plaques / plate according to the manufacturer's instructions. Plaques were transferred to nitrocellulose membrane. Each membrane was incubated with the SEQ ID NO: 1 probe in ExpressHyb ^™ hybridization solution at 65 ° C. for 2 hours purchased from Clontech (Palo Alto, California, USA). The filter was washed according to Clontech instructions. Film was exposed to the membrane to identify putative positive plaques containing the desired TIAM2 polynucleotide.

  A second plating and hybridization was performed to identify a single positive plaque. The first positive plaque was grown and plated on agar according to the instructions provided by Stratagene. Plaques were transferred to the filter. These filters were incubated with the SEQ ID NO: 1 probe. Probe and hybridization conditions were the same as above. Positive plaques were identified and propagated.

  The BlueScript plasmid was recovered from the phage vector according to the manufacturer's instructions. The EcoRI insert from the plasmid was sequenced. The polynucleotide sequence is shown in SEQ ID NO: 6.

  The invention has been described with reference to specific embodiments. However, this application is intended to include changes and substitutions that may be made by those skilled in the art without departing from the spirit and scope of the appended claims.

(Deposit information)
The following materials were deposited with the American Type Culture Collection.

The above materials were deposited with the American Type Culture Collection (Manassas, Virginia) under the accession number indicated. This deposit is maintained under the Budapest Treaty on the International Approval of Deposits of Microorganisms in Patent Procedures. This deposit will be maintained for a period longer than either 30 years after the issuance of this patent or the validity period of this patent. Upon issuance of a patent, this deposit will be available to the public without restrictions from the ATCC.

  These deposits are provided solely for confirmation by those skilled in the art, and the deposits are 35U. S. C. It does not approve what is required under Article 112. The polynucleotide sequence contained in the deposited material, as well as the amino acid sequence of the polypeptide encoded by the polynucleotide, is incorporated herein by reference and in the event of any discrepancy with the sequence described herein Also prioritize. A license may be required for the production, use, or sale of the deposited material, but such license is not provided herein.

Claims (27)

