JPH09224661A - Glucose-6-phosphate dehydrogenase and dna capable of coding the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To isolate the above enzyme, derived from a coryneform bacterium and capable of catalyzing a pentose phosphate cycle according to a gene recom bination technology. SOLUTION: This glucose 6-phosphate dehydrogenase has an amino acid sequence represented by the formula. The enzyme is obtained by expressing a DNA (hereinafter referred to as a zwf gene), obtained from a chromosome of a coryneform bacterium, isolated and determined from a Brevibacterium flavum ML-233 (FERM BP-1497) strain and capable of coding the glucose 6-phosphate dehydrogenase in a coryneform bacterium. When the coryneform bacterium is transformed with the zwf gene, a bacterium capable of highly producing the glucose 6-phosphate dehydrogenase is obtained.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to glucose-6-
Phosphate dehydrogenase and DNA encoding the same
About.

[0002]

BACKGROUND OF THE INVENTION Glucose-6-phosphate dehydrogenase [EC1.1.1.49] is an enzyme of the pentose phosphate cycle and produces phosphoglucono-δ-lactone and NADPH from glucose-6-phosphate and NADP +. It is a catalyst for the irreversible reaction that forms. For the DNA encoding glucose-6-phosphate dehydrogenase,
In prokaryotes, Escherichia coli
ia coli) -derived gene [J. Bacteri
ol. , Vol. 173, p. 968 (199
1)], Erwinia Chrysansemi (Erwinia)
chrysanthemi) -derived gene [Gen
e, Vol. 101, p. 51 (1991)], Leuconostoc Mescenteroides (Leuconos)
toc mesenteroides) -derived gene [J. Biol. Chem. , Vol. 266,
p. 13028 (1991)] and the like, and its base sequence has been determined.

However, regarding coryneform bacteria widely used in industry such as amino acid synthesis, the enzyme protein and its nucleotide sequence have not been reported.

[0004]

Generally, if the origin is different, the enzyme gene is not or hardly expressed in the host, and therefore glucose-6-phosphate dehydrogenase derived from coryneform bacterium which can be expressed in coryneform bacterium. And the isolation of the DNA encoding it was desired.

[0005]

Means for Solving the Problems As a result of intensive studies to solve the above problems, the present inventors have made use of a gene recombination technique to convert glucose-6-phosphate dehydrogenase and glucose-6-phosphate dehydrogenase from coryneform bacteria. The inventors have found that the DNA encoding it can be isolated, and completed the present invention. That is, the gist of the present invention is glucose-represented by the amino acid sequence of SEQ ID NO: 1 in the sequence listing.
6-phosphate dehydrogenase and D encoding it
Exists in NA.

[0006]

BEST MODE FOR CARRYING OUT THE INVENTION Glucose-6-phosphate dehydrogenase of the present invention and a DNA encoding the same (hereinafter, referred to as
abbreviated as zwf gene) is a chromosome D of a coryneform bacterium.
NA, specifically Brevibacterium flavum (B
revibacterium flavum) MJ-2
It can be isolated and determined from the 33 (FERM BP-1497) strain by the method described below.

First, the coryneform bacterium is treated by a conventional method [eg,
See Japanese Patent Application Laid-Open No. 51-130592],
Cells are collected from the culture and chromosomal DNA is extracted from the cells. Chromosomal DNA can be obtained, for example, from JP-A-5-15378.
It can be easily extracted from the cells by the method described in Example 1 (A) of the publication. It is possible to obtain a partial fragment of the zwf gene by performing polymerase chain reaction (PCR) using oligodeoxyribonucleotide reverse-translated from a highly homologous portion of the primary structure of glucose-6-phosphate dehydrogenase such as Escherichia coli as a primer. it can.

Chromosomal DNA containing at least a part of the zwf fragment is obtained by subjecting the chromosomal DNA restriction enzyme degradation product to Southern hybridization using the fragment as a template.
Determine the size of the restriction enzyme fragment. Z obtained by PCR
Using a partial fragment of the wf gene as a template, λ phage containing the fragment was isolated from the gene library λFIXII by plaque hybridization. This is cloned.

