JPH10501985A - Interleukin-1β converting enzyme-like apoptotic protease-1 and 2 - Google Patents

Abstract

  (57) [Summary] Disclosed are human interleukin-1β converting enzyme-like apoptotic proteases-1 and -2, and DNA (RNA) encoding these polypeptides. Also provided are procedures for producing such polypeptides, and antibodies and antagonists / inhibitors to such polypeptides, by recombinant techniques. Also, polypeptides, eg, as anti-tumor and anti-viral agents, and antibodies and antagonists / inhibitors to such polypeptides, eg, for the treatment of Alzheimer's disease, Parkinson's disease, rheumatoid arthritis, and head trauma Provides usage of

Description

DETAILED DESCRIPTION OF THE INVENTION   Interleukin-1β converting enzyme-like apoptosis protease-1 and 2   The present invention relates to newly identified polynucleotides, such polynucleotides. Polypeptides, such polynucleotides and polypeptides Use of such polynucleotides and the production of such polynucleotides and polypeptides I do. More specifically, the polypeptides of the present invention may have an interleukin-1β conversion Enzyme-like apoptotic protease-1 and interleukin-1β converting enzyme-like It is an apoptotic protease-2, and hereafter, often collectively as "IC Called E-LAP-1 and 2 ". The present invention also relates to the action of such a polypeptide. Related to inhibiting.   Interleukin-1β converting enzyme (ICE) converts pro-IL-1β to mature, active I Involved in cleavage to L-1β and also removes unwanted cells from the organism. Process is most likely involved in programmed cell death (or apoptosis). Recently discovered. The present invention relates to ICE-LAP-1 and 2 which are structurally related to ICE. .   The genetic pathway of programmed cell death in the nematode caenorhabditis elegans The path was confirmed (Ellis, R.E., et al., Annu. Rev. Cell Biol., 7: 663-698 (1991)). 2 Genes (ced-3 and ced-4) are programmed cell death in C. elegans It is essential for cells to go through. (Ellis, H.M., and Horvitz, H.R., C ell, 44: 817-829 (1986)). A recessive mutant that eliminates the function of these two genes Blocks normal programmed cell death, during C. elegans development. ced-3 tampa The known vertebrate counterpart to dentin is ICE. The whole between ced-3 and ICE The amino acid identity over the entire region is 28%, a region of 115 amino acids (the remainder of ced-3). It shows the highest identity (43%) at groups 246-360 and residues 164-278 of the ICE. This area Contains the conserved pentapeptide QACRG (residues 356-360 of ced-3) Contains cysteines known to be essential for ICE function. ICE of the present invention -LAP-1 and 2 polypeptides also have the same conserved pentapeptide and ICE It has cysteine residues essential for its function.   The similarity between ced-3 and ICE indicates that ced-3 functions as a cysteine protease. Not only gain, but also ICE as a gene for vertebrate programmed cell death It also suggests that it can work. ced-3 and vertebrate counterparts (ICE) During programmed cell death (Gagliarnini, V. et al., Science, 263: 826 : 828 (1994).   ICE mRNA is detected in various tissues, such as peripheral blood monocytes, Peripheral blood lymphocytes, peripheral blood neutrophils, resting or activated peripheral blood T lymphocytes , Placenta, B lymphoblastoid cell line CB23, and monocyte leukemia cell line THP-1 cells (Cerreti, D.P. , Et al., Science, 256: 97-100 (1992)). This means that ICE is pro-IL-1 Suggests that it may have additional substrates in addition to β. ICE acts to cause cell death Substrate substrates are currently unknown. One possibility is that it is a cell death of C. elegans It could be a vertebrate homolog of the gene ced-4. Alternatively, ICE is Proteolytic cleavage of essential proteins directly Bleeding can occur.   The mammalian gene bcl-2 allows immune cells called lymphocytes to Was found to protect the vesicles. In addition, crmA (copox virus gene product) is IC Inhibits E's ability to split proteins.   According to one aspect of the present invention, ICE-LAP-1 and 2, and fragments thereof, Novel mature polypeptides that are nalogs and their derivatives are provided. Book The polypeptides of the invention are of human origin.   According to another aspect of the invention, a polynucleotide encoding such a polypeptide is provided. Otides (DNA or RNA) are provided.   According to a further aspect of the present invention, such a polypeptide is obtained by recombinant technology. A process for generating is provided.   According to a further aspect of the invention, such a polypeptide, or such a Polynucleotides encoding polypeptides may be used for therapeutic purposes (eg, antiviral Agents, antitumor agents, and regulating embryonic development and homeostasis A process is provided for utilizing   According to a further aspect of the present invention, there is provided an antibody against such a polypeptide. Is done.   According to yet another aspect of the present invention, for example, Alzheimer's disease, Parkinson Disease, rheumatoid arthritis, septic shock and head injury Such polypeptides that can be used to inhibit the action of such polypeptides Provided are antagonists / inhibitors to the drug.   These and other aspects of the invention will be apparent to those skilled in the art from the teachings herein. Should be clear.   BRIEF DESCRIPTION OF THE DRAWINGS The following drawings are illustrative of embodiments of the invention and are intended to be within the scope of the claims Is not intended to limit the scope of   FIG. 1 shows the cDNA sequence of ICE-LAP-1 and the corresponding deduced amino acid sequence. Show The polypeptide encoded by the amino acid sequence Mature form (excluding the first methionine residue), and standard amino acids A one-letter abbreviation is used.   FIG. 2 shows the cDNA sequence of ICE-LAP-2 and the corresponding deduced amino acid sequence. Show The polypeptide encoded by the amino acid sequence Mature form (excluding the first methionine residue).   FIG. 3 shows a comparison of the amino acid sequences of ICE-LAP-1 and ICE.   FIG. 4 shows Northern blots of ICE-LAP-1 showing concentrations in various human tissues. The gel after the precipitation is illustrated.   According to an aspect of the present invention, a mature polypeptide having the deduced amino acid sequence of FIGS. A peptide encoding the peptide or deposited as ATCC Deposit Nos. 75772 and 75819 The isolated nucleic acid of the mature polypeptide encoded by the Reotide) is provided. ATCC deposit number 75772 codes for ICE-LAP-1 Includes cDNA and ATCC Deposit No. 75819 encodes cDNA for ICE-LAP-2 Is included.   The polynucleotide encoding ICE-LAP-1 is a cDNA library from human fetal liver Found at the rally. This indicates that the interleukin-1β converting enzyme fa Structurally related to Millie. This translates into a protein of about 377 amino acid residues. Includes open reading frame to encode. This protein is 68% similarity and overall amino acid sequence to terleukin-1β converting enzyme And 53% identity show the highest degree of homology. Pentapeptide QACRG preserved And shows that it is located at amino acid positions 256-260.   A polynucleotide encoding ICE-LAP-2 is obtained from a cDNA line derived from human Jurkat cells. Found in Burrly. This is structurally relevant to the ICE family . This is an open-ready protein that encodes a protein of about 435 amino acid residues. Including frame. This protein contains 128 of the mouse Nedd-2 proteins. Highest degree of phase with 91% identity and 94% similarity over the amino acid range Show the same sex. Total protein is 400 cells in C. elegans cell death protein ced-3 Of the highest degree with about 40% identity and 60% similarity across amino acid residues Shows homology. The pentapeptide QACRG is conserved and is located at amino positions 301-305 That is also important.   