JPH09252781A - Protein and its gene and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new protein comprising a nucleotide diphosphate kinase, etc., capable of inducing in a plant by sunshine or light irradiation and creating a high-quality plant having prolificacy by converting sensitivity of a plant to light by introduction of the gene. SOLUTION: This new protein such as nucleotide diphosphate kinase in a plant is obtained by being induced by sunshine or light irradiation and the gene is introduced into other plant cell. As a result, highquality plant having prolificacy can be created by converting sensitivity of the plant to light. The new protein is obtained by isolating mRNA by ordinary method from negative photoblastic young leaf of rice, synthesizing cDNA by using the mRNA as a template, preparing cDAN library, screening the library with a probe comprising a part of uncleotide diphosphate kinase gene, integrating the resultant cDNA into a vector and developing cDNA in a host cell.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a protein involved in plant growth and differentiation, and a gene encoding the protein. More specifically, the present invention has revealed that the nucleoside diphosphate is an optical signal transducer that receives and transmits a signal from an optical signal receptor that catches an optical signal, which is essential in the process of plant growth and differentiation. Kinase (ND
K) and the gene encoding the NDK. The present invention also relates to increasing production of plants using the NDK gene, maintaining the quality and a method thereof, and providing a plant transformed with the gene.

[0002]

2. Description of the Related Art The amount of sunshine on the ground is greatly affected by the weather. In high latitudes, sunshine hours are short. The amount of sunlight has a great influence on the harvest of plants, especially food plants and clothing plants. The plant responds to such external factors, light, temperature, drought, salt concentration, etc., to make various adaptive responses. During this process, various genes are expressed via the receptors for these external factors and their signal transducers, leading to the completion of the adaptive response. The plant thus decides when to flower by light (photoperiod) and temperature. In other words, it is no exaggeration to say that the change from leaf bud differentiation to flower bud differentiation in the apical meristem of the stem is determined by light and temperature.

[0003]

[Problems to be Solved by the Invention] In order to feed the population on the earth, which is increasing explosively, and to increase the population, the number of edible and clothing plants is increased more than ever before in the agricultural land of one of the planting areas. In order to harvest, it is necessary to create high-quality, high-productivity plants that proliferate more than ever, and this is an urgent issue for consideration. The purpose of the present invention is such high quality
It is to provide a technique for creating a prolific plant.

[0004]

From this situation, the present inventor has clarified the mechanism that operates in the plant body in response to sunlight and light irradiation, that is, the mechanism of the adaptive response of the plant to a light signal, and We planned a study to identify and identify the biological substances and factors involved. Then, the present inventors found that the red light signal from phytochrome was transmitted to the 15 kDa protein using the third internode of dark germinated Alaskan pea (Hamada, T. & Hasunuma, K .: J. Photochem. . Photob
iol. B. Biol., 24, 163-167, 1994). Also, blue light is 1
It was suggested to suppress the dephosphorylation of the 5 kDa protein (K.
Ito, T. Hamada & K. Hasunuma, J. Photochem. Photo
biol. B. Biol., 28, 223-227, 1995).

Based on these findings, the present inventors have further researched, and instead of natural sunshine, in response to irradiation of optical signals, that is, blue light or red light, especially red light, in the laboratory. If a protein that is a signal transducer that transmits a light signal from a photoreceptor that catches a light signal is purified and isolated from various proteins that are contaminated and identified, and the gene can be cloned, a recent genetic engineering technique will be available. Therefore, it is possible to produce a cultivar with a modified flower bud formation that shows an adaptive response different from that of existing cultivars.

The main reasons why red light is particularly selected in the present invention are as follows. Blue light acts to inhibit dephosphorylation of the 15 kDa protein, whereas red light promotes phosphorylation of the 15 kDa protein. In addition, the red light signal via phytochrome, which is a red light receptor, changes the timing of flower bud formation, but the blue light signal via the blue light receptor mainly controls the phototropism and Has little effect. Mutants ( hy1 , hy2, and hy6 ) that are unable to synthesize the chromophore of the red light receptor phytochrome are not able to receive red light, but flower bud formation is accelerated in Arabidopsis thaliana (J. Chory & RW). Susek, Arabido
psis, Cold Spr. Harb. Lab. Press, 1994).

The above findings mean that blue light and red light have different signal transmission paths. Two-dimensional electrophoresis revealed that 6 to 7 kinds of proteins to be phosphorylated were present at the site corresponding to 15 kDa.

The inventors of the present invention conducted intensive research to irradiate the following various plant species with this red light in a laboratory and identify a protein which is enhancedly expressed in response to it and a gene corresponding thereto. Then, the present inventors have previously found a new 15 kDa protein at a position slightly different from the electrophoretic position of a protein whose dephosphorylation is suppressed by blue light irradiation, and also at a position different by two-dimensional electrophoresis. Moreover, by cloning the gene encoding this protein, NDs found in rice, pea, Arabidopsis thaliana, spinach, etc.
It was clarified to be the base sequence of K and homolog.
That is, the present invention has succeeded in identifying and identifying a protein whose phosphorylation is promoted in a large number of plants by sunshine, particularly red light irradiation, and cDNA corresponding thereto, and further based on the findings, the use of the present invention. Clarified and completed the present invention. Hereinafter, the embodiments of the invention will be described in detail for each plant.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION

(A) Rice ( Oryza sativa ) was germinated at 25 ° C in the dark for 10 days. Red light was irradiated for 60 seconds at 0, 10, 50 μmole / m ² / sec, and 50 young leaves were cut with a razor. Immediately, it was placed in an ice-cooled mortar and ground with 5 ml of extraction buffer. After centrifugation,
The crude membrane fraction and the soluble fraction were phosphorylated with [γ- ³² P] ATP and fractionated by one-dimensional or two-dimensional electrophoresis. It was revealed that phosphorylation of two 15 kDa proteins with different pIs was promoted by red light irradiation. These were immunoprecipitated with an anti-rice NDK antibody and the 15 kDa protein was further purified and variously characterized and found to be NDK.

[0010] mRNA was prepared from dark germinated young leaves, and λZAPII
A cDNA library was prepared. PNDKN1 of the present invention isolated from the cDNA library in [Example 2] described later.
When the NDK cDNA was cloned using (SEQ ID NO: 1) as a probe, it was shown in Fig. 3 that the previously reported rice NDK c
DNA (A. Yano, T. Shimazaki, A. Kato, M. Umeda & HU
chimiya, Plant Mol. Biol. 23, 1087-1090, 1993). In addition, DNA was prepared from dark germinated young leaves by the CTAB method, cleaved with restriction enzymes EcoRI, BamH1, and HindIII, and Southern analysis was performed. As a result, multiple bands were detected.

