JPH09224662A - 6-phosphogluconate dehydrogenase and dna capable of coding the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To isolate the above enzyme, derived from a coryneform bacterium and capable of catalyzing a pentose phosphate cycle according to a gene recombination technique. SOLUTION: This phosphogluconate dehydrogenase has an amino acid sequence represented by the formula. The enzyme is obtained by expressing a DNA (hereinafter referred to as a gnd gene), isolated and determined from a chromosomal DNA of a Brevibacterium flavum ML-233 (FERM BP-1497) strain, etc., and capable of coding the 6-phosphogluconate dehydrogenase in a coryneform bacterium. When the eoryneform bacterium is transformed with the gnd gene, a bacterium capable of highly producing the glucose 6 phosphate dehydrogenase is obtained.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to 6-phosphogluconate dehydrogenase and DNA encoding the same.

[0002]

2. Description of the Related Art 6-Phosphogluconate dehydrogenase is an enzyme of the pentose phosphate cycle and oxidizes and decarboxylates 6-phosphogluconate to form D-ribulose-5-.
It is a catalyst for irreversible reactions that produce phosphoric acid. Regarding the gene encoding 6-phosphogluconate dehydrogenase, Escherichia coli (Escherichia coli) is known in prokaryotes.
ichia coli) -derived gene [Gene, V
ol. 27, p. 253 (1984)], Bacillus
A gene derived from Bacillus subtilis [J. Biol. Chem. , Vol. 2
61, p. 13744 (1986)], Synechococcus sp. Stra.
in PCC7942) -derived gene [J. Bact
eriol. , Vol. 172, p. 4023 (1
990)] and the like, and its base sequence has been determined.

However, no enzyme protein and its nucleotide sequence have been reported for industrially important coryneform bacteria such as amino acid synthesis.

[0004]

Generally, if the origin is different, the enzyme gene is not or hardly expressed in the host. Therefore, it encodes 6-phosphogluconate dehydrogenase derived from coryneform bacterium which can be expressed in coryneform bacterium. It has been desired to isolate a DNA fragment that

[0005]

Means for Solving the Problems As a result of intensive studies to solve the above problems, the present inventors have made full use of gene recombination techniques to produce 6-phosphogluconate dehydrogenase and its derivative from coryneform bacteria. The inventors have found that the DNA encoding the protein can be isolated, and completed the present invention. That is, the gist of the present invention is 6-phosphogluconate dehydrogenase represented by the amino acid sequence of SEQ ID NO: 1 in the sequence listing, and DNA encoding the same.
Exists.

[0006]

BEST MODE FOR CARRYING OUT THE INVENTION The 6-phosphogluconate dehydrogenase of the present invention and the DNA encoding the same (hereinafter, referred to as
abbreviated as gnd gene) is a chromosome D of a coryneform bacterium.
NA, specifically Brevibacterium flavum (B
revibacterium flavum) MJ-2
33 (FERM BP-1497) strain and other chromosomal DNA
Can be isolated and determined by the method described below.

First, the coryneform bacterium is treated by a conventional method [eg,
See Japanese Patent Application Laid-Open No. 51-130592],
Cells are collected from the culture and chromosomal DNA is extracted from the cells. Chromosomal DNA can be obtained, for example, from JP-A-5-15378.
It can be easily extracted from the cells by the method described in Example 1 (A) of the publication. Oligodeoxyribonucleotides reverse-translated from a highly homologous portion of the primary structure of 6-phosphogluconate dehydrogenase such as Escherichia coli are used as a polymerase chain reaction (P
CR) can be performed to obtain a partial fragment of the gnd gene.

A chromosomal DNA containing at least a part of the gnd fragment is obtained by subjecting the chromosomal DNA restriction enzyme degradation product to Southern hybridization using the fragment as a template.
Determine the size of the restriction enzyme fragment. G obtained by PCR
Using a partial fragment of the nd gene as a template, a λ phage containing the fragment is isolated from the gene library λFIXII by plaque hybridization and cloned.

