JPH10313866A - Screening of agonist or antagonist of doc2alpha-munc13 combination - Google Patents

Abstract

PROBLEM TO BE SOLVED: To screen the subject agonist or antagonist by reacting Doc2α, etc., with Munc13, etc., in the presence or absence of a candidate and subsequently selecting a candidate for increasing or decreasing the binding ability. SOLUTION: This method for screening the candidate of an agonist or antagonist of a Doc2α-Munc13 combination comprises reacting Doc2α or Doc2α analogue with Munc13 or Munc13 analogue in the presence or absence of a candidate and selecting a candidate for increasing or decreasing their binding ability. The agonist or antagonist giving an effect to the binding ability of Munc13 to Doc2α related to the release of a calcium ion-dependent neurotransmitter can thus be screened. The proteins can control the release of the neurotransmitter or hormone.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for screening for an agonist or antagonist that affects the binding between Doc2α and Munc13; a peptide used in the method; and a method for regulating the release of a neurotransmitter or hormone by the peptide. .

[0002]

2. Description of the Related Art Recently, Doc2α, Munc13-1, and the like have been reported as proteins considered to be involved in calcium ion-dependent release of neurotransmitters.

Since the Doc2 protein isolated and expressed from a human cDNA library has two C2 regions, it is a protein named Double C2 [1 and 2] (hereinafter [] is The number of the reference is indicated, and the references are collectively described later.) Doc2 protein has Do
Includes c2α and Doc2β proteins.

Doc2α is expressed in a brain-specific manner.
Overexpressed in PC12 cells promotes calcium ion-dependent secretion and is thought to play an important role in neurotransmitter release
[3].

Doc2β is expressed in all examined tissues and is thought to be involved in the transport of vesicles that are ubiquitous in cells [4].

[0006] Doc2α and Doc2β have two C2 regions as described above, but do not have a transmembrane region and a labfilin (Rab) 3A binding region. Instead, Doc2α
And Doc2β have a region in which the amino acid sequence specific to Doc2 is conserved (Doc2 specific region) [4].

[0007] The C2 region of Doc2α and Doc2β is a region first discovered in protein kinase C proteins [5 and 6], and is a region that binds to calcium ions and phosphatidylserine [7]. In addition to protein kinase C, several types of proteins are known to have a C2 region. They include phospholipase A2 [8], phospholipase Cγ [9], unc-13
[10], Munc13-1 [11], synaptotagmin I [12], labfilin 3A [13] and the like.

[0008] Munc13 is a nematode (Caenorhabditis elegan)
It is a protein encoded by a rat gene similar to the unc-13 gene [14] in s). The unc-13 gene of the nematode is 1
Munc13 has one C1 region and three C2 regions, whereas it has one C1 region and two C2 regions [10, 11, 15]. It is known that phospholipids such as phorbol ester, diacylglycerol and phosphatidylserine bind to the C1 region [10 and 15]. In worms, mutations in the unc-13 gene cause acetylcholine to accumulate in the body and impair movement.
13 is thought to be involved in the release of neurotransmitters such as acetylcholine [16]. It has been reported that Munc13 contains three similar proteins, Munc13-1, Munc13-2 and Munc13-3. All Munc13 is expressed in a brain-specific manner, and it has been reported that Munc13-1 is present in synaptic membranes [11]. From these, Munc
Like unc-13, 13 is also thought to be involved in neurotransmitter release [11].

[0009] As described above, Doc2α and Munc13 are thought to play an important role in secretion of neurotransmitters. However, it is not completely clear how Doc2α and Munc-13 are involved in secretion of neurotransmitters or hormones, and we elucidate the mechanisms to control neurotransmitter or hormone secretion. It is desired. Furthermore, by screening for agonists or antagonists of substances involved in secretion of neurotransmitters or hormones, more effective control of neurotransmitters or hormones is expected.

[0010]

SUMMARY OF THE INVENTION The present invention has been made to solve the above problems, and has as its object to provide a substance which controls secretion of a neurotransmitter or a hormone, and a screening method using the substance.

[0011]

Means for Solving the Problems The present inventors have proposed that Doc2α
Munc13-1 (one of the three discovered Munc13)
It has been found that the present invention is combined with the present invention, thereby completing the present invention. Based on this discovery, the following various findings were obtained.

(1) The binding between Doc2α and Munc13-1 is promoted by treatment with phorbol ester, and this promoting effect is carried out through the C1 region of Munc13-1;
Expression of PC12 cells in a region required for binding of unc13-1 to Doc2α inhibits calcium ion-dependent neurotransmitter and hormone secretion, and (3) Mun
The simultaneous expression of Doc2α with the region of c13-1 required for binding to Doc2α suppresses the calcium ion-dependent secretion inhibitory effect.

From the above, it is considered that the binding between Doc2α and Munc13-1 induced by phorbol ester plays an important role in secretion of calcium ion-dependent neurotransmitters and hormones. This suggests that the phorbol ester is acting as an agonist.

[0014] From the above, by measuring the speed, strength, etc. of the binding between Doc2α and Munc13-1, the substance that inhibits the binding
(Antagonists) or promoting substances (agonists) can be screened. The screened substance can control the neurotransmitter release function of nerve cells,
Thereby, it can be used as a therapeutic drug for neurological diseases, for example, an anti-dementia drug, an antiepileptic drug, a psychotropic drug, or a drug for improving brain metabolism.

The method for screening candidate substances for agonists or antagonists of the binding between Doc2α and Munc13 according to the present invention comprises the steps of:
reacting the nc13 analog with the candidate substance in the presence and absence of the candidate substance; and selecting the candidate substance that increases or decreases the binding ability.

In a preferred embodiment, Doc2α or
The Doc2α analog is a fusion protein with a carrier protein.

In a preferred embodiment, Munc13 or
Munc13 analogs are fusion proteins with a carrier protein.

In a preferred embodiment, Doc2α or
Doc2α analog is an amino acid sequence of positions 13 to 37 of Doc2α,
Amino acid sequence of positions 1 to 37 of Doc2α, positions 9 to 37 of Doc2α
Amino acid sequence at positions 1 to 78 of Doc2α, amino acid sequence at positions 1 to 90 of Doc2α, and Doc2α
Or a polypeptide comprising an amino acid sequence selected from the group consisting of all amino acid sequences of

In a preferred embodiment, the above Munc13 or
The Munc13 analog has the amino acid sequence from position 851 to position 1461 of Munc13-1, the amino acid sequence from position 840 to position 1743 of Munc13-1, and Munc13-1.
A polypeptide comprising an amino acid sequence selected from the group consisting of the entire amino acid sequence of unc13-1.

In a preferred embodiment, the Doc2α analog is a polypeptide comprising the amino acid sequence of positions 14 to 38 of Doc2β.

[0021] In a preferred embodiment, the Munc13 analog is a polypeptide comprising the amino acid sequence of positions 1110 to 1695 of Munc13-2.

The agonist or antagonist of the present invention for binding Doc2α to Munc13-1 can be obtained by any of the methods described above.

The vector expressing the Doc2α or Doc2α analog of the present invention is used for inhibiting calcium ion-dependent secretion of neurotransmitters or hormones.

In a preferred embodiment, Doc2α or
Doc2α analog is an amino acid sequence of positions 13 to 37 of Doc2α,
Amino acid sequence of positions 1 to 37 of Doc2α, positions 9 to 37 of Doc2α
Amino acid sequence at positions 1 to 78 of Doc2α, amino acid sequence at positions 1 to 90 of Doc2α, and Doc2α
Or a polypeptide comprising an amino acid sequence selected from the group consisting of all amino acid sequences of

In a preferred embodiment, Doc2α or
A Doc2α analog is a polypeptide having the amino acid sequence of positions 14 to 38 of Doc2β.

The vectors expressing Munc13 or Munc13 analogs of the present invention are used to inhibit calcium ion-dependent secretion of neurotransmitters or hormones.

In a preferred embodiment, Munc13 or
The Munc13 analog has the amino acid sequence from position 851 to position 1461 of Munc13-1, the amino acid sequence from position 840 to position 1743 of Munc13-1, and Munc13-1.
A polypeptide comprising an amino acid sequence selected from the group consisting of the entire amino acid sequence of unc13-1.

In a preferred embodiment, the above Munc13 or
A Munc13 analog is a polypeptide having the amino acid sequence of positions 1110 to 1695 of Munc13-2.

[0029] The fusion protein of the present invention comprises Doc2α or
It is a fusion protein of Doc2α analog and carrier protein.

The fusion protein of the present invention is a fusion protein of Munc13-1 or a Munc13 analog and a carrier protein.

[0031] The polypeptide of the present invention comprises a doc2α at position 13 to
It comprises the amino acid sequence at position 37 and has a binding ability to Munc13-1 and consists of 90 or less amino acid residues.

The polypeptide of the present invention comprises 851 of Munc13-1.
It is composed of 904 or less amino acid residues, including the amino acid sequence at positions 1 to 1461, and having binding ability to Doc2α.

The polypeptide of the present invention is a Doc2α analog, consisting of 90 or less amino acid residues.

The polypeptides of the present invention are Munc13 analogs and consist of up to 904 amino acid residues.

[0035]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below in detail.

In the present invention, unless otherwise indicated,
Recombinant DNA methods, protein separation and analysis methods, and immunological techniques known in the art may be employed. When performing these methods, commercially available enzymes, kits, antibodies,
A labeling substance or the like may be used.

(Doc2α) Doc2α used in the screening method of the present invention can be obtained from natural sources and recombinant methods. Doc2α analogs include natural full-length Doc2β,
In addition, at least a part of the sequence of natural Doc2α,
Amino acid sequence Mid (Munc13-1-inte
racting domain of Doc2α: a polypeptide comprising SEQ ID NO: 1) in the sequence listing, and substitution or deletion of one or more amino acids in the amino acid sequence at positions 13 to 37 of Doc2α, or into these amino acid sequences And a polypeptide having a sequence having one or more amino acid insertions or additions, and capable of binding to Munc13-1. Polypeptides having one or more substitutions, deletions, insertions or additions of amino acids can be made by methods well known to those skilled in the art, for example, by recombinant DNA technology.

Examples of the polypeptide comprising the amino acid sequence at positions 13 to 37 of Doc2α include a polypeptide comprising the amino acid sequence at positions 13 to 37 of Doc2α, and a polypeptide comprising the amino acid sequence at positions 1 to 37 of Doc2α. Peptide, position 9 to 37 of Doc2α
A polypeptide consisting of the amino acid sequence of positions 1 to 78 of Doc2α, a polypeptide consisting of the amino acid sequence of positions 1 to 90 of Doc2α, and a polypeptide consisting of the entire amino acid sequence of Doc2α. No. Doc2α may be a fusion protein with a carrier protein. SEQ ID NO: 2 shows the entire amino acid sequence of Doc2α and the DNA sequence encoding it.

(Munc13) Munc13 or a Munc13 analog used in the screening method of the present invention can be obtained from natural sources and recombinant methods. As Munc13, Munc13-1, Mu
nc13-2, and Munc13-3 can be used. Munc13 analogs include some sequences of native Munc13 that have at least Mu
The amino acid sequence Did of nc13-1 at positions 851 to 1461 (Doc2α-int
eracting domain of Munc13-1: a polypeptide comprising SEQ ID NO: 3) in the sequence listing, and substitution or deletion of one or more amino acids in this amino acid sequence, or one or more amino acids in these amino acid sequences And any polypeptide having a binding ability to Doc2α. SEQ ID NO: 4 shows the entire amino acid sequence of Munc13-1 and the DNA sequence encoding it.

Used in the screening method of the present invention
Doc2α, Doc2α analogs, Munc13 and Munc13 analogs are
It may be a fusion protein with a carrier protein. Examples of proteins used as carrier proteins include glutathione S-transferase, histidine tag (amino acid sequence consisting of six consecutive histidines), and maltose binding protein.
These fusion proteins can be prepared, for example, by recombinant DNA methods well known to those skilled in the art.

(Isolation of DNA Encoding a Polypeptide That Binds Doc2α) DNA encoding a polypeptide that binds Doc2α or a 2α analog can be isolated using, for example, a two-hybrid method. The principle of the two-hybrid method utilizes two domains present in a transcription factor, a DNA binding domain and a transcription activation domain. When two domains, a DNA binding domain and a transcription activation domain, of a transcription factor are expressed as the same protein molecule, transcription is activated. However, transcription is not activated even when the two domains, the DNA binding domain and the transcription activation domain, are separated and expressed. On the other hand, if substances X and Y that mediate the binding between the separately expressed DNA binding domain and the transcription activation domain exist, the DNA binding domain and the transcription activation domain function as the same protein molecule, Activate. Therefore, in the same cell, the fusion protein of the transcription activation domain and the substance X and the fusion protein of the DNA binding domain and the substance Y are simultaneously expressed, and the transcription activity is measured. It is determined whether to combine.

The two-hybrid method according to the present invention comprises the following steps.
Plasmids in which the coding sequence of the binding region of c2α to Munc13-1 is linked to the DNA sequence of the transcription activation domain, and plasmids in which the coding sequence of the polypeptide to be screened is linked to the DNA sequence of the DNA binding domain . Then, these two plasmids are simultaneously transformed into a host having a reporter gene (eg, β-galactosidase gene) and its promoter sequence, and the expression of the reporter gene is confirmed. If the expression of the reporter gene is confirmed, the polypeptide binding to Doc2α
DNA is obtained. The reporter gene and its promoter sequence may be contained in any of the above two plasmids.

DNA encoding a polypeptide that binds to Doc2α or a Doc2α analog can be obtained from a variety of libraries. Libraries made from cDNA derived from mammalian brain are preferred, and cDNAs derived from human or rat brain are preferred.
Libraries made from NA are more preferred, and libraries made from cDNA derived from rat brain are even more preferred.

(Identification of Protein Binding to Doc2α and Isolation of Full-length cDNA Encoding the Protein) The DNA sequence obtained above was subjected to homology search using the program BLAST and the database GenBank, and the Munc13-1 gene was subjected to homology search. Part is confirmed. Next, labeling is performed using this DNA sequence as a probe and, for example, by cloning an arbitrary cDNA library using a colony hybridization method, a cDNA encoding the full length of the Munc13-1 gene can be isolated. . Isolated cD
NA is sequenced by methods well known to those skilled in the art.

(Determination of Doc2α binding region of Munc13-1) Various deletion mutants were obtained from the full-length Munc13-1 cDNA obtained above.
DNA is prepared, and the peptide encoded by this DNA and Do
By examining the presence or absence and strength of binding to c2α or Doc2α analog, the Doc2α binding region of Munc13-1 can be determined.

This can be performed as follows using, for example, the two hybrid method. Based on the sequence of the full-length Munc13-1 cDNA obtained above, various primers for obtaining a deletion mutant are designed. For each deletion mutant, the full-length cDNA (template
DNA), Ampli Taq DNA Polymerase, one set of primers, 10 × PCR buffer, and dNTPs (dATP, dGTP, dTT
P and dCTP) to perform a PCR reaction under appropriate PCR reaction conditions for the primers used to amplify the deletion mutant DNA fragment. The obtained deletion mutant DNA fragment was
Into a plasmid encoding the DNA binding domain in the method to prepare a plasmid. On the other hand, a cDNA corresponding to positions 1 to 90 of the amino acid sequence of Doc2α is inserted into a plasmid containing a gene encoding a transcriptional activation domain in the two hybrid method to prepare a plasmid. The same cells are transformed with the two plasmids thus prepared. Similarly to the above-mentioned "Determination of the Doc2α-binding region of Munc13-1", the presence or absence of the interaction can be known by confirming the presence or absence of the reporter gene expression in the transformed cells.
In addition, the strength of binding can be known by measuring the expression level of the reporter gene, and by comparing the binding strength of various deletion mutants, the site required for binding to Doc2α was identified. obtain.