(B) Alaskan pea ( Pisum sativum Alas
(ka) was germinated in the dark for 160 hours, 50 pieces were cut out between the third internodes of the epicotyl and placed in a mortar containing 5 ml of water. After 1 hour at 25 ° C., red light was irradiated for 0, 10, 50, 100 μmole / m ² / sec, 20 seconds. Immediately thereafter, the third internode was ground with 5 ml of extraction buffer and filtered through a nylon cloth. Membrane and soluble fractions were obtained by centrifugation. This was phosphorylated with [γ- ³² P] ATP, fractionated by one-dimensional and two-dimensional electrophoresis, and autoradiography was performed. It was revealed that phosphorylation of two 15 kDa proteins with different pIs was promoted by red light irradiation. These were immunoprecipitated with an anti-rice NDK antibody and proved to be NDK. The 15 kDa protein was purified and the partial amino acid sequence was determined.

MRNA was prepared from Section 3 and cDN was added to λZAPII.
A library was prepared. D from that cDNA library
NA was extracted by the CTAB method, and cDNA (PM Finan, IR White, SH Red isolated from pea ( Pisum sativum L.) was isolated.
path, JBC Findlay, PA Millner, Plant Mol. B
iol. 25, 59-67, 1994), NDK-P1 (shown in FIG. 1) was used as a primer, and amplified by PCR. Using it as a probe, PNDKN1 (SEQ ID NO: 1) was isolated from the cDNA library. In addition, DNA was extracted from green leaves by the CTAB method, cleaved with restriction enzymes EcoRI, BamH1, and HindIII, and Southern analysis was performed. The presence of multiple copies of the NDK gene was confirmed.

(C) Arabidopsis thaliana
) After infiltrating the seeds of wild strain and hy2 mutant strain,
It was grown in the light for 24 hours and in the dark for 6 days. About 100 hypocotyls are cut with a razor and divided into two 5 ml
The mixture was placed in a mortar containing the water of 1. and kept at 25 ° C for 1 hour. One kept in the dark (dark control), the other red light 100 μmol
Irradiation was performed at e / m ² / sec for 20 seconds. Drain water, grind with 2.5 ml of extraction buffer, squeeze with a nylon cloth, then 9000 × g 1
It was centrifuged for 0 minutes. The supernatant was centrifuged at 105,000 × g for 30 minutes to obtain a crude membrane fraction and a soluble fraction. Each fraction was phosphorylated with [γ- ³² P] ATP, subjected to one-dimensional and two-dimensional electrophoresis, and autoradiographed. Two spots where phosphorylation proceeded with 15 kDa red light were detected. This 15 kDa protein was stained with an anti-rice NDK antibody and confirmed to be NDK.

CDNA was cloned from a λgt11 cDNA library of Arabidopsis using PNDKN1 as a probe. Its nucleotide sequence (EMBL database X69376) was identical to that shown in FIG. In addition, DNA was prepared from the green leaves of Arabidopsis by the CTAB method. Restriction enzymes EcoRI, Ba
After cleaving the DNA with mH1 and HindIII, Southern analysis revealed genes with homology to multiple NDKs.

In Arabidopsis, the red photoreceptors contain phytochromes A and B, and it was reported that hy1 , hy2 , and hy6 mutations that do not have the activity cause early flower bud formation (J. Chory & R.
W. Susek, 1994). However, the blue light mutant has not been reported to affect flower bud formation. Therefore, it was concluded that red light is definitely involved in flower bud formation control. In this way, it was judged that it is possible to create plants that can be expected to have high productivity even with a little sunshine, by applying flowers early.

(D) 1 seed of wheat ( Triticum aestivum )
After soaking in running water for 2 hours, 3 liters of vermiculite
2 l of deionized water was added to and seeded on it. 25 ℃
Then, it was grown in the dark for 7 days. About 50 red light 0, 2,
Irradiated with 10, 50 μmole / m ² / sec for 60 seconds, and immediately after that, young leaves were excised with a razor. Below is the same analysis as for rice,
We found two 15 kDa proteins with different isoelectric points that are phosphorylated by red light. Using an anti-rice NDK antibody, it was confirmed by immunoprecipitation that this 15 kDa protein was NDK.

MRNA was extracted from the seeds of mature wheat and a cDNA library was prepared in λgt11. NDK cDNA was isolated using PNDKN1 as a probe, and its candidate clone was obtained. In addition, DNA was extracted from yellowed young leaves by the CTAB method, cleaved with restriction enzymes EcoRI, BamH1, and HindIII, and Southern analysis was performed. We confirmed the existence of genes that have similarities to multiple PND KN1.

(E) 1 seed of barley ( Hordeum vulgare )
It was infiltrated in running water for 2 hours. It was grown in vermiculite in the dark at 25 ° C for 10 days. Yellowed young leaves of about 100 individuals each are irradiated with red light for 0, 2, 10, 50 μmole / m ₂ / sec, 60 seconds,
Immediately after, I cut it off with a razor. Trituration with 5 ml of extraction buffer gave crude membrane and soluble fractions as in wheat. Phosphorylation was labeled with [γ- ₃₂ P] ATP, one-dimensional and two-dimensional electrophoresis was performed, and autoradiography was performed. pI
Of two spots where phosphorylation was promoted by two red lights of 15 kDa, which were different from each other, were detected. Since these phosphorylated proteins were immunoprecipitated with an anti-rice NDK antibody, they were confirmed to be NDK. MRNA was prepared from the above yellowed young leaves and λZA
A cDNA library was prepared in PII. CDNA candidate clones were isolated using PNDKN1 as a probe. DNA was extracted from young yellow leaves by the CTAB method and digested with restriction enzymes. Southern analysis identified the presence of genes that resemble multiple NDKs.

Using the same method, it was confirmed that the phosphorylation of the 15 kDa protein by the red light of the plants described below was promoted and that the protein was stained with the anti-rice NDK antibody. DNA was extracted from these plants by the CTAB method and the restriction enzyme Eco
It was cut with R1, BamH1, and HindIII. Using PNDKN1 as a probe, we confirmed the existence of multiple similar genes in all plants.