This chromosomal DNA fragment is cut out using an appropriate restriction enzyme, the obtained DNA fragment is subcloned into an appropriate cloning vector, for example pUC118 (Takara Shuzo), and Escherichia coli JM109 strain (Takara Shuzo) is transformed. To do. This transformant is cultured under selection of an appropriate antibiotic, cells are recovered from the culture, and a plasmid is extracted from the cells by a conventional method, for example, the alkali-SDS method. By determining the base sequence of the DNA inserted into this plasmid, the DNA fragment containing the gnd gene of the present invention can be obtained.

The nucleotide sequence of this DNA fragment was determined by the dideoxynucleotide enzymatic method [dideoxy chain t].
termination method; Sanger, F .; , E
tal. , Proc. Nat. Acad. Sc
i. USA, Vol. 74, p. 5463,
(1977)]. The nucleotide sequence of the DNA fragment having a size of about 2 kb determined in this manner is shown in SEQ ID NO: 1 in the sequence listing below.

From the open reading frame present in this sequence, the 6-phosphogluconate dehydrogenase of the present invention consists of the amino acid sequence of SEQ ID NO: 1.
The gene encoding it is, for example, the one represented by the nucleotide sequence from 374th to 1849th in the nucleotide sequence of SEQ ID NO: 1. The gnd gene in the present invention is a chromosomal DN of natural bacteria such as coryneform bacteria.
Not only that isolated from A, but also based on the nucleotide sequence described in the present specification, a commonly used DNA synthesizer, for example, System-1 Plus (System-1 manufactured by Beckman).
Plus) may be used.

Further, as described above, the DNA fragment of the present invention obtained from the chromosome of coryneform bacterium has a part of the nucleotide sequence as long as it does not substantially impair the function of encoding 6-phosphogluconate dehydrogenase. The base may be replaced with another base, may be deleted, a new base may be inserted, or a part of the base sequence may be rearranged. DNA sequence containing a gene encoding the 6-phosphogluconate dehydrogenase of the present invention.
It is included in the fragment.

[0013]

EXAMPLES The present invention will be described in more detail below with reference to examples. However, these examples do not limit the scope of the invention. (A) Extraction of total DNA of Brevibacterium flavum MJ-233 Brevibacterium flavum MJ-233 (FERM
BP-1497) is a semi-synthetic medium A medium [composition: urea 2 g, (NH ₄ ) ₂ SO ₄ 7 g, K ₂ HPO ₄
0.5g, KH ₂ PO ₄ 0.5g, MgSO ₄ · 7H _{2
O 0.5g, FeSO 4 · 7H 2} O 6mg, MnSO
₄ · _{4~6H 2} O 6mg, yeast extract 2.5g, casamino acid 5g, biotin 200 [mu] g, thiamine hydrochloride 2
00 μg and 20 g of glucose are dissolved in distilled water to make 1 liter] The cells were cultured in 1 liter until the latter phase of the logarithmic growth phase, and the cells were recovered.

The obtained cells were lysozyme at 10 mg / m
1 solution [composition: 10 mM NaCl,
20 mM Tris buffer (pH 8.0), 1 mM ED
TA • 2Na] in 15 ml. Proteinase K was added to the suspension at a final concentration of 100 μg / ml, which was incubated at 37 ° C. for 1 hour. Next, sodium dodecyl sulfate was added to a final concentration of 0.5%, and the mixture was incubated at 50 ° C for 6 hours to lyse the cells. After adding an equal amount of a phenol / chloroform solution to the obtained lysate and gently shaking at room temperature for 10 minutes, the total amount was subjected to 5,000 × g centrifugation at 10 to 12 ° C. for 20 minutes, and The supernatant fraction was collected. Sodium acetate was added to the supernatant fraction to a concentration of 0.3M,
Then 2 volumes of ethanol were added gently. The DNA existing between the aqueous layer and the ethanol layer was picked up with a glass rod, washed with 70% ethanol and air dried. The obtained DNA was subjected to an experiment after adding 5 ml of a solution [composition: 10 mM Tris buffer (pH 7.5), 1 mM EDTA · 2Na] at 4 ° C. overnight.