Alternatively, the binding region can also be determined by isolating Doc2α and examining its binding to various modified Munc13 proteins.

(Determination of Munc13-1 binding region of Doc2α) Doc2
From the full-length cDNA of α, various deletion mutant DNAs were prepared, and by examining the presence or absence and strength of the binding between the peptide encoded by the DNA and Munc13-1, Munc13 of Doc2α was obtained.
-1 binding region can be determined.

In the same manner as in the above “Determination of Doc2α binding region of Munc13-1”, Munc13-1 (positions 851 to 1461) is used instead of Doc2α (positions 1 to 90), and Munc13-1 is used. -1
Tw using a deletion mutant of Doc2α instead of a deletion mutant of
It can be performed by the o-hybrid method.

(Purification of Recombinant Doc2α and Munc13 Proteins) Doc2α used in the screening method of the present invention
Or Doc2α analog and Munc13 or Munc13 analog are DNA or M
DNA encoding unc13 or Munc13 analogs can be prepared using an expression vector incorporated into a suitable vector. The expression vector is introduced into, for example, bacteria, yeast, insect cells, or animal cells, and a transformant is prepared and cultured. The target protein is purified from the culture using a purification method well known to those skilled in the art (ion exchange chromatography, affinity chromatography, HPLC, etc.). When each protein is expressed as a fusion protein with a carrier protein, the fusion protein can be easily purified by using a column that specifically adsorbs the carrier protein (for example, an affinity column).

(Binding of Doc2α to Munc13 in vitro) Doc2α or Doc2α analog and Munc13 or Munc13
The binding is tested in vitro with 13 analogs.
This is performed, for example, by the following method.

DN encoding Munc13 or Munc13 analog
A was inserted into an appropriate in vitro translation plasmid, in vitro translation was performed using the obtained plasmid in the presence of a labeled amino acid, and labeled Munc1 was used.
3 or Munc13 analogs are obtained. Doc2α or Doc2 on the other hand
The alpha analog, which can be a fusion protein with the carrier protein, is adsorbed on the column. The labeled Munc13 or Munc13 analog is applied to the column to which the peptide is adsorbed, and incubated in a binding buffer under appropriate conditions (eg, 4 ° C. for 5 hours), and Doc2α or Doc2α analog and Munc13 or Munc13 analog are incubated. Join the body. Combined
The presence and amount of bound protein is determined by eluting Munc13 or Munc13 analog from the column, performing SDS-PAGE of the eluate, and confirming the resulting electrophoresis gel by exposing and developing an X-ray film. Can be confirmed.

(Confirmation of binding between Doc2α and Munc13 in vivo) Doc2α or a Doc2α analog and Munc13 or Munc13
To confirm that the 13 analog is bound in vivo, DNA encoding Doc2α or Doc2α analog and DNA encoding Munc13 or Munc13 analog can be expressed as fusion proteins with different tags, respectively. As described above to prepare an expression vector. The resulting two expression vectors are introduced into bacteria, yeast, insect cells, or animal cells and expressed simultaneously. The cells are lysed, the protein is adsorbed using a column that adsorbs one tag, and it is detected whether the adsorbed protein has the other tag. Detection can be performed by Western blotting. Alternatively, there is a method in which either one is tagged, the tag is adsorbed, and the other protein is detected by Western blotting using an antibody. If protein is detected, Doc2α or Doc2
It is shown that the α analog and Munc13 or Munc13 analog bind in vivo.

(Effect of Doc2α analog or Munc13 analog on calcium ion-dependent secretion of neurotransmitter or hormone) DNA fragment encoding Doc2α analog or Munc13 analog was inserted into an appropriate vector,
Create an expression vector. This expression vector is introduced into a cell that secretes a calcium ion-dependent neurotransmitter or hormone to prepare a transformant. The transformant and the non-transformant are cultured under conditions for inducing or not inducing calcium ion-dependent secretion, and the amount of secretion is measured. By comparing the secreted amount of the transformant and the secreted amount of the non-transformant, the Doc2α analog or Munc
It is determined whether 13 analogs affect calcium ion-dependent secretion.

(Screening of Substances Affecting the Binding between Doc2α and Munc13-1)
Binding to Munc13 "in the assay method, using a binding buffer to which a candidate substance for agonist or antagonist was added, and using the Doc2α analog and Munc when no candidate substance was used.
13 The amount of binding to the analog and Doc2 when the candidate substance was added
By comparing the amount of binding between α or Doc2α analog and Munc13 or Munc13 analog, an agonist or antagonist of the binding between Doc2α and Munc13 can be screened. A substance that increases the amount of protein bound is determined to be an agonist, and a substance that decreases the amount of protein bound is determined to be an antagonist.

(Vector Used for Regulation of Calcium Ion-Dependent Neurotransmitter or Hormone Secretion) Doc2α or a Doc2α analog, or Munc13-1 or a DNA fragment encoding a Munc13-1 analog is inserted into an appropriate vector. Insert to create an expression vector. This expression vector is introduced into a cell that performs calcium ion-dependent neurotransmitter or hormone secretion, and Doc2α or a Doc2α analog, or Munc13-1 or a Munc13-1 analog is expressed in the cell, whereby calcium ion is expressed. Can inhibit dependent neurotransmitter or hormone secretion. This method can be used, for example, to treat dementia.

As an example of the vector used here,
Retrovirus vector, adenovirus vector, adeno-associated vector, Human Immunodeficiency Virus (HI
V) Vectors, herpes simplex virus vectors, and vaccinia virus vectors.

[0058]

【Example】

Example 1 Cloning of protein binding to Doc2α by two-hybrid system using yeast cells Based on the method described in Reference [17], amino acid residues 1 to 90 of human Doc2α and the DNA binding region of LexA were A plasmid pBTM116-Doc2α (1-90 amino acids) to be expressed as a fusion protein was constructed.

The library to be screened is a rat brain MATCHMAKER cDNA library (Clontech, CA, USA) having 1 × 10 ⁶ independent clones and into which rat brain-derived cDNA has been inserted. Was. The plasmid of this library has a sequence encoding a transcription activation domain.

The plasmid pBTM116-Doc2α (1-90 amino acids)
Using the rat brain MATCHMAKER cDNA library, the yeast L40 strain (His required strain) was transformed by the method described in reference [18]. The transformed yeast was cultured in a SD-LWH medium (0.67% yeast nitrogen base w / o amiami) containing 2.5 mM 3-amino 1H-1,2,4-triazole without histidine.
no acid; manufactured by Difco, 2% glucose, 300 mg / l L-isoleucine, 1500 mg / l L-valine, 200 mg / l L-adenine hemisulfate, 200 mg / l L-arginine hydrochloride, 300 mg / l L-lysine hydrochloride, 200 mg / l L-methionine, 500 mg / l L-phenylalanine, 2000 mg / l L-threonine, 300 mg / l L-tyrosine, 200 mg / l uracil), and formed a colony on a plate made with β-galactosidase activity. The positive clones found were selected. The expression of β-galactosidase activity was assayed according to a conventional method. As a result, seven positive clones were obtained. Each of these positive clones was subjected to Autoread S by the Sanger method [19].
equencing Kit (Pharmacia Biotech, Uppsala, Swe
den) was used for sequencing. As a result, it was found that these seven clones had exactly the same sequence. According to this nucleotide analysis, the positive clone having the longest cDNA was a protein in which the region of amino acid residues 840-1743 of rat Munc13-1 was fused at the site of the restriction enzyme EcoRI downstream of the transcriptional activation region of GAL4. Was found to be expressed.

Example 2 Isolation of Munc13-1 Gene Full Length cDNA A Munc13-1 cDNA fragment (encoding the region of amino acid residues 840-1743 of Munc13-1) obtained by two-hybrid screening was multi-primed. Using a DNA labeling system (Amersham Japan) according to the manufacturer's instructions
Labeled with ³² P, and using this as a probe, a rat brain cDNA library (rat brain MATCHMAKER cDNA library; Clontec
h, CA, USA). The colony hybridization method was performed as follows according to a conventional method [20]. Escherichia coli DH5α constituting the rat brain cDNA library (introduced according to a conventional method) was placed on an LB-plate (10 g tryptone, 5 g yeast extract, 10 g
g NaCl, 15 g agar / l) and cultured overnight at 37 ° C. E. coli colonies growing on the plate were transferred to a nylon membrane (Hybond-N +, manufactured by Amersham Japan), followed by SDS treatment (10% SDS), alkali denaturation (0.5 M NaOH, 1.5 M NaCl), and washing (2 x SSC) (1 x
SSC consisted of 0.15 M NaCl and 0.015 M sodium citrate). Nylon membrane after washing is 6 × SSC, 5 × D
enhardt's solution, 0.5% SDS, 50% formamide, 1
Munc13-1 cDNA labeled with ³² P as a probe in a hybridization solution consisting of 00 μg / ml salmon sperm DNA
Using the fragment (430-bp), hybridization was carried out at 42 ° C. overnight. After the hybridization, the nylon membrane is placed in 2 × SSC + 0.5% SDS at room temperature for 10 minutes, and 1 × SS
C + 0.5% SDS at 65 ° C for 30 minutes (twice), and 0.1%
After washing at 65 ° C. for 30 minutes (twice) in × SSC + 0.5% SDS, an X-ray film (manufactured by Kodak) was exposed, and the film was developed to identify colonies that reacted with the probe. . Finally, one cDNA clone was obtained. The nucleotide sequence of the cDNA was determined by Autoread Sequencin according to the Sanger method [18].
The sequence was determined using g Kit (Pharmacia Biotech, Uppsala, Sweden). As a result of the nucleotide sequence determination, it was revealed that this clone contained the full length of rat Munc13-1.

Example 3 Determination of Doc2α-binding region of Munc13-1 From the cloned full-length cDNA of rat Munc13-1 gene,
The DNA fragment shown in FIG. 1 was obtained using the polymerase chain reaction (PCR) as follows. Plasmid obtained from the clone obtained in Example 2 according to a conventional method was replaced with a restriction enzyme EcoRI.
The DNA cut in step was used as template DNA. 0.5 ng of template DNA (rat Munc13-1 cDNA fragment), Ampli Taq DNA Polymeras
e 5 units, 50 pmol of each of the two primers, and 10 × PCR buffer (100 mM Tris-HCl, pH 8.3, 500 mM
5 μl of KCl, 15 mM MgCl ₂ , 0.1% gelatin) were mixed, and dNTPs (dATP, dGTP, dTTP, and dCTP) were added to a final concentration of 20 μl.
It was added to 0 mM, and finally made up to 50 μl with sterile distilled water. The primer used to obtain each DNA fragment was a positive primer 5′-C for DNA fragments 840-1743.
ATGAATTCCTTCACATCAGTGTGGAGATC-3 '(SEQ ID NO: 5),
Reverse primer 5'-CATGAATTCCATGGGCGCAGGCGCGGCACC-
3 ′ (SEQ ID NO: 6); For DNA fragment 851-1461, positive primer 5′-CATGAATTCGAGAAGGTGGCACCCTACCATG-
3 '(SEQ ID NO: 7), reverse primer 5'-CATGAATTCTCAG
CTTGGCAGTTTCACCCTGCC-3 '(SEQ ID NO: 8); DNA fragment 85
For 1-1336, the positive primer 5'-CATGAATTCGAGAA
GGTGGCACCCTACCATG-3 ′ (SEQ ID NO: 7), reverse primer 5′-CATGAATTCTCAGGTGGCAAACACGTGGCTGAG-3 ′ (SEQ ID NO: 9); for DNA fragment 851-1208, forward primer 5′-CATGAATTCGAGAAGGTGGCACCCTACCATG-3 ′ (reverse primer) 5'-CATGAATTCTCAGAGTGCACCATGC
AGGAAGTC-3 '(SEQ ID NO: 10); and DNA fragment 1208-
For 1461, the positive primer 5'-CATGAATTCCTCGAGGG
GGACAAGAAGGATG-3 '(SEQ ID NO: 11) and reverse primer 5'-CATGAATTCTCAGCTTGGCAGTTTCACCCTGCC-3' (SEQ ID NO: 8). The reaction conditions for the PCR reaction were as follows: heating at 94 ° C. for 5 minutes, followed by 94 ° C. for 1 minute, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes.
After repeating the reaction cycle for 30 minutes for 30 minutes, the temperature was 72 ° C. for 5 minutes. The PCR reaction product was transferred to a 2% agarose gel (SeaKe
m Agarose, FMC, purchased from Takara Shuzo)
Confirmed by staining with ethidium bromide (500 ng / ml) for 5 minutes and isolated from the gel. The isolated reaction product is digested with EcoRI as described above, and then the yeast expression plasmid pGAD424 (Clontech, CA, US
The restriction enzyme was inserted into the EcoRI site of A).

DNA fragment 1-851 + 1 lacking the Did portion
For 461-1743, to obtain DNA fragment 1-851,
Positive primer 5'-CATGAATTCATGAAGCGACATGGCCGGCGA-
3 '(SEQ ID NO: 12) and reverse primer 5'-CATAGCGCTCT
Using a primer set with TTCCCGAAATTGGAGGCAGCG-3 ′ (SEQ ID NO: 13), a positive primer 5′-CATAGCGCTAGCCACTCAGACGGGACACA was obtained in order to obtain a DNA fragment 1461-1743.
AATG-3 '(SEQ ID NO: 14) and reverse primer 5'-CATGAA
PCR was performed as described above using a primer set with TTCCTAGGGCGCAGGCGCGGCACC-3 ′ (SEQ ID NO: 15), and each DNA fragment was amplified and isolated. Then, each of the isolated amplified fragments was subjected to EcoRI and Eco47II.
After digestion with I, this was mixed with pGAD424 digested with EcoRI, and the three DNAs were ligated according to a conventional method. Was selected.

Using any one of the obtained plasmids and the aforementioned pBTM116-Doc2α (1-90 amino acids) together,
Transforming the yeast strain L40 as described in [17],
Using the expression of β-galactosidase activity as an index, Munc13-
1 Doc2α binding region was determined.

The β-galactosidase activity was measured by the following method according to the literature [21]. Various of Munc13-1 gene
PGAD424 plasmid into which any one of the DNA fragments was inserted
Yeast transformed with the pBTM116-Doc2α plasmid was added to 5 ml of SD-LW medium (Yeastnitrogen base w / o amino).
acid; Difco: 2% glucose, 300 mg / l L-isoleucine, 1500 mg / l L-valine, 200 mg / l L-adenine hemisulfate, 200 mg / l L-arginine hydrochloride, 200 mg / l L-histidine hydrochloride, 300 mg / l L-lysine hydrochloride, 200 mg / l L-methionine, 500 mg / l L-phenylalanine, 2000 mg / l L-threonine, 300 mg / l L-tyrosine, 200 mg / l uracil)
C. overnight, and after collecting the cells, 5 ml of a Z buffer containing 0.27% mercaptoethanol (16.1 g / l disodium hydrogen phosphate heptahydrate, 5.5 g / l sodium dihydrogen phosphate monohydrate) ,
0.75 g / l potassium chloride, 0.246 g / l magnesium sulfate heptahydrate). After measuring the OD ₆₀₀ of this suspension with a spectrophotometer, 500 μl was placed in a new Eppendorf tube, frozen in liquid nitrogen, and then thawed at 30 ° C. twice. This was placed in an incubator at 30 ° C., and 100 μl of a substrate solution (Z buffer containing 4 mg / ml o-nitrophenylgalactoside) was added thereto. Exactly 10 minutes after the addition of the substrate solution as 0 minute, the reaction was stopped by adding 250 μl of 1 M Na ₂ CO ₃ . After centrifuging this reaction solution at 14,000 rpm for 10 minutes,
The A ₄₂₀ of the supernatant was measured with a spectrophotometer. β-galactosidase activity (unit) was calculated by the following equation.