(F) Corn ( Zea mays ) (G) Oat ( Avena sativa ) (H) Flies ( Panicum Crus-galli L. var. Frumentaceum) (I) Sorghum ( Sorghum bicolor ) (J) Millet ( Setaria italica ) (K) Millet ( Panicum miliaceum ) (L) Tulip ( Tulipa Gesneriana ) (M) Taro ( Colocasia antiquorum ) (N) Duckweed ( Lemna paucicostata ) (O) Sugarcane ( Saccharum officinarum ) (P) Cotton ( GossypQ indicum ) ) Asa ( Cannabis sativa ) (R) Brassica campestris

(S) Cabra ( Brassica campestris ) (T) Cabbage ( Brassica oleracea ) (U) Japanese radish ( Raphanus sativus ) (V) European pumpkin ( Cucurbita Pepo ) (W) Pumpkin ( Cucurbita moschata ) (X) Cucumber ( Cucumis ) sativus ) (Y) Melon ( Cucumis Melo ) (Z) Watermelon ( Citrullus Battich )

(A) Dutch strawberries (Fragaria chiloensis
 ) (b) Azuki (Phaseolus angularis ) (c) Peanut (Arachis hypogaea ) (d) Soybean (Glycine max ) (e) common bean (Phaseolus vulgaris ) (f) Broad beans (Vicia Faba ) (g) Pea (Pisum sativum ) (h) mandarin orange (Citrus deliciosa ) (i) Grape (Vitis vinifera ) (j) sesame (Sesamum indicum ) (k) Sweet potato (Ipomoea Batatas ) (l) eggplant (Solanum melongena ) (m) potato (Solanum tuberosum ) (n) tomato (Lycopersicon esculentum ) (o) Capsicum (Capsicum annuum )

(P) Tobacco ( nicotiana tabacum ) (q) Tsukubae morning glory ( Petunia hybrida ) (r) Sunflower ( Helianthus annuus ) (s) Burdock ( Arctium Lappa ) (t) Chrysanthemum ( Chrysanthemum morifolium ) (u) Spinach ( Spinacia ) oleracea ).

The properties of the protein of the present invention are listed below. It has a molecular weight of 15 kDa and was purified to a single protein by two-dimensional electrophoresis. The pI is 6.0, and phosphorylation by [γ- ³² P] ATP promotes phosphorylation by red light.
Yielded 5.4. 2. This protein showed cross-reactivity with anti-rice NDK antibody, antibody against synthetic polypeptide using NDK common amino acid sequence, and anti-rat NDK antibody. 3. It was immunoprecipitated with anti-rice NDK antibody and anti-rat NDK antibody. 4. After singularization by two-dimensional electrophoresis, in gel or
It was autophosphorylated on PVDF membrane. 5. Phosphorylated amino acid residues included P-Ser and P-Tyr. 6. It was demonstrated that P-Ser and P-Tyr are present in the autophosphorylated protein, and that tyrosine kinase activity is present. 7. Purified NDK was phosphorylated with NDK, and it was mixed with NDK whose phosphorylation activity was increased by a red light signal and subjected to two-dimensional electrophoresis. Based on the above, the purified NDK was determined to be the NDK involved in red light signal transduction.

Based on the above findings, PNDKN1cD according to the present invention
NA encodes an NDK protein involved in red light signaling m
It was considered to be cDNA synthesized from RNA.

As shown in FIG. 3, those cloned by NDK and already reported were pea as a biological species.
( Pisum sativum ) (2 types), rice ( Oryza sativa ) (1
Seeds), spinach ( Spinacia oleracea ) (2 kinds),
Arabidopsis thaliana (1 species), tomato ( Lycopersicon esculentum ) (1 species), Drosophila melamogaster (1 species),
Humans ( Homo s apiens ) (2 types) and the like.

Although the plant has not been cloned in a large number of crop species such as wheat, barley and corn, the present invention identifies a 15 kDa protein of a large number of crop species expressed in response to light irradiation. It was confirmed that the genes encoding these proteins are NDK genes. The protein sequence of each crop species and the nucleotide sequence of the gene are easily determined. Then, plants are transformed with genes encoding these proteins or genes in which a part of them is replaced, deleted or added within a range that does not change the action, and the sensitivity to light is changed to change the flower bud formation time. It is possible to create a plant. With such a technique, a high-quality, high-productivity plant can be obtained.

[0028]

【Example】

Example 1 Rice ( Oryza sativa ) 1. Fir-removed seeds which had been infiltrated with running tap water for 12 hours were wound with 4 L of vermiculite and 2.8 L of water added thereto. It was grown in the dark at 25 ° C for 10 days. Manipulations of the study were performed under a weak green safety light or under infrared light using Noctovision. 2. 6 red light at 0, 2, 10 and 50 μmole / m ² / sec
Immediately after applying 0 second, 50 aboveground parts of yellowed young leaves were collected. 3.5 ml of extraction buffer A (type 1 or type 2) was placed in an ice-cooled mortar, and 50 yellowed young leaves were placed therein and ground 300 times. 4. A glass funnel was placed on a 50 ml centrifuge tube, a nylon cloth was placed on it, and the ground product was put in from above and squeezed and filtered. 5. Place the tube in an ice-cooled centrifuge rotor in the dark and
Centrifugation was performed at 0 rpm (9,000 xg) for 10 minutes at 4 ° C. 6. The supernatant was placed in a polycarbonate centrifuge tube and centrifuged in an ultracentrifuge rotor at 39,000 rpm (105,000 xg) for 30 minutes at 4 ° C. This supernatant was used as the soluble fraction. 7. Invert the centrifuge tube to remove the supernatant completely. Add 2.5 ml of Extraction Buffer B (Type 1 or Type 2),
Suspend well. Put in a Teflon homogenizer for 1 ml,
It was lightly suspended while rotating for 3 strokes and used as a crude membrane fraction.

[0029] The pH was adjusted to 7.8 with concentrated sulfuric acid. Immediately before use, a proteolytic enzyme inhibitor was used in an amount of 0.1 µm pepstatin A 10 mg / ml 70 µl 0.1 mM leupeptin 10 mg / ml 50 µl 0.5 mM PMSF 100 µl 50 mM in ethanol per 10 ml of extraction buffer.

The following extraction buffers were prepared in the same manner.

[0031] The pH was adjusted to 7.8 with concentrated sulfuric acid.

[0032] When controlling Ca ²⁺ , type 1 extraction buffers A and B were used.

8. A method for analyzing protein phosphorylation (experiments were carried out using infrared vision using Noct Vision). 4 μl, 5 × reaction solution (0.1 M PIPES (pH 6.4), 0.5 mM EDTA, 0.5 M NaC
l, 7.5 mM MgCl ₂ , 1 mM PMSF, 2.5 μCi / 4 μl [γ- ³² P] ATP
(3000 Ci / mmol)), 16 μl of soluble fraction (1000 μg protein / ml) or crude membrane fraction (1000 μg / ml) was added, RI labeled at 0 ° C. for 7 seconds or 15 seconds, and 20 μl of 2X SDS sample buffer The liquid was added to stop the reaction.