This chromosomal DNA fragment is cut out using an appropriate restriction enzyme, the obtained DNA fragment is subcloned into an appropriate cloning vector, for example pUC118 (Takara Shuzo), and Escherichia coli JM109 strain (Takara Shuzo) is transformed. To do. This transformant is cultured under selection of an appropriate antibiotic, cells are recovered from the culture, and a plasmid is extracted from the cells by a conventional method, for example, the alkali-SDS method. The DNA fragment containing the zwf gene of the present invention can be obtained by determining the nucleotide sequence of the DNA inserted into this plasmid.

The nucleotide sequence of this DNA fragment was determined by the dideoxynucleotide enzymatic method [dideoxy chain t].
termination method; Sanger, Fet
al. , Proc. Nat. Acad. Sc
i. USA, Vol. 74, p. 5463,
(1977)]. The sequence of the DNA fragment of about 2 kb in size thus determined is shown in SEQ ID NO: 1 in the sequence listing below. From the open reading frame present in this sequence, the glucose-6-phosphate dehydrogenase of the present invention consists of the amino acid sequence represented by 1 to 484 in the amino acid sequence set forth in SEQ ID NO: 1, and the DNA encoding the same is: For example,
629 to 2083 in the nucleotide sequence of SEQ ID NO: 1
It is shown by the base sequence up to the th.

The zwf gene in the present invention is not limited to one isolated from the chromosomal DNA of a natural bacterium, for example, a coryneform bacterium, and a DNA synthesizer usually used based on the nucleotide sequence described in the present specification, such as Beckman. It may be synthesized by using System-1 Plus manufactured by the company. In addition, as described above, the DNA fragment of the present invention obtained from the chromosome of a coryneform bacterium has a part of the bases of the base sequence unless the function encoding glucose-6-phosphate dehydrogenase is substantially impaired. It may be substituted with another base, deleted, a new base may be inserted, or a part of the base sequence may be rearranged. It may be a nucleotide sequence that hybridizes to the sequence, and any of these derivatives is included in the DNA fragment containing the gene encoding glucose-6-phosphate dehydrogenase of the present invention.

[0012]

EXAMPLES The present invention will be described in more detail below with reference to examples. However, these examples do not limit the scope of the invention. (A) Extraction of total DNA of Brevibacterium flavum MJ-233 (FERM)
BP-1497) is a semi-synthetic medium A medium [composition: urea 2 g, (NH ₄ ) ₂ SO ₄ 7 g, K ₂ HPO ₄
0.5g, KH ₂ PO ₄ 0.5g, MgSO ₄ · 7H _{2
O 0.5g, FeSO 4 · 7H 2} O 6mg, MnSO
₄ · _{4~6H 2} O 6mg, yeast extract 2.5g, casamino acid 5g, biotin 200 [mu] g, thiamine hydrochloride
200 μg and 20 g of glucose are dissolved in distilled water to obtain 1
The cells were collected after culturing in 1 liter until the late logarithmic growth phase.

The obtained cells were treated with 10 mg / m of lysozyme.
1 solution [composition: 10 mM NaCl,
20 mM Tris buffer (pH 8.0), 1 mM ED
TA • 2Na] in 15 ml. Proteinase K was added to the suspension at a final concentration of 100 μg / ml, which was incubated at 37 ° C. for 1 hour. Next, sodium dodecyl sulfate was added to a final concentration of 0.5%, and the mixture was incubated at 50 ° C for 6 hours to lyse the cells. After adding an equal amount of a phenol / chloroform solution to the obtained lysate and gently shaking at room temperature for 10 minutes, the total amount was subjected to 5,000 × g centrifugation at 10 to 12 ° C. for 20 minutes, and The supernatant fraction was collected. Sodium acetate was added to the supernatant fraction to a concentration of 0.3M,
Then 2 volumes of ethanol were added gently. The DNA existing between the aqueous layer and the ethanol layer was picked up with a glass rod, washed with 70% ethanol and air dried. The obtained DNA was subjected to an experiment after adding 5 ml of a solution [composition: 10 mM Tris buffer (pH 7.5), 1 mM EDTA · 2Na] at 4 ° C. overnight.

(B) Collection of partial fragment of zwf gene Escherichia col
i) [J. Bacteriol. , Vol. 17
3, p. 968 (1991)], Erwinia chrysanthem.
i) [Gene, Vol. 101, p. 51 (199
1)], and Leuconostoc mesenteroid
es) [J. Biol. Chem. , Vol. 2
66, p. 13028 (1991)] glucose-
A PCR primer DNA for gene cloning was designed based on the sequence of the homologous portion of the amino acid sequence deduced from the base sequence of the DNA gene encoding 6-phosphate dehydrogenase.