The polynucleotide of the present invention may be in the form of RNA or DNA. DN Form A includes cDNA, genomic DNA and synthetic DNA. DNA is double-stranded or single-stranded Can be a chain. And in the case of single strand, coding strand or non-coding (antisense ) Can be a chain. The coding sequence encoding the mature polypeptide is shown in FIGS. Or the same as the coding sequence of the deposited clone. possible. Alternatively, if the coding sequence is a result of duplication or degeneracy of the genetic code , Different coding sequences encoding the same mature polypeptide, and FIGS. The DNA or the deposited cDNA may be a derivative thereof.   The mature polypeptide of FIG. 1 and FIG. The polynucleotide encoding the mature polypeptide comprises a coding sequence for the mature polypeptide. Sequence only; coding sequence for mature polypeptide and additional coding sequences (eg, Leader sequence or secretory sequence or proprotein sequence; Code sequences (and additional coding sequences as needed) and non-coding sequences (e.g., For example, 5 'and / or 3' of the coding sequence of an intron or mature polypeptide. Non-coding sequence).   Thus, the term "polynucleotide encoding a polypeptide" refers to a polypeptide. And a further coding sequence comprising only the coding sequence of And / or polynucleotides containing non-coding sequences.   The present invention further relates to polypeptides having the deduced amino acid sequence of FIG. 1 or FIG. Fragment of a polypeptide encoded by the cDNA of the deposited clone or Variants of the above-described polynucleotides encoding amino acids, analogs, and derivatives Regarding foreign bodies. Polynucleotide variants are naturally occurring variants of the polynucleotide. Allelic variants or non-naturally occurring variants of the polynucleotide You.   Thus, the present invention provides the same mature polypeptide or that shown in FIG. 1 or FIG. Encodes the same mature polypeptide encoded by the cDNA of the deposited clone Polynucleotides, as well as variants of such polynucleotides. You. These variants are those of the polypeptides of FIGS. 1 and 2 or the deposited clones. Fragments, derivatives, or analogs of a polypeptide encoded by the cDNA of Code. Such nucleotide variants include deletion variants, substitution variants, And addition or insertion variants.   As indicated hereinabove, the polynucleotide may be as shown in FIG. 1 or FIG. Naturally occurring allelic variations of the coding sequence or the coding sequence of the deposited clone It may have a coding sequence that is variant. As is known in the art, allelic variation Variants are polynucleotide sequences that may have nucleotide substitutions, deletions, or additions. Another form of sequence that substantially alters the function of the encoded polypeptide Do not let. A polynucleotide may also comprise a mature protein and additional 5 'amino acids The residue may encode a proprotein. Mature proteins with prosequences It is a proprotein, and it is an inactive form of the protein. Once professional distribution When the row is cut, the active mature protein remains.   Thus, for example, a polynucleotide of the invention may comprise a mature protein, Both a protein having a sequence or both a prosequence and a presequence (leader sequence) May be encoded.   The polynucleotide of the present invention also allows for purification of the polypeptide of the present invention. It may have the coding sequence fused in frame to the sequence. Marker sequences are bacterial PQE-9 vector in preparation for purification of the mature polypeptide fused to the marker in the case of the host Hex-histidine tag supplied by the protein. Or, for example, The Kerr sequence may be a hemagglutinin when a mammalian host (eg, COS-7 cells) is used. It can be a tinin (HA) tag. HA tag is for influenza hemagglutinin Corresponds to the epitope from the protein (Wilson, I. et al., Cell, 37: 767 (1984)).   The invention further provides that there is at least 50% and preferably 70% identity between the sequences. If present, the polynucleotides that hybridize to the sequences described herein I do. The invention is particularly applicable to the polynucleotides described above which are stringent. A polynucleotide that hybridizes under conditions. As used herein The term "stringent conditions" means that hybridization is less between sequences. Generated only if at least 95% and preferably at least 97% identity is present It means In a preferred embodiment, a polynucleotide as described herein above The polynucleotide that hybridizes to the cDNA of FIG. 1 and FIG. Substantially the same biological function as the mature polypeptide encoded by the cDNA or Encodes a polypeptide that retains biological activity.   The deposit (s) referred to in this specification is a fine deposit for patent processing purposes. Maintained under the terms of the Budapest Treaty on the International Recognition of Deposits of Organisms. these Deposits are provided solely for convenience to those of skill in the art and are not permitted under 35 U.S.C. 112. It is not an admission that trust is required. Polynucleotides in the deposit The sequence of the tide, as well as the amino acid sequence of the polypeptide encoded thereby, It is hereby incorporated by reference and has the sequence description herein. The case of such a contradiction is also controlled. Manufacture, use, or sell the deposit May require a license, and such a license is hereby granted. Not necessarily.   The invention further has or has the deposited amino acid sequence of FIGS. 1 and 2. ICE-LAP-1 and ICE-LAP-2 having an amino acid sequence encoded by the cDNA Peptides, and fragments, analogs, and Related to derivatives.   The terms "fragment," "derivative," and "analog" are described in FIGS. A polypeptide or a polypeptide encoded by the deposited cDNA If so, essentially the same biological function or biological activity as such a polypeptide. Means a polypeptide that retains And in this case, the derivative is Includes polypeptides having reduced biological function. Analog is Protan A protein that can be activated by cleavage of a protein moiety to produce an active mature polypeptide Proteins.   The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or It can be a synthetic polypeptide, preferably a recombinant polypeptide.   1 or 2 or the polypeptide encoded by the deposited cDNA A fragment, derivative, or analog of a peptide may comprise (i) one or more Amino acid residues are conserved or non-conserved amino acid residues (preferably conserved amino acid residues) Substituted and such substituted amino acid residues are encoded by the genetic code. Fragments, derivatives or even amino acid residues that may or may not be Or an analog, or (ii) in which one or more amino acid residues contain a substituent. Fragment, derivative, or analog, or (iii) the mature polypeptide therein. Are compounds that increase the half-life of the polypeptide (eg, polyethylene glycol Fragment, derivative, or analog fused to another compound, such as Or (iv) a leader or secretory sequence or a mature polypeptide. Or additional amino acids such as those used to purify proprotein sequences. Can be a fragment, derivative, or analog fused to a mature polypeptide . Such fragments, derivatives and analogs are derived from the teachings herein. Are considered to be within the purview of those skilled in the art.   