(B) Collection of partial fragment of gnd gene (Escherichia coli)
i) [J. Bacteriol. , Vol. 17
3, p. 968 (1991)], Erwinia chrysanthem.
i) [Gene, Vol. 101, p. 51 (199
1)], and Leuconostoc mesenteroid
es) [J. Biol. Chem. , Vol. 2
66, p. 13028 (1991)], a PCR primer DNA for gene cloning was designed based on the sequence of the homologous portion of the amino acid sequence deduced from the base sequence of the DNA gene encoding 6-phosphogluconate dehydrogenase.

An example of the polymerase chain reaction is shown below. The reaction solution has the following composition. The concentration represents the final concentration. [25 units / ml Taq DNA polymerase, 10 mM Tris-HCl buffer (pH 8.0), 5
0 mM KCl, 1.5 mM MgCl ₂ , 0.25 m
M dATP, 0.25 mM dCTP, 0.25 mM
dGTP, 0.25 mM dTTP, 0.5 μg / m
l Chromosome DNA saturated aqueous solution, 1 μM primer 1: A
TGGTICA (TC) AA (TC) GGNAT (ATC) GA (AG) TA (TC) GGNGA (TC) AT
G (sequence designed based on the amino acid sequence 196 to 206 of SEQ ID NO: 1; SEQ ID NO: 2), 1 μM primer 2: GCICC (AG) AA (AG) TA (AG) TCIC (TG) (TC) TGIGC ( TC) TG
(A sequence designed based on the amino acid sequences 459 to 467 described in SEQ ID NO: 1: SEQ ID NO: 3) is used as a reaction mixture of 100 μl. ] The reaction conditions of the polymerase chain reaction are, for example, 1 ° C. at 94 ° C.
Min, 55 ° C for 2 minutes, 72 ° C for 3 minutes as one cycle 2
5 cycles. Then, the DNA obtained by the above reaction was purified.

Each final concentration was 50 mM Tris-
Hydrochloric acid buffer (pH 7.9), 10 mM MgCl ₂ , 2
0 mM dithiothreitol, 1 mM ATP, 1un
it / 10 μl T4 DNA ligase, 50 ng / 10
μl pGEM-T vector, 10 ng / 10 μl P
Each component was added so as to be a CR product and reacted at 16 ° C. for 3 hours to bind the PCR product DNA.

Then, the conventional method [J. Mol. Bio
l. , 53, 159 (1970)],
The resulting solution was used to transform Escherichia coli JM109. The transformant thus obtained was used as a selection medium [composition:
Tryptone 10 g, yeast extract 5 g, NaCl 5
g, agar 15 g, ampicillin 50 mg, isopropiothiogalactoside 0.238 g, X-gal
0.2 g and 2 ml of dimethylformamide were dissolved in distilled water to make 1 liter], and the mixture was incubated at 37 ° C. for 16 hours.

The colonies thus obtained were blue / white color screened. L strain containing ampicillin at a final concentration of 50 μg / ml was added to the strain grown on the selection medium [trypton 10 g, yeast extract 5 g, NaCl
5 g was dissolved in distilled water to make 1 liter], and this was cultured at 37 ° C. for 7 hours. Culture at 1 ℃ at 4 ℃
The cells were recovered by centrifugation at 8,000 × g for 0 minutes. An alkali-SDS method [T. Ma
niatis, E .; F. Fritsch, J. et al.
Sambrook, Molecular clone
ing, p. 90-91 (1982)].

