JPH09194502A - New chondroitin sulfate proteoglycan, its core protein, dna coding the same and antibody to the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new proteoglycan useful for diagnosis, medical treatment and prevention of cerebropathy. SOLUTION: This chondoritin sulfate proteoglycan is composed of a core protein and a saccharide having the following properties. (A) The primary structure of the core protein has an amino acid sequence of the first valine(val) to the 514th threonine(Thl) expressed in the formula or an amino acid sequence having homogeny to the formula. (B) The saccharide contains a chondoritin sulfate having a molecular weight of approximately 30 kilo dalton. (C) Saccharides are released by acting neuraminidase, 0-glucosidase or N-glucosidase on this proteoglycan.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel chondroitin sulfate proteoglycan, a core protein thereof, DNA encoding the same, and an antibody thereto.

[0002]

2. Description of the Related Art Proteoglycan is a general term for compounds in which glycosaminoglycan is covalently bound to a protein (core protein). They are localized on the cell surface and extracellular space, and they are chemotrophic factors, cell adhesion molecules, and extracellular matrix glycoproteins (Reference 1,
It is presumed that it has various regulatory effects on somatic cells by binding to 2) and the like.

Further, recent biochemical studies on mammalian brain proteins have revealed that various proteoglycans are precisely regulated and expressed during development of the brain (References 3 and 4). Such molecularly regulated expression of proteoglycans is found in the brain such as glial fibers (ref. 5), visual system (ref. 6), and barrel system of cerebral cortex (refs. 7-9). Are involved in the formation of some complex structures. In vitro studies have also shown that nervous system proteoglycans are involved in neuronal morphogenesis, for example in axon development. This proteoglycan is involved in both positive (10, 11) and negative (12-15) effects on axonal growth in vitro.

Regarding the function of nervous system proteoglycans, since the primary structure of the core protein in other somatic cells has been clarified, various things have been clarified. As a result of such research progress, it was revealed that many proteoglycan core proteins have similar sequence motifs and can be grouped into several families. Neurokan (N
eurocan) (reference 16), brevican (reference 1)
7), versican (Reference 18) and BEH
AB (Reference 19) is a member of the soluble chondroitin sulfate proteoglycan family. These sequences contain a tandem repeat of the hyaluronan-binding domain. N-syndecan (Reference 20) is a member of the syndecan family, a heparan sulfate proteoglycan that contains many similar transmembrane and cytoplasmic domains. More recently, the chondroitin sulfate proteoglycan phosphacan (phosphac
It has been clarified that an) / 6B4 proteoglycan is an extracytoplasmic mutant of the receptor-like protein tyrosine phosphatase RPTPβ / ζ (References 21 and 22).

As described above, recently, the primary structures of many core proteins have been reported. However, many proteoglycans remain unidentified in the brain. Although there are at least 16 types of core proteins in the membrane-bound fraction of rat brain (Reference 4), only the complete primary structure of only 3 types of membrane-bound proteoglycans has been reported. In other words, NG2 (Reference 23), glypican (gl
ypican) (ref. 24) and celeblogrican (cerebr)
oglycan) (Reference 25).

[0006]

DISCLOSURE OF INVENTION Problems to be Solved by the Invention The discovery, purification and identification of a novel proteoglycan has led to progress in brain research, establishment of new diagnostic methods for brain diseases, novel therapeutic methods and preventive methods for brain diseases. Leads to development. In particular, it is presumed that the novel membrane-bound proteoglycan of the present invention is involved in nerve axon development and is involved in nervous system morphogenesis through these. The present inventors searched for such a novel proteoglycan in the brain, and found a novel proteoglycan. The object of the present invention is therefore to discover, purify and identify a novel proteoglycan in the brain and to provide it. Further, the object of the present invention is to prepare an antibody against a brain-specific membrane-bound proteoglycan as a tool for the discovery of such a novel proteoglycan, and to provide such an antibody. Especially. Another object is to provide a DNA encoding the proteoglycan or protein of the present invention.