Unit = (1000 × A ₄₂₀ ) / (t × V × OD ₆₀₀ × 1 / 0.85) t: reaction time (minute) V: amount of culture solution used for reaction (ml) It is shown in FIG.

FIG. 1 is a schematic diagram of the primary structure of Munc13-1 and Doc2α, each mutant used in the yeast two-hybrid system, Xg
binding capacity estimated from the intensity of the color reaction of al, and β-
Shows galactosidase activity. The strength of β-galactosidase activity indicates the strength of the binding ability. Munc13-1 and Do
In the primary structure schematic diagram of c2α, C1 is the C1 region, and C2 is the C2 region.
In the figure, the binding ability ++ indicates strong coloring, + indicates weak coloring, and − indicates no coloring. The binding ability of the peptide containing the region of amino acid residues 851-1461 of Munc13-1 is strong, and the presence of a deletion in the amino acid residues in this region significantly reduces the binding ability. It became clear that the region of No. 851-1461 was required for binding to Doc2α. Therefore, this area is designated Did (Doc2α-inter
acting domain of Munc13-1). The sequence of Did is shown in SEQ ID NO: 1.

Example 4 Determination of Munc13-1 Binding Region of Doc2α A DNA fragment shown in FIG. 2 was obtained from the full-length human Doc2α gene cDNA by PCR as follows. PCR reaction was performed using 0.5 ng of template DNA (human Doc2α cDNA fragment) and Ampli Taq DNA Polymerase.
Five units, 50 pmol of each of the two primers, and 5 μl of 10 × PCR buffer were mixed, and dNTP (dATP,
dGTP, dTTP, and dCTP) were added to a final concentration of 200 mM, and the final volume was adjusted to 50 μl with sterile distilled water. The primers used to obtain each DNA fragment were DNA
For fragment 1-90, the positive primer 5'-CATGAATTCAT
GAGGGGCCGCAGGGGCGAT-3 '(SEQ ID NO: 16), reverse primer 5'-CATGAATTCTCAGGCGGTGGCATCATCCGAGTC-3'
(SEQ ID NO: 17); For DNA fragment 1-78, forward primer 5′-CATGAATTCATGAGGGGCCGCAGGGGCGAT-3 ′ (SEQ ID NO: 16), reverse primer 5′-CATGAATTCTCACTCCGCA
CCATCCTCAGGCGT-3 ′ (SEQ ID NO: 18); DNA fragment 1-37
About the positive primer 5'-CATGAATTCATGAGGGGCCGC
AGGGGCGAT-3 '(SEQ ID NO: 16), reverse primer 5'-C
ATGAATTCTCAGGGGAAGTAGTCAGAGATCTG-3 ′ (SEQ ID NO: 1
9); For DNA fragment 9-37, positive primer 5'-CA
TGAATTCATGACCATCAACATCCAGGAG-3 ′ (SEQ ID NO: 2
0), reverse primer 5'-CATGAATTCTCAGGGGAAGTAGTCAGA
GATCTG-3 '(SEQ ID NO: 19); For DNA fragment 13-37, positive primer 5'-CATGAATTCATCCAGGAGCACATGGCCAT
C-3 '(SEQ ID NO: 21), reverse primer 5'-CATGAATTC
TCAGGGGAAGTAGTCAGAGATCTG-3 '(SEQ ID NO: 19); DNA
For fragment 9-32, the positive primer 5'-CATGAATTCAT
GACCATCAACATCCAGGAG-3 '(SEQ ID NO: 20), reverse primer 5'-CATGAATTCTCAGATCTGGCGGATGGGCCGGAT-3'
(SEQ ID NO: 22); For DNA fragment 19-37, positive primer 5′-CATGAATTCATCAACGTGTGCCCCGGGCCCATC-3 ′
(SEQ ID NO: 23), reverse primer 5′-CATGAATTCTCAGGG
GAAGTAGTCAGAGATCTG-3 '(SEQ ID NO: 19); and DNA
For fragment 90-400, the positive primer 5'-CATGAATTCC
AAGGCAAGCTGGAGTTTGAC-3 '(SEQ ID NO: 24) and reverse primer 5'-CATGAATTCTCAGGCTGAGGACAGAGCCCC-3' (SEQ ID NO: 25). The PCR reaction conditions were as follows: after heating at 94 ° C for 5 minutes, 94 ° C for 1 minute, 55 ° C for 1 minute, and 72 ° C for 2 minutes.
After repeating the reaction cycle for 30 minutes for 30 minutes, the temperature was 72 ° C. for 5 minutes. Reaction products were confirmed by staining with ethidium bromide (500 ng / ml) for 5 minutes after running on a 2% agarose gel and isolated from the gel. The isolated reaction product was digested with EcoRI as described above, and then inserted into the restriction enzyme EcoRI site of the yeast expression plasmid pBTM116 according to a conventional method. Any one of the obtained plasmids and a plasmid in which rat Munc13-1-Did (this is a peptide having the amino acid sequence of positions 851-1461 of Munc13-1) was inserted into the EcoRI site of pGAD424 described above. Using both, the yeast L40 strain was transformed as described in reference [18], and the binding region of Doc2α to Munc13-1 was determined using the expression of β-galactosidase activity as an index. β-galactosidase activity was measured using the same method as in Example 3 above.

FIG. 2 shows the results of the above experiment. FIG.
Primary structure schematic diagram of Munc13-1 and Doc2α, yeast two-hybr
The mutants used in the id system, the binding ability estimated from the intensity of the color reaction of X-gal, and β-galactosidase activity are shown. C1 of the primary structure schematic diagram of Munc13-1 and Doc2α
Indicates the C1 region, C2 indicates the C2 region, and ++ of the binding ability indicates strong coloring, + indicates weak coloring, and-indicates no coloring. The binding ability of the peptide containing the region of amino acid residues 13 to 37 of Doc2α is strong.
It was revealed that the region of amino acid residues 13-37 of α was required for binding to Munc13-1. Therefore, this region was named Mid (Munc13-1-interacting domain of Doc2α). The sequence of Mid is shown in SEQ ID NO: 2.

Example 5 Binding of Doc2 Family Protein to Munc13 Family Protein Using the human Doc2β gene full-length cDNA as a template,
An R reaction was performed to obtain a DNA fragment encoding a region of amino acid residues 1-122 which is an upstream portion of the C2 region of human Doc2β. Template DNA (human Doc2β cDNA fragment) 0.5 ng, Ampli Taq
5 units of DNA Polymerase, 50 pmol of each of the two primers, and 5 μl of 10 × PCR buffer were mixed, and dNTPs (dATP, dGTP, dTTP, and dCTP) were added to a final concentration of 20 μl.
It was added to 0 mM, and finally made up to 50 μl with sterile distilled water. The primer used was a forward primer 5'-CATGAA
TTCATGACCCTCCGGCGGCGCGGGGAG-3 ′ (SEQ ID NO: 26),
And reverse primer 5'-CATGAATTCTCAGGCAGTGCAGTC
GTCCGACTCGT-3 ′ (SEQ ID NO: 27). The reaction conditions for the PCR reaction were heating at 94 ° C. for 5 minutes, repeating a reaction cycle of 94 ° C. for 1 minute, 55 ° C. for 1 minute, and 72 ° C. for 2 minutes 30 times, and then 72 ° C. for 5 minutes. Was. PCR reaction product
% Agarose gel, followed by ethidium bromide
(500 ng / ml) for 5 minutes to confirm and isolate from the gel. The isolated reaction product was digested with EcoRI, and then inserted into the restriction enzyme EcoRI site of the yeast expression plasmid pBTM116 according to a conventional method.

On the other hand, a DNA fragment encoding a region (amino acid residues 1110-1695) of rat Munc13-2 having high similarity to rat Munc13-1 was ligated to rat brain using PCR as follows.
It was obtained from a cDNA library (rat brain MATCHMAKER cDNA library; manufactured by Clontech, CA, USA). Template DNA
(Rat brain cDNA library) 0.5mg, Ampli Taq DNA Po
5 units of lymerase, 50 oligonucleotides each
pmol and 5 μl of 10 × PCR buffer, and add dNT
P (dATP, dGTP, dTTP, and dCTP) was added to a final concentration of 200 mM and finally made up to 50 μl with sterile distilled water.
The primer used was a forward primer 5'-CATGAATTCG
ACGATGCATGGAAGGTGTAC-3 '(SEQ ID NO: 28) and reverse primer 5'-CATGAATTCTCAGGTGCCTGTCTGGTCAATGA
G-3 '(SEQ ID NO: 29). The reaction conditions for the PCR reaction are
After heating at 94 ° C for 5 minutes, a reaction cycle of 94 ° C for 1 minute, 55 ° C for 1 minute, and 72 ° C for 2 minutes was repeated 30 times.
5 minutes at 72 ° C. After the PCR reaction product was run on a 2% agarose gel, ethidium bromide (500 ng / m
Confirmed by staining for 5 minutes in l) and isolated. The isolated reaction product was confirmed by DNA sequencing and E
After digestion with coRI, the fragment was inserted into the restriction enzyme EcoRI site of the yeast expression plasmid pGAD424 according to a conventional method.

The two plasmids thus obtained and the above plasmids pBTM116-Doc2α (1-90 amino acids) and pGAD424-Munc13-1-Did were used in combination in the manner shown in FIG. The yeast L40 strain was transformed by the method described above, and Munc13-1 and Munc13 against Doc2α and Doc2β
The binding ability of -2 was examined. β-galactosidase activity was measured using the same method as in Example 3 above.

FIG. 3 shows the results. FIG. 3 shows Munc13-1, Mu
Primary structure schematic diagram of nc13-1, Doc2α and Doc2β, yeast tw
The mutants used in the o-hybrid system, the binding ability estimated from the intensity of the color reaction of X-gal, and β-galactosidase activity are shown. Munc13-1, Munc13-1, Doc2α and Doc2β
In the primary structure schematic diagram, C1 indicates the C1 region, C2 indicates the C2 region, and ++ of the binding ability indicates strong coloring and + indicates weak coloring. Since binding was observed in any combination of Doc2α or Doc2β and Munc13-1 or Munc13-2, Do
Both c2α and Doc2β were found to bind to Munc13-1 and Munc13-2. This revealed that the Doc2 family protein and the Munc13 family protein bind.

Mid region of Doc2α (amino acid residues 13 to 37)
Position) is the Doc2β Mid region (amino acid residues 14 to 38) and 9
It has 2% similarity, and the Did region of Munc13-1 (amino acid residues 851 to 1461) is 81% similar to the Did region of Munc13-2 (amino acid residues 1110 to 1695). have. Since this region is a specific region having no similarity to other proteins for each protein, it is considered that the binding between both is also specific.

Example 6 Expression of Doc2α and Munc13-1 Proteins in Escherichia coli and Purification of Expressed Proteins Vectors pGEX-2T-Doc2-N and Munc13 expressing parts corresponding to amino acid residues 1 to 90 of Doc2α Did of -1
A vector pGEX-2T-Munc13-1-Did expressing a region (amino acid residues 851 to 1461) was constructed by the following method.
First, for Doc2α, the pSPORT1 vector was used as a template, and for Munc13-1, the plasmid isolated from the clone containing the full-length Munc13-1 gene obtained in Example 2 was used as a template, and PCR was performed. A DNA fragment encoding the amino acid sequence was obtained. The pSPORT1 vector contains the full-length 1.7k of Doc2 cDNA cloned from human brain.
b has been integrated and this vector is available from Gibco-BRL. Template DNA 0.5mg, Ampli Taq DNA Pol
5 units of ymerase, 2 primers of 100 pm each
ol, and 5 μl of 10 × PCR buffer, and add dNTP
(DATP, dGTP, dTTP, and dCTP) were added to a final concentration of 200 mM and finally made up to 50 μl with sterile distilled water.
The primers used for Doc2α were the positive primer 5′-CATGGATCCATGAGGGGCCGCAGGGGCGAT-3 ′
(SEQ ID NO: 30); reverse primer 5'-CATGGATCCTCAGGCG
For GTGGCATCATCCGAGTC-3 '(SEQ ID NO: 31) and Munc13-1, the positive primer 5'-CATGGATCCGAGAAGGTGGCACCC
TACCATG-3 '(SEQ ID NO: 32); reverse primer 5'-CATGG
ATCCTCAGCTTGGCAGTTTCACCCTGCC-3 ′ (SEQ ID NO: 33). The reaction conditions for the PCR reaction were as follows: after heating at 94 ° C for 5 minutes, 9
The reaction cycle of 1 minute at 4 ° C, 1 minute at 55 ° C, and 2 minutes at 72 ° C was repeated 30 times. PCR reaction product
After running on a 2% agarose gel, it was confirmed by staining with ethidium bromide (500 ng / ml) for 5 minutes and isolated from the gel. The isolated reaction product was digested with BamHI according to the manufacturer's instructions. Next, each DNA fragment obtained by digestion was inserted into the BamHI site of pGEX-2T (Pharmacia) according to a conventional method. Thus, pGEX-2
T-Doc2-N and pGEX-2T-Munc13-1-Did were obtained.

PGEX-2T-Doc2-N or pGEX-2T-Munc13-1-D
Using id, Escherichia coli DH5α strain was transformed according to a conventional method. The resulting transformants were each cultured at 37 ° C. in LB medium (10 g tryptone, 5 g yeast extract and 10 g NaCl per liter), and then 0.1 mM IPTG
After adding (isopropyl-β-D-thiogalactopyranoside), protein induction was performed by culturing at 30 ° C. for 3 hours. Cultures after protein induction were
The cells were collected by centrifugation at 000 × g for 20 minutes, the supernatant was discarded, and the bacterial pellet was washed with 10 ml of PBS (−) (8 g NaCl, 0.2 g
_{KCl, 2.9g Na 2 HPO 4,} 0.2g KH 2 PO 4 / 1L distilled water, pH 7.4)
Was suspended. The bacterial suspension was sonicated to disrupt the cells and then centrifuged at 100,000 xg for 1 hour at 4 ° C. The obtained supernatant is applied to a glutathione sepharose column (Pharmacia), and the column is washed with PBS.
And elution buffer (20 mM glutathione, 50 mM
The fusion protein was purified by elution with Tris-HCl, pH 8.0).

Each of the obtained transformants expressed each protein as a fusion protein with glutathione transferase.