Next, the nucleotide sequence of the obtained chromosomal DNA fragment inserted into the plasmid was determined by the dideoxynucleotide enzyme method. Specifically, the plasmid DNA extracted from the above culture was used for Catalist 800 Molecular Biology Laboratory Station (CATALYST 800 Molecular) manufactured by Perkin Elmer.
r Biology Labostation; P
erkin-Elmer) according to the protocol, followed by 373A DN manufactured by Perkin-Elmer
The nucleotide sequence of the inserted DNA fragment of the plasmid was determined by A sequencer.

By comparing the homology between the protein obtained by translating the determined nucleotide sequence and the known 6-phosphogluconate dehydrogenase of Escherichia coli, it was found that the gnd of Brevibacterium flavum MJ-233 was obtained.
It was found to be a part of the gene (from the 959th position to the 1773rd position in the nucleotide sequence of SEQ ID NO: 1). (C) Determination of size of chromosomal DNA restriction enzyme fragment containing partial fragment of gnd gene Chromosomal DNA was subjected to restriction enzymes BamHI, EcoRI, Hi
It was digested with ndIII and SalI, respectively. O these
A nylon membrane filter for Southern hybridization was prepared using Probe tech 2 manufactured by Ncor.

The partial fragment of the gnd gene obtained by PCR as described above was used as a template, and the labeling was made by Amersham [α- ³² P].
Ramd manufactured by Takara Shuzo Co., Ltd. using dCTP AA0005
omPrimer DNA Labeling Ki
t Ver. Probes were labeled in two ways. The filter is a solution having the following composition [5 × SSC solution, 5 × Denhardt's solution, 0.5% sodium dodecyl sulfate, 0.1 m
g / ml SIGMA SALMON TESTES
DNA For Hybridization (10
mg / ml)] at 65 ° C. for 2 hours. The 20 × SSC solution had the following composition [3M NaCl, 0.3M sodium citrate],
The 100 × Denhardt's solution has the following composition [2% bovine serum albumin, 2% polyvinylpyrrolidone, 2% Ficoll].

The probe prepared above was added, and Southern hybridization was carried out at 65 ° C. overnight. The filter was washed with 2 × SSC, 0.1% SDS at 65 ° C. for 15 minutes with gentle shaking. The filter was then washed with 1 × SSC, 0.1% SDS at 65 ° C. for 15 minutes with gentle shaking. After air-drying the filter, autoradiography was performed. Read the bioimaging analyzer B manufactured by Fuji Photo Film Co., Ltd.
AS-2000 was used.

As a result, the size of the chromosomal DNA restriction enzyme fragment containing the partial fragment of the gnd gene was about 5 kb, 8 kb, 5 kb and 9 kb for the BamHI fragment, the EcoRI fragment, the HindIII fragment and the SalI fragment, respectively. (D) Chromosomal DNA B containing a partial fragment of gnd gene
Isolation of amHI fragment Escherichia coli P2329 was inoculated into an LB culture medium supplemented with 0.2% maltose and 10 mM MgSO ₄ , and cultured at 37 ° C. And the gene library λF
The P2329 culture solution was mixed with 400 μl of the IXII phage solution and incubated at 37 ° C. for 15 minutes. Next, 4 ml of λ top agar (preserved at 50 ° C.) was added, spread uniformly on a λ plate, and cultured at 37 ° C. overnight.

The nitrocellulose filter was gently placed on the λ plate so that air could not enter, and the mark points previously written on the filter were copied on the plate. The filter was peeled off, and the adsorption surface was placed on the filter paper, which was soaked in the following solution, and sequentially treated for 5 minutes (Solution 1: [0.5M N
aOH, 1.5 M NaCl], solution 2: [1 M Tris-hydrochloric acid (pH 7.5), 0.75 M NaCl], solution 3: 2 x SSC). After drying the filter, 80
The DNA was immobilized on the filter by heating at 30 ° C. for 30 minutes.