[0007]

[Means for Solving the Problems] In order to solve the above problems, the present inventors first tried to identify and identify a novel proteoglycan. Next, we attempted to create an antibody against the isolated novel proteoglycan, obtained cDNA for the novel proteoglycan using the obtained antibody, and confirmed that this chondroitin sulfate proteoglycan is specific to the brain after analyzing the entire gene structure. Then, the present invention has been completed.

Next, the present invention will be described in detail. <1> Extraction and partial purification of chondroitin sulfate proteoglycan of the present invention The novel chondroitin sulfate proteoglycan can be extracted by the following method. A mammalian (eg, rat) brain is treated with a protease inhibitor (eg, 2 mM phenylmethylsulfonyl fluoride), a metal chelating agent (eg, 20 mM ethylenediaminetetraacetic acid (E).
DTA) etc.) and a reducing agent (eg 10 mM N-ethylmaleimide etc.) in a buffer solution (eg phosphate buffered saline (PBS) etc.) is homogenized using a homogenizer etc. and the homogenate is insoluble by high speed centrifugation etc. Obtain the substance (homogenization and high speed centrifugation may be repeated again). The insoluble substance is homogenized in a buffer solution containing a protease inhibitor and a surfactant (for example, Triton-based surfactant (Nonidet P-40 (trade name), etc.)), and then centrifuged to obtain a supernatant. As a crude chondroitin sulfate proteoglycan fraction is obtained.

The chondroitin sulfate proteoglycan crude fraction thus obtained can be partially purified. That is, the crude fraction is used as it is or after freeze-drying or the like, and then a surfactant (for example, Triton-based surfactant (Nonidet P-40
(Trade name) etc.), metal chelating agent (eg EDTA)
Etc.), a reducing agent (eg, N-ethylmaleimide, etc.) and a protease (eg, phenylmethylsulfonyl fluoride, etc.), and an appropriate amount of a buffer solution (urea buffer solution) containing a highly concentrated urea solution (eg, 4M urea). Disperse into. After that, dialyzing with the same urea buffer. High speed centrifugation (eg 27,000
g, 30 minutes), the supernatant is mixed with an anion exchange resin (eg DEAE Sephacel etc.) equilibrated with urea buffer. The anion exchange resin is recovered according to a conventional method, packed in a column, and subjected to a salt concentration gradient (for example, 0.1 M in urea buffer).
To 0.7 M linear gradient) to elute chondroitin sulfate proteoglycans. Proteoglycan fractions (fractions eluted at a concentration of 0.45 to 0.68M NaCl) are collected and concentrated according to a conventional method (for example, ultrafiltration). Concentrated sample Next Sepharose CL-4B
Gel filtration chromatography is performed using a gel filtration agent such as (Pharmacia).

The chondroitin sulfate proteoglycan fraction (Kav is 0.11 to 0.65) is collected and concentrated (for example, ultrafiltration) by a conventional method. The proteoglycan is precipitated from the solution by addition of an aqueous solution of ethanol containing potassium acetate (eg about 1.3% (w / v) in ethanol (eg ethanol at a concentration of about 95%). The precipitate is potassium acetate (eg 1% (W / v) under ice cooling. / V)) in an aqueous ethanol solution (for example, about 75% ethanol), and dried under reduced pressure. The dried product is dissolved in a buffer solution (guanidine buffer solution) containing an appropriate amount of guanidine hydrochloride (preferably 4M), and octyl is added. Hydrophobic chromatography is performed using Sepharose or the like, and a surfactant (for example, Triton-based surfactant (Nonidet P-4
Elute with a concentration gradient of 0 (trade name) etc.). Chondroitin sulfate proteoglycan fraction (for example, in the case of Nonidet P-40, 0.3% to 0.6% of Nonidet P-
40 concentration fractions) are collected, precipitated with ethanol or the like as described above, and dried. The chondroitin sulfate proteoglycan thus obtained was subjected to cesium chloride (CsCl) density gradient centrifugation in a guanidine buffer (for example, an initial density of 1.38 g).
(/ Ml) and may be further purified by centrifugation (eg, 150,000 × g for 30 hours) by a conventional method. Thus purified chondroitin sulfate proteoglycan can be obtained. The chondroitin sulfate proteoglycan thus obtained forms a band of about 150 kilodaltons (kDa) under reducing conditions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Since the amino acid sequence of the core protein of the chondroitin sulfate proteoglycan of the present invention has been clarified by the present invention, the present invention can also be achieved by synthesizing a core protein from amino acids and covalently binding a sugar chain to the core protein. The chondroitin sulfate proteoglycan can be obtained. Further, the present invention revealed the nucleotide sequence of the DNA encoding the core protein of the chondroitin sulfate proteoglycan of the present invention. Therefore, the core protein was expressed from this DNA and the sugar chain was shared with the core protein obtained by the expression. The chondroitin sulfate proteoglycan of the present invention can also be obtained by binding.