2X SDS sample buffer 125 mM Tris-HCl, pH 6.8 10% SDS 20 mM dithiothreitol 20% glycerin 0.008% (W / V) Bromophenol blue (BPB)

Electrophoresis was performed on a 9.5 to 20% SDS polyacrylamide gradient gel. Alternatively, electrophoresis was performed using Tricine SDS polyacrylamide. Furthermore, Tricine SDS
Electrophoresis was performed by a two-dimensional electrophoresis method using polyacrylamide gel. Ten. Electroblotting of protein on nitrocellulose membrane a) After completion of electrophoresis, the concentrated gel was removed, and the upper left side of the developed gel was cut out to make a mark. b) Place in a vat and add 100 ml of equilibration buffer (20 mM Tris, 2
00 mM glycine, pH 8.3 (is), 20% methanol,
1 ml of Bradford protein assay reagent (Bio-Rad) was added to 1% SDS) and shaken at room temperature for 1 hour. c) Blotting onto a nitrocellulose membrane (0.20 μm, Schleicher & Schuell) at 38 V in protein blotting buffer for 24 to 48 hours.

Protein blotting buffer (8 l
How) a 20 mM Tris 19.36 g 200 mM glycine 115.2 g (pH 8.3) and 8l with 20% methanol 1.6 l deionized water.

11. Autoradiography was taken. The gel part turned blue and the protein molecular weight marker was also clearly stained. The molecular weight of the RI labeled protein was determined on autoradiography. 12． Control of protein phosphorylation by red light and near-infrared light. Yellowed young leaves were dark control, red light irradiated, and also red light-
After continuous irradiation with near-infrared light, it was ground to obtain a crude membrane fraction and a soluble fraction. The proteins were phosphorylated with [γ- ³² P] ATP. The RI-labeled protein was subjected to two-dimensional electrophoresis with Tricine SDS electrophoresis as the second dimension, and autoradiography was performed. Two spots were observed for the 15 kDa protein in the crude membrane fraction, and phosphorylation activity was clearly increased by red light. Three types of 15 kDa proteins in the soluble fraction were found, and the phosphorylation promotion by red light was clearly increased. The 15 kDa protein whose phosphorylation was promoted by red light irradiation was strongly labeled at pH 5.4.

Purification and characterization of the 13.15 kDa protein Purification of the protein migrating at pI 6.0 by two-dimensional electrophoresis was performed. The crude extract was fractionated with (NH ₄ ) ₂ SO ₄ , and the precipitate was dialyzed and subjected to Q Sepharose FF chromatography.
The active fractions were pooled with a 0-0.2 M gradient elution of NaCl and subjected to a second round of Q Sepharose FF chromatography. The protein was precipitated with 70% (NH ₄ ) ₂ SO ₄ , the protein was recovered and dialyzed. This fraction was subjected to Toyopearl HW60S gel filtration to collect active peaks. Further, this was applied to a PBE94 isoelectric point column to obtain a fraction having its activity center around pI 6.0. This fraction contained a large amount of Coomassie blue-stained protein spots around pI 6.0.

14. Characterization of the purified NDK The purified NDK showed pI 6.0, and showed autophosphorylation ability in the gel in two-dimensional electrophoresis and on PVDF membrane. When proteins were extracted from the autophosphorylated spots in the gel and subjected to two-dimensional electrophoresis, NDK showed a total of 5 spots, one of which was labeled with RI, which promotes phosphorylation by light. It coincided with the spot of pI 5.4. Therefore, NDK (pI 6.0) is phosphorylated by the red light signal,
It is considered to be an RI-labeled 15 kDa protein (pI 5.4). Furthermore, when the protein is phosphorylated using the first Q sepharose fractionation and then immunoprecipitated with an anti-rice NDK antibody, two 15 kDa protein spots into which a light signal enters are both immunoprecipitated. When the first Q Sepharose fraction in the 15 kDa protein purification process was subjected to secondary source electrophoresis,
A 15 kDa protein was found that stained with 6 silver stain, all of which were stained with anti-rice NDK antibody. Among these 5 to 6 protein spots, the most electrophoresed ones migrated to the most alkaline side. The above results indicate that, of the two phosphorylated proteins into which the light signal enters, the strongly labeled pI5.4 can be considered to be the phosphorylated NDK, which is the most abundant.

15. Analysis of phosphorylated amino acids The first Q sepharose fraction of the 15 kDa protein was phosphorylated, subjected to two-dimensional electrophoresis and transferred to a PVDF membrane. Two RI-labeled spots, pI 5.4 and pI 5.2, were excised, acid digested and fractionated on PEI cellulose. Only P-Tyr, P-Thr, and P-Ser, which are stable to acid treatment, can be measured, but P-Tyr and P-Ser were clearly phosphorylated. Furthermore, the 15 kDa protein was subjected to two-dimensional electrophoresis without labeling, transferred to a PVDF membrane, and autophosphorylated. When analyzed in the same manner, P-Tyr and P-Ser were also identified as phosphorylated amino acids. So for the 15 kDa protein, pI
It was shown that P-Tyr of 6.0 was autophosphorylated.

16. Cloning of NDK cDNA Poly (A) RNA was prepared with guanidine thiocytenate from dark germinated young leaves grown for 10 days. For poly (A) RNA, an mRNA separation kit was used. ΛZAP using 5 μg of poly (A) RNA
-CDNA synthesis kit (stratagene) was used for the packaging reaction, and the package reaction used the package kit (Amersham) or Gigapack II (stratagene). PND KN1 cDNA according to the present invention
Was labeled with [α- ³² P] dCTP by the random primer method and used as a probe.

Plaques were made on E. coli , XL1-Blue MRF ', and the plaques were screened by a conventional method. 5
Rice NDK, which has obtained one candidate clone but has already been reported
It had the same nucleotide sequence as. 17． Southern analysis DNA was extracted from 2 g of the above yellowed young leaves by the CTAB method. It was cleaved with restriction enzymes EcoRI, BamH1 and HindIII and separated on 0.7% agarose gel. The DNA was transferred to Hybond N ⁺ membrane, and hybridization was performed using PNDKN1 as a probe. Multiple bands were detected, indicating the presence of a gene similar to PNDKN1.

Example 2 Case of Alaskan Pea ( Pisum sativum Alaska) 1. Approximately 450 Alaskan pea seeds 1 liter 1/10 diluted H
Place in oagland medium (7.5 ml of 15 × Hoagland medium added to 1 liter of deionized water) and infiltrate at 25 ° C. in the dark for 4 hours. The following operations were performed under a weak green safety light, or under infrared light using Noctovision. 2.2 liters of 1.5 / 10 diluted Hoagland medium (15 x Hoagland medium 2
8 ml was added to 2 l of deionized water) was put into a drainage wash vat (height 14 cm, 36 x 29 cm), and 3 l of vermiculite was added and stirred well. 3. 450 seeds of the infiltrated seeds were evenly sown, and 1 l of vermiculite was lightly overlaid thereon. Deionized water 0.8l
Was poured evenly over it to complete seeding. 4. The seeded poly vat was put in a large black plastic box, and a black lid which could keep air permeability was put on. 2m x
It was wrapped in a 2 m curtain, completely shielded from light, and allowed to grow for 160 hours, starting from seed infiltration at 24 to 25 ° C in the dark.