Example 7 Binding of Doc2α and Munc13-1 in vitro First, an HA tag (amino acid sequence, Met-Tyr-Pro-Tyr-Asp-Val-Pro-Asp) was added to the pGEM-1 plasmid (promega). -Tyr-Al
Plasmid pGEM-HA into which a DNA fragment encoding a) has been inserted
Was prepared. This consists of two chemically synthesized oligonucleotides 5'-AATTCGGTACGA, each containing an HA tag.
TGTACCCATACGACGTCCCAGACTACGCTGGTACCG-3 ′ (SEQ ID NO: 34) and 5′-GATCCGGTACCAGCGTAGTCTGGGACGTCGTATG
GGTACATCGTACCG-3 '(SEQ ID NO: 35) was annealed and then ligated in the forward direction with pGEM-1 cut with restriction enzymes EcoRI and BamHI. Further pBluescript
(Strategene) plasmid with myc tag (amino acid sequence, Met-Glu-Gln-Lys-Leu-Ile-Ser-Gln-Glu-Asp-Leu)
Plasmid pBluescript into which a DNA fragment encoding
-myc was prepared. This consists of two chemically synthesized oligonucleotides 5'-GATC containing the myc tag.
GATGGAGCAGAAGCTTATCAGCGAGGAGGACCTGG-3 ′ (SEQ ID NO: 36) and 5′-GATCCCAGGTCCTCCTCGCTGATAAGCTTCTGCT
CCATC-3 '(SEQ ID NO: 37) was annealed and ligated in the forward direction with pBluescript cut with the restriction enzyme BamHI.

Next, amino acid residues 1 to 40 of human Doc2α
Amino acid sequences at positions 0, 1 to 241 and 90 to 400, and amino acid residues 1 to 1743 of rat Munc13-1
Rank, 851 rank-1461 rank, and 1st rank-851 rank + 1461 rank-1743
A DNA fragment encoding the amino acid sequence at position 1 was obtained by performing a PCR reaction. 0.5 ng template DNA, Ampli Taq DNA P
olymerase 5 units, 2 primers 50p each
mol, and 5 μl of 10 × PCR buffer, and add dNTP
(DATP, dGTP, dTTP, dCTP) were added to a final concentration of 200 mM, and finally adjusted to 50 μl with sterile distilled water. Template DNA
For human Doc2α, human Doc2α full-length cDNA was used; for rat Munc13-1, rat Munc13-1 full-length cD
NA was used. The primer was a positive primer 5′-CATGGATCCAT for amino acid residues 1 to 400 of human Doc2α.
GAGGGGCCGCAGGGGCGAT-3 '(SEQ ID NO: 38), reverse primer 5'-CATGGATCCTCAGGCTGAGGACAGAGCCCC-3' (SEQ ID NO: 39); , Reverse primer 5'-CATGGATCCTCACTGCTCCA
AGTCCTTCAGATA-3 ′ (SEQ ID NO: 40); 90 of human Doc2α
For positions -400, the positive primer 5'-CATGGATCCCTAG
GCAAGCTGGAGTTTGAC-3 '(SEQ ID NO: 41), reverse primer 5'-CATGGATCCTCAGGCTGAGGACAGAGCCCC-3' (SEQ ID NO: 39); For amino acid residues 1 to 1743 of rat Munc13-1, the forward primer 5'-CATGGATCCATGAAGCGACATGGC
CGGCGA-3 '(SEQ ID NO: 42), reverse primer 5'-CATGGA
TCCCTAGGGCGCAGGCGCGGCACC-3 '(SEQ ID NO: 43); and positions 851 to 1461 of rat Munc13-1, forward primer 5'-CATGGATCCGAGAAGGTGGCACCCTACCATG-3' (SEQ ID NO: 44), reverse primer 5'-CATGGATCCTCAGCTTGGCA
GTTTCACCCTGCC-3 ′ (SEQ ID NO: 45) was used. The reaction conditions of the PCR reaction were as follows: after heating at 94 ° C for 5 minutes,
The reaction cycle of 1 minute at 72 ° C and 2 minutes at 72 ° C was repeated 30 times, followed by 5 minutes at 72 ° C. The resulting reaction products were each run on a 2% agarose gel, confirmed by staining with ethidium bromide (500 ng / ml) for 5 minutes, and isolated from the gel. The isolated reaction product is
After digesting Doc2α with BamHI as described above, pGE
At the BamHI site of M-HA, for Munc13-1, B
After digestion with amHI, it was inserted into the BamHI site of pBluescript-myc. This site is downstream of the T7 promoter, and by inserting into this site, T7 RNA polymerase synthesizes mRNA from each DNA fragment.

With respect to the DNA fragment encoding amino acid residues 1-851 + 1461-1743 of Munc13-1 in which the Did portion has been deleted, in order to obtain a DNA fragment encoding amino acid residues 1-851, '-CATGGATCCATGAAGCGACATGGCCG
GCGA-3 '(SEQ ID NO: 42) and reverse primer 5'-CATAGCG
Using a primer set with CTCTTTCCCGAAATTGGAGGCAGCG-3 ′ (SEQ ID NO: 13), a positive primer 5′-CATA was used to obtain a DNA fragment encoding amino acid residues 1461-1743.
GCGCTAGCCACTCAGACGGGACACAAATG-3 '(SEQ ID NO: 14)
And reverse primer 5'-CATGGATCCCTAGGGCGCAGGCGCGGCACC-
Using the primer set with 3 ′ (SEQ ID NO: 43), PCR was performed as described above, and each DNA fragment was amplified and isolated. Then, each of the isolated amplified fragments was digested with BamHI and Eco47III, and this was mixed with pBluescript-myc digested with BamHI.
NA was ligated, and one in which DNA fragments 1-851 and 1461-1743 were ligated in the forward direction to the restriction enzyme BamHI site of pBluescript-myc was selected.

Using these plasmids as templates, TNT T7 coupled Reticu in the presence of ³⁵ S-methionine.
The protein labeled with ³⁵ S was synthesized by in vitro translation using locyte lysate system (Promega) according to the manufacturer's instructions.

Regarding the binding of Doc2α and Munc13-1 in a test tube, first, 2 μg of the fusion protein of GST and Munc13-1 obtained in Example 6 was added to a binding buffer (150 mM NaCl, 5 mM).
It was dissolved in 0 mM HEPES, pH 7.4, and 1 mM EGTA), poured into a glutathione sepharose column (Pharmacia), and allowed to react at 4 ° C. for 1 hour to bind to the column. Next, one of the ³⁵ S-labeled Doc2α mutants (2 μg) was added to a binding buffer (150 mM NaCl, 5 mM).
(0 mM Hepes, pH 7.4, and 1 mM EGTA), added to the column, and reacted at 4 ° C. for 5 hours. The column was then washed four times with binding buffer and the bound protein was eluted using 100 μl elution buffer. To the eluate obtained, 1 mg of SDS was added and reacted at 100 ° C. for 5 minutes to form SDS. The SDS-converted protein was applied to SDS-PAGE using a 12% acrylamide gel, and after electrophoresis, the gel was dried, exposed to an X-ray film (Kodak), developed, and analyzed for bands that appeared.

FIG. 4 shows the results. Fig. 4 is a schematic diagram of the primary structure of Doc2α, ³⁵ S prepared by in vitro translation.
Labeled Doc2α and its variants (1 to 3), and GST-Munc
FIG. 9 shows autoradiography of a gel obtained by electrophoresis of an eluate obtained after a binding reaction with 13-Did. The arrow points to GST-Mu
The position of Doc2α bound to nc13-Did and its mutants are shown.
Also, the numbers shown to the right of autoradiography are
Indicates the molecular weight of the protein (unit is Dalton, K is kilo). As a result, the proteins (1 and 2) having the region from position 13 to position 37 of Doc2α were found to have the Did
It was found to bind to the region.

Next, the fusion protein (2 μg) of GST and Doc2α obtained in Example 6 was bound to a glutathione sepharose column (Pharmacia). Then, any one of the variants of Munc13-1 labeled with the ³⁵ S a (2 [mu] g), in a manner similar to that described for the variants Doc2arufa, proteins bound to Doc2arufa immobilized on the column The eluate was obtained, subjected to SDS-PAGE, and analyzed for bands.

FIG. 5 shows the results. Figure 5 is a primary structural schematic view Munc13-1, were prepared by in vitro translation ³⁵
S-labeled Munc13-1 and its variants (1 to 3), and GST-D
Fig. 4 shows an autoradiography of a gel obtained by electrophoresing an eluate obtained after a binding reaction with oc2α (1-90). The arrow is
The position of Munc13-1 bound to GST-Doc2α (1-90) and its mutants are shown. In addition, the numbers shown on the right side of the autoradiography indicate the molecular weight of the protein (unit, Dalton, K is kilo). As a result, it was revealed that the proteins (1 and 2) containing the Did region of Munc13 bind to the region of amino acid residues 1 to 90 containing the Mid region of Doc2α even in a test tube.

Since it was found that Doc2α also binds to Munc13-1 in a test tube, it became possible to search for a substance that inhibits or promotes the binding between Doc2α and Munc13-1 in a test tube.

Example 8 Binding of Doc2α to Munc13-1 in PC12 cells PC12 cells derived from rat adrenal pheochromocytoma (PC12 pheno
chromocytoma cell line; see reference 30), 35
The seeds were seeded on a mmφdish at 5 × 10 ⁵ and cultured at 37 ° C. for 18 hours in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum and 5% horse serum. After culturing PC12 cells, use T7RN
Vaccinia virus encoding A polymerase (L0-T7
Co., Ltd. (Granted by Dr. Michiho Ohara, Tokyo Clinical Research Institute) 30
Minutes, then the human, prepared in Example 7 above,
Plasmid having cDNA fragment encoding amino acid residues 1 to 400 of Doc2α inserted into pGEM-HA and rat Munc1
The cDNA encoding amino acid residues 1 to 1743 of 3-1 is pBl
The plasmid inserted in uescript-myc was introduced by transfection using Lipofectamine (manufactured by Gibco BRL) according to the manufacturer's instructions.

After transfection, the cells were
Cultured for hours. In order to compare the expression levels of Doc2α protein and Munc13-1 protein with and without secretion stimulation, high-concentration potassium treatment or TPA treatment was performed, and no treatment was used as a control. When stimulating secretion, PC12 cells after culturing were converted to PSS (140 mM NaCl,
4.7 mM KCl, 2.5 mM CaCl ₂ , 1.2 mM MgSO ₂ , 1.2 mM KH ₂ P
O ₄ , 20 mM HEPES, pH 7.4, and 11 mM glucose), wash, centrifuge, and pellet the PSS containing 60 mM KCl and 85 mM NaCl (for high concentration potassium treatment)
Or 100 nM TPA (12-o-tetradecanoylphorbol-13-ace
tate) and treated at 37 ° C. for 10 minutes. After the treatment, the cells are collected by centrifugation, the cells are washed, and 500 μl of a lysis buffer (20 mM Tris / HCl at pH 7.5,
150 mM NaCl, 1% NP-40 and 10 mM p-amidino-phenylm
The cells are lysed by suspending them in ethanesulfonyl fluoride) and leaving them to stand for 30 minutes.
After centrifugation at 0 × g for 1 hour, a supernatant was obtained.

This supernatant was used as a cytoplasmic fraction. 3 μg of the anti-HA monoclonal antibody (Ber
Immunoprecipitation was performed by adding 20 μl of protein A-Sepharose (manufactured by Pharmacia) and reacting at 4 ° C. for 4 hours. After the reaction, the cytoplasmic fraction was centrifuged at 1,000 × g for 1 minute to obtain a pellet of protein bound to protein A-Sepharose. To this pellet was added 100 μl of SDS solution containing 1 mg of SDS,
By heating at 00 ° C. for 5 minutes, the protein bound to Protein A-Sepharose was converted into SDS and released from Protein A-Sepharose. After SDS conversion,
The mixture was centrifuged at 1,000 xg for 1 minute to obtain a supernatant containing the SDS-converted protein. This supernatant was subjected to SDS-PAGE using a 12% polyacrylamide gel, and a nylon membrane (trade name: Immo
bilon, Millipore). This film is
PB containing% skim milk (Difco Laboratories)
After blocking in S buffer, anti-m
The reaction was carried out at room temperature for 1 hour in a PBS buffer containing a yc monoclonal antibody (Boehringer Mannheim) and 5% skim milk. Thereafter, the plate was washed three times at room temperature with PBS containing 1% Tween20. Next, 5%
Skim milk and horseradish peroxi diluted 1000 times
Anti-mouse immunoglobulin sheep polyclonal antibody (manufactured by Amersham Japan) bound to dase was added.
The reaction was carried out in a PBS buffer at room temperature for 1 hour. afterwards,
Washing was performed three times at room temperature using PBS containing 1% tween20. After washing, a color reaction is performed using an ECL western blotting detection system (manufactured by Amersham Japan) according to the manufacturer's instructions, and an X-ray film (Kodak) is exposed to light and developed to detect bands that come out. did.
This band indicates the fusion protein of myc tag and Munc13-1 bound to the fusion protein of HA tag and Doc2α.

FIG. 6 shows the results. FIG. 6 shows the results of Western blot analysis of an immunoprecipitated product using an anti-HA antibody with an anti-myc antibody. PC1 cells not stimulated by secretion were stimulated, PC12 cells stimulated by high-potassium stimulation were stimulated, 3 shows PC12 cells secreted and stimulated by TPA treatment.
The arrow on the left indicates the position of Munc13-1 bound to Doc2α. The numbers on the right side indicate the molecular weight of the protein (unit, dalton, K is kilo). As a result, Doc2α becomes Munc
13-1 was also shown to bind in PC12 cells. Also,
It was found that the binding was promoted by high concentration potassium ion or TPA treatment. Based on previous reports that secretion caused by stimulation of high-concentration potassium ions, etc., induces an increase in intracellular calcium ions and production of diacylglycerol [22], TPA-induced Doc2α and diacylglycerol have similar effects. Munc13-1 binding is thought to play an important role in calcium ion-dependent secretion. Therefore, Doc2α and Munc13-1
Is expected to act on calcium ion-dependent secretion.

Example 9 Effect of Doc2α-Mid or Munc13-1-Did on Growth Hormone Secretion in PC12 Cells DNA fragment encoding human Doc2α-Mid was expressed in expression vector pEF.
The plasmid inserted into -Bos was constructed as follows. Doc2α-Mid obtained in Example 4 (this is
A plasmid having a DNA encoding the amino acid sequence at positions 13 to 37) is cleaved with a restriction enzyme XbaI, a plasmid inserted into pBTM116, and a DNA fragment encoding Doc2α-Mid is isolated. It is inserted into the XbaI site of pEF-Bos in the forward direction and ligated.

A plasmid in which a DNA fragment encoding rat Munc13-1-Did was inserted into the expression vector pEF-Bos was constructed as follows. Munc13-1-D obtained in Example 4
The DNA encoding id (amino acid residues 851 to 1461)
The plasmid inserted into pGAD424 is cut with the restriction enzyme XbaI, a DNA fragment encoding Munc13-1-Mid is isolated, and inserted into the XbaI site of the expression vector pEF-Bos in the forward direction and ligated.

PC12 cells were seeded at 5 × 10 ⁵ on a 35 mm dish and cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and 5% horse serum for 18 hours. Thereafter, human Doc2α-Mid (amino acid residues 13 to 37) or rat Munc13-1-Did (amino acid residues 851 to 146)
One of the plasmids in which the DNA fragment encoding 1) was inserted into the expression vector pEF-Bos was combined with 15 μg of lipofectamine (manufactured by Gibco BRL) together with the plasmid pXGH5 expressing human growth hormone and 1 ml of opti-MEM (Gibc
o BRL) according to the manufacturer's instructions. The amount of plasmid used for transfection was 2 μg each. After culturing any of the transfected cells for 4 hours, the medium was changed and cultured in Dulbecco's modified Eagle medium supplemented with 10% fetal calf serum and 5% horse serum for 48 hours. Doc2α protein and Mu with and without secretion stimulation
To compare the expression level of the nc13-1 protein, high-concentration potassium treatment or TPA treatment was performed in the same manner as in Example 8 above, and no treatment was used as a control. After secretion stimulation,
The cell pellet was recovered and suspended in 500 μl of PSS containing 1% Triton-X-100 to dissolve the growth hormone remaining in the cells. Measurement kit for radioimmunoassay using anti-human growth hormone antibody (Nichols Institute) to measure the amount of growth hormone contained in culture supernatant and cell lysate
Was measured based on the manufacturer's instructions. Based on the obtained measurements, the ratio of the secreted growth hormone to the total growth hormone produced was determined.