The filter was mixed with the following mixed solution [5 × SSP
E, 1 × Denhardt's solution, 50% formamide, 0.1
mg / ml SIGMA SALMON TESTE
SDNA For Hybridization (10
mg / ml)] at 42 ° C. for 1 hour. The composition of 20 × SSPE is 3.6M
NaCl, 0.2M NaH ₂ PO ₄ , 0.02M E
DTA. The DNA probe prepared in the above item (C) was added, and hybridization was carried out at 42 ° C. overnight.

The filters were washed with 5 × SSPE, 1 × Denhardt's solution, 50% formamide solution at 42 ° C. for 15 minutes with gentle shaking. The filter was then washed with 2 × SSPE, 0.1% sodium dodecyl sulfate solution at 42 ° C. for 15 minutes with gentle shaking. After air-drying the filter, autoradiography was performed. A bioimaging analyzer BAS-2000 manufactured by Fuji Photo Film Co., Ltd. was used for reading.

The target plaque soft agarose was crushed and suspended in 200 μl of SM buffer. The above solution 10
μl was mixed with 300 μl of the Escherichia coli P2329 strain cultured at 37 ° C. for 3 to 4 hours, top agarose was added, and the mixture was spread on a λ plate. The cells were cultured overnight at 37 ° C. to form plaques. Add 4 ml of SM buffer to the λ plate, scrape off the top agarose,
Shake gently for hours. The supernatant was transferred to a new tube so that top agarose was not mixed, and a few drops of chloroform were added. Then, the mixture was centrifuged at 5,000 rpm for 5 minutes to obtain a supernatant. In addition DNase and RNase
(Final concentration 1 μg / ml) was added, and the mixture was incubated at 37 ° C. for 15 minutes. Add an equal amount of 20% polyethylene glycol (average molecular weight 6,000) -2M NaCl and add 1 on ice.
After standing for 4 hours, the mixture was centrifuged at 10,000 rpm at 4 ° C. for 10 minutes, and the supernatant was completely removed. 250 μl of Tris-EDTA buffer was added and suspended, 5 μl of 10% sodium dodecyl sulfate was added, and after heating at 68 ° C. for 5 minutes,
Add 10 μl of 5M NaCl and add equal volume of phenol /
Chloroform was added and well suspended. 12,000 rp
The mixture was centrifuged at m for 10 minutes, and the aqueous layer was transferred to a new tube.
After isopropanol precipitation, it was washed with 70% ethanol, dried and suspended in 50 μl of Tris-HCl buffer.

DN of λFIXII obtained by the above operation
A was cut with BamHI. The digested product was subjected to agarose gel electrophoresis to obtain Ba of chromosomal DNA containing a part of the gnd gene.
The mHI fragment was separated and purified. This BamHI fragment was added to p
Subcloned in UC118. PUC118 containing the subcloned BamHI fragment was cleaved with BamHI to recover the BamHI fragment.

(E) Determination of total nucleotide sequence of gnd gene The DNA fragment solution of about 5 kb obtained in (D) was treated at 37 ° C. with the restriction enzyme Sau3AI to partially decompose the DNA fragment. Also, cloning vector pUC
118 was cleaved with the restriction enzyme BamHI. The obtained vector DNA fragment and the partially decomposed DNA fragment were mixed, and the final concentration of the mixture was 50 mM Tris buffer (pH 7.6), 10 mM dithiothreitol, 1 m, respectively.
M ATP, 10 mM MgCl ₂ , and 1 unit
Each component was added so as to obtain / 10 μl T4 DNA ligase, and the vector DNA fragment and the partially degraded DNA fragment were ligated.

Similarly to the above, a solution of a DNA fragment having a size of about 5 kb was reacted with a restriction enzyme TaqI to prepare a partially degraded DNA fragment. After cloning the cloning vector pUC118 with the restriction enzyme AccI, this was ligated to the partially degraded DNA in the same manner as above. Using the obtained plasmid mixture, Escherichia coli JM109 strain was transformed by a conventional method and smeared on the selection medium.