5. Cut off the epicotyl with a single-edged razor,
It was placed on a paper towel moistened with deionized water. The third internode (about 1 cm) was cut off with scissors. 5 ml of deionized water was set aside in a mortar or glass dish, and 50 third internodes were placed on it. Cover with aluminum foil, 25 ° C
I left it in the dark for an hour. 6. 5 ml of extraction buffer A (type 1 or type 2) was placed in an ice-cooled mortar. 7. Illuminate or hold in the dark during section 3 (dark control) and quickly remove water from mortar or glass dish with pipettor. Put between the third section in the mortar of ice-cold, strong, grinding quickly 300 times in prospect. Glass funnel 5
It was placed in a 0 ml centrifuge tube and covered with a nylon cloth. The grinding fluid was put into a nylon cloth, and the grinding fluid was squeezed out by a hand with surgical gloves. 8. Place the tube in an ice-cooled centrifuge rotor in the dark and
Centrifugation was performed at 0 rpm (9,000 xg) for 10 minutes at 4 ° C.

9. Put the supernatant in a polycarbonate centrifuge tube, and use an ultracentrifuge rotor at 39,000 rpm (105,000 × g), 30
Centrifuge at 4 ° C for min. This supernatant was used as the soluble fraction. Ten. The centrifuge tube was placed upside down and the supernatant was completely removed. Extraction buffer B (type 1 or type 2), 2.5 ml, was put therein and well suspended. It was put in a 1 ml Teflon homogenizer and lightly suspended while rotating for 3 strokes. 11． Analysis method of protein phosphorylation (experiment with infrared vision using Noctovision) 4 μl, 5 × reaction solution (0.1 M PIPES (pH 6.4), 0.5 mM EDT
A, 0.5 M NaCl, 7.5 mM MgCl ₂ , 1 mM PMSF, 2.5 μCi / 4
μl [γ- ³² P] ATP (3000 Ci / mmol)) soluble fraction (1000 μg
16 μl of protein / ml) or crude membrane fraction (1000 μg / ml) was added, RI labeled at 0 ° C. for 7 seconds or 15 seconds, and 20 μl of 2XSD.
The reaction was stopped by adding S sample buffer.

Electrophoresis was performed on a 12.5 to 20% SDS polyacrylamide gradient gel. After that, I already mentioned [α- ³²
Use the same formulation as for the P] NTP binding analysis. Alternatively, electrophoresis is performed using Tricine SDS polyacrylamide. Further, electrophoresis is performed by a two-dimensional electrophoresis method using Tricine SDS polyacrylamide gel. 13. Control of protein phosphorylation by red light and near-infrared light Dark control, red light irradiation, and red light-
After continuous irradiation with near-infrared light, it was ground to obtain a crude membrane fraction and a soluble fraction. The proteins were phosphorylated with [γ- ³² P] ATP. The RI-labeled protein was subjected to two-dimensional electrophoresis with Tricine SDS electrophoresis as the second dimension, and autoradiography was performed. Two spots were observed on the 15 kDa protein in the crude membrane fraction, and phosphorylation activity was clearly increased by red light, and phosphorylation was suppressed by continuous irradiation of red light-near infrared light. Three types of 15 kDa proteins in the soluble fraction were found, and the promotion of phosphorylation by red light was clearly increased, but the inhibition of phosphorylation of those proteins by near infrared light was not so clear. The strongly labeled 15 kDa protein whose phosphorylation was promoted by red light irradiation was pI 5.4.

Purification and characterization of the 14.15 kDa protein Purification of the protein migrating at pI 6.0 by two-dimensional electrophoresis was performed. The crude extract was fractionated with (NH ₄ ) ₂ SO ₄ , and the precipitate was dialyzed and subjected to Q Sepharose FF chromatography.
The active fractions were pooled with a 0-0.2 M gradient elution of NaCl and subjected to a second round of Q Sepharose FF chromatography. The protein was precipitated with 70% (NH ₄ ) ₂ SO ₄ , the protein was recovered and dialyzed. This fraction was subjected to Toyopearl HW60S gel filtration to collect active peaks. Further, this was applied to a PBE94 isoelectric point column to obtain a fraction having its activity center around pI 6.0. This fraction contained a large amount of Coomassie blue-stained protein spots around pI 6.0. This spot was identified as Alaskan pea PNDK1 from the partial sequence of amino acids.

15. Characterization of the purified NDK The purified NDK showed pI 6.0, and showed autophosphorylation ability in the gel in two-dimensional electrophoresis and on PVDF membrane. When proteins were extracted from the autophosphorylated spots in the gel and subjected to two-dimensional electrophoresis, NDK showed a total of 5 spots, one of which 22 was labeled with RI, which promotes phosphorylation by light. It coincided with the spot of pI 5.4 that was performed. Therefore, it was considered that NDK (pI 6.0) was phosphorylated by the red light signal to become the RI-labeled 15 kDa protein (pI 5.4). Furthermore, when the protein was phosphorylated using the first Q Sepharose fractionation and then immunoprecipitated with an anti-rice NDK antibody, two 15 kDa protein spots into which a light signal was received were both immunoprecipitated.

When the first Q sepharose fraction in the purification process of the 15 kDa protein was subjected to two-dimensional electrophoresis, a 15 kDa protein stained with seven silver stains was found, all of which were anti-rice.
Stained with NDK antibody. Of these seven protein spots, the protein that migrates to the most alkaline side and is present in a large amount (pI 6.0) is the PNDKN1 protein. The correspondence between the seven protein spots and the autophosphorylation spot of PNDKN1 is pI.
Not very clear except for 6.0. The above results indicate that, of the two phosphorylated proteins into which the light signal enters, the strongly labeled pI5.4 (on the left side) may be considered to be the phosphorylated PNDKN1.

16. Analysis of phosphorylated amino acids The first Q sepharose fraction of the 15 kDa protein was phosphorylated, subjected to two-dimensional electrophoresis and transferred to a PVDF membrane. Two RI-labeled spots, pI 5.4 and pI 5.2, were excised, acid digested and fractionated on PEI cellulose. Only P-Tyr, P-Thr, and P-Ser, which are stable to acid treatment, can be measured, but P-Tyr and P-Ser were clearly phosphorylated. Furthermore, the 15 kDa protein was subjected to two-dimensional electrophoresis without labeling, transferred to a PVDF membrane, and autophosphorylated. When analyzed in the same manner, P-Tyr and P-Ser were also identified as phosphorylated amino acids. Furthermore, immunoprecipitation was performed using an antibody against P-Tyr, and it was confirmed to be P-Tyr.
Therefore, it was confirmed that P-Tyr of the 15 kDa protein with pI 6.0 was autophosphorylated.