FIG. 7 shows the results. FIG. 7 shows control PC12 cells without plasmid, PC12 cells expressing Doc2α-Mid, and PC expressing Munc13-1-Did.
When 12 cells were treated with low-concentration potassium ion (low K ⁺ ), high-concentration potassium ion (high K ⁺ ), and TPA, respectively, the ratio of the secreted hormone amount to the total growth hormone amount is shown in percentage. Both Doc2α-Mid and Munc13-1-Did showed an inhibitory effect on growth hormone secretion in PC12 cells. When human growth hormone is expressed in PC12 cells, it is known that human growth hormone is transported to secretory granules containing norepinephrine, one of the neurotransmitters, and is secreted together with norepinephrine by calcium ion-dependent secretion. I have. Therefore, the secretion of growth hormone reflects the calcium ion-dependent secretion. From this result, the Mid of Munc13-1 and the Mid of Doc2α
All affect calcium-dependent secretion.

[0095]

According to the present invention, there is provided a method for screening candidate substances for agonists or antagonists of the binding between Doc2α and Munc13-1; a method for inhibiting calcium ion-dependent secretion of neurotransmitters or hormones; Doc2α analogs And a fusion protein of a carrier protein and the like.

[0096] The binding of Doc2α to Munc13 in the present invention provides a new development in elucidation of the calcium ion-dependent secretion mechanism of neurotransmitters or hormones in nerve cells or endocrine cells.

Both Doc2α and Munc13 have a C2 region, and it is considered that calcium ions bind to this region to function as a calcium ion sensor. Experiments on secretion of growth hormone using PC12 cells suggest that the binding of Doc2α to Munc13 regulates calcium ion-dependent secretion. From the above, a substance that inhibits the binding of Doc2α to Munc13 (antagonist) or a substance that promotes it (agonist) can be used to control the function of releasing neurotransmitters in nerve cells. Agonists or antagonists of the binding between Doc2α and Munc13 may be used as therapeutic agents for neurological diseases involving neurotransmitters or calcium ions (eg, anti-dementia drugs, anti-epileptic drugs, psychotropic drugs, or drugs for improving brain metabolism). It is possible to use.

Further, since Doc2α-Mid is composed of only 25 amino acids, these 25 amino acids are chemically synthesized and bound to a resin or a 96-well plate, and then prepared as a recombinant protein together with an agonist or antagonist candidate substance. Purified and labeled Munc13-Did
By measuring the label bound to the resin or the 96-well plate and determining whether the binding between Munc13-Did and Doc2α-Mid was promoted or inhibited, agonists and antagonists can be rapidly screened. It is possible.

(References) Orita, S., Sasaki, T., Naito, A., Komuro, R., Ohts
uka, T., Maeda, M., Suzuki, H., Igarashi, H., and Taka
i, Y., Doc2: a novel brain protein having two repea
ted C2-like domains.Biochemical & Biophysical Res
earch Communications, 1995. 206: p. 439-448. JP-A-8-16385 Orita, S., Sasaki, T., Komuro, R., Sakaguchi, G.,
Maeda, M., Igarashi, H., And Takai, Y., Doc2 enhances
Ca2 + -dependent exocytosis from PC12 cells.Journa
l of Biological Chemistry, 1996.271: p.7257-726
0.4. Sakaguchi, G., Orita, S., Maeda, M., Igarashi, H.,
and Takai, Y., Molecular cloning of an isoform of
Doc2 having two C2-like domains. Biochemical & Bio
physical Research Communications, 1995.217 p. 105
3-1061. Takai, Y., Kishimoto, A., Kikkawa, U., M
ori, T., and Nishizuka, Y., Unsaturated diacylglycer
ol as a possible messenger for the activation of c
alcium-activated, phospholipid-dependent protein k
inase system.Biochemical & Biophysical Research C
ommunications, 1979. 91: p. 1218-1224. Takai, Y., Kishimoto, A., Kikkawa, U., Mori, T., A
nd Nishizuka, Y., Unsaturated diacylglycerol as ap
ossible messenger for the activation of calcium-ac
tivated, phospholipid-dependent protein kinase sys
tem.Biochemical & Biophysical Research Communicat
ions, 1979. 91: p. 1218-1224. Takai, Y., Kishimoto, A., Iwasa, Y., Kawahara, Y.,
Mori, T., and Nishizuka, Y., Calcium-dependent activ
ation of a multifunctional protein kinaseby membra
ne phospholipids. Journal of Biological Chemistry,
1979. 254: p.3692-3695. Nishizuka, Y., The molecular heterogeneity of p
rotein kinase C andits implications for cellular r
egulation. Nature, 1988. 334: p. 661-665 8. Clark, JD, Lin, LL, Kriz, RW, Ramesha, CS,
Sultzman, LA, Lin, AY, Milona, N., and Knopf, J.
L., Cell, 1991. 65: p. 1043-1051. 9.Stahl, ML, Ferenz, CR, Kelleher, KL, Kriz, R.
W., and Knopf, JL, Sequence similarity of phospholi
pase C with the non-catalytic region ofsrc.Natur
e, 1988. 332: p. 269-272. Maruyama, IN and Brenner, S., A phorbol ester /
diacylglycerol-binding protein encoded by the unc-
13 gene of Caenorhabditis elegans. Proceedings of
the National Academy of Sciences of the United Sta
tes of America, 1991. 88: p. 5729-5733. Brose, N., Hofmann, K., Hata, Y., and Sudhof, T.
C., Mammalian homologues of Caenorhabditis elegans
unc-13 gene define novel family of C2-domain prot
eins. Journal of Biological Chemistry, 1995.270:
p. 25273-25280. Perin, MS, Fried, VA, Mignery, GA, Jahn, R.,
and Sdhof, TC, Phospholipid binding by a synapti
c vesicle protein homologous to the regulatory reg
ion of protein kinase C. Nature, 1990.345: p.260
-263. Shirataki, H., Kaibuchi, K., Sakoda, T., Kishida,
S., Yamaguchi, T., Wada, K., Miyazaki, M., and Takai,
Y., Rabphilin-3A, a putative target protein for sm
g p25A / rab3A p25 small GTP-binding protein related
to synaptotagmin.Molecular & Cellular Biology, 19
93. 13: p. 2061-2068. Ahmed, S., Maruyama, IN, Kozma, R., Lee, J., Bre
nner, S., and Lim, L., The Caenorhabditis elegans unc-
13 gene product is a phospholipid-dependent high-a
ffinity phorbol ester receptor. Biochemical Journa
1, 1992. 287 (Pt 3): p. 995-999. Kazanietz, MG, Lewin, NE, Bruns, JD, and Bl
umberg, PM, Characterization of the cysteine-rich
region of the Caenorhabditis elegans protein Unc-
13 as a high affinity phorbol ester receptor. Anal
ysis of ligand-binding interactions, lipid cofacto
r requirements, and inhibitor sensitivity.Journal
of Biological Chemistry, 1995.270 (18): p. 10777-
10783. 16. Hosono, R. and Kamiya, Y. Neuroscience Letter 19
91. 128: 243-244 17． Vojtek, AB, Hollenberg, SM, and Cooper, JA,
Mammalian Ras interacts directly with the serine /
threonine kinase Raf. Cell, 1993. 74 p. 205-214. Gietz, D., St. Jean, A., Woods, RA, and Schiest
l, RH, Improved method for high efficiency transf
ormation of intact yeast cells.Nucleic Acids Rese
arch, 1992. 20: p. 1425. Sanger, F., Nicklen, S., and Coulson, AR, DNA s
equencing with chain-terminating inhibitors. Proce
edings of the National Academy of Sciencesof the U
nited States of America, 1977. 74: p. 5463-5467. Sambrook, F., Fritsch, EF, and Maniatis, T., Mo
lecular Cloning: A Laboratory Manual. 2nd ed. 198
9, NY .: Cold Spring Harbor Laboratory Press. Rose, MD, Winston, F., and Hieter, P., Methods
in Yeast Genetics. 1990, NY: Cold Spring Harbor La
boratory Press. Wakade, TD, Bhave, SV, Bhave, AS, Malhotra,
RK, and Wakade, AR, Journal of Biological Chemi
stry, 1991.266: p. 6424-6428.

[0100]

[Sequence list]

SEQ ID NO: 1 Sequence length: 611 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Origin Organism name: Rat Other information: This sequence corresponds to the amino acid sequence at positions 851-1461 of Munc13-1. Equivalent sequence: Glu Lys Val Ala Pro Tyr His Val Gln Tyr Thr Cys Leu His Glu Asn 1 5 10 15 Leu Phe His Phe Val Thr Asp Val Gln Asn Asn Gly Val Val Lys Ile 20 25 30 Pro Asp Ala Lys Gly Asp Asp Ala Trp Lys Val Tyr Tyr Asp Glu Thr 35 40 45 Ala Gln Glu Ile Val Asp Glu Phe Ala Met Arg Tyr Gly Val Glu Ser 50 55 60 Ile Tyr Gln Ala Met Thr His Phe Ala Cys Leu Ser Ser Lys Tyr Met 65 70 75 80 Cys Pro Gly Val Pro Ala Val Met Ser Thr Leu Leu Ala Asn Ile Asn 85 90 95 Ala Tyr Tyr Ala His Thr Thr Ala Ser Thr Asn Val Ser Ala Ser Asp 100 105 110 Arg Phe Ala Ala Ser Asn Phe Gly Lys Glu Arg Phe Val Lys Leu Leu 115 120 125 Asp Gln Leu His Asn Ser Leu Arg Ile Asp Leu Ser Met Tyr Arg Asn 130 135 140 Asn Phe Pro Ala Ser Ser Pro Glu Arg Leu Gln Asp Leu Lys Ser Thr 145 1 50 155 160 Val Asp Leu Leu Thr Ser Ile Thr Phe Phe Arg Met Lys Val Gln Glu 165 170 175 Leu Gln Ser Pro Pro Arg Ala Ser Gln Val Val Lys Asp Cys Val Lys 180 185 190 Ala Cys Leu Asn Ser Thr Tyr Glu Tyr Ile Phe Asn Asn Cys His Glu 195 200 205 Leu Tyr Gly Arg Glu Tyr Gln Thr Asp Pro Ala Lys Lys Gly Glu Val 210 215 220 Pro Pro Glu Glu Gln Gly Pro Ser Ile Lys Asn Leu Asp Phe Trp Ser 225 230 235 240 Lys Leu Ile Thr Leu Ile Val Ser Ile Ile Glu Glu Asp Lys Asn Ser 245 250 255 Tyr Thr Pro Cys Leu Asn Gln Phe Pro Gln Glu Leu Asn Val Gly Lys 260 265 270 Ile Ser Ala Glu Val Met Trp Ser Leu Phe Ala Gln Asp Met Lys Tyr 275 280 285 Ala Met Glu Glu His Asp Lys His Arg Leu Cys Lys Ser Ala Asp Tyr 290 295 300 Met Asn Leu His Phe Lys Val Lys Trp Leu Tyr Asn Glu Tyr Val Ala 305 310 315 320 Glu Leu Pro Thr Phe Lys Asp Arg Val Pro Glu Tyr Pro Ala Trp Phe 325 330 335 Glu Pro Phe Val Ile Gln Trp Leu Asp Glu Asn Glu Glu Val Ser Arg 340 345 350 Asp Phe Leu His Gly Ala Leu Glu Arg Asp Lys Lys Asp Gly Phe Gln 355 Three 60 365 Gln Thr Ser Glu His Ala Leu Phe Ser Cys Ser Val Val Asp Val Phe 370 375 380 Ser Gln Leu Asn Gln Ser Phe Glu Ile Ile Lys Lys Leu Glu Cys Pro 385 390 395 400 400 Asp Pro Gln Ile Val Gly His Tyr Met Arg Arg Phe Ala Lys Thr Ile 405 410 415 Ser Asn Val Leu Leu Gln Tyr Ala Asp Ile Val Ser Lys Asp Phe Ala 420 425 430 Ser Tyr Cys Ser Lys Glu Lys Glu Lys Val Pro Cys Ile Leu Met Asn 435 440 445 445 Asn Thr Gln Gln Leu Arg Val Gln Leu Glu Lys Met Phe Glu Ala Met 450 455 460 Gly Gly Lys Glu Leu Asp Ala Glu Ala Ser Gly Thr Leu Lys Glu Leu 465 470 475 480 480 Gln Val Lys Leu Asn Asn Val Leu Asp Glu Leu Ser His Val Phe Ala 485 490 495 Thr Ser Phe Gln Pro His Ile Glu Glu Cys Val Arg Gln Met Gly Asp 500 505 510 Ile Leu Ser Gln Val Lys Gly Thr Gly Asn Val Pro Ala Ser Ala Cys 515 520 525 Ser Ser Val Ala Gln Asp Ala Asp Asn Val Leu Gln Pro Ile Met Asp 530 535 540 Leu Leu Asp Ser Asn Leu Thr Leu Phe Ala Lys Ile Cys Glu Lys Thr 545 550 555 560 Val Leu Lys Arg Val Leu Lys Glu Leu Trp Lys Leu Val Met Asn Thr 565 Five 70 575 Met Glu Arg Thr Ile Val Leu Pro Pro Leu Thr Asp Gln Thr Met Ile 580 585 590 Gly Thr Leu Leu Arg Lys His Gly Lys Gly Leu Glu Lys Gly Arg Val 595 600 605 Lys Leu Pro 610