<2> Purification of Core Protein Next, the core protein should be partially purified according to the method used for partial purification of the proteoglycan type protein tyrosine phosphatase described by Maeda et al. (Reference 22). You can That is, the denuclearized fraction prepared from whole mammalian brain is solubilized with 1% CHAPS or the like.
The solubilized product is loaded onto a column of anion exchange resin such as DEAE-resin (for example, DEAE Toyopearl) and eluted with a high-concentration salt solution (for example, about 0.6M) by a conventional method. Subsequently, it is fractionated by CsCl density gradient centrifugation. The obtained fraction was digested with chondroitinase ABC, and SDS-
The core protein can be obtained by separation by PAGE (eg 6% polyacrylamide etc.) or the like. The core protein thus obtained was analyzed by SDS-PAGE under reducing conditions.
A band of 20 kDa is formed. Also, this core protein is recognized by a monoclonal antibody that recognizes a novel chondroitin sulfate proteoglycan described later using Western blot. Further, since the amino acid sequence of the core protein of the chondroitin sulfate proteoglycan of the present invention was clarified by the present invention, the core protein can also be synthesized from the amino acid. Further, since the nucleotide sequence of the DNA encoding the core protein of the chondroitin sulfate proteoglycan of the present invention was clarified by the present invention, the core protein can be obtained by expressing the core protein from this DNA.

<3> Production of Antibody of the Present Invention The antibody of the present invention is an antibody which binds to both or either of the proteoglycan of the present invention and the protein of the present invention, and may be either polyclonal or monoclonal. The antibody of the present invention can be prepared according to a conventional method, for example, as follows, using the proteoglycan of the present invention or its core protein produced as described above or a fusion protein of these and other proteins as an antigen. is there. The polyclonal antibody of the present invention is, for example, a mouse,
It can be obtained by immunizing an immunized animal such as rat, guinea pig, rabbit, goat, or sheep with the above-mentioned antigen and collecting serum from these animals. When an immunized animal is immunized, it is possible to use an auxiliary agent in combination.
It is desirable because it activates antibody-producing cells. From the obtained antiserum, the immunoglobulin fraction may be purified by a conventional method.

The monoclonal antibody of the present invention can be obtained, for example, as follows. That is, mouse, rat, guinea pig, rabbit, goat, intraperitoneal of immunized animals such as sheep, subcutaneous, after administration to the footpad (footpad), the spleen or popliteal lymph node was extracted and collected from these antigens. Cells and myeloma cells, which are tumor cell lines, are fused to establish hybridomas, the hybridomas obtained are continuously propagated, and specific antibodies against the proteoglycan of the present invention or the protein of the present invention from the obtained hybridomas are continued. Cell lines that produce specifically. By culturing the selected strain in a suitable medium, the monoclonal antibody of the present invention can be obtained in the medium. Alternatively, a large amount of the monoclonal antibody of the present invention can be produced by culturing the hybridoma in a living body such as the abdominal cavity of a mouse. As cells to be used for cell fusion, lymph node cells and lymphocytes in peripheral blood can be used in addition to spleen cells. In addition, the myeloma cell line is preferably derived from a homologous cell type as compared with that derived from a heterologous cell type, and a stable antibody-producing hybridoma can be obtained.