An example of the polymerase chain reaction is shown below. The reaction solution has the following composition. The concentration represents the final concentration. [25 units / ml Taq DNA polymerase, 10 mM Tris-HCl buffer (pH 8.0), 5
0 mM KCl, 1.5 mM MgCl ₂ , 0.25 m
M dATP, 0.25 mM dCTP, 0.25 mM
dGTP, 0.25 mM dTTP, 0.5 μg / m
l Chromosome DNA saturated aqueous solution, 1 μM Primer 1:
AT (ATC) GA (TC) CA (TC) TA (TC) (TC) TIGGIAA (AG) GA (sequence designed based on the amino acid sequence 174 to 181 of SEQ ID NO: 1: SEQ ID NO: 2), 1 μM primer 2: GGIA
CICCI (TG) (GC) CCAIC (amino acid sequence 3 of SEQ ID NO: 1
Sequence designed based on 24 to 329: SEQ ID NO: 3),
Is used as a reaction mixture of 100 μl. ] The reaction conditions of the polymerase chain reaction are, for example, 1 ° C. at 94 ° C.
Min, 55 ° C for 2 minutes, 72 ° C for 3 minutes as one cycle 2
5 cycles. Then, the DNA obtained by the above reaction was purified.

Each of the final concentrations was 50 mM Tris-
Hydrochloric acid buffer (pH 7.9), 10 mM MgCl ₂ , 2
0 mM dithiothreitol, 1 mM ATP, 1un
it / 10 μl T4 DNA ligase, 50 ng / 1
0 μl pGEM-T vector, 10 ng / 10 μl
Each component was added so as to be a PCR product and reacted at 16 ° C. for 3 hours to bind the PCR product DNA.

Then, the conventional method [J. Mol. Bio
l. , 53, 159 (1970)],
The resulting solution was used to transform Escherichia coli JM109. The transformant thus obtained was used as a selection medium [composition:
Tryptone 10 g, yeast extract 5 g, NaCl 5
g, agar 15 g, ampicillin 50 mg, isopropiothiogalactoside 0.238 g, X-gal
0.2 g and 2 ml of dimethylformamide were dissolved in distilled water to make 1 liter], and the mixture was incubated at 37 ° C. for 16 hours.

The colonies thus obtained were blue / white color screened. L strain containing ampicillin at a final concentration of 50 μg / ml was added to the strain grown on the selection medium [trypton 10 g, yeast extract 5 g, NaCl
5 g was dissolved in distilled water to make 1 liter], and this was cultured at 37 ° C. for 7 hours. Culture at 1 ℃ at 4 ℃
The cells were collected by centrifugation at 8,000 × g for 0 minutes. An alkali-SDS method [T. M
aniatis, E .; F. Fritsch, J. et al.
Sambrook, Molecular clone
ing, p. 90-91 (1982)].

Next, the nucleotide sequence of a chromosome-derived DNA fragment of about 470 bp inserted into the obtained plasmid was determined by the dideoxynucleotide enzymatic method. Specifically, the plasmid DNA extracted from the above culture was used as Catalyst 800 Molecular Biology Lab Station (CATALYST 80 manufactured by Perkin Elmer Co., Ltd.).
0 Molecular Biology Labos
reaction; Perkin-Elmer) according to the protocol, and then the nucleotide sequence of the inserted DNA fragment of the plasmid was determined with a Perkin-Elmer 373A DNA sequencer.

A protein obtained by translating the determined nucleotide sequence and a known glucose-6 of Escherichia coli
-Comparison of homology with phosphate dehydrogenase reveals that it is the zw of Brevibacterium flavum MJ-233.
It was found to be a part of the f gene (1148th to 1614th in the nucleotide sequence of SEQ ID NO: 1 in the sequence listing).

(C) Determination of Size of Chromosomal DNA Restriction Enzyme Fragment Containing Partial Fragment of zwf Gene Chromosomal DNA was digested with restriction enzymes BamHI, EcoRI, Hi
It was digested with ndIII and SalI, respectively. O these
A nylon membrane filter for Southern hybridization was prepared using Probe tech 2 manufactured by Ncor.