SEQ ID NO: 2 Sequence length: 1718 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA origin Organism name: human Sequence characteristics Characteristic symbols: Location of CDS: 125..1324 Method for determining characteristics: S sequence CCACGCGTCC GGTCCTGACG GCGCTGGAGC TGA
GGGGCAG TGCGGATGCC CCAGGAAGGC 60 TCCTAGGAAG AGGGGACCCA CGGTGACTTC CTA
AGGAAGC GCGGTTCCCA GCCAGGGGTG 120 CTGC ATG AGG GGC CGC AGG GGC GAT CGC
ATG ACC ATC AAC ATC CAG GAG 169 Met Arg Gly Arg Arg Gly Asp Arg
Met Thr Ile Asn Ile Gln Glu 15
10 15 CAC ATG GCC ATC AAC GTG TGC CCC GGG
CCC ATC CGG CCC ATC CGC CAG 217 His Met Ala Ile Asn Val Cys Pro Gly
Pro Ile Arg Pro Ile Arg Gln 20
25 30 ATC TCT GAC TAC TTC CCC CGG GGA CCA
GGA CCT GAA GGG GGC GGC GGG 265 Ile Ser Asp Tyr Phe Pro Arg Gly Pro
Gly Pro Glu Gly Gly Gly Gly Gly 35 40
45 AGC GGC GGG GAG GCC CCC GCC CAT CTG
GTC CCC CTG GCT CTG GCC CCC 313 Ser Gly Gly Glu Ala Pro Ala His Leu
Val Pro Leu Ala Leu Ala Pro 50 55
60 CCT GCA GCC CTC CTT GGG GCC ACC ACG
CCT GAG GAT GGT GCG GAG GTG 361 Pro Ala Ala Leu Leu Gly Ala Thr Thr
Pro Glu Asp Gly Ala Glu Val 65 70
75 GAC AGC TAT GAC TCG GAT GAT GCC ACC
GCC CTA GGC AAG CTG GAG TTT 409 Asp Ser Tyr Asp Ser Asp Asp Ala Thr
Ala Leu Gly Lys Leu Glu Phe 80 85
90 95 GAC CTT CTC TAC GAC CGG GCC TCC TGC
ACT CTG CAC GTA TGC ATC CTC 457 Asp Leu Leu Tyr Asp Arg Ala Ser Cys
Thr Leu His Val Val Cys Ile Leu 100
105 110 AGG GCC AAG GGC CTC AAG CCC ATG GAT
TTC AAT GGC CTC GCC GAC CCC 505 Arg Ala Lys Gly Leu Lys Pro Met Asp
Phe Asn Gly Leu Ala Asp Pro 115 120
125 TAC GTC AAG CTG CAC TTG CTG CCT GGA
GCC TGT AAG GCC AAT AAG CTA 553 Tyr Val Lys Leu His Leu Leu Pro Gly
Ala Cys Lys Ala Asn Lys Leu 130 135
140 AAA ACG AAG ACT CAG AGG AAC ACA CTG
AAT CCC GTG TGG AAT GAG GAC 601 Lys Thr Lys Thr Gln Arg Asn Thr Leu
Asn Pro Val Trp Asn Glu Asp 145 150
155 CTG ACT TAC AGC GGG ATC ACA GAT GAC
GAC ATC ACG CAC AAG GTG CTC 649 Leu Thr Tyr Ser Gly Ile Thr Asp Asp
Asp Ile Thr His Lys Val Leu 160 165
170 175 AGG ATC GCC GTC TGT GAT GAG GAC AAG
CTG AGT CAC AAT GAG TTT ATT 697 Arg Ile Ala Val Cys Asp Glu Asp Lys
Leu Ser His Asn Glu Phe Ile 180
185 190 GGG GAG ATC CGC GTG CCC CTC CGC CGC
CTC AAG CCT TCG CAG AAG AAG 745 Gly Glu Ile Arg Val Pro Leu Arg Arg
Leu Lys Pro Ser Gln Lys Lys 195 200
205 CAT TTT AAC ATC TGC CTC GAG CGC CAA
GTC CCG CTG GCG TCC CCC TCT 793 His Phe Asn Ile Cys Leu Glu Arg Gln
Val Pro Leu Ala Ser Pro Ser 210 210 215
220 TCC ATG TCA GCG GCG CTG AGG GGC ATC
TCC TGT TAT CTG AAG GAC TTG 841 Ser Met Ser Ala Ala Leu Arg Gly Ile
Ser Cys Tyr Leu Lys Asp Leu 225 230
235 GAG CAG GCG GAG CAGGGG CAGGGG CTG
CTG GAG GAG CGT GGC CGC ATC 889 Glu Gln Ala Glu Gln Gly Gln Gly Leu
Leu Glu Glu Arg Gly Arg Ile 240 245
250 255 CTG CTG AGT CTC AGC TAC AGC TCG CGG
CGC CGG GGA CTG CTG GTA GGC 937 Leu Leu Ser Leu Ser Tyr Ser Ser Arg
Arg Arg Gly Leu Leu Val Gly 260
265 270 ATC TTG CGC TGC GCC CAT CTG GCT GCC
ATG GAC GTC AAC GGT TAC TCG 985 Ile Leu Arg Cys Ala His Leu Ala Ala
Met Asp Val Asn Gly Tyr Ser 275 280
285 GAC CCC TAC GTC AAG ACG TAC CTG AGG
CCC GAT GTG GAC AAG AAA TCC 1033 Asp Pro Tyr Val Lys Thr Tyr Leu Arg
Pro Asp Val Asp Lys Lys Ser 290 295
300 AAG CAT AAG ACG TGT GTG AAG AAG AAG AAG
ACT CTC AAC CCA GAA TTT AAC 1081 Lys His Lys Thr Cys Val Lys Lys Lys
Thr Leu Asn Pro Glu Phe Asn 305 310
315 GAG GAG TTT TTC TAC GAG ATA GAG CTC
TCC ACT CTG GCC ACC AAG ACC 1129 Glu Glu Phe Pyr Tlu Glu Ile Glu Leu
Ser Thr Leu Ala Thr Lys Thr 320 325
330 335 CTG GAA GTC ACC GTC TGG GAC TAT GAC
ATT GGC AAA TCC AAT GAC TTC 1177 Leu Glu Val Thr Val Trp Asp Tyr Asp
Ile Gly Lys Ser Asn Asp Phe 340
345 350 ATT GGT GGC GTG TCC CTG GGG CCA GGT
GCC CGA GGC GAG GCT CGG AAG 1225 Ile Gly Gly Val Ser Leu Gly Pro Gly
Ala Arg Gly Glu Ala Arg Lys 355 360
365 CAC TGG AGT GAC TGC CTG CAG CAG CGG
GAC GCA GCC CTG GAG CGC TGG 1273 His Trp Ser Asp Cys Leu Gln Gln Arg
Asp Ala Ala Leu Glu Arg Trp 370 375
380 CAC ACC CTG ACC AGT GAG CTG CCC CCT
GCG GCC GGG GCT CTG TCC TCA 1321 His Thr Leu Thr Ser Glu Leu Pro Pro
Ala Ala Gly Ala Leu Ser Ser 385 390
395 GCC TGAGTGGACA GCAGGTTCCC GGCACAGGCC
CATCGAGCCG GGTCCAGTAC 1374 Ala 400 CCAACCTTCG CACGAGTGTG TTGCACGTTTT ACA
CAGGTGG GCTGCCCCAC CCTGCACTAC 1434 CTATTTTTGTG AGTCTCGTGA CCCGGGTCTG TCT
GCTCATG AGGGGCTGCG GAGTCTTATA 1494 TTCACATATG CAAACCTCCT GCTCTGACTCG CTA
GTCCCTG CAAATATGCA AACCCCCCTA 1554 CTACTGCACCA CCCGGGCAGT GCTCAGAGCC GCC
CAGCCCCCCGCGCTCCTCACTCCTGCCT 1614 CTCCACGCTGCCCCGTCCCT CTCCCCCAAC AGG
GAGGAGGG TCGGATTAGG GAGGTTCAGA 1674 GGAGGAGAAT GTCTCAAAAA AAAAAAAAAAA AAA
AAAAAAAAAAAA 1718

SEQ ID NO: 3 Sequence length: 25 Sequence type: amino acid Topology: linear Sequence type: peptide Origin Organism name: human Other information: This sequence is the amino acid sequence at positions 13 to 37 of Doc2α Sequence corresponding to: Ile Gln Glu His Met Ala Ile Asn Val Cys Pro Gly Pro Ile Arg Pro 1 5 10 15 Ile Arg Gln Ile Ser Asp Tyr Phe Pro 20 25