The obtained polyclonal antibody and monoclonal antibody can be purified by salting out with sodium sulfate, ammonium sulfate, etc., low temperature alcohol precipitation and selective precipitation fractionation with polyethylene glycol or isoelectric point, electrophoresis, DEAE (diethylamino). Ion exchange chromatography using an ion exchanger such as ethyl) -derivative, CM (carboxymethyl) -derivative,
Affinity chromatography using protein A or protein G, hydroxyapatite chromatography, immunoadsorption chromatography with immobilized antigen, gel filtration method, ultracentrifugation method and the like can be mentioned. The antibody of the present invention may be a fragment containing Fab obtained by treating the antibody with a protease that does not degrade the antigen-binding site (Fab) (eg, plasmin, pepsin, papain, etc.). Once the nucleotide sequence of the gene encoding the antibody of the present invention or the amino acid sequence of the antibody is determined, a fragment or chimeric antibody (for example, Fab of the antibody of the present invention) containing the Fab of the antibody of the present invention can be genetically engineered.
And the like, and such fragments and chimeric antibodies are also included in the antibodies of the present invention.

An example of the method for producing the antibody of the present invention will be described below, but the method is not limited thereto. The chondroitin sulfate proteoglycans of the invention are administered intraperitoneally to mice, for example, with complete and incomplete Freund's adjuvant at 2 week intervals. After the fourth administration as a booster, the mice are sacrificed and the spleen cells are fused with myeloma cells using polyethylene glycol. After culturing the selected hybridoma in the medium, the hybridoma is screened by Western blotting using the culture supernatant for the presence or absence of an antibody that reacts with the chondroitin sulfate proteoglycan of the present invention. Positive hybridomas are cloned by the limiting dilution method. The established hybridoma cell line produced an antibody that reacts with chondroitin sulfate proteoglycan (molecular weight: about 150 kDa) or core protein (about 120 kDa) by Western blotting.

Antibody production, however, can also be produced by other methods. That is, in the antibody, the core protein is 5 from the first valine (Val) shown in SEQ ID NO: 1 in Sequence Listing.
A proteoglycan represented by an amino acid sequence having homology with amino acids up to the 14th threonine (Thr),
The 252nd lysine (Ly shown in SEQ ID NO: 1 in the sequence listing)
s) to the 398th cysteine (Cys) or an amino acid sequence having homology therewith, or a protein which may have a sugar chain or a peptide fragment thereof is immunized to a mammal other than human, An antibody which can be collected from the body fluid of the animal or which is produced by antibody-producing cells of the animal and reacts with the proteoglycan and / or the protein, and a method for producing such an antibody. For example, it can be used as a method for antibody production. The protein or fragment thereof recognized by the obtained antibody is localized in the brain. The antibody obtained by the above method may be further purified by a known method.

<4> Separation of cDNA Clone from cDNA Library and Chondroitin Sulfate Proteoglycan Poly (A) ⁺ obtained from whole mammalian brain was used to prepare a cDNA library (Reference 22) to be used as a template and a random primer. To do. Also, poly (A) ⁺ obtained from whole mammalian brain was used for template and oligo d.
(T) Construct a cDNA library to be used as a primer. These cDNA libraries can be immunologically screened using the previously obtained monoclonal antibody that recognizes chondroitin sulfate proteoglycan. Immunological screening can be performed as described in Sambrook et al. (Reference 29). Positive clones were isolated by immunological screening and DN was used according to the usual method.
By performing the sequence determination of A and the like, the DNA shown in SEQ ID NO: 1 in the sequence listing can be obtained. Thus, it was possible to obtain a cDNA encoding the amino acid of 514 residues which encodes the signal peptide of 30 residues and the core protein of the novel chondroitin sulfate proteoglycan.