The strain grown in the above selection medium was liquid-cultured according to a conventional method, and plasmid DNA was extracted from the obtained culture. Using the extracted plasmid DNA, the base sequence of the partially degraded DNA fragment inserted into the vector pUC118 was determined. And the concatenation of these individual sequences is
It was performed using a sequence analysis software Autoassembler (Autoassembler) manufactured by Perkin-Elmer.

As a result, the base sequence shown in SEQ ID NO: 1 was identified. By comparing the homology between the amino acid primary structure of the translated protein and the amino acid primary structure of the known 6-phosphogluconate dehydrogenase of Escherichia coli, it was found that it was Brevibacterium flavum MJ-23.
3 gnd gene open reading frame 374th to 1852th in the nucleotide sequence described in SEQ ID NO: 1).

[0034]

ADVANTAGES OF THE INVENTION DN containing a gene encoding 6-phosphogluconate dehydrogenase provided by the present invention
By breeding and improving a coryneform bacterium using the A fragment, it becomes possible to obtain a coryneform bacterium having a high productivity of 6-phosphogluconate dehydrogenase.

[0035]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 1916 Number of strands: Double-stranded Sequence type: Nucleic acid Topology: Linear Sequence type: Genomic DNA sequence AATGATCCAG TGGATTCGGC AATGGCGGCG TAGACACCAC CGTTGACCAA GCCCACCACT 60 TGCAGGTGCTTGCGTGACAC GTGAAGTTCGG CGTACCAGGT GACC GTCGAGGCCG TAATTGGCGT TGTTGAGTGC TTCAAGTTCG 180 TCAGTTGTTA AAGCTCTGGT GGCGGCAAGT TCTGCAAGCG AAAGCAGATC TTGGGGTTGA 240 TCATCGCGGG AAGTCATATT TTATTACTCT AGTCGGCCTA AAATGGTTGG ATTTTCACCT 300 GCTGTGACCT GGTAAAATGG CCACTACCCC CAAATGGTCA CACCTTTTAG GCCGATTTTG 360 CTGACACCGG GCT 373 ATG CCG TCA AGT ACG ATC AAT AAC ATG ACT AAT GGA GAT AAT CTC GCA 421 Met Pro Ser Ser Thr Ile Asn Asn Met Thr Asn Gly Asp Asn Leu Ala 1 5 10 15 CAG ATC GGC GTT GTA GGC CTA GCA GTA ATG GGC TCA AAC CTC GCC CGC 469 Gln Ile Gly Val Val Gly Leu Ala Val Met Gly Ser Asn Leu Ala Arg 20 25 30 AAC TTC GCC CGC AAC GGC CAC ACT GTC GCT GTC TAC AAC CGC AGC ACT 517 Asn Phe Ala Arg Asn Gly His Thr Val Ala Val Tyr Asn Arg Ser Thr 35 40 45 GAC AAA ACC GAC AAG CTC ATC GCC GAT CAC GGC TCC GAA GGC AAC TTC 565 Asp Lys Thr Asp Lys Leu Ile Ala Asp His Gly Ser Glu Gly Asn Phe 50 55 60 ATC CCT TCC GCA ACC GTC GAA GAG TTC GTA GCA TCC CTG GAA AAG CCA 613 Ile Pro Ser Ala Thr Val Glu