The polypeptides and polynucleotides of the present invention are preferably in isolated form And is preferably purified to homogeneity. The term "isolated" refers to a substance Removed from its natural environment (eg, the natural environment if it occurs naturally) Means that it is. For example, natural polynuclei present in living animals Otides or polypeptides not isolated, but coexist in natural systems The same polynucleotide or polypeptide isolated from some or all of the same Has been isolated. Such a polynucleotide can be part of a vector, And / or such a polynucleotide or polypeptide may be one of the compositions And may further comprise such a vector or composition in its natural environment. It is not a part and can be isolated.   The present invention also provides a vector comprising the polynucleotide of the present invention, a vector of the present invention. Host cells that are genetically engineered with Related to generating peptides.   The host cell is a vector of the present invention (for example, a cloning vector or Genetic manipulation (transduction or transformation or Transfected). Vectors include, for example, plasmids, viral particles, It may be in the form of a phage or the like. Engineered host cells activate the promoter And select appropriate transformants or modify appropriately to amplify ICE-LAP-1 gene Cultured in a conventional nutrient medium. Culture conditions (eg, temperature, pH, etc.) Are the conditions previously used in the host cell selected for expression, and It is clear to the person.   The polynucleotides of the present invention can be used to produce polypeptides by recombinant techniques. Can be used. Thus, for example, a polynucleotide expresses a polypeptide For expression in any one of a variety of expression vectors. Vector like this Include chromosomal, non-chromosomal, and synthetic DNA sequences and include, for example, SV40 derivatives Bacterial plasmid; phage DNA; baculovirus; yeast plasmid; Vectors, vaccinia, and adenoviruses derived from combinations of sumid and phage DNA Virus DNA, such as virus, fowlpox virus, and pseudorabies. I However, any other vector as long as it is replicable and viable in the host. Can be used.   The appropriate DNA sequence can be inserted into the vector by various procedures. Generally, DNA distribution The sequence is inserted into the appropriate restriction endonuclease site by procedures known in the art. You. Such and other procedures are considered to be within the purview of those skilled in the art. You.   The DNA sequence in the expression vector contains the appropriate expression control sequence (s) (pro Operably linked to a motor) to direct mRNA synthesis. Such a promotion Representative examples of the virus may include the following: retroviruses (eg, RSV , HIV, HTLVI, CMV, or SV40 promoter) derived LTR,E.coli lacOrtrp , λ phage P_LPromoters and prokaryotic or eukaryotic cells or their cells Other promoters known to control the expression of genes in irs. However Alternatively, cell signals such as the human-β-actin promoter can also be used. . Expression vectors also provide a ribosome binding site for translation initiation and a transcription terminator. Noether. Vectors can also be used to amplify gene copy numbers. It can include a unique sequence.   Furthermore, the expression vector is preferably for selection of transformed host cells. Phenotypic characteristics (eg, for eukaryotic cell cultures, dihydrofolate reductase or Or neomycin resistance, orE . coliTetracycline resistance or Contains one or more selectable marker genes that provide for (ampicillin resistance).   A suitable DNA sequence as described herein above, as well as a suitable promoter sequence or The vector containing the control sequences is used to transform the Can be used to express   Representative examples of suitable hosts may include: bacterial cells (eg,E . coli ,Bacillus subtilis , Streptomyces, Salmonella typhimurium);fungus Cells (eg, yeast); insect cells (eg,DrosophilaandSf9); Animal cells ( For example, CHO, COS, HEK 293 or Bowes melanoma); plant cells and the like. Of a suitable host The selection is deemed to be within the scope of those skilled in the art from the teachings herein.   More particularly, the present invention also includes one or more of the sequences broadly described above. Includes recombinant constructs. The construct may be a vector (eg, a plasmid vector or Or a viral vector), in which the sequence of the present invention has a forward orientation. Or they are inserted in the opposite direction. According to a preferred aspect of this embodiment, the construct Further comprises a regulatory sequence operably linked to the sequence (eg, including a promoter). To). Many suitable vectors and promoters are known to those of skill in the art. And can be purchased. The following vectors are provided as examples. Bacterial: pQ E70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8a, pNH16a, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3 , PKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pX T1, pSG (Stratagene); pSVK3, pBPV, pMSG, pSVL (Pharmacia). But the inn Any other plasmid or plasmid as long as it is replicable and viable in the main Can also be used as a vector.   The promoter region is CAT (chloramphenicol transferase) vector Using any vector that has a desired marker or other Can be selected from Two suitable vectors are pKK232-8 and pCM7. Especially Well known bacterial promoters include lacI, lacZ, T3, T7, -gpt, λP_R, P_L, And And trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, SV40 and late SV40, LTRs from retrovirus, and mouse metallothione In I. Selection of the appropriate vector and promoter is well within the skill of the art. Within the level of   In a further embodiment, the present invention relates to a host cell containing the above-described construct. Host cells can be higher eukaryotic cells (eg, mammalian cells) or lower eukaryotic cells (eg, Or a host cell can be a prokaryotic cell (eg, a bacterial cell). Can be The introduction of the construct into the host cells is performed by calcium phosphate transfection. Reaction, DEAE-dextran mediated transfection, lipofection or It can be achieved by electroporation (Davis, L., Dibner, M., Battey, I ., Basic Methods in Molecular Biology, 1986).   The construct in the host cell produces the gene product encoded by the recombinant sequence To be used in a conventional manner. Alternatively, the polypeptide of the present invention Can be produced synthetically by a peptide synthesizer.   Mature proteins are suitable for use in mammalian cells, yeast, bacteria, or other cells. And can be expressed under the control of a promoter. Cell-free translation systems also use such proteins. Can be used to generate quality using RNA from the DNA constructs of the present invention. . Appropriate cloning vectors and expression for use in prokaryotic and eukaryotic hosts Vectors are described in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd edition ( Cold Spring Harbor, N.Y., 1989) (the disclosure of which is incorporated herein by reference). Has been described).   Transcription of a DNA encoding a polypeptide of the present invention by higher eukaryotes may be a vector It is increased by inserting an enhancer sequence into the gene. Enhancers are DNA Cis-acting factor, usually about 10 to about 300 bp, which acts on the promoter To increase its transcription. An example is the SV40 mutant on the late side of the replication origin bp 100-270. Enhancer, cytomegalovirus early promoter enhancer, origin of replication Includes late-stage polyoma enhancer and adenovirus enhancer I do.   