The above-mentioned partial fragment of the zwf gene obtained by PCR was used as a template, and labeling was performed by Amersham [α- ³² P].
Ramd manufactured by Takara Shuzo Co., Ltd. using dCTP AA0005
omPrimer DNA Labeling Ki
t Ver. Probes were labeled in two ways. Filter the solution of the following composition [5 × SSC solution, 5 × Denhardt's solution, 0.5% sodium dodecyl sulfate (SD
S), 0.1 mg / ml SIGMA SALMON
TESTES DNA For Hybridiza
cation (10 mg / ml)] at 65 ° C. for 2 hours. The 20 × SSC solution has the following composition [3M NaCl, 0.3M sodium citrate], and the 100 × Denhardt solution has the following composition [2% bovine serum albumin, 2% polyvinylpyrrolidone, 2% Ficoll].

The probe prepared above was added, and Southern hybridization was carried out at 65 ° C. overnight. The filters were washed with 2 × SSC, 0.1% SDS at 65 ° C. for 15 minutes with gentle shaking. The filters were then washed with 1 × SSC, 0.1% SDS at 65 ° C. for 15 minutes with gentle shaking. After air-drying the filter, autoradiography was performed. Read the bioimaging analyzer B manufactured by Fuji Photo Film Co., Ltd.
AS-2000 was used.

As a result, the size of the chromosomal DNA restriction enzyme fragment containing the partial fragment of zwf gene was about 2 kb, 3 kb, 8 kb and 10 kb for BamHI fragment, EcoRI fragment, HindIII fragment and SalI fragment, respectively. (D) Chromosomal DNA B containing a partial fragment of zwf gene
Isolation of amHI fragment Escherichia coli P2329 was inoculated into an LB culture medium supplemented with 0.2% maltose and 10 mM MgSO ₄ , and cultured at 37 ° C. And the gene library λF
The P2329 culture solution was mixed with 400 μl of the IXII phage solution and incubated at 37 ° C. for 15 minutes. Next, 4 ml of λ top agar (preserved at 50 ° C.) was added, spread uniformly on a λ plate, and cultured at 37 ° C. overnight.

The nitrocellulose filter was gently placed on the λ plate so that air could not enter, and the mark points previously written on the filter were copied on the plate. The filter was peeled off, and the adsorption surface was placed on the filter paper soaked in the following mixed solution, and treated sequentially for 5 minutes (Solution 1: [0.5M
NaOH, 1.5M NaCl], Solution 2: [1M Tris-HCl (pH 7.5), 0.75M NaCl],
Solution 3: 2 x SSC). After drying the filter, 8
DNA was immobilized on the filter by heating at 0 ° C. for 30 minutes.

The filter was mixed with the following mixed solution [5 × SSP
E, 1 × Denhardt's solution, 50% formamide, 0.1
mg / ml SIGMA SALMON TESTE
SDNA For Hybridization (1
0 mg / ml)] at 42 ° C. for 1 hour. The composition of 20 × SSPE is 3.6.
M NaCl, 0.2M NaH ₂ PO ₄ , 0.02M
EDTA. The probe prepared in the item (C) was added, and hybridization was carried out at 42 ° C. overnight.

The filters were washed with 5 × SSPE, 1 × Denhardt's solution, 50% formamide solution at 42 ° C. for 15 minutes with gentle shaking. Then filter 2
× SSPE, washed with 0.1% sodium dodecyl sulfate solution at 42 ° C for 15 minutes with gentle shaking. After air-drying the filter, autoradiography was performed. A bioimaging analyzer BAS-2000 manufactured by Fuji Photo Film Co., Ltd. was used for reading.