SEQ ID NO: 4 Sequence length: 5318 Sequence type: nucleic acid Number of strands: double-stranded Topology: linear Sequence type: cDNA to mRNA origin Organism name: rat Sequence characteristics Characteristic symbols: Location of CDS: 30..5315 Method for determining characteristics: S sequence GTATTGAAGT GGGAAATGGA GGGTCGGGG ATG AAG CGA CAT GGC CGG CGA CCG 50 Met Lys Arg His Gly Arg Arg Pro 15 GGC CCC AGC GTA AGC TCT GAG CCC CGC GCT GCG CCC GCC GCG CTC TGG 98 Gly Pro Ser Val Ser Ser Glu Pro Arg Ala Ala Pro Ala Ala Leu Trp 10 15 20 CCG CCT GGA GTC ATG TCT CTG CTG TGC GTG GGA GTC AAA AAA GCC AAG 146 Pro Pro Gly Val Met Ser Leu Leu Cys Val Gly Val Lys Lys Ala Lys 25 30 35 40 TTT GAC GGT GCC CAA GAG AAG TTC AAC ACA TAC GTG ACG CTG AAG GTG 194 Phe Asp Gly Ala Gln Glu Lys Phe Asn Thr Tyr Val Thr Leu Lys Val 45 50 55 CAG AAC GTG AAG AGC ACT ACC ATA GCT GTA CGC GGC AGC CAG CCT AGC 242 Gln Asn Val Lys Ser Thr Thr Ile Ala Val Arg Gly Ser Gln Pro Ser 60 65 70 TGG GAG CAG GAC TTC ATG TTT GAG ATC AAC CGC CTG GAT CTG GGC CTG 290 Trp Glu Gln Asp Phe Met Phe Glu Ile Asn Arg Leu Asp Leu Gly Leu 75 80 85 ACG GTG GAG GTG TGG AAC AAG GGT CTC ATC TGG GAC ACA ATG GTG GGT 338 Thr Val Glu Val Trp Asn Lys Gly Leu Ile Trp Asp Thr Met Val Gly 90 95 100 ACT GTG TGG ATC CCA CTT CGG ACC ATC CGT CAG TCC AAT GAG GAG GGT 386 Thr Val Trp Ile Pro Leu Arg Thr Ile Arg Gln Ser Asn Glu Glu Gly 105 110 115 120 CCG GGA GAA TGG CTG ACA CTG GAC TCT CAG GCC ATC ATG GCG GAC AGT 434 Pro Gly Glu Trp Leu Thr Leu Asp Ser Gln Ala Ile Met Ala Asp Ser 125 130 135 GAG ATC TGT GGG ACC AAG GAC CCC ACC TTC CAC CGC ATC CTC CTG GAC 482 Glu Ile Cys Gly Thr Lys Asp Pro Thr Phe His Arg Ile Leu Leu Asp 140 145 150 GCA CAT TTT GAG CTG CCT TTG GAC ATC CCC GAG GAG GAG GCG CGC TAC 530 Ala His Phe Glu Leu Pro Leu Asp Ile Pro Glu Glu Glu Ala Arg Tyr 155 160 165 TGG GCC AAG AAG CTG GAG CAG CTG AAT GCC ATG CGT GAC CAA GAT GAG 578 Trp Ala Lys Lys Leu Glu Gln Leu Asn Ala Met Arg Asp Gln Asp Glu 170 175 180 TAC TCC TTT CAG GAC CAG C AG GAC AAG CCA CTG CCG GTG CCC AGC AGC 626 Tyr Ser Phe Gln Asp Gln Gln Asp Lys Pro Leu Pro Val Pro Ser Ser 185 190 195 200 CAG TGC TGC AGC TGG AAT TAC TTT GGC TGG GGA GAA CAG AAT GAT GAT 674 Gln Cys Cys Asn Trp Asn Tyr Phe Gly Trp Gly Glu Gln Asn Asp Asp 205 210 215 CCC GAC AGT GCC GTG GAT GAC CGG GAC AGT GAT TAT AGG AGT GAG ACG 722 Pro Asp Ser Ala Val Asp Asp Arg Asp Ser Asp Tyr Arg Ser Glu Thr 220 225 230 AGC AAC AGC ATC CCA CCG CCT TAC TAC ACG ACT TCG CAG CCC AAT GCT 770 Ser Asn Ser Ile Pro Pro Pro Tyr Tyr Thr Thr Ser Gln Pro Asn Ala 235 240 245 TCG GTG CAC CAG TAC TCC GTG CGG CCA CCC CCT CTG GGG TCC CGG GAG 818 Ser Val His Gln Tyr Ser Val Arg Pro Pro Pro Leu Gly Ser Arg Glu 250 255 260 TCC TAC AGC GAC TCC ATG CAC AGC TAT GAA GAG TTC TCT GAG CCG CGG 866 Ser Tyr Ser Asp Ser Met His Ser Tyr Glu Glu Phe Ser Glu Pro Arg 265 270 275 280 280 GCA CTC AGT CCC ACA GGC AGC AGC CGC TAT GCT TCC AGT GGG GAG CTG 914 Ala Leu Ser Pro Thr Gly Ser Ser Arg Tyr Ala Ser Ser Gly Glu Leu 285 290 295 295 AGC CAG G GC AGC TCC CAG CTG AGT GAG GAC TTC GAC CCG GAT GAG CAC 962 Ser Gln Gly Ser Ser Gln Leu Ser Glu Asp Phe Asp Pro Asp Glu His
300 305 310 AGC CTA CAG GGC TCA GAG CTG GAT GAC GAG AGG GAC CGA GAT TCT TAT 1010 Ser Leu Gln Gly Ser Glu Leu Asp Asp Glu Arg Asp Arg Asp Ser Tyr 315 320 325 CAC TCC TGC CAC AGC TCT GTG AGC TAC CAC AAG GAC TCA CCC CGC TGG 1058 His Ser Cys His Ser Ser Val Ser Tyr His Lys Asp Ser Pro Arg Trp 330 335 340 GAC CAG GAT GAG GAG GAC CTG GAG GAC CTG GAG GAC CTG GAA GAT GAG 1106 Asp Gln Asp Glu Glu Asp Leu Glu Asp Leu Glu Asp Leu Glu Asp Glu 345 350 355 360 GAG TTG CCC GAG GAA GAG GAG TTG GAA GAG GAG GAG TTG GAG GAG GAG 1154 Glu Leu Pro Glu Glu Glu Glu Leu Glu Glu Glu Glu Leu Glu Glu Glu 365 370 375 GAG GAG TTG GAG GAA GAG GAA TTG GAG TTG GAG GAG GAG GAG GAG GTG 1202 Glu Glu Leu Glu Glu Glu Glu Leu Glu Leu Glu Glu Glu Glu Glu Val 380 385 390 CCT GAT GAC CTG GCC AGC TAT ACC CAG CAG GAG GAC ACC ACT GTG 1250 Pro Asp Asp Leu Ala Ser Tyr Thr Gln Gln Glu Asp Thr Thr Val Ala 395 400 405 GAG CCC AAA GAG TTC AAG CGG ATC AGC TTC CCA ACA GCT GCA CCT CAG 1298 Glu Pro Lys Glu Phe Lys Arg Ile Ser Phe Pro T hr Ala Ala Pro Gln 410 415 420 AAG GAA GAC AAA GTT TCA GCT GTG CCC ATT GAG GCC CCC GAT GTG TCC 1346 Lys Glu Asp Lys Val Ser Ala Val Pro Ile Glu Ala Pro Asp Val Ser 425 430 435 435 440 AAA GGC ATC CCC AAG GCA GCC ACA CCT GAA GAG AAG GCA GCT GCG GAG 1394 Lys Gly Ile Pro Lys Ala Ala Thr Pro Glu Glu Lys Ala Ala Ala Glu 445 450 455 TGT GCA CAG GAA GCG GAG CCC CCC AAG TCT GAG GAG AGT TTC AGA TCT 1442 Cys Ala Gln Glu Ala Glu Pro Pro Lys Ser Glu Glu Ser Phe Arg Ser 460 465 470 CGA GAG GCT GAG GAG GGC CAG GAA GGG CAG GAT GCC ATG TCC AGG GCC 1490 Arg Glu Ala Glu Glu Gly Gln Glu Gly Gln Asp Ala Met Ser Arg Ala 475 480 485 AAA GCC AAC TGG TTG CGA GCC TTC AAC AAG GTG CGC ATG CAG CTG CAG 1538 Lys Ala Asn Trp Leu Arg Ala Phe Asn Lys Val Arg Met Gln Leu Gln 490 495 500 GAG GCC CGA GGA GAA GGA GAG ATG TCC AAGCT CTG TGG TTC AAA GGC 1586 Glu Ala Arg Gly Glu Gly Glu Met Ser Lys Ser Leu Trp Phe Lys Gly 505 510 515 515 520 GGC CCT GGT GGT GGC CTT ATC ATC ATT GAC AGC ATG CCA GAC ATC AGG 1634 Gly Pro Gly Gly Gly Le u Ile Ile Ile Asp Ser Met Pro Asp Ile Arg 525 530 535 AAG CGG AAG CCC ATT CCC CTC GTG AGC GAC CTG GCT ATG TCT CTG GTC 1682 Lys Arg Lys Pro Ile Pro Leu Val Ser Asp Leu Ala Met Ser Leu Val 540 545 550 550 CAG TCA CGG AAG GCG GGC ATC ACC TCG GCC TTG GCC TCC AGC ACG TTG 1730 Gln Ser Arg Lys Ala Gly Ile Thr Ser Ala Leu Ala Ser Ser Thr Leu 555 560 565 AAC AAT GAA GAG TTG AAA AAC CAC GTT TAC AAG AAG ACC CTG CAA GCC 1778 Asn Asn Glu Glu Leu Lys Asn His Val Tyr Lys Lys Thr Leu Gln Ala 570 575 580 TTA ATC TAC CCC ATC TCC TGC ACC ACG CCG CAC AAC TTC GAG GTG TGG 1826 Leu Ile Tyr Pro Ile Ser Cys Thr Thr Pro His Asn Phe Glu Val Trp 585 590 595 600 ACG GCC ACC ACT CCC ACC TAC TGC TAC GAG TGC GAG GGG CTG CTG TGG 1874 Thr Ala Thr Thr Pro Thr Tyr Cys Tyr Glu Cys Glu Gly Leu Leu Trp 605 610 615 615 GGC ATC GCG CGG CAG GGC ATG CGC TGC ACC GAG TGC GGC GTT AAG TGC 1922 Gly Ile Ala Arg Gln Gly Met Arg Cys Thr Glu Cys Gly Val Lys Cys 620 625 630 CAC GAG AAG TGC CAA GAC CTG CTC AAC GCG GAC TGC CTG CAG CGG GCG 1970 His Glu Lys Cys Gln Asp Leu Leu Asn Ala Asp Cys Leu Gln Arg Ala 635 640 645 GCT GAG AAG AGT TCT AAG CAT GGC GCT GAA GAC CGC ACG CAG AAC ATC 2018 Ala Glu Lys Ser Ser Lys His Gly Ala Glu Asp Arg Thr Gln Asn Ile 650 655 660 ATC ATG GTG CTG AAG GAC CGC ATG AAG ATC CGC GAG CGC AAC AAG CCT 2066 Ile Met Val Leu Lys Asp Arg Met Lys Ile Arg Glu Arg Asn Lys Pro 665 670 675 680 680 GAG ATC AGC TGA TCC AGG AGG TCT CGG TCA CCA AGA GCG CAT TCG 2114 Glu Ile Phe Glu Leu Ile Gln Glu Val Phe Ala Val Thr Lys Ser Ala 685 690 695 CAC ACA CAG CAG ATG AAG GCC GTC AAG CAG AGT GTG CTG GAT GGC ACA 2162 His Thr Gln Gln Met Lys Ala Val Lys Gln Ser Val Leu Asp Gly Thr 700 705 710 TCC AAG TGG TCT GCC AAA ATT AGC ATC ACG GTG GTC TGT GCC CAG GGC 2210 Ser Lys Trp Ser Ala Lys Ile Ser Ile Thr Val Val Cys Ala Gln Gly 715 720 725 TTG CAG GCC AAG GAC AAG ACA GGA TCC AGT GAC CCT TAT GTC ACC GTC 2258 Leu Gln Ala Lys Asp Lys Thr Gly Ser Ser Asp Pro Tyr Val Thr 730 735 740 740 CAG GAC CAA GAA AAG GAC AAA AAC CAT CTA CGG GAA CCT T TT GGG AAG 2306 Gln Val Gly Lys Thr Lys Lys Arg Thr Lys Thr Ile Tyr Gly Asn Leu 745 750 755 760 AAC CCA GTG TGG GAA GAG AAT TTC CAC TTT GAA TGT CAC AAC TCC TCT 2354 Asn Pro Val Trp Glu Glu Asn Phe His Phe Glu Cys His Asn Ser Ser 765 770 775 GAC CGG ATC AAG GTG CGT GTG TTG GAT GAA GAC GAT GAC ATC AAA TCC 2402 Asp Arg Ile Lys Val Arg Val Leu Asp Glu Asp Asp Asp Ile Lys Ser 780 785 790 790 CGT GTG AAG CAA AGG TTT AAG AGG GAG TCT GAT GAC TTC CTA GGG CAG 2450 Arg Val Lys Gln Arg Phe Lys Arg Glu Ser Asp Asp Phe Leu Gly Gln 795 800 805 ACA ATC ATC GAG GTG CGG ACG CTT AGC GGC GAG ATG GAT GTG TGG TAC 2498 Thr Ile Ile Glu Val Arg Thr Leu Ser Gly Glu Met Asp Val Trp Tyr 810 815 820 AAT CTG GAC AAG AGA ACA GAC AAG TCT GCT GTG TCG GGC GCC ATT CGG 2546 Asn Leu Asp Lys Arg Thr Asp Lys Ser Ala Val Ser Gly Ala Ile Arg 825 830 835 840 CTT CAC ATC AGT GTG GAG ATC AAA GGG GAG GAG AAG GTG GCA CCC TAC 2594 Leu His Ile Ser Val Glu Ile Lys Gly Glu Glu Lys Val Ala Pro Tyr 845 850 855 855 CAT GTC CAG TAC ACC TGT CTG CA T GAG AAC CTG TTC CAT TTT GTG ACG 2642 His Val Gln Tyr Thr Cys Leu His Glu Asn Leu Phe His Phe Val Thr 860 865 870 GAT GTA CAG AAC AAT GGC GTG GTG AAG ATT CCC GAT GCC AAA GGT GAC 2690 Asp Val Gln Asn Asn Gly Val Val Lys Ile Pro Asp Ala Lys Gly Asp 875 880 885 GAC GCC TGG AAG GTT TAC TAT GAT GAG ACT GCC CAG GAG ATC GTG GAT 2738 Asp Ala Trp Lys Val Tyr Tyr Asp Glu Thr Ala Gln Glu Ile Val Asp 890 895 900 GAG TTT GCC ATG CGC TAT GGC GTT GAA TCC ATC TAC CAA GCC ATG ACC 2786 Glu Phe Ala Met Arg Tyr Gly Val Glu Ser Ile Tyr Gln Ala Met Thr 905 910 915 915 920 CAC TTT GCC TGC CTC TCC TCC AAG TAC ATG TGC CCT GGG GTA CCC GCT 2834 His Phe Ala Cys Leu Ser Ser Lys Tyr Met Cys Pro Gly Val Pro Ala 925 930 935 GTC ATG AGC ACC CTG CTT GCC AAC ATC AAC GCC TAC TAC GCA CAC ACC 2882 Val Met Ser Thr Leu Leu Ala Asn Ile Asn Ala Tyr Tyr Ala His Thr 940 945 950 ACC GCC TCC ACC AAC GTG TCT GCC TCC GAC CGC TTC GCT GCC TCC AAT 2930 Thr Ala Ser Thr Asn Val Ser Ala Ser Asp Arg Phe Ala Ala Ser Asn 955 960 965 TTC GGG AAA GAG CGC TTT GTG AAA CTT CTG GAC CAG CTG CAC AAC TCC 2978 Phe Gly Lys Glu Arg Phe Val Lys Leu Leu Asp Gln Leu His Asn Ser 970 975 980 CTG CGG ATT GAC CTG TCC ATG TAC CGG AAC AAC TTC CCG GCC AGC AGC 3026 Leu Arg Ile Asp Leu Ser Met Tyr Arg Asn Asn Phe Pro Ala Ser Ser 985 990 995 1000 CCC GAG CGG CTG CAG GAT CTC AAG TCC ACA GTG GAC CTG CTT ACC AGC 3074 Pro Glu Arg Leu Gln Asp Leu Lys Ser Thr Val Asp Leu Leu Thr Ser 1005 1010 1015 ATC ACC TTC TTC CGG ATG AAG GTT CAG GAA CTG CAG AGT CCG CCA CGT 3122 Ile Thr Phe Phe Arg Met Lys Val Gln Glu Leu Gln Ser Pro Pro Arg 1020 1025 1030 GCC AGT CAG GTG GTG AAG GAC TGC GTG AAG GCG TGC CTC AAC TCC ACC 3170 Ala Ser Gln Val Val Lys Asp Cys Val Lys Ala Cys Leu Asn Ser Thr 1035 1040 1045 TAC GAG TAC ATC TTC AAC AAC TGT CAT GAG CTC TAT GGC CGG GAG TAC 3218 Tyr Glu Tyr Ile Phe Asn Asn Cys His Glu Leu Tyr Gly Arg Glu Tyr 1050 1055 1060 CAG ACA GAC CCG GCC AAG AAG GGG GAG GTC CCC CCG GAG GAG CAA GGC 3266 Gln Thr Asp Pro Ala Lys Lys Gly Glu Val Pro Pro Glu Glu Gln Gly 1065 1070 1075 1080 CCT AGC ATC AAG AAC CTG GAT TTC TGG TCC AAG CTC ATC ACC CTC ATC 3314 Pro Ser Ile Lys Asn Leu Asp Phe Trp Ser Lys Leu Ile Thr Leu Ile 1085 1090 1095 GTG TCT ATC ATT GAG GAG GAT AAG AAC TCC TAC ACA CCC TGC CTC AAT 3362 Val Ser Ile Ile Glu Glu Asp Lys Asn Ser Tyr Thr Pro Cys Leu Asn 1100 1105 1110 CAG TTT CCC CAG GAG CTG AAT GTG GGG AAG ATC AGT GCT GAG GTG ATG 3410 Gln Phe Pro Gln Glu Leu Asn Val Gly Lys Ile Ser Ala Glu Val Met 1115 1120 1125 TGG AGC CTG TTT GCC CAG GAC ATG AAG TAC GCC ATG GAG GAA CAC GAC 3458 Trp Ser Leu Phe Ala Gln Asp Met Lys Tyr Ala Met Glu Glu His Asp 1130 1135 1140 AAG CAC CGG CTG TGT AAG AGC GCA GAC TAC ATG AAC CTG CAT TTC AAG 3506 Lys His Arg Leu Cys Lys Ser Ala Asp Tyr Met Asn Leu His Phe Lys 1145 1150 1155 1160 GTC AAG TGG TTG TAC AAC GAG TAC GTG GCT GAA CTG CC ACC TTC AAG 3554 Val Lys Trp Leu Tyr Asn Glu Tyr Val Ala Glu Leu Pro Thr Phe Lys 1165 1170 1175 GAC CGC GTG CCG GAG TAC CCT GCG TGG TTT GAG CCC TTC GTC ATC CAG 3602 Asp Arg V al Pro Glu Tyr Pro Ala Trp Phe Glu Pro Phe Val Ile Gln 1180 1185 1190 TGG TTA GAT GAG AAT GAG GAG GTG TCC CGG GAC TTC CTG CAT GGT GCA 3650 Trp Leu Asp Glu Asn Glu Glu Val Ser Arg Asp Phe Leu His Gly Ala 1195 1200 1205 CTC GAG CGG GAC AAG AAG GAT GGG TTC CAG CAG ACA TCG GAG CAC GCC 3698 Leu Glu Arg Asp Lys Lys Asp Gly Phe Gln Gln Thr Ser Glu His Ala 1210 1215 1220 CTG TTC TCT TGC TCG GTA GTG GAC GTC TTC TCC CAG CTC AAC CAG AGC 3746 Leu Phe Ser Cys Ser Val Val Asp Val Phe Ser Gln Leu Asn Gln Ser 1225 1230 1235 1240 TTT GAG ATC ATC AAG AAG CTG GAG TGT CCT GAC CCC CAG ATT GTG GGC 3794 Phe Glu Ile Ile Lys Lys Leu Glu Cys Pro Asp Pro Gln Ile Val Gly 1245 1250 1255 CAC TAC ATG CGG CGC TTT GCC AAG ACC ATT AGC AAT GTG CTT CTC CAG 3842 His Tyr Met Arg Arg Phe Ala Lys Thr Ile Ser Asn Val Leu Leu Gln 1260 1265 1270 TAC GCC GAC ATC GTC TCC AAG GAC TTC GCT TCC TAC TGC TCC AAG GAG 3890 Tyr Ala Asp Ile Val Ser Lys Asp Phe Ala Ser Tyr Cys Ser Lys Glu 1275 1280 1285 AAG GAG AAA GTG CCC TGC ATC CTC ATG A AC AAC ACA CAG CAG CTG CGG 3938 Lys Glu Lys Val Pro Cys Ile Leu Met Asn Asn Thr Gln Gln Leu Arg 1290 1295 1300 GTG CAG CTG GAG AAG ATG TTC GAG GCG ATG GGT GGG AAG GAG CTG GAC 3986 Val Gln Leu Glu Lys Met Phe Glu Ala Met Gly Gly Lys Glu Leu Asp 1305 1310 1315 1320 GCC GAG GCC AGC GGA ACC CTG AAG GAG CTG CAG GTG AAA CTC AAC AAT 4034 Ala Glu Ala Ser Gly Thr Leu Lys Glu Leu Gln Val Lys Leu Asn Asn 1325 1330 1335 GTC CTG GAT GAA CTC AGC CAC GTG TTT GCC ACC AGC TTC CAG CCA CAC 4082 Val Leu Asp Glu Leu Ser His Val Phe Ala Thr Ser Phe Gln Pro His 1340 1345 1350 ATC GAG GAG TGT GTC AGA CAA ATG GGT GAC ATC CTA AGC CAA GTG AAG 4130 Ile Glu Glu Cys Val Arg Gln Met Gly Asp Ile Leu Ser Gln Val Lys 1355 1360 1365 GGC ACG GGC AAC GTG CCC GCC AGT GCC TGC AGC AGC GTG GCA CAG GAC 4178 Gly Thr Gly Asn Val Pro Ala Ser Ala Cys Ser Ser Val Ala Gln Asp 1370 1375 1380 GCA GAC AAC GTG CTA CAG CCC ATC ATG GAT CTT CTG GAC AGC AAC CTC 4226 Ala Asp Asn Val Leu Gln Pro Ile Met Asp Leu Leu Asp Ser Asn Leu 1385 1390 1 395 1400 ACC CTG TTT GCC AAA ATC TGT GAG AAG ACG GTT CTG AAG CGG GTG CTG 4274 Thr Leu Phe Ala Lys Ile Cys Glu Lys Thr Val Leu Lys Arg Val Leu 1405 1410 1415 AAG GAG CTG TGG AAG CTG GTG ATG AAC ACC ATG GAG AGG ACC ATT GTC 4322 Lys Glu Leu Trp Lys Leu Val Met Asn Thr Met Glu Arg Thr Ile Val 1420 1425 1430 CTG CCG CCA CTC ACT GAC CAG ACG ATG ATG ATT GGT ACC CTC TTG AGA AAA 4370 Leu Pro Pro Leu Thr Asp Gln Thr Met Ile Gly Thr Leu Leu Arg Lys 1435 1440 1445 CAT GGC AAG GGC CTA GAA AAG GGC AGG GTG AAA CTG CCA AGC CAC TCA 4418 His Gly Lys Gly Leu Glu Lys Gly Arg Val Lys Leu Pro Ser His Ser 1450 1455 1460 GAC GGG ACA CAA ATG ATC TTC AAT GCC GCC AAG GAG CTG GGC CAG CTG 4466 Asp Gly Thr Gln Met Ile Phe Asn Ala Ala Lys Glu Leu Gly Gln Leu 1465 1470 1475 1480 TCC AAA CTG AAG GAT CAC ATG GTG CGA GAA GAA GCC AAG AGC TTG ACC45 Ser Lys Leu Lys Asp His Met Val Arg Glu Glu Ala Lys Ser Leu Thr 1485 1490 1495 CCG AAG CAG TGT GCC GTG GTT GAA CTG GCC CTG GAC ACC ATC AAG CAA 4562 Pro Lys Gln Cys Ala Val Val G lu Leu Ala Leu Asp Thr Ile Lys Gln 1500 1505 1510 TAC TTC CAC GCG GGG GGC GTG GGC CTC AAG AAG ACC TTT CTC GAG AAA 4610 Tyr Phe His Ala Gly Gly Val Gly Leu Lys Lys Thr Phe Leu Glu Lys 1515 1520 1525 AGC CCG GAC CTT CAG TCC CTG CGC TAC GCC CTG TCG CTC TAC ACA CAG 4658 Ser Pro Asp Leu Gln Ser Leu Arg Tyr Ala Leu Ser Leu Tyr Thr Gln 1530 1535 1540 GCC ACC GAC CTG CTC ATC AAA ACC TTC GTG CAG ACG CAG TCA GCG CAG 4706 Ala Thr Asp Leu Leu Ile Lys Thr Phe Val Gln Thr Gln Ser Ala Gln 1545 1550 1555 1560 GTC CAT GGT GGA AAG GGG ACT AGG TTT ACC CTT AGT GAA GAC GTT TGT 4754 Val His Gly Gly Lys Gly Thr Arg Phe Thr Leu Ser Glu Asp Val Cys 1565 1570 1575 CCT GAG ATG GGC TCG GGT GTG GAA GAC CCT GTA GGT GAA GTA TCC GTC 4802 Pro Glu Met Gly Ser Gly Val Glu Asp Pro Val Gly Glu Val Ser Val 1580 1585 1590 CAC GTG GAG CTG TTC ACG CAT CCG GGA ACT GGG GAA CAG AAG GTC ACA 4850 His Val Glu Leu Phe Thr His Pro Gly Thr Gly Glu Gln Lys Val Thr 1595 1600 1605 GTG AAG GTG GTG GCC GCC AAC GAC CTC AAG TGG CAG ACT TCT G GC ATC 4898 Val Lys Val Val Ala Ala Asn Asp Leu Lys Trp Gln Thr Ser Gly Ile 1610 1615 1620 TTC CGT CCG TTC ATT GAG GTC AAC ATC GTT GGA CCT CAG CTC AGC GAC 4946 Phe Arg Pro Phe Ile Glu Val Asn Ile Val Gly Pro Gln Leu Ser Asp 1625 1630 1635 1640 AAG AAA CGA AAG TTC GCC ACC AAA TCG AAA AAC AAC AGC TGG GCG CCC 4994 Lys Lys Arg Lys Phe Ala Thr Lys Ser Lys Asn Asn Ser Trp Ala Pro 1645 1650 1655 AAA TAT AAC GAG AGC TTC CAG TTC TCC CTG AGC GCC GAC GCG GGA CCC 5042 Lys Tyr Asn Glu Ser Phe Gln Phe Ser Leu Ser Ala Asp Ala Gly Pro 1660 1665 1670 GAG TGC TAC GAG TTG CAG GTG TGC GTG AAG GAC TAC TGC TTC GCG CGC 5090 Glu Cys Tyr Glu Leu Gln Val Cys Val Lys Asp Tyr Cys Phe Ala Arg 1675 1680 1685 GAG GAC CGC ACG GTG GAG CTG GCG GTG CTG CAG CTG CGG GAG CTG GCT 5138 Glu Asp Arg Thr Val Glu Leu Ala Val Leu Gln Leu Arg Glu Leu Ala 1690 1695 1700 CAG CGC GGG AGC GCC GCG TGC TGG CTG CCG CTC GGC CGC CGC ATC CAC 5186 Gln Arg Gly Ser Ala Ala Cys Trp Leu Pro Leu Gly Arg Arg Ile His 1705 1710 1715 1720 ATG GAC GAC ACG GGG CTC ACA GTG CTG CGT ATC CTG TCG CAG CGC AGC 5234 Met Asp Asp Thr Gly Leu Thr Val Leu Arg Ile Leu Ser Gln Arg Ser 1725 1730 1735 AAT GAC GAG GTG GCC AAG GAG TTC GTC AAG CTC AAG TCC GAC ACG CGC 5282 Asn Asp Glu Val Ala Lys Glu Phe Val Lys Leu Lys Ser Asp Thr Arg 1740 1745 1750 TCG GCC GAG GAG GGC GGT GCC GCG CCT GCG CCC TAG 5318 Ser Ala Glu Glu Gly Gly Ala Ala Pro Ala Pro 1755 1760