In general, recombinant expression vectors enable the origin of replication and the transformation of host cells. Selectable marker (for example,E . coliAmpicillin resistance gene andS . cerevi siae TRP1 gene) and highly expressed genes that direct transcription of downstream structural sequences Contains a promoter. Such promoters are particularly useful for glycolytic enzymes (eg, For example, 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, May be derived from an operon that encodes a heat shock protein. Heterogeneous structure The columns are the translation initiation and termination sequences, and preferably the translated protein. A leader sequence that can direct secretion of the protein into the periplasmic space or extracellular medium. Assembled in the most difficult phase. If desired, the heterologous sequence may have desired characteristics (eg, expression). N-terminal identification peptides that provide for stabilization or simplified purification of the expressed recombinant product) It may encode a fusion protein comprising a tide.   Expression vectors useful for bacterial use include functional promoters and operable readouts. In the interrogation phase, the structural DNA sequence encoding the desired protein is replaced with an appropriate translation initiation signal. And a translation termination signal. The vector is One or more phenotypic selectable markers, and to ensure the maintenance of the vector, and And optionally an origin of replication to provide for amplification in the host. Transformed Prokaryotic hosts suitable forE . coli,Bacillus subtilis,Salmonella typhimuri um And various species of the genera Pseudomonas, Streptomyces, and Staphylococcus But other species may also be used as selections.   As a representative, but non-limiting example, an expression vector useful for bacterial use is Commercially available containing the genetic elements of the well-known cloning vector pBR322 (ATCC 37017) And a bacterial origin of replication. this Such commercially available vectors are, for example, pKK223-3 (Pharmacia Fine Chemicals, Upps ala, Sweden) and GEM1 (Promega Biotec, Madison, WI, USA). This These pBR322 "backbone" portions contain a suitable promoter and the structural elements to be expressed. Combined with columns.   Following transformation of the appropriate host line and propagation of the host line to the appropriate cell density, , The selected promoter may be selected by appropriate means (eg, temperature shift or chemical induction). And the cells are cultured for an additional period.   Cells are typically harvested by centrifugation and applied by physical or chemical means. More disrupted and the resulting crude extract is retained for further purification.   Microbial cells used in protein expression include freeze-thaw cycles, supersonic By any convenient method, including sonication, mechanical disruption, or use of cell lysing agents. And such methods are well known to those skilled in the art.   Various mammalian cell culture systems have also been used to express recombinant proteins. Can be Examples of mammalian expression systems are described in Gluzman, Cell, 23: 175 (1981). COS-7 strain of monkey kidney fibroblasts, and other capable of expressing compatible vectors Cell lines (eg, C127, 3T3, CHO, HeLa, and BHK cell lines). Feeding Animal expression vectors contain an origin of replication, appropriate promoters and enhancers, An adenylation site, a splice donor site and a splice acceptor site, It may contain a transcription termination sequence, and a 5 'flanking non-transcribed sequence. SV40 splice DNA sequences derived from the DNA and polyadenylation sites contain the necessary non-transcribed genetic elements. Can be used to provide   ICE-LAP-1 and ICE-LAP-2 polypeptides are recombinantly produced by the methods described below. Can be recovered from cell cultures and purified. These methods include ammonium sulfate precipitation or Is ethanol precipitation, acid extraction, anion or cation exchange chromatography, Cellulose phosphate chromatography, hydrophobic interaction chromatography, Affinity chromatography, hydroxylapatite chromatography , And lectin chromatography. If necessary, protein Refolding process completes the placement of the mature protein Can be used for Ultimately, high performance liquid chromatography (HPLC) It can be used in the manufacturing process.   The polypeptides of the present invention may be natural purified products or products of chemical synthetic procedures. Or a prokaryotic or eukaryotic host (eg, a bacterium, an enzyme in culture). Produced by recombinant techniques from mother, higher plants, insects, and mammalian cells). Can be Depending on the host used for the recombinant production procedure, the polypeptide of the invention may be , Can be glycosylated or not glycosylated. Polype of the present invention The peptide may also include an initial methionine amino acid residue.   ICE-LAP-1 and ICE-LAP-2 polypeptides are abnormally regulated programmed cells Can be used to treat death. Abnormally controlled programmed cell death An abnormal amount of growth may be the underlying cause of cancer. Therefore, ICE-LAP genetics Offspring are involved in programmed cell death and therefore are unwanted cells (e.g., cancer Cells). ICE-LAP-1 and ICE-LAP-2 also Used to control growth of tissues and homeostasis of tissues (due to their apoptotic potential) It is.   Also, programmed cell death is one of the cell's major antiviral defense mechanisms. Because it is possible, ICE-LAP-1 and ICE-LAP-2 polypeptides will Can be used to overcome many viral infections by overcoming cell death .   ICE-LAP-1 and ICE-LAP-2 also target virus-infected cells for cell death Can be used to treat disorders associated with immunosuppression (e.g., AIDS). You.   The polypeptides of the present invention also identify other molecules with similar biological activities. Can be used to An example of a screen for this is the oligonucleotide The ICE-LAP gene by using a known DNA sequence to synthesize a dope probe Isolation of the coding region of Labeled oligonucleotide having sequence complementarity with the gene of the present invention Gonucleotides are used to screen human cDNA, genomic DNA, or mRNA libraries. Which members and probes from the library are hybridized Decide what to do.   The polypeptides may also be used in vivo in accordance with the present invention. It can be used by expression of the tide. This is often called "gene therapy".   Thus, for example, a cell from a patient can be a polynucleotide encoding a polypeptide. Can be engineered ex vivo with a peptide (DNA or RNA) and then engineered cells. The vesicle is provided to a patient to be treated with the polypeptide. Such a method is It is well known in the art. For example, a cell may comprise an RNA encoding a polypeptide of the invention. Is manipulated by procedures known in the art by use of retroviral particles containing Can be made.   