Since the novel chondroitin sulfate proteoglycans thus found and identified are localized in the brain and show no homology with any other known proteoglycans, the chondroitin sulfate proteoglycans of the present invention are novel chondroitin sulfate proteoglycans. Since these are considered to be involved in the morphogenesis of neurons (FIG. 1), they are expected to be used as a diagnostic method for nervous system diseases and the like, and as a therapeutic or preventive drug. In addition, the route of administration for treatment or prevention includes intravenous injection, arterial injection,
Intraventricular administration, genetically engineered administration means utilizing viral genes, and the like can be used.

<5> Proteoglycan of the Present Invention The proteoglycan of the present invention is a chondroitin sulfate proteoglycan composed of a core protein and a sugar chain having the following properties. (A) Primary structure of core protein: 1st valine (Val) to 514th threonine (T
It has an amino acid sequence up to hr) or an amino acid sequence having homology thereto. (B) Sugar chain: Contains chondroitin sulfate having a molecular weight of about 30 kilodaltons. (C) When a neuraminidase, O-glycosidase or N-glycosidase is allowed to act on this proteoglycan, sugar chains are released.

Further included in the present invention is the chondroitin sulfate proteoglycan characterized by having a molecular weight of about 150 kilodaltons in sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing conditions.

<6> Glycoprotein of the present invention A glycoprotein having the following properties is also included in the present invention. (A) Molecular weight: (a) About 12 under reducing conditions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
Forming a band of 0 kilodalton, (b) after enzymatic reaction of neuraminidase, O-glycosidase and N-glycosidase, forming a band of about 100 kilodalton under reducing conditions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, (B) Primary structure of protein: 1st valine (Val) to 514th threonine (T
It has an amino acid sequence up to hr) or an amino acid sequence having homology thereto.

<7> Protein of the Present Invention A sequence containing a sugar chain containing an amino acid sequence from the first valine (Val) to the 514th threonine (Thr) shown in SEQ ID NO: 1 or an amino acid sequence having homology thereto The protein that may be included is also included in the present invention. Furthermore, the 252nd lysine (Ly
Since the amino acid sequence from s) to the 398th cysteine (Cys) is a characteristic of the proteoglycan and protein of the present invention, the 252nd lysine (L
The present invention also includes a protein containing an amino acid sequence from ys) to the 398th cysteine (Cys) or an amino acid sequence having homology therewith, which may have a sugar chain, and encodes each of the above proteoglycans and proteins. Included in the present invention.

Such proteins include, for example, methionine (Met) 5 to -30 at SEQ ID NO: 1 in the Sequence Listing.
A protein which contains an amino acid sequence up to the 14th threonine (Thr) or an amino acid sequence having homology thereto and which may have a sugar chain is included. Having homology in the amino acid sequence in the present invention means that a certain proportion of amino acid sequences are maintained in the proteoglycan and protein having the same function even if the biological species from which the proteoglycan and protein of the present invention are derived are different, and the commonality is maintained. Means having. For example, in versican, which is a known chondroitin sulfate proteoglycan, the amino acid sequence of the active domain has 96% homology between the chicken-derived proteoglycan and the human-derived proteoglycan core protein. Further, it is known that the core protein of syndecan, which is a known membrane-bound proteoglycan, has a highly homologous portion in the amino acid sequence between mouse and human. Therefore, in the proteoglycan and protein of the present invention, the homology of the amino acid sequence between species is expected to be about 60 to 90% or more.

The protein deduced from the gene sequence of the cDNA of one example of the present invention includes a signal peptide domain, a chondroitin sulfate binding domain (CS attachment), a cluster of basic amino acids, a cysteine-containing domain,
It is presumed to consist of transmembrane domain and cytoplasmic domain (Fig. 1). The novel brain-localized chondroitin sulfate proteoglycan of the present invention