Glu Phe Val Ala Ser Leu Glu Lys Pro 65 70 75 80 CGC CGC GCC ATC ATC ATG GTT CAG GCT GGT AAC GCC ACC GAC GCA GTC 661 Arg Arg Ala Ile Ile Met Val Gln Ala Gly Asn Ala Thr Asp Ala Val 85 90 95 ATC AAC CAG CTG GCA GAC GCC ATG GAC GAA GGC GAC ATC ATC ATC GAC 709 Ile Asn Gln Leu Ala Asp Ala Met Asp Glu Gly Asp Ile Ile Ile Asp 100 105 110 GGC GGC AAC GCC CTC TAC ACC GAC ACC ATT CGT CGC GAG AAG GAA ATC 757 Gly Gly Asn Ala Leu Tyr Thr Asp Thr Ile Arg Arg Glu Lys Glu Ile 115 120 125 TCC GCA CGC GGT CTC CAC TTC GTC GGT GCT GGT ATC TCT GGC GGC GAA 805 Ser Ala Arg Gly Leu His Phe Val Gly Ala Gly Ile Ser Gly Gly Glu 130 135 140 GAA GGC GCA CTC AAC GGC CCA TCC ATC ATG CCT GGT GGC CCA GCA AAG 853 Glu Gly Ala Leu Asn Gly Pro Ser Ile Met Pro Gly Gly P ro Ala Lys 145 150 155 160 TCC TAC GAG TCC CTC GGA CCA CTG CTT GAG TCC ATC GCT GCC AAC GTT 901 Ser Tyr Glu Ser Leu Gly Pro Leu Leu Glu Ser Ile Ala Ala Asn Val 165 170 175 GAC GGC ACC CCA TGT GTC ACC CAC ATC GGC CCA GAC GGC GCC GGC CAC 949 Asp Gly Thr Pro Cys Val Thr His Ile Gly Pro Asp Gly Ala Gly His 180 185 190 TTC GTC AAG ATG GTC CAC AAC GGC ATC GAG TAC GCC GAC ATG CAG GTC 997 Phe Val Lys Met Val His Asn Gly Ile Glu Tyr Ala Asp Met Gln Val 195 200 205 ATC GGC GAG GCA TAC CAC CTT CTC CCG TAC GCA GCA GGC ATG CAG CCA 1045 Ile Gly Glu Ala Tyr His Leu Leu Pro Tyr Ala Ala Gly Met Gln Pro 210 215 220 GCT GAA ATC GCT GAG GTT TTC AAG GAA TGG AAC GCA GGC GAC CTG GAT 1093 Ala Glu Ile Ala Glu Val Phe Lys Glu Trp Asn Ala Gly Asp Leu Asp 225 230 235 240 TCC TAC CTC ATC GAG ATC ACC GCA GAG GTT CTC TCC CAG GTG GAT GCT 1141 Ser Tyr Leu Ile Glu Ile Thr Ala Glu Val Leu Ser Gln Val Asp Ala 245 250 255 GAA ACC GGC AAG CCA CTG ATC GAC GTC ATC GTT GAC GCT GCA GGC CAG 1189 Glu Thr Gly Lys Pro Leu Ile Asp V al Ile Val Asp Ala Ala Gly Gln 260 265 270 AAG GGC ACC GGA CGT TGG ACC GTC AAG GCT GCT CTT GAT CTG GGT ATT 1237 Lys Gly Thr Gly Arg Trp Thr Val Lys Ala Ala Leu Asp Leu Gly Ile 275 280 285 GCT ACC ACC GGC ATC GGC GAA GCT GTT TTC GCA CGT GCA CTC TCC GGC 1285 Ala Thr Thr Gly Ile Gly Glu Ala Val Phe Ala Arg Ala Leu Ser Gly 290 295 300 GCA ACC AGC CAG CGC GCT GCA GCA CAG GGC AAC CTA CCT GCA GGT GTC 1333 Ala Thr Ser Gln Arg Ala Ala Ala Gln Gly Asn Leu Pro Ala Gly Val 305 310 315 320 CTC ACC GAT CTG GAA GCA CTT GGC GTG GAC AAG GCA CAG TTC GTC GAA 1381 Leu Thr Asp Leu Glu Ala Leu Gly Val Asp Lys Ala Gln Phe Val Glu 325 330 335 GAC GTT CGC CGT GCA CTG TAC GCA TCC AAG CTT GTT GCT TAC GCA CAG 1429 Asp Val