Similarly, cells can be used, for example, to express the polypeptide for in vivo expression of the polypeptide. It can be manipulated in vivo by known procedures in the field. As is known in the art, To produce retroviral particles containing RNA encoding the light polypeptide Producing cells for engineering cells in vivo and for polypeptides in vivo Can be administered to the patient for the expression of the drug. By such a method, the polypeptide of the present invention These and other methods for administering tides are known to those of skill in the art from the teachings of the present invention. It is clear. For example, an expression vehicle for manipulating cells is It can be other than a retrovirus (eg, an adenovirus). This is suitable Can be used to manipulate cells in vivo after combination with a smart delivery vehicle You.   The polypeptides of the present invention can be used in combination with a suitable pharmaceutical carrier. . Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable A carrier or excipient is included. Such carriers include physiological saline, Buffered saline, dextrose, water, glycerol, ethanol, and These combinations include, but are not limited to. The formulation is the mode of administration Should be adjusted to   The invention also relates to one or more components filled with one or more components of the pharmaceutical composition of the invention. A pharmaceutical pack or kit containing the container of Such containers are Stipulated by government agencies governing the manufacture, use, or sale of agents or biological products May be associated with a notice in the form of Or reflect government approvals in sales. Further, the polypep of the present invention Tide may be used in combination with other therapeutic compounds.   Pharmaceutical compositions may be administered by intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. Such can be administered in any convenient manner. ICE-LAP-1 and ICE-LAP-2 are specific Is administered in an amount effective for treatment and / or prevention of any symptoms. In general, ICE-LAP-1 and ICE-LAP-2 are administered, for example, in an amount of at least about 10 μg / kg body weight. , And in most cases, no more than 8 mg / kg body weight per day . In most cases, the dose is about 10 μg / kg body weight daily, taking into account the administration route, symptoms, etc. ~ 1 mg / kg body weight.   The sequences of the present invention may also be useful for chromosome identification. This array is Specifically target a specific location on the chromosome, and hybridize at that location I can do it. In addition, it is now necessary to identify specific sites on the chromosome. Currently, dyed Chromosome markers based on actual sequence data (repetitive polymorphisms) that can be used to label chromosome locations There are few reagents. Mapping of DNA to chromosome of DNA according to the present invention This is an important first step in the correlation between these sequences and genes related to diseases.   Briefly, the sequence consists of a PCR primer (preferably 15-25 bp) from the cDNA. It can be mapped to a chromosome by preparation. Computer analysis of cDNA Does not span more than one exon in nome DNA, thus complicating the amplification process Used to quickly select primers that do not. Then these ply Mer is a PCR screener for somatic cell hybrids containing individual human chromosomes Used for Only hybrids containing the human gene corresponding to the primer This produces an amplified fragment.   PCR mapping of somatic cell hybrids assigns specific DNA to specific chromosomes A quick procedure for The present invention with the same oligonucleotide primer Use a panel of fragments from a particular chromosome or similar format in a large Sublocalization is achieved using a pool of genomic clones obtain. Other mapping strategies that can also be used to map to chromosomes are In situ hybridization, labeled by flow cytometry (Flow-sorted) Prescreening using chromosomes and chromosome-specific cDNA Includes pre-selection by hybridization to construct libraries You.   Fluorescence in situ hybridization of cDNA clones to metaphase chromosomal spreads (FISH) can be used to provide a precise chromosomal location in one step. This technique Surgery can be used with cDNAs as short as 500 or 600 bases; Larger clones have unique chromosomal locations with sufficient signal strength for easy detection Easy to combine. FISH requires the use of clones from which ESTs are derived, and The longer the clone, the better. For example, 2,000bp is better and 4,000bp is more Good and over 4,000 bp in length at a reasonable rate of time (a resonab le percentage of the time) probably necessary to get good results Absent. For a review of this technology, see Verma et al., Human Chromosomes: a Manual of B See asic Techniques, Pergamon Press, New York (1988).   Once a sequence has been mapped to the exact chromosomal location, the physical The location can be correlated with genetic map data. Such data is described, for example, in M cKusick, found in Mendelian Inheritance in Man (Johns Hopkins Univers (available online from ity Welch Medical Library). Then the same The relationship between the gene mapped to the chromosomal region and the disease is analyzed by linkage analysis (physical neighbors). (Inheritance of adjacent genes).   Next, determine the differences in the cDNA or genomic sequence between affected and unaffected individuals There is a need. Mutation is observed in some or all affected individuals but is normal If not observed, the mutation is likely to be a causative agent of the disease.   With the current resolution of physical and genetic mapping techniques, CDNA that is correctly located in the chromosomal region of interest has between 50 and 500 potential causes. It may be one of the genes. (This is a mapping resolution of 1 megabase, and 20 Assume one gene per kb. )   The polypeptide, a fragment or other derivative thereof, or an analog thereof. Logs, or cells that express them, generate antibodies against them Can be used as an immunogen. These antibodies are, for example, polyclonal antibodies. Or a monoclonal antibody. The present invention also relates to chimeric antibodies, single chain antibodies and And humanized antibodies, as well as Fab fragments or the products of an Fab expression library. Include. Various procedures known in the art may be used for such antibodies and fragments. Can be used for the generation of   Antibodies raised against polypeptides corresponding to the sequences of the present invention may be used to Obtained by direct injection of the polypeptide or by administration of the polypeptide to the animal. obtain. The animal is preferably not a human. Then obtained in this way The antibody binds to the polypeptide itself. Thus, the polypeptide flag Antibodies that bind to the entire native polypeptide, even sequences that encode only Can be used to generate Such an antibody is then Can be used to isolate the polypeptide from a tissue that expresses.   Antibodies produced by continuous cell line cultures for the preparation of monoclonal antibodies Any technique for providing the body can be used. Examples include hybridoma technology (Ko hler and Milstein, 1975, Nature, 256: 495-497), trioma technology, human B Cell hybridoma technology (Kozbor et al., 1983, Immunology Today 4:72), and EBV hybridoma technology for producing human monoclonal antibodies (Cole et al., 198 5, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 ).   The technique described for generating single chain antibodies (U.S. Pat. Can be adapted to generate single chain antibodies to the immunogenic polypeptide products of the invention. You.   