Less than:
(A) Conditions stringent to at least one of the group consisting of nucleotides 1 to 1346 of SEQ ID NO: 9, nucleotides 51 to 1346 of SEQ ID NO: 9, nucleotides 1 to 1274 of SEQ ID NO: 10, and nucleotides 51 to 1274 of SEQ ID NO: 10 contacting the and (b) the polynucleotide probes with mRNA of the TIAM2 _L,; a nucleic acid sequence containing Mikatsu capable of hybridizing under, providing a polynucleotide probe capable of hybridizing to the mRNA of TIAM2 _L
Where the TIAM2 _L mRNA is
polynucleotide shown in a) SEQ ID NO: 9;
b) a polynucleotide that encodes a polypeptide shown in SEQ ID NO: 10; and c) a polypeptide in which less than 20 amino acids are altered by deletion, addition or substitution from the polypeptide encoded by a) or b). The method of detecting expression of TIAM2 _L mRNA in a sample, wherein the polypeptide encoded by c) is selected from the group consisting of polynucleotides having GDP-GTP exchange activity. A method for detecting hyperproliferating cells in a sample, comprising:
  (A) providing a probe polynucleotide comprising a sequence capable of hybridizing under stringent conditions to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof;
  (B) contacting the polynucleotide of the sample cell with the probe under conditions that form a polynucleotide hybrid; and
  (C) detecting the hybrid;
Including the method. A method for detecting a TIAM2 polypeptide in a sample, comprising:
  (A) providing an antibody that specifically binds to a TIAM2 polypeptide, wherein the TIAM2 polypeptide is at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof Comprising an amino acid sequence encoded by a polynucleotide comprising a sequence capable of hybridizing to:
  (B) contacting the sample with the sample under conditions that form an antibody / antigen complex; and
  (C) detecting the complex;
Including the method. Less than:
(A) encoding about position 1 to about 626 of the amino acid of SEQ ID NO: 11 polynucleotide;
(B) polynucleotides encoding about 2 position and about 626 of the amino acid of SEQ ID NO: 11;
Polynucleotide complement of the polynucleotide and (d) (a) or (b),; (c) (a) or at least 80% identical to the polynucleotide for the polynucleotide of (b)
An isolated nucleic acid molecule comprising a polynucleotide selected from the group consisting of: An isolated nucleic acid molecule comprising 10 consecutive nucleotides from the coding region of SEQ ID NO: 8 . 6. The isolated nucleic acid molecule of claim 5, comprising 20 consecutive nucleotides from the coding region of SEQ ID NO: 8 . 7. The isolated nucleic acid molecule of claim 6, comprising 50 contiguous nucleotides from the coding region of SEQ ID NO: 8 . An isolated nucleic acid molecule comprising a polynucleotide encoding a polypeptide, wherein with the exception of at least one conservative amino acid substitution, said polypeptide follows:
(A) from about position 1 encoding about 626 amino acid position polynucleotide of SEQ ID NO: 11; and (b) from about 2 position and about 626 of the polynucleotides amino encoding of SEQ ID NO: 11;
Or having an amino acid sequence encoded by a nucleic acid sequence selected from Ranaru group, an isolated nucleic acid molecule. A method for producing a recombinant vector comprising the step of inserting the nucleic acid molecule according to claim 4 into a vector in an operable linkage to a promoter. A recombinant vector produced by the method according to claim 9 . A method for producing a recombinant host cell comprising introducing the recombinant vector of claim 10 into the host cell. A recombinant host cell produced by the method of claim 11 . A recombinant method for producing a polypeptide comprising the steps of culturing the recombinant host cell of claim 12 and recovering the polypeptide under conditions such that the polypeptide is expressed. ,Method. Less than:
(A) from about position 1 to about 626 of the amino acid of SEQ ID NO: 11; about 2 position and about 626 of the and (b) SEQ ID NO: 11 amino acids;
Or Ranaru at least 90% identical to the amino acid to the amino acid selected from the group, the isolated polypeptide De. An isolated polypeptide, with the exception of at least one conservative amino acid substitution, the polypeptide is selected from the group consisting of:
(A) from about position 1 to about 626 of the amino acid of SEQ ID NO: 11; about 2 position and about 626 of the and (b) SEQ ID NO: 11 amino acids;
Or Ranaru having an amino acid sequence selected from the group isolated polypeptide De. Less than:
(A) from about position 1 to about 626 of the amino acid of SEQ ID NO: 11; about 2 position and about 626 of the and (b) SEQ ID NO: 11 amino acids;
Or Ranaru comprising an amino acid selected from the group, isolated polypeptide. An epitope-bearing portion of the polypeptide of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13. 18. The epitope-bearing portion according to claim 17, comprising 10 consecutive amino acids of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13. The epitope-bearing portion according to claim 18, comprising 20 consecutive amino acids of SEQ ID NO: 11, SEQ ID NO: 12 or SEQ ID NO: 13. 15. An isolated antibody that specifically binds to the polypeptide of claim 14 . 16. An isolated antibody that specifically binds to the polypeptide of claim 15 . An isolated antibody that specifically binds to the polypeptide of claim 16 . (I) an antisense polynucleotide comprising a sequence capable of hybridizing under stringent conditions to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or fragments thereof, wherein An antisense vector comprising: an antisense polynucleotide capable of hybridizing to native human TIAM2 mRNA; and (ii) a polynucleotide comprising a sequence capable of initiating transcription of said antisense polynucleotide. 24. The antisense vector of claim 23, wherein the sequence for initiating transcription is from a retrovirus, adenovirus or adeno-associated virus. The antisense vector according to claim 24, further comprising an origin of replication. A method for inhibiting the expression of TIAM2, comprising:
  (A) a nucleic acid sequence comprising a nucleic acid sequence capable of hybridizing under stringent conditions to at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or a fragment thereof, and a native human TIAM2 mRNA; Providing an antisense polynucleotide capable of hybridizing; and
  (B) contacting the antisense polynucleotide with the TIAM2;
Including the method. A method for inhibiting cell replication, comprising:
  (A) providing an antibody that specifically binds to a TIAM2 polypeptide, wherein the TIAM2 polypeptide is at least one of SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10 or a fragment thereof. Comprising an amino acid sequence encoded by a polynucleotide comprising a sequence capable of hybridizing to one another; and
  (B) contacting the antibody with a sample under conditions that form an antibody / antigen complex;
Including the method.