SEQ ID NO: 5 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCC TTCACATCAG TGTGGAGATC 30

SEQ ID NO: 6 Sequence length: 30 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCC ATGGGCGCAGGCGCGCACC
30

SEQ ID NO: 7 Sequence length: 31 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCG AGAAGGTGGC ACCCTACCAT G 31

SEQ ID NO: 8 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGCTTGGCA GTTTCACCCT GCC 33

SEQ ID NO: 9 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGGTGGCAA ACACGTGGCT GAG
33

SEQ ID NO: 10 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGAGTGCAC CATGCAGGAA GTC 33

SEQ ID NO: 11 Sequence length: 31 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCC TCGAGGGGGA CAAGAAGGAT G 31

SEQ ID NO: 12 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCA TGAAGCGACA TGGCCGGCGA 30

SEQ ID NO: 13 Sequence length: 32 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATAGCGCTC TTTCCCGAAA TTGGAGGCAG CG 32

SEQ ID NO: 14 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATAGCGCTA GCCACTCAGA CGGGACACAA ATG 33

SEQ ID NO: 15 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCC TAGGGCGCAG GCGCGGCACC 30

SEQ ID NO: 16 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCA TGAGGGGCCG CAGGGGCGAT 30

SEQ ID NO: 17 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGGCGGTGG CATCATCCGA GTC 33

SEQ ID NO: 18 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence: CATGAATTCT CACTCCGCAC CATCCTCAGG CGT 33

SEQ ID NO: 19 Sequence length: 33 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA sequence: CATGAATTCT CAGGGGAAGT AGTCAGAGAT CTG 33

SEQ ID NO: 20 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCA TGACCATCAA CATCCAGGAG 30

SEQ ID NO: 21 Sequence length: 30 Sequence type: nucleic acid Number of strands: single-stranded Topology: linear Sequence type: other nucleic acid Synthetic DNA Sequence: CATGAATTCA TCCAGGAGCA CATGGCCATC 30

SEQ ID NO: 22 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGATCTGGC GGATGGGCCG GAT 33

SEQ ID NO: 23 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCA TCAACGTGTG CCCCGGGCCC ATC 33

SEQ ID NO: 24 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCC AAGGCAAGCT GGAGTTTGAC 30

SEQ ID NO: 25 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGGCTGAGG ACAGAGCCCC
30

SEQ ID NO: 26 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acids Synthetic DNA Sequence: CATGAATTCA TGACCCTCCG GCGGCGCGGG GAG 33

SEQ ID NO: 27 Sequence length: 35 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGGCAGTGC AGTCGTCCGA CTCGT 35

SEQ ID NO: 28 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCG ACGATGCATG GAAGGTGTAC 30

SEQ ID NO: 29 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGAATTCT CAGGTGCCTG TCTGGTCAAT GAG 33

SEQ ID NO: 30 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCA TGAGGGGCCG CAGGGGCGAT 30

SEQ ID NO: 31 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCT CAGGCGGTGG CATCATCCGA GTC 33

SEQ ID NO: 32 Sequence length: 31 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCG AGAAGGTGGC ACCCTACCAT G 31

SEQ ID NO: 33 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCT CAGCTTGGCA GTTTCACCCT GCC 33

SEQ ID NO: 34 Sequence length: 48 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: AATTCGGTAC GATGTACCCA TACGACGTCC CAGACTACGC TGGTACCG 48

SEQ ID NO: 35 Sequence length: 48 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: GATCCGGTAC CAGCGTAGTC TGGGACGTCG TATGGGTACA TCGTACCG 48

SEQ ID NO: 36 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: GATCGATGGA GCAGAAGCTT ATCAGCGAGG AGGACCTGG 39

SEQ ID NO: 37 Sequence length: 39 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: GATCCCAGGT CCTCCTCGCT GATAAGCTTC TGCTCCATC 39

SEQ ID NO: 38 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCA TGAGGGGCCG CAGGGGCGAT 30

SEQ ID NO: 39 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCT CAGGCTGAGG ACAGAGCCCC 30

SEQ ID NO: 40 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCT CACTGCTCCA AGTCCTTCAG ATA 33

SEQ ID NO: 41 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCC TAGGCAGCT GGAGTTTGAC
30

SEQ ID NO: 42 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCA TGAAGCGACA TGGCCGGCGA 30

SEQ ID NO: 43 Sequence length: 30 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCC TAGGGCGCAG GCGCGGCACC 30

SEQ ID NO: 44 Sequence length: 31 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCG AGAAGGTGGC ACCCTACCAT G 31

SEQ ID NO: 45 Sequence length: 33 Sequence type: Number of nucleic acid strands: Single strand Topology: Linear Sequence type: Other nucleic acid Synthetic DNA Sequence: CATGGATCCT CAGCTTGGCA GTTTCACCCT GCC 33

[Brief description of the drawings]

FIG. 1 is a table showing the results of analysis of the binding region of Munc13-1 to Doc2α by the yeast two-hybrid method.

FIG. 2 is a table showing the results of analysis of the binding region of Doc2α to Munc13-1 by the yeast two-hybrid method.

FIG. 3 is a table showing the results of analyzing whether a Doc2 family protein binds to a Munc13 family protein by the yeast two-hybrid method.

FIG. 4 (a) Munc13-1-Did protein produced and purified in E. coli and Doc2α produced by in vitro translation
5 is a photograph of electrophoresis showing the results of an in vitro binding experiment of a deletion mutant protein and the mutant protein. (b) is a diagram showing Doc2α and its deletion mutant protein used in the binding experiment.

FIG. 5 (a) In vitro binding experiments of Doc2α-N-terminal protein (1-90 amino acids) prepared and purified in E. coli and Munc13-1 and its deletion mutant protein prepared by in vitro translation. It is an electrophoresis photograph showing a result. (b) shows Munc13-1 and deletion mutant proteins thereof used in the binding experiment.

FIG. 6 is an X-ray photograph showing the result of Western blot analysis showing that Doc2α and Munc13-1 bind to PC12 cells by immunoprecipitation.

FIG. 7 shows that Doc2α-Mid and Munc13-1-Did suppress calcium ion-dependent secretion in PC12 cells,
It is a figure which shows the result of having investigated by measuring the secretion amount of growth hormone.

Continued on the front page (51) Int.Cl. ⁶ Identification code FI C12P 21/02 C12P 21/02 C (C12P 21/02 C12R 1:91) (72) Inventor Takeshi Sakaguchi 13-16 Showacho, Suita-shi, Osaka Grand Shari Omikasa 301 (72) Inventor Yoshimi Takai 2-5-73 Gakuen Higashi-cho, Nishi-ku, Kobe-shi, Hyogo

Claims (20)

[Claims] 1. A method for screening a candidate substance for an agonist or an antagonist of the binding between Doc2α and Munc13, comprising the steps of: And selecting the candidate substance that increases or decreases the binding ability. 2. The method of claim 1, wherein the Doc2α or Doc2α analog is a fusion protein with a carrier protein. 3. The method of claim 1, wherein the Munc13 or Munc13 analog is a fusion protein with a carrier protein. 4. The method according to claim 1, wherein the Doc2α or Doc2α analog is Doc2α.
Amino acid sequence at positions 13 to 37 of α, amino acid sequence at positions 1 to 37 of Doc2α, amino acid sequence at positions 9 to 37 of Doc2α, Do
The polypeptide according to claim 1 or 2, which is a polypeptide comprising an amino acid sequence selected from the group consisting of the amino acid sequence of positions 1 to 78 of c2α, the amino acid sequence of positions 1 to 90 of Doc2α, and the entire amino acid sequence of Doc2α. The described method. 5. The method according to claim 1, wherein the Munc13 or Munc13 analog is Munc13.
A polypeptide comprising an amino acid sequence selected from the group consisting of the amino acid sequence of positions 851 to 1461 of 13-1, the amino acid sequence of positions 840 to 1743 of Munc13-1, and the entire amino acid sequence of Munc13-1. Item 4. The method according to item 1 or 3. 6. The Doc2α analog is located at positions 14 to 38 of Doc2β.
2. A polypeptide comprising the amino acid sequence at position 1.
The method described in. 7. The method according to claim 1, wherein the Munc13 analog is a polypeptide comprising the amino acid sequence at positions 1110 to 1695 of Munc13-2. 8. An agonist or antagonist of the binding between Doc2α and Munc13-1, obtained by the method according to any one of claims 1 to 7. 9. A method for inhibiting calcium ion-dependent secretion of neurotransmitters or hormones, comprising
Vector expressing c2α or Doc2α analog. 10. The Doc2α or Doc2α analog is Do
an amino acid sequence of positions 13 to 37 of c2α, an amino acid sequence of positions 1 to 37 of Doc2α, an amino acid sequence of positions 9 to 37 of Doc2α,
Amino acid sequence of positions 1 to 78 of Doc2α, positions 1 to 90 of Doc2α
The vector according to claim 9, which is a polypeptide comprising an amino acid sequence selected from the group consisting of the amino acid sequence at position 1 and the entire amino acid sequence of Doc2α. 11. The method according to claim 11, wherein the Doc2α or Doc2α analog is Do
The vector according to claim 9, which is a polypeptide having the amino acid sequence of positions 14 to 38 of c2β. 12. Use for inhibiting calcium ion-dependent secretion of a neurotransmitter or hormone,
A vector that expresses Munc13 or a Munc13 analog. 13. The Munc13 or Munc13 analog is Mu
Amino acid sequence at positions 851 to 1461 of nc13-1, 840 of Munc13-1
The vector according to claim 12, which is a polypeptide comprising an amino acid sequence selected from the group consisting of the amino acid sequence at positions 1 to 1743 and the entire amino acid sequence of Munc13-1. 14. The Munc13 or Munc13 analog is Mu
The vector according to claim 12, which is a polypeptide having the amino acid sequence of positions 1110 to 1695 of nc13-2. 15. A fusion protein of Doc2α or Doc2α analog and a carrier protein. 16. A fusion protein of Munc13-1 or a Munc13 analog and a carrier protein. 17. A polypeptide comprising the amino acid sequence of positions 13 to 37 of Doc2α and having a binding ability to Munc13-1, consisting of 90 or less amino acid residues. 18. A 904 comprising the amino acid sequence of positions 851 to 1461 of Munc13-1, and having a binding ability to Doc2α.
A polypeptide consisting of not more than amino acid residues. 19. A polypeptide which is a Doc2α analog and comprises 90 or fewer amino acid residues. 20. A polypeptide which is a Munc13 analog and comprises 904 or fewer amino acid residues.