17. CDNA cloning and amino acid sequence of PNDKN1 After leaving the third internode in the dark at 25 ° C. for 1 hour, it was irradiated with red light and immediately after that, poly (A) RNA was prepared. From that, a cDNA library was prepared in a λZAPII cloning vector.
PCR primers were prepared and PCR amplification was performed using the cDNA prepared from the cDNA library. Amplified DN
A was labeled with RI, and NDK cDNA candidates were screened. Nine clones were sequenced from both sides three times, and their nucleotide sequences were determined. The nucleotide sequence of the cDNA named PNDKN1 is shown in FIGS. PNDKN1 is already reported NDK-
Different from P1 by 13 bases, the glutamic acid at the 140th position in 149 amino acids is glutamine in the protein coding region. P
The actual amino acid sequence of the NDKN1 protein was partially determined (SEQ ID NO: 2). ND isolated from pea chloroplasts
KcDNA has been reported (J. Luebeck & J. Soll, Plant
a, 196 , 668-673, 1995), and amino acid sequence homology was 59%.

18. Southern analysis using PNDKN1 DNA was extracted by the CTAB method from 2 g of the third node between dark germinated epicotyls. After cutting the DNA with the restriction enzymes EcoR1, BamH1, and HindIII, 20 μg of the DNA fragment was electrophoresed on a 0.7% agarose gel and separated. After transfer of HybondN ⁺ membrane, [α- ³² P] dCTP
Thus, a probe was prepared using PNDKN1 as a template. As a result of hybridization, it was confirmed that multiple PND KN1s themselves and their similar genes were present.

Example 3 In the case of Arabidopsis thaliana 1. 1/10 diluted Hoagland medium (1.5% agar) was autoclaved and dispensed into sterile 15 cm plastic petri dishes in 50 ml aliquots. 2. Seeds were infiltrated with sterile water for 6 hours and washed again with sterile water. 3. Spread about 100 seeds on a dish. It was kept at 25 ° C under bright light for 24 hours, and then germinated for 6 days in the dark at 25 ° C. 4. Cut off about 100 germinated hypocotyls with a razor,
It was placed in a mortar containing 5 ml of water. The lid was covered with aluminum foil and left at 25 ° C in the dark for 1 hour. 5. 5 ml of extraction buffer A (type 1 or type 2) was placed in an ice-cooled mortar.

6. Red light 10, 50, 100 μmole on hypocotyl
Irradiation / m2 / sec for 40 seconds or kept in the dark (dark control), the water in the mortar was quickly removed with a pipettor. Place section 3 in an ice-cooled mortar to make it strong and quick
300 times was ground to a prospect. The glass funnel was placed in a 50 ml centrifuge tube and a nylon cloth was placed on it. The grinding liquid was put into a nylon cloth, and the grinding liquid was squeezed out. 7. Place the tube in an ice-cooled centrifuge rotor in the dark and
Centrifugation was performed at 0xg for 10 minutes at 4 ° C. 8. The supernatant was placed in a polycarbonate centrifuge tube and centrifuged in an ultracentrifuge rotor at 39,000 rpm (105,000 xg) for 30 minutes at 4 ° C. Generally this supernatant was used as the soluble fraction.

9. The centrifuge tube was placed upside down and the supernatant was completely removed. Extraction buffer B (type 1 or type 2),
2.5 ml was added and well suspended. It was put in a 1 ml Teflon homogenizer, lightly suspended while rotating for 3 strokes, and used as a crude membrane fraction. Ten. The crude membrane fraction and the soluble fraction were fractionated in the same manner as described in Example 1. In the wild strain, spots of two phosphorylated phosphorylation proteins of 15 kDa were observed in red light. However
In the hy2 mutant, promotion of phosphorylation of two spots was not observed. 11． After phosphorylation labeling with ³² P, immunoprecipitation was performed using an anti-rice NDK antibody. The two spots were confirmed to be NDK by immunoprecipitation with anti-rice NDK antibody. 12． NDK partially purified from dark germinated hypocotyls of the wild strain was separated by two-dimensional electrophoresis. After transfer to PUDF membrane, [γ- ³² P] ATP
Autophosphorylated with. Autophosphorylation of at least one spot was seen. 13. The autophosphorylated amino acids at that spot are P-Ser and PT.
It was yr.

14. Arabidopsis wild strain (Landsberg) P
cDNA prepared from oly (A) RNA was ligated to λgt11 to prepare a cDNA library. Plaques were screened using PNDKN1 as a probe to obtain 6 clones. The clones were sequenced and all were identical to those previously reported. 15． DNA was prepared by the CTAB method from a sterile liquid culture of dark germination of a wild strain. Cleaved with restriction enzymes EcoR1, BamH1, and HindIII, electrophoresed on 0.7% agarose gel, and then Hybond N ⁺ memb
It was transcribed to rane and subjected to Southern analysis using PNDKN1 as a probe. Multiple bands were detected, indicating that there are multiple genes that are similar to PNDKN1.

Example 4 Wheat ( Triticum aestivum ) 1. After soaking the seeds in running water for 12 hours, 3 l of vermiculite was added with 2 l of deionized water, mixed well, and then sown. 2. It was grown in the dark at 25 ° C for 10 days. About 50 red light
Irradiation was performed at 0, 2, 10, 50 μmole / m ² / sec for 60 seconds, and immediately after that, young leaves were excised with a razor. 3. Grind in the same way as for rice, 9,000 × g 10
Minutes were centrifuged. The supernatant is further added to 105,000 × g 30
The crude membrane fraction and the soluble fraction were obtained by centrifugation for minutes. 4. Each fraction was phosphorylated with [γ- ³² P] ATP and fractionated by two-dimensional electrophoresis. We have found a 15 kDa protein that exhibits two different isoelectric points that undergo phosphorylation with red light. 5. Each fraction was phosphorylated and immunoprecipitated using an anti-rice NDK antibody. By immunoprecipitation of the two 15 kDa proteins, it was confirmed that these two 15 kDa proteins are NDK.

6. The partially purified NDK fraction was further fractionated by two-dimensional electrophoresis. In gel and after transfer to PUDF membrane,
Autophosphorylation was performed with [γ- ³² P] ATP. At least three spots were found to be autophosphorylated on the 15 kDa protein, one of which was segregated at the same site where phosphorylation was promoted by light. 7. Phosphorylated amino acid analysis of autophosphorylated spots on PVDF film revealed P-Ser and P-Tyr. 8. Poly (A) RNA was prepared in the same manner as in [Example 1] from the ripening process of wheat seeds. A cDNA library was prepared by preparing a cDNA from the poly (A) RNA and binding it to λgt11. Screening was performed using PNDKN1 as a probe.
Eight clones were obtained and confirmed to be NDK candidate clones. 9. DNA was extracted from 2 g of young yellow leaves by the CTAB method. It was cleaved with restriction enzymes EcoR1, BamH1, and HindIII, and separated by 0.7% agarose gel electrophoresis. DNA to Hybond N ⁺ membrane
Then, it was transcribed to and subjected to Southern analysis using PNDKN1 as a probe. Multiple bands were detected and multiple similar genes to PNDKN1 were identified.