The invention also relates to a sample (eg, blood, urine, or serum sample) obtained from a host. ICE-LAP-1 and ICE-LAP-2 levels in I do. ICE-LAP-1 and ICE-LAP-2 levels can be determined, for example, by procedures known in the art. By immunoassay techniques. An example of such an assay is ICE- Two antibodies specific for the LAP-1 and ICE-LAP-2 antigens, preferably one of the antibodies are labeled (Eg, such as indicator enzymes (eg, horseradish peroxidase)) Sandwiches using monoclonal antibodies (by attaching appropriate labels) And the unlabeled antibody is preferably on a solid support. Antigen present If so, the antigen binds to both antibodies. Peroxidase-conjugated antibody to antigen After binding, peroxidase is measurable and its concentration is determined by the concentration of antigen in the sample. It can be used to produce a quantity related colored product. Depends on the catalytic properties of the enzyme And the system greatly amplifies the signal. Changed level of ICE-LAP-1 and ICE-LAP-2 Indicate the specific diseases described above.   The present invention also relates to antagonists / inhibitors of the polypeptides of the present invention. You. Antagonists / inhibitors reduce or eliminate polypeptide function Can be used to   An example of an antagonist is an antibody, or in some cases, ICE-LAP-1 And ICE-LAP-2 polypeptides. Inhibi An example of a small molecule is a small molecule that binds to the catalytic site of a polypeptide. The catalytic site, thereby making the catalytic site inaccessible to the substrate, thereby Activity is disrupted. Examples of small molecules include small peptides or peptide-like molecules But not limited to them.   In vivo, the levels of ICE-LAP-1 and ICE-LAP-2 are determined using antisense technology. Antisense that inhibits the production of ICE-LAP-1 and ICE-LAP-2 in vivo Can be reduced by the administration of the DNA construct. Antisense technology forms a triple helix Alternatively, regulate gene expression through antisense DNA or antisense RNA Can be used for Both of these methods use polynucleotides for DNA or RNA. Based on the linkage of the tide. For example, a polynucleic acid encoding the mature polypeptide of the invention The 5 'coding portion of the reotide sequence is an antisense R of about 10 to 40 base pairs in length. Used to design NA oligonucleotides. DNA oligonucleotides Designed to be complementary to the region of the gene involved in transcription (triple helix- Lee et al., Nucl. Acids Res., 6: 3073 (1979); Cooney et al., Science, 241: 456 (1988). And Dervan et al., Science, 251: 1360 (1991)), and consequently ICE-LAP. Prevents transcription and production of -1 and ICE-LAP-2 polypeptides. Antisense RNA The oligonucleotide hybridizes to the mRNA in vivo, and ICE-LAP-1 and Blocking translation of mRNA molecules into ICE-LAP-2 and ICE-LAP-2 polypeptides (antisense-O kano, J .; Neurochem., 56: 560 (1991); Oligodeoxynucleotides as Antisense In See hibitors of Gene Expression, CRC Press, Boca Raton, FL (1988) ).   Antagonists / inhibitors may cause cardiovascular disease, stroke, trauma, and other degenerative Diseases (abnormal regulation of ICE-LAP-1 and ICE-LAP-2 may lead to pathological cell death, eg, immune Causes suppression-related diseases, Alzheimer's disease, Parkinson's disease, rheumatoid arthritis Can be used to treat non-programmed necrotic cell death associated with     Antagonists / inhibitors may also be found in lung and trachea, central nervous system, eyes and For immune-based disorders of the ears, joints, bones, cardiovascular, and gastrointestinal and urinary systems Can be used to treat. Antagonists / inhibitors are pharmaceutically acceptable Can be used in compositions with active carriers, such as those described herein above.   The present invention further provides an ANT-LAP-1 and ICE-LAP-2 polypeptide of the invention. Screening molecules to identify gonists / inhibitors or agonists Related to the process of Agonists are the natural sources of ICE-LAP-1 and ICE-LAP-2. While increasing physical function, antagonists decrease such function. And remove it. Examples of such assays allow for action on a substrate, and Do these compounds prevent ICE-LAP-1 and ICE-LAP-2 from cleaving the substrate ICE-LAP-1 and ICE-LAP under conditions that determine whether -2, as well as potential antagonist or agonist compounds and their Includes combinations with natural substrates.   The invention will be further described with reference to the following examples; It should be understood that the present invention is not limited to such an embodiment. All parts or quantities are stated Unless indicated otherwise, by weight.   To facilitate understanding of the following examples, certain frequently occurring methods and And / or describe terms.   “Plasmids” are capital letters before and / or after a lower case p and / or Indicated by numbers. The starting plasmids herein are either commercially available or subject to restriction criteria. Plus publicly available or available according to published procedures Either can be constructed from mid. In addition, the plasmids described Valent plasmids are known in the art and will be apparent to those skilled in the art.   `` Digestion '' of DNA involves touching it with a restriction enzyme that acts only at certain sequences in the DNA. It means to cut by a medium reaction. The various restriction enzymes used herein are commercially available. Are sold and their reaction conditions, cofactors, and other requirements are The known ones were used. For analytical purposes, typically 1 μg of plasmid or Uses a DNA fragment with about 2 units of enzyme in about 20 μl of buffer solution . For the purpose of isolating DNA fragments for plasmid construction, typically Is Digest 5-50 μg of DNA with 20-250 units of enzyme in a larger volume. specific Appropriate buffers and substrate amounts for restriction enzymes are specified by the manufacturer. 37 ℃ An incubation time of about 1 hour is usually used, but this is It can vary according to the written instructions. After digestion, the reaction is directly electrophoresed on a polyacrylamide gel. Run to isolate the desired fragment.   Size separation of the cleaved fragments is described by Goeddel, D. et al., Nucleic Acids Res. 8% polyacrylamide gel described by 8: 4057 (1980), or agaro This is done using swell gel (0.5-1.5%).   "Oligonucleotide" refers to a single-stranded polydeoxynucleotide or two phases. Refers to any of the complementary polydeoxynucleotide chains, which are chemically synthesized Can be Such synthetic oligonucleotides have no 5 'phosphate and therefore If phosphate and ATP are not added in the presence of the Do not tie. Synthetic oligonucleotides are converted to non-dephosphorylated fragments. connect.   "Ligation" forms a phosphodiester bond between two double-stranded nucleic acid fragments. (Maniatis, T. et al., Supra, p. 146). Unless you provide otherwise, Ligation is performed with approximately equimolar amounts of 10 units of T / 0.5 μg of DNA fragment to be ligated. 4 Along with DNA ligase (“ligase”), use known buffers and conditions. Can be achieved.   Unless otherwise stated, transformations were performed by Graham, F. and Van der Eb, A., Virology. 52: 456-457 (1973).                                 Example 1 COS Expression of recombinant ICE-LAP-1 in cells   The expression plasmid (ICE-LAP-1 HA) contains the vector pcDNAI / Amp (Invitr ogen): 1) SV40 replication origin, 2) ampicillin resistance gene, 3) E.col i replication origin, 4) CMV promoter, followed by polylinker region, SV40 Ron and polyadenylation sites. All ICE-LAP-1 precursors and an inf The DNA fragment encoding the HA tag fused to the Cloned into Kerr region. Therefore, recombinant protein expression is Under the control of the territory. The HA tag is for the influenza hemagglutinin protein (I. Wilson, H. Niman, R. Heighten, A. Che renson, M .; Connolly, and R. Lerner, 1984, Cell 37, 767). Inventor's mark Fusion of an HA tag to a specific protein, together with an antibody that recognizes the HA epitope, Enables easy detection of the recombinant protein.   