Arg Arg Ala Leu Tyr Ala Ser Lys Leu Val Ala Tyr Ala Gln 340 345 350 GGC TTC GAC GAG ATC AAG GCT GGC TCC GAC GAG AAC AAC TGG GAT GTT 1477 Gly Phe Asp Glu Ile Lys Ala Gly Ser Asp Glu Asn Asn Trp Asp Val 355 360 365 GAC CCT CGC GAC CTC GCT ACC ATC TGG CGC GGC GGC TGC ATT ATT CGC 1525 Asp Pro Arg As p Leu Ala Thr Ile Trp Arg Gly Gly Cys Ile Ile Arg 370 375 380 GCT AAG TTC CTC AAC CGC ATC GTC GAA GCA TAC GAT GCA AAC GCT GAA 1573 Ala Lys Phe Leu Asn Arg Ile Val Glu Ala Tyr Asp Ala Asn Ala Glu 385 390 395 400 CTT GAG TCC CTG CTG CTC GAC CCT TAC TTC AAG AGC GAG CTC GGC GAC 1621 Leu Glu Ser Leu Leu Leu Asp Pro Tyr Phe Lys Ser Glu Leu Gly Asp 405 410 415 CTC ATC GAT TCA TGG CGT CGC GTG ATT GTC ACC GCC ACC CAG CTT GGC 1669 Leu Ile Asp Ser Trp Arg Arg Val Ile Val Thr Ala Thr Gln Leu Gly 420 425 430 CTG CCA ATC CCA GTG TTC GCT TCC TCC CTG TCC TAC TAC GAC AGC CTG 1717 Leu Pro Ile Pro Val Phe Ala Ser Ser Leu Ser Tyr Tyr Asp Ser Leu 435 440 445 CGT GCA GAG CGT CTG CCA GCA GCC CTG ATC CAG GGA CAG CGC GAC TTC 1765 Arg Ala Glu Arg Leu Pro Ala Ala Leu Ile Gln Gly Gln Arg Asp Phe 450 455 460 TTC GGT GCG GAC ACC TAC AAG GGC ATC GAC AAG GAT GGC CCC TTC CAC 1813 Phe Gly Ala Asp Thr Tyr Lys Gly Ile Asp Lys Asp Gly Pro Phe His 465 470 475 480 ACC GAG TGG TCC GGC GAC CGC TCC GAG GTG GAA GCT 1849 Thr Glu Trp Ser Gly Asp Arg Ser Glu Val Glu Ala 485 490 TAAAGGCTCC CCCTAAATAG CAAAACGCTA AAACCCCTCA CAGTCACCTT AGGTTGTAAG 1909 GGGTTTT 1916 SEQ ID NO: 2 Sequence length: Number of chains: Single-stranded Sequence type: Nucleic acid Topology: Linear Sequence type : Other nucleic acid (synthetic DNA) sequence ATGGTNCAYA AYGGNATHGA RTAYGGNGAY ATG 33 SEQ ID NO: 3 Sequence length: Number of strands: Single strand Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) ) Sequence GCNCCRAART ARTCNCKYTG NGCYTG 26

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Office reference number FI technical display location C12R 1:13) (C12N 1/20 C12R 1:13) (72) Inventor Hideaki Yukawa Inashiki, Ibaraki Prefecture 3-1-3 Chuo 8-chome, Ami-cho, Gunma

Claims (3)

[Claims] 1. A 6-phosphogluconate dehydrogenase represented by the amino acid sequence set forth in SEQ ID NO: 1 in the Sequence Listing. 2. A DNA encoding the 6-phosphogluconate dehydrogenase according to claim 1. 3. The base sequence of SEQ ID NO: 1 in the sequence listing, which is 3
A DNA encoding the 6-phosphogluconate dehydrogenase represented by the nucleotide sequences from 74th to 1849th.