Example 5 Barley ( Hordeum vulgare ) 1. Seeds were infiltrated in running water for 12 hours. As with wheat, it was germinated and grown on vermiculite in the dark at 25 ° C for 10 days. 2. Red light 0, 2, 10, 50μ on yellowed young leaves of about 50 individuals
It was irradiated with mole / m ₂ / sec for 60 seconds, and immediately after that, it was cut with a razor. The mixture was ground with 5 ml of extraction buffer A, squeezed with a nylon cloth, and then centrifuged at 9,000 × g for 10 minutes. The supernatant was further centrifuged at 105,000 × g for 30 minutes to obtain a crude membrane fraction and a soluble fraction as in rice. 3. Phosphorylation labeling was performed with [γ- ³² P] ATP as in [Example 1], and separation was performed by two-dimensional electrophoresis. Two 15 kDa proteins whose phosphorylation was promoted by red light were detected.

4. Two phosphorylated proteins were detected by immunoprecipitation of the phosphorylated re-fractionated with anti-rice NDK antibody. These two 15 kDa proteins were identified as NDK. 5. The partially purified NDK fraction was fractionated by two-dimensional electrophoresis. At least one spot in the gel and on the PDF film was autophosphorylated by [γ- ³² P] ATP. 6. Two-dimensional electrophoresis of NDK auto-phosphorylated in the gel reveals at least three spots.
The spot that was most strongly phosphorylated was migrated to the same spot as the spot where phosphorylation was promoted by red light. 7. In addition, P-Ser and P-Tyr were detected by the phosphorylated amino acid analysis of the protein autophosphorylated on the PVDF membrane. 8. Poly (A) RNA was prepared from the above-mentioned young leaves of yellow leaves, and a cDNA library was prepared at λgt11 in the same manner as in [Example 1]. Screening was performed using PNDKN1 as a probe.
Six clones were obtained and confirmed to be NDK candidate clones. 9. As in the case of [Example 1], DNA was extracted from yellowed young leaves by the CTAB method. Restriction enzymes EcoRI, BamH1, HindIII
Cleavage was performed and the fractions were separated on a 0.7% agarose gel. Hybo DNA
It was transferred to a nd N ⁺ membrane and hybridized using PNDKN1 as a probe. Detect multiple bands,
It was confirmed that there are multiple genes similar to PND KN1.

Using the same method as described below, promotion of phosphorylation of 15 kDa protein by plant red light described below and anti-NDK
The detection of the 15 kDa protein was confirmed by immunoprecipitation with the antibody. In particular, since the tissues used for analysis differed for each plant, only the characteristic parts were entered. DNA was extracted from each tissue by the CTAB method and digested with restriction enzymes EcoRI, BamH1 and HindIII. Southern analysis was performed using PNDKN1 as a probe. All confirmed the presence of multiple genes similar to PND KN1.

Example 6. Maize ( Zea mays ) Yellow germinated germinated in the dark 7. Avena sativa 〃 8. Flies ( Panicum Crus-galli L. var. Frumentaceum) 〃 9. Sorghum bicolor 〃 10. Millet ( Setaria italica ) 〃 11. Millet ( Panicum miliaceum ) 〃 12. Tulipa Gesneriana 〃 13. Taro ( Colocasia antiquorum ) 〃 14. Duckweed ( Lemna paucicostata ) Leaves left in the dark for 1 hour 15. Sugar cane ( Saccharum officinarum ) yellow seedlings 16. Cotton ( Gossypium indicum ) 〃 17. Cannabis sativa 〃 18. Brassica campestris 〃 19． Turnip ( Brassica campestris ) 〃

20. Cabbage ( Brassica oleracea ) 〃 21. Japanese radish ( Raphanus sativus ) 〃 22. Cucurbita Pepo 〃 23. Pumpkin ( Cucurbita moschata ) 〃 24. Cucumber ( Cucumis sativus ) 〃 25. Melon ( Cucumis Melo ) 〃 26. Watermelon ( Citrullus Battich ) 〃 27. Dutch strawberries ( Fragaria chiloensis ) Young leaves left in the dark for 1 hour 28. Azuki ( Phaseolus angularis ) yellowing seedlings 29. Peanut ( Arachis hypogaea ) 〃 30. Soybean ( Glycine max ) 〃 31. Common bean ( Phaseolus vulgaris ) 〃 32. Broad bean ( Vicia Faba ) 〃 33. Pea ( Pisum sativum ) 〃

34. Mikan ( Citrus deliciosa ) Young leaf left in the dark for 1 hour 35. Grape ( Vitis vinifera ) 〃 36. Sesamum indicum yellow seedlings 37. Sweet potato ( Ipomoea Batatas ) Young leaves left in the dark for 1 hour 38. Eggplant ( Solanum melongena ) 〃 39. Potato ( Solanum tuberosum ) 〃 40. Tomato ( Lycopersicon esculentum ) Yellow seedling 41. Capsicum annuum 〃 42. Tobacco ( Nicotiana tabacum ) 〃 43. Tsukubane morning glory ( Petunia hybrida ) 〃 44. Sunflower ( Helianthus annuus ) 〃 45. Burdock ( Arctium Lappa ) 〃 46. Chrysanthemum ( Chrysanthemum morifolium ) 〃 47. Spinach ( Spinacia oleracea ) For Examples 6 to 47, the same analysis as in Examples 1 to 5 was performed, and similar results were obtained.

[0065]

【The invention's effect】

1. When the wild-type cDNA of NDK defined in the present invention is overexpressed in each plant, the plant becomes hypersensitive to red light, and the cDNA is modified to overexpress an inactive NDK in the plant. If so, the plant becomes less sensitive to red light. Therefore, it is possible to change the timing of planting flower buds of each plant. 2. PNDKN1 newly provides a template DNA for probe preparation for isolation of NDK cDNA from various crop species. 3. PNDKN1 is expressed in Escherichia coli in a large amount to provide a large amount of protein that is the basis of antibody production. 4. It also provides an important probe for the isolation of genomic DNA of many crop species. 5. Using the protein of the present invention and its gene, the ND
Inactive ND by overexpressing K and modifying a part of NDK
By overexpressing K, the sensitivity of plants of the present invention to light can be altered. By this method, the timing of flower bud formation of the plant can be changed and the creation of a new plant can be achieved.