The plasmid construction method is as follows:   A DNA sequence encoding ICE-LAP-1 (ATCC # 75772) was prepared using two primers. Was constructed by PCR on full length ICE-LAP-1: 5 ′ primer-sequence (5′-GTTCACTATGG CAGAAGGCAAGGACAG-3 ') from the ICE-LAP-1 translation start site ATG, followed by the start codon Contains 17 nucleotides of the starting ICE-LAP-1 coding sequence; 3 'sequence 5'-AATCAAGCG TAGTCTGGGACGTCGTATGGGTAATTGCCAGGAAAGAGGTAGAAA-3 ′ is a translation stop codon, HA tag And the last 28 nucleotides of the ICE-LAP-1 coding sequence (not including the stop codon) ). Therefore, the PCR product was ICE-L with the HA tag fused in-frame. Contains the AP-1 coding sequence and a translation termination stop codon adjacent to the HA tag. PCR The amplified DNA fragment was ligated with pcDNAI / Amp by blunt end ligation. Concatenated mixture Was replaced with E. coli strain SURE (Stratagene Cloning Systems, 11099 North Torrey Pines R oad, available from La Jolla, CA 92037). A. Stained on ampicillin media plates and resistant colonies were selected. plus Mid DNA was isolated from transformants and tested for the presence of the correct fragment. Tested by restriction analysis. For expression of recombinant ICE-LAP-1, COS cells were Transfected with an expression vector by the kisstran method (J. Sambrook , E. Fritsch, T .; Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1988)). ICE-LAP-1 HA protein expression Detected by the sexual labeling method and the immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1989)). cell Check the quality two days after transfection³⁵Labeled with S-cysteine for 8 hours. Next The culture medium was harvested with and the cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5) ). (Wilson, I. et al., Supra at 37: 767 (1984)). Both cell lysate and culture medium Precipitated with HA specific monoclonal antibody. Precipitated protein is purified with 15% SDS-PA Analyzed on GE gel.                                 Example 2 COS Expression of recombinant ICE-LAP-2 in cells   The expression plasmid (ICE-LAP-2 HA) contains the vector pcDNAI / Amp (Invitr ogen): 1) SV40 replication origin, 2) ampicillin resistance gene, 3) E.col i replication origin, 4) CMV promoter, followed by polylinker region, SV40 Ron and polyadenylation sites. All ICE-LAP-2 precursors and inflation at their 3 'end The DNA fragment encoding the HA tag fused to the Cloned into Kerr region. Therefore, recombinant protein expression is Under the control of the territory. The HA tag is for the influenza hemagglutinin protein (I. Wilson, H. Niman, R. Heighten, A. Che renson, M .; Connolly, and R. Lerner, 1984, Cell 37, 767). Inventor's mark Fusion of an HA tag to a specific protein, together with an antibody that recognizes the HA epitope, Enables easy detection of the recombinant protein.   The plasmid construction method is as follows:   The DNA sequence encoding ICE-LAP-2 (ATCC # 75819) was prepared using two primers. Was constructed by PCR on full-length ICE-LAP-2: 5 ′ primer (5′-AGCTGATGGCCGCT GACAGGGG-3 ') is an ICE-LAP-2 translation initiation site (ATG) followed by an I Contains 14 nucleotides of the CE-LAP-2 coding sequence; 3 'sequence (5' AATCAAGCGTAGTC TGGGACGTCGTATGGGTATGTGGGAGGGTGTCCTGGGA 3 ') is a translation stop codon, HA tag and And the last 20 nucleotides of the ICE-LAP-2 coding sequence (not including the stop codon) contains. Thus, the PCR product was ICE-LAP-2 with the HA tag fused in-frame. The coding sequence contains a translation termination stop codon adjacent to the HA tag. PCR amplified DNA Fragment was ligated with pcDNAI / Amp by blunt end ligation. The concatenated mixture is transferred to the E. SURE (Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Joll a, available from CA 92037). Transform the culture into ampicillin Ground Plates were plated and resistant colonies were selected. Transform plasmid DNA Isolated from recombinant and tested by restriction analysis for the presence of the correct fragment did. For expression of recombinant ICE-LAP-2, COS cells were harvested by the DEAE dextran method. Transfected using an expression vector (J. Sambrook, E. Fritsch, T. Ma niatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory P ress, (1989)). ICE-LAP-2 HA protein expression was determined by free labeling and immunoprecipitation. Detected by the descending method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, (1988)). Transfect cells Two days after the³⁵Labeled with S-cysteine for 8 hours. The culture medium is then collected, The cells were then lysed with a detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0. 1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5)). (Wilson, I. et al., Before Ex 37: 767 (1984)). Both cell lysate and culture medium are Precipitated with null antibody. The precipitated protein was analyzed on a 15% SDS-PAGE gel.                                 Example 3 Expression pattern of ICE-LAP-1 in human tissues   Perform Northern blot analysis to determine the level of ICE-LAP-1 expression in human tissues. Tested. RNAzol^TMB system (Biotecx Laboratories, I nc. 6023 South Loop East, Houston, TX 77033). Each person instructed Approximately 10 μg of total RNA isolated from the tissue was separated on a 1% agarose gel and Blotted on Iron filter. (Sambrook, Fritsch, and Maniatis, M olecular Cloning, Cold Spring Harbor Press, (1989)). Labeling reaction with 50 ng This was performed according to the Stratagene Prime-It kit using the DNA fragment. Marked The purified DNA was purified on a Select-G-50 column. (5Prime-3Prime, Inc. 5603 Arapaho e Road, Boulder, CO 80303). The filter is then used to remove the radiolabeled full length 0.5M NaPO using ICE-LAP-1 gene_Four(pH 7.4) and 1,000,000 cp in 7% SDS Hybridized overnight at 65 ° C. at m / ml. 0.5 × SSC, 0.1% SDS, room temperature After washing twice at 60 ° C and twice at 60 ° C, the filter is then Exposure overnight with lean (intensifying screen). Messe for ICE-LAP-1 Gage RNA is abundant in the liver. (FIG. 5).                                 Example 4 Expression pattern of ICE-LAP-2 in human tissues   Perform Northern blot analysis to test for ICE-LAP-2 expression levels in human tissues. Tested. RNAzol^TMB system (Biotecx Laboratories, I nc. 6023 South Loop EaSt, Houston, TX 77033). Each person instructed Approximately 10 μg of total RNA isolated from the tissue was separated on a 1% agarose gel and Blotted on Iron filter. (Sambrook, Fritsch, and Maniatis, M olecular Cloning, Cold Spring Harbor Press, (1989)). Labeling reaction with 50 ng This was performed according to the Stratagene Prime-It kit using the DNA fragment. Marked The purified DNA was purified on a Select-G-50 column. (5Prime-3Prime, Inc. 5603 Arapaho e Road, Boulder, CO 80303). The filter is then used to remove the radiolabeled full length 0.5M NaPO using ICE-LAP-2 gene_Four(pH 7.4) and 1,000,000 cp in 7% SDS Hybridized overnight at 65 ° C. at m / ml. 0.5 × SSC, 0.1% SDS, room temperature After washing twice at 60 ° C and twice at 60 ° C, the filter is then Exposure overnight with lean.   Many modifications and variations of the present invention are possible and in light of the above teachings. Thus, within the scope of the appended claims, the invention may be practiced other than as specifically described. .