The target plaque soft agarose was crushed and suspended in 200 μl of SM buffer. The above solution 10
μl was mixed with 300 μl of the Escherichia coli P2329 strain cultured at 37 ° C. for 3 to 4 hours, top agarose was added, and the mixture was spread on a λ plate. The cells were cultured overnight at 37 ° C. to form plaques. Add 4 ml of SM buffer to the λ plate, scrape off the top agarose,
Shake gently for hours. The supernatant was transferred to a new tube so that top agarose was not mixed, and a few drops of chloroform were added. Then, the mixture was centrifuged at 5,000 rpm for 5 minutes to obtain a supernatant. Furthermore, DNase and RNase
(Final concentration 1 μg / ml) was added, and the mixture was incubated at 37 ° C. for 15 minutes. Add an equal amount of 20% polyethylene glycol (average molecular weight 6,000) -2M NaCl and add 1 on ice.
After standing for 4 hours, the mixture was centrifuged at 10,000 rpm at 4 ° C. for 10 minutes, and the supernatant was completely removed. 250 μl of Tris-EDTA buffer was added and suspended, 5 μl of 10% sodium dodecyl sulfate was added, and after heating at 68 ° C. for 5 minutes,
Add 10 μl of 5M NaCl and add equal volume of phenol /
Chloroform was added and well suspended. 12,000 rp
The mixture was centrifuged at m for 10 minutes, and the aqueous layer was transferred to a new tube.
After isopropanol precipitation, it was washed with 70% ethanol, dried and suspended in 50 μl of Tris-HCl buffer.

ΛFIXII DN obtained by the above operation
A was cut with BamHI. The digested product was subjected to agarose gel electrophoresis to obtain Ba of chromosomal DNA containing a part of the zwf gene.
The mHI fragment was separated and purified. About 2 of this BamHI fragment
The kb was subcloned in pUC118. PUC11 containing a subcloned BamHI fragment of about 2 kb
8 was cleaved with BamHI and the BamHI fragment was recovered.

(E) Determination of nucleotide sequence upstream of zwf gene DNA fragment solution of about 2 kb obtained in item (D) was treated with restriction enzyme Sau3AI at 37 ° C.
The fragment was partially disassembled. Also, cloning vector pU
C118 was cut with the restriction enzyme BamHI. The obtained vector DNA fragment and the partially decomposed DNA fragment were mixed, and the final concentration of the mixture was 50 mM Tris buffer (pH 7.6), 10 mM dithiothreitol, 1 m, respectively.
M ATP, 10 mM MgCl ₂ , and 1 unit
Each component was added so as to obtain / 10 μl T4 DNA ligase, and the vector DNA fragment and the partially degraded DNA fragment were ligated.

Similarly to the above, a partially fragmented DNA fragment was prepared by reacting a DNA fragment solution of about 2 kb with the restriction enzyme TaqI. After cloning the cloning vector pUC118 with the restriction enzyme AccI, this was ligated to the partially degraded DNA in the same manner as above. Using the obtained plasmid mixture, Escherichia coli JM109 strain was transformed by a conventional method and smeared on the selection medium.

The strain grown in the above selection medium was liquid-cultured according to a conventional method, and plasmid DNA was extracted from the obtained culture. Using the extracted plasmid DNA, the base sequence of the partially degraded DNA fragment inserted into the vector pUC118 was determined. And the concatenation of these individual sequences is
Perkin-Elmer sequence analysis software Auto-assembler (Autoassembler)
This was performed using

As a result, 1 in the base sequence shown in Sequence Listing 1
The nucleotide sequence from the 1st to 1965th was revealed. By comparing the homology between the amino acid primary structure of the translated protein and the amino acid primary structure of known glucose-6-phosphate dehydrogenase of Escherichia coli, Sequence Listing 1
The 629th to 1965th nucleotides in the described nucleotide sequence are glucose-of Brevibacterium flavum MJ-233.
It was found to be upstream of the open reading frame of the 6-phosphate dehydrogenase gene.

(F) Determination of the complete nucleotide sequence of zwf gene In order to clone the downstream portion of the open reading frame, the inverse polymerase chain reaction [eg, Yuuki, Experimental Medicine, Vol. 8, No. 9 (Special Issue), p. 49 (1990)]. First, the chromosomal DNA was digested with EcoRI. After this DNA degradation product was subjected to agarose gel electrophoresis, an agarose gel containing a DNA degradation product of about 3 kb was cut out with reference to the result obtained in (C).

From this agarose gel, BIO101
The DNA degradation product was extracted using GENECLEAN II manufactured by the company. And the following composition [50 mM Tris-HCl buffer (pH 7.9), 10 mM MgCl ₂ , 20 mM
Dithiothreitol, 1 mM ATP, 1 unit /
10 μl T4 DNA ligase, 10 μg / ml chromosomal DNA digested with EcoRI] were added, and the mixture was reacted overnight at 16 ° C. to self-bond the DNA degraded product.

Then, the primer pair [CTGAGCTGGAAGATTC
TGG (from 1943 to 1 of the nucleotide sequence of SEQ ID NO: 1
959th: SEQ ID NO: 4), CGAAAGCTGCATCATCATC (complementary strand of the 875th to 893rd nucleotides of the nucleotide sequence of SEQ ID NO: 1: SEQ ID NO: 5)], using the above self-binding chromosomal DNA EcoRI degradation product as a template, Polymerase chain reaction was performed by the method.

The obtained DNA was treated with pGEM- by the method described above.
It was ligated to the T vector, subcloned with Escherichia coli JM109, and extracted by the alkali-SDS method.
The nucleotide sequence of the inserted fragment was determined by the dideoxynucleotide enzymatic method, and as a result, 196 in the nucleotide sequence shown in Sequence Listing 1
It was revealed to be the 6th to 2260th base sequence.

As a result of the above, the size shown in Sequence Listing 1 is about 2.
A 260 bp DNA base sequence was determined. The presence of an open reading frame was confirmed in the determined nucleotide sequence. By comparing the homology between the amino acid primary structure of the translated protein and the amino acid primary structure of known glucose-6-phosphate dehydrogenase of Escherichia coli, 629 to 2083 in the nucleotide sequence of SEQ ID NO: 1 in the sequence listing are compared. The second is the glucose-6-phosphate dehydrogenase gene of Brevibacterium flavum MJ-233, the amino acid sequence of which is SEQ ID NO: 1.
It was found to be the amino acid sequence described.

[0039]

EFFECT OF THE INVENTION Glucose-6 provided by the present invention
Glucose-by breeding and improving coryneform bacteria with a gene encoding phosphate dehydrogenase
It is possible to obtain a coryneform bacterium having a high 6-phosphate dehydrogenase producing ability.

[0040]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 2260 Number of strands: Double-stranded Sequence type: Nucleic acid Topology: Linear Sequence type: Genomic DNA sequence GATCCGATGA GGCTTTGGCT CTGCGTGGCA AGGCAGGCGT TGCCAACGCT CAGCGCGCTT 60 ACGCTGTGTA CAAGGAGCTT TTCGACGCCACCCAGGCCAGCTACGAGCTGCCTGCCGAGCTGCCTG CGGCGTGAAG AACCCTGCGT ACGCTGCAAC TCTTTACGTT 180 TCCGAGCTGG CTGGTCCAAA CACCGTCAAC ACCATGCCAG AAGGCACCAT CGACGCTGTT 240 CTGGAACTGG GCAACCTGCA CGGTGACAAC CTGTCCAACT CCGCGGCAGA AGCTGACGCT 300 GTGTTCTCCC AGCTTGAGGC TCTGGGCGTT GACTTGGCAG ATGTCTTCCA GGTCCTGGAG 360 ACCGAGGCCG TGGACAAGTT CGTTGCTTCT TGGAGCGAAC TGCTTGAGTC CATGGAAGCT 420 CGCCTGAAGT AGAATCAGCA CGCTGCATCA GTAACGGCGA CATGAAATCG AATTAGTTCG 480 ATCTTATGTG GCCGTTACAC ATCTTTCATT AAAGAAAGGA TCGTGACGCT TACCATCGTG 540 AGCACAAAAC ACGACCCCCT CCAGCTGGAC AAACCCACTG CGCGACCCGC AGGATAAACG 600 ACTCCCCCGCGC ATCGCTGGCC CTTCCGGC 628 ATG GTG ATC TTC GGT GTC ACT GGC GAC TTG GCT CGA AAG AAG CTG CTC 676 Met Val Ile Phe Gly Val Thr Gly Asp Leu Ala Arg Lys Lys Leu Leu 1 5 10 15 CCC GCC ATT TAT GAT CTA GCA AAC CGC GGA TTG CTG CCC CCA GGA TTC 724 Pro Ala Ile Tyr Asp Leu Ala Asn Arg Gly Leu Leu Pro Pro Gly Phe 20 25 30 TCG TTG GTA GGT TAC GGC CGC CGC GAA TGG TCC AAA GAA GAC TTT GAA 772 Ser Leu Val Gly Tyr Gly Arg Arg Glu Trp Ser Lys Glu Asp Phe Glu 35 40 45 AAA TAC GTA CGC GAT GCC GCA AGT GCT GGT GCT CGT ACG GAA TTC CGT 820 Lys Tyr Val Arg Asp Ala Ala Ser Ala Gly Ala Arg Thr Glu Phe Arg 50 55 60 GAA AAT GTT TGG GAG CGC CTC GCC GAG GGT ATG GAA TTT GTT CGC GGC 868 Glu Asn Val Trp Glu Arg Leu Ala Glu Gly Met Glu Phe Val Arg Gly 65 70 75 80 AAC TTT GAT GAT GAT GCA GCT TTC GAC AAC CTC GCT GCA ACA CTC AAG 916 Asn Phe Asp Asp Asp Ala Ala Phe Asp Asn Leu Ala Ala Thr Leu Lys 85 90 95 CGC ATC GAC AAA ACC CGc GGC ACC GCc GGC AAC TGG GCT TAC TAC CTG 964 Arg Ile Asp Lys Thr Arg Gly Thr Ala Gly Asn Trp Ala Tyr Tyr Leu 100 105 110 TCC ATT CCA CCA GAT TCC TTC GCA GCG GTC TGC CAC CaG CTG GAG CGT 1012 Ser Ile Pro Pro Asp Ser Phe Ala Ala Val Cys His Gln Leu Glu Arg 115 120 125 TCC GGC ATG GCT GAA TCC ACC GAA GAA GCA TGG CGC CGC GTG ATC ATC 1060 Ser Gly Met Ala Glu Ser Thr Glu Glu Ala Trp Arg Arg Val Ile Ile 130 135 140 GAG AAg CCT TTC GGC CAC AAC CTC GAA TCC GCA CAC GAG CTC AAC CAG 1108 Glu Lys Pro Phe Gly His Asn Leu Glu Ser Ala His Glu Leu Asn Gln 145 150 155 160 CTG GTC AAC GCA GTC TTC CCA GAA TCT TCT GTG TTC CGC ATC GAC CAC 1156 Leu Val Asn Ala Val Phe Pro Glu Ser Ser Val Phe Arg Ile Asp His 165 170 175 TAT TTG GGC AAG GAA ACA GTT CAA AAC ATC CTG GCT CTG CGT TTT GCT 1204 Tyr Leu Gly Lys Glu Thr Val Gln Asn Ile Leu Ala Leu Arg Phe Ala 180 185 190 AAC CAG CTG TTT GAG CCA CTG TGG AAC TcC AAC TAC GTT GAC CAC GTC 1252 Asn Gln Leu Phe Glu Pro Leu Trp Asn Ser Asn Tyr Val Asp His Val 195 200 205 CAG ATC ACC ATG GCT GAA GAT ATT GGC TTG GGT GGA CGT GCT GGT TAC 1300 Gln Ile Thr Met Ala Glu Asp Ile Gly Leu Gly Gly Arg Ala Gly Tyr 210 215 220 TAC GAC GGC ATC GGC GCA GcC CGC GAC GTC ATC CAG AAC CAC CTG ATC 1348 Tyr Asp Gly Ile Gly Ala Ala la Arg Asp Val Ile Gln Asn His Leu Ile 225 230 235 240 CAG CTC TTG GCT CTG GTT GCC ATG GAA GAA CCA ATT TCT TTC GTG CCA 1396 Gln Leu Leu Ala Leu Val Ala Met Glu Glu Pro Ile Ser Phe Val Pro 245 250 255 GCG CAG CTG CAG GCA GAA AAG ATC AAG GTG CTC TCT GCG ACA AAG CCG 1444 Ala Gln Leu Gln Ala Glu Lys Ile Lys Val Leu Ser Ala Thr Lys Pro 260 265 270 TGC TAC CCA TTG GAT AAA ACC TCC GCT CGT GGT CAG TAC GCT GCC GGT 1492 Cys Tyr Pro Leu Asp Lys Thr Ser Ala Arg Gly Gln Tyr Ala Ala Gly 275 280 285 TGG CAG GGC TCT GAG TTA GTC AAG GGA CTT CGC GAa GAA GAT GGC TTC 1540 Trp Gln Gly Ser Glu Leu Val Lys Gly Leu Arg Glu Glu Asp Gly Phe 290 295 300 AAC CCT GAG TCC ACC ACT GAG ACT TTT GCG GCT TGT ACC TTA GAG ATC 1588 Asn Pro Glu Ser Thr Thr Glu Thr Phe Ala Ala Cys Thr Leu Glu Ile 305 310 315 320 ACG TCT CGT CGC TGG GCT GGT GTG CCG TTC TAC CTG CGC ACC GGT AAG 1636 Thr Ser Arg Arg Trp Ala Gly Val Pro Phe Tyr Leu Arg Thr Gly Lys 325 330 335 CGT CTT GGT CGC CGT GTT ACT GAG ATT GCC GTG GTG TTT AAA GAC GCA 1684 Ar g Leu Gly Arg Arg Val Thr Glu Ile Ala Val Val Phe Lys Asp Ala 340 345 350 CCA CAC CAG CCT TTC GAC GGC GAC ATG ACT GTA TCC CTT GGC CAA AAC 1732 Pro His Gln Pro Phe Asp Gly Asp Met Thr Val Ser Leu Gly Gln Asn 355 360 365 GCC ATC GTG ATT CGC GTG CAG CCT GAT GAA GGT GTG CTC ATC CGC TTC 1780 Ala Ile Val Ile Arg Val Gln Pro Asp Glu Gly Val Leu Ile Arg Phe 370 375 380 GGT TCC AAG GTT CCA GGT TCT GCC ATG GAA GTC CGT GAC GTC AAC ATG 1828 Gly Ser Lys Val Pro Gly Ser Ala Met Glu Val Arg Asp Val Asn Met 385 390 395 400 GAC TTC TCC TAC TCA GAA TCC TTC ACT GAA GAA TCA CCT GAA GCA TAC 1876 Asp Phe Ser Tyr Ser Glu Ser Phe Thr Glu Glu Ser Pro Glu Ala Tyr 405 410 415 GAG CGC CTT ATC TTg GAT GCG CTG TTG GAT GAA TCC AGC CTT TTC CCT 1924 Glu Arg Leu Ile Leu Asp Ala Leu Leu Asp Glu Ser Ser Leu Phe Pro 420 425 430 ACC AAC GAG GAA GTG GAA CTG AGC TGG AAG ATT CTG GAT CCA ATT CTT 1972 Thr Asn Glu Glu Val Glu Leu Ser Trp Lys Ile Leu Asp Pro Ile Leu 435 440 445 GAA GCA TGG GAT GCC GAT GGA GAA CCA GAG GAT TAC CCA GCA GGT ACG 2020 Glu Ala Trp Asp Ala Asp Gly Glu Pro Glu Asp Tyr Pro Ala Gly Thr 450 455 460 TGG GGT CCA AAG AGC GCT GAT GAA ATG CTT TCC CGC AAC GGT CAC ACC 2068 Trp Gly Pro Lys Ser Ala Asp Glu Met Leu Ser Arg Asn Gly His Thr 465 470 475 480 TGG CGC AGG CCA TAATTTAGGG GCAAAAAATG ATCTTTGAAC TTCCGGATAC 2120 Trp Arg Arg Pro 484 CACCACCCAG CAAATTTCCA AGACCCTAAC TCGACTGCGT GAATCGGGCA CCCA 2AG Number of chains: 1 strand Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence ATHGAYCAYT AYYTNGGNAA RGA 23 N represents inosine. SEQ ID NO: 3 Sequence length: Number of chains: Single strand Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence GGNACNCCNK SCCANC 16 N represents inosine. SEQ ID NO: 4 Sequence length: Number of strands: Single strand Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence CTGAGCTGGA AGATTCTGG 19 SEQ ID NO: 5 Sequence length: Number of strands: 1 strand Sequence type: Nucleic acid Topology: Linear Sequence type: Other nucleic acid (synthetic DNA) Sequence CGAAAGCTGC ATCATCATC 19

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification number Office reference number FI technical display location C12R 1:13) (C12N 1/20 C12R 1:13) (72) Inventor Hideaki Yukawa Inashiki, Ibaraki Prefecture 3-1-3 Chuo 8-chome, Ami-cho, Gunma

Claims (3)

[Claims] 1. A glucose-6-phosphate dehydrogenase represented by the amino acid sequence set forth in SEQ ID NO: 1 in the Sequence Listing. 2. A DNA encoding the glucose-6-phosphate dehydrogenase according to claim 1. 3. The nucleotide sequence of SEQ ID NO: 1 in the sequence listing, which is 6
A DNA encoding glucose-6-phosphate dehydrogenase represented by the nucleotide sequences from 29 to 2083.