[0066]

[Sequence list]

SEQ ID NO: 1 Sequence length: 629 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA to mRNA Origin: Alaska pea ( Pisum sativum Alaska) Sequence ACAGAGACCAAGATGGCCGAGCAAACTTTCATCATGATCAAGCCCGAT 48 GGCGTTCAAAGAGGCATAGCAGTAGTCGCATAGAGTGGCAGATGAAGCAG TTGTCTGCAAAGCCTTTCTTTAGTGGATTGGTGGATTACATTATCTCTGGCCCTGTTGTT 228 GCCATGATCTGGGAGGGTAAGAATGTTGTGACAACCGGAAGAAAGATAATTGGTGCCACA 288 AACCCTGCTCAATCTGAGCCTGGAACTATCCGTGGTGACTTTGCCATTGACATTGGCAGG 348 AATGTTATTCATGGAAGTGATGCTGTTGAAAGTGCTAACAAGGAAATTGCTCTGTGGTTC 408 CCTGAGGGTGCTGCTAACTGGCAAAGCAGCCTTCACTCTTGGATCTACGAGTAAAGATGA 468 AATATGTGGTTGATTTTGAATATGCCCTATTTTGATCTGTTAAATTTTATTAAGTCTGGT 528 ATGTGTCTTGGTTTGGATGTCAAGTCTCTTTATGTTGTTTCTGTTGAAACATTTTCACAG 588 TTTGATTATTCAAATCGAAATCTAGTTTTGCTTTGAAAAAA 629

[0067]

[Sequence list]

SEQ ID NO: 2 Sequence length: 149 Sequence type: Amino acid Topology: Linear Sequence type: Protein Origin: Alaska pea ( Pisum sativum Alaska) Sequence Met Ala Glu Gln Thr Phe Ile Met Ile Lys Pro Asp Gly Val Gln 15 Arg Gly Leu Val Gly Glu Ile Ile Ser Arg Phe Glu Lys Lys Gly 30 Phe Tyr Leu Lys Gly Leu Lys Phe Val Asn Val Glu Arg Ala Phe 45 Ala Glu Lys His Tyr Ala Asp Leu Ser Ala Lys Pro Phe Phe Ser 60 Gly Leu Val Asp Tyr Ile Ile Ser Gly Pro Val Val Ala Met Ile 75 Trp Glu Gly Lys Asn Val Val Thr Thr Gly Arg Lys Ile Ile Gly 90 Ala Thr Asn Pro Ala Gln Ser Glu Pro Gly Thr Ile Arg Gly Asp 105 Phe Ala Ile Asp Ile Gly Arg Asn Val Ile His Gly Ser Asp Ala 120 Val Glu Ser Ala Asn Lys Glu Ile Ala Leu Trp Phe Pro Glu Gly 135 Ala Ala Asn Trp Gln Ser Ser Leu His Ser Trp Ile Tyr Glu 149

[Brief description of drawings]

[1] Alaska pea (Pisum sativum Alasak) of dark germinating on hypocotyl information of the nucleotide sequence of cDNA, designated isolated PNDKN1 was as from a cDNA library prepared from mRNA between Section 3 pea (Pisum sativum LDK) is a cDNA isolated from NDK-P1 (PM Finan, IR White, S.
H. Redpath, JBC Findlay, PA Millner, Plant
Mol. Biol. 25, 59-67, 1994), and is a diagram in which * is a common part.

FIG. 2 is a diagram in which the information on the amino acid sequence deduced from the nucleotide sequence encoded by PNDKN1 cDNA and the deduced amino acid sequence of NDK-P1 are shown together.

[Fig. 3] PN of Alaskan pea ( Pisum sativum Alaska)
It is the figure which compared the amino acid sequence estimated from DKN1 cDNA, and the amino acid sequence estimated from other NDK cDNAs already cloned, and * mark is a common part. Rice; Oryza sativa , Spinach; Spinacia oleracea , To
mato; Lycopersicon esculentum , Arabidopsis; Arabid
opsis thaliana , Drosophila; Drosophila melamogaste
r , Human; Homo sapiens

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical indication C12N 9/12 C12N 5/00 C

Claims (10)

[Claims] 1. A protein in a plant obtained by being induced by sunlight or light irradiation. 2. The protein according to claim 1, which is a nucleoside diphosphate kinase. 3. The protein according to claim 1, wherein the plant is a monocotyledonous plant. 4. The protein according to claim 1 or 2, wherein the plant is a dicotyledon. 5. The monocotyledonous plants are rice ( Oryza sativa ), wheat ( Triticum aestivum ), and barley ( Hordeum vulgare ).
), Corn ( Zea mays ), oats ( Avena sativa )
), Millet ( Panicum Crus-galli L. var. Frumentaceum
), Sorghum ( Sorghum bicolor ), millet ( Setaria itali
ca ), millet ( Panicum miliaceum ), tulip ( Tulip
a Gesneriana ), taro ( Colocasia antiquorum ),
Duckweed ( Lemna paucicostata ) or sugarcane
( Saccharum officinarum ) The protein of claim 3. 6. The dicot is cotton (Gossypium indicum
 ), Asa (Cannabis sativa ), Canola (Brassica camp
estris ), Turnip (Brassica campestris ), Cabbage (B
rassica oleracea), Japanese radish (Raphanus sativus),
Pumpkin (Cucurbita Pepo ),Pumpkin(Cucurb
ita moschata ), Cucumber (Cucumis sativus ),melon(C
ucumis Melo ),watermelon(Citrullus Battich ), Oran
Dastrawberry (Fragaria chiloensis ), Arabidopsis (Ara
bidopsis thaliana ), Alaska Pea (Pisum sativu
m Alaska), Azuki (Phaseolus angularis ), Nankin
Bean (Arachis hypogaea ), Soybean (Glycine max ),I
Green beans (Phaseolusvulgaris ), Broad beans (Vicia Fab
a ),pea(Pisum sativum ),Orange(Citrus delic
iosa ), Grape (Vitis vinifera ),Gum(Sesamum indi
cum ),sweet potato(Ipomoea Batatas ),eggplant(Solanum
melongena ),potato(Solanum tuberosum ), Thomas
To (Lycopersicon esculentum ), Capsicum (Capsicum
annuum ),tobacco(Nicotiana tabacum ), Tsukubanasa
Gao (Petunia hybrida ),Sun Flower(Helianthus annuus
 ), Burdock (Arctium Lappa ), Chrysanthemum (Chrysanthemum mor
if olium ) Or spinach (Spinacia oleracea )so
The certain protein of claim 4. 7. The protein according to claim 1, wherein the light irradiation is red light irradiation. 8. A gene encoding the protein according to any one of claims 1 to 7. 9. A gene encoding the protein of claim 2 comprising the nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence substituted, deleted or added within a range that does not change its action. 10. A plant transformed with the gene of claim 8 or 9 or a gene containing a nucleotide sequence substituted, deleted or added within a range that does not change its action.