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁶ Identification code Agency reference number FI // C12P 21/08 7823-4B C12Q 1/68 A C12Q 1/68 9735-4B C12N 5 / 00B (C12N 9/64 C12R 1:91) (72) Rosen, Craig A. Inventor, Maryland, USA 20882, Rolling Hill Road 22400, Laytonsville, USA (72) Inventor Hastings, Greg A. Maryland, 20850, Rock Building, Gable Ridge Terrace 9913, Apartment H (72) Inventor Hudson, Peter El. United States Maryland 20874, Germantown, Highstream Drive 19041 (72) Inventor Kirknes, Ewen F. United States Wa Cantonal Deasy 20008, Kyasedoraru Avenue 2301, Apartment 406

Claims (1)

[Claims]   1. An isolated polynucleotide comprising: (a) Polynucleotide encoding ICE-LAP-1 polypeptide having the deduced amino acid sequence of FIG. Nucleotides, or fragments, analogs, or derivatives of the polypeptides ; (b) a polynucleotide encoding an ICE-LAP-2 polypeptide having the deduced amino acid sequence of FIG. A nucleotide or a fragment, analog, or derivative of the polypeptide; (c) having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75772 A polynucleotide encoding an ICE-LAP-1 polypeptide, or the polypeptide Fragments, analogs or derivatives of (d) having the amino acid sequence encoded by the cDNA contained in ATCC Deposit No. 75819 A polynucleotide encoding an ICE-LAP-2 polypeptide, or the polypeptide Fragments, analogs or derivatives of A polynucleotide selected from the group consisting of:   2. The polynucleotide according to claim 1, wherein the polynucleotide is DNA. .   3. The polynucleotide according to claim 1, wherein the polynucleotide is RNA. .   4. The polynucleotide according to claim 1, wherein the polynucleotide is genomic DNA. Otide.   5. The polynucleotide comprises ICE-LAP-1 having the deduced amino acid sequence of FIG. 3. The polynucleotide of claim 2, which encodes.   6. The polynucleotide comprises ICE-LAP-2 having the deduced amino acid sequence of FIG. 3. The polynucleotide of claim 2, which encodes.   7. The polynucleotide is an ICC encoded by the cDNA of ATCC Deposit No. 75772. 3. The polynucleotide of claim 2, which encodes a CE-LAP-1 polypeptide.   8. The polynucleotide is an ICC encoded by the cDNA of ATCC Deposit No. 75819. 3. The polynucleotide of claim 2, which encodes a CE-LAP-2 polypeptide.   9. 2. The polypeptide according to claim 1, which has the coding sequence of ICE-LAP-1 shown in FIG. nucleotide.   10. 2. The polypeptide according to claim 1, having the coding sequence of ICE-LAP-2 shown in FIG. Renucleotide.   11. Having the coding sequence of ICE-LAP-1 deposited as ATCC deposit number 75772, The polynucleotide according to claim 2.   12. Having the coding sequence of ICE-LAP-2, deposited as ATCC deposit no. The polynucleotide according to claim 2.   13. A vector containing the DNA according to claim 2.   14． A host cell genetically engineered with the vector of claim 13.   15. The host cell according to claim 14, wherein the polypeptide encoded by the DNA is used. A method of producing a polypeptide, comprising the step of expressing from a cell.   16. 14. Genetic manipulation of cells using the vector according to claim 13. Process for producing a cell capable of expressing a polypeptide.   17． An ICE-LAP-1 activity capable of hybridizing to the DNA according to claim 2. An isolated DNA encoding a polypeptide having the formula:   18. It can hybridize to the DNA according to claim 2, and has ICE-LAP-2 activity. An isolated DNA encoding a polypeptide having   19. A polypeptide comprising: (i) ICE-LAP-1 having the deduced amino acid sequence of FIG. Polypeptides, and fragments, analogs, and derivatives thereof; (ii) FIG. ICE-LAP-2 polypeptide having a deduced amino acid sequence and its fragment (Iii) encoded by the cDNA under ATCC Deposit No. 75772 ICE-LAP-1 polypeptide, and fragments and analogs of the polypeptide ICE-LA encoded by the cDNA of ATCC Deposit No. 75819 P-2 polypeptides, and fragments, analogs, and Derivatives, A polypeptide selected from the group consisting of:   20. The polypeptide is ICE-LAP-1 having the deduced amino acid sequence of FIG. The polypeptide of claim 19.   21. The polypeptide is ICE-LAP-2 having the deduced amino acid sequence of FIG. The polypeptide of claim 19.   22. An antibody against the polypeptide of claim 19.   23. An antagonist / inhibitor for the polypeptide of claim 19. -   24. Administering a therapeutically effective amount of the polypeptide of claim 19 to the patient. A method of treating a patient in need of ICE-LAP-1 comprising:   25. Administering a therapeutically effective amount of the polypeptide of claim 19 to the patient. A method of treating a patient in need of ICE-LAP-2, comprising:   26. 24. A therapeutically effective amount of the antagonist / inhibitor of claim 23. To treat patients in need of ICE-LAP-1 inhibition, including the step of administering to patients Law.   27. 24. A therapeutically effective amount of the antagonist / inhibitor of claim 23. To treat patients in need of ICE-LAP-2 inhibition, including the step of administering to the elderly Law.   28. The therapeutically effective amount of the polypeptide only encodes the polypeptide Providing the patient with DNA expressing the polypeptide in vivo. 25. The method of claim 24, wherein the method is provided.   29. The therapeutically effective amount of the polypeptide only encodes the polypeptide Providing the patient with DNA expressing the polypeptide in vivo. 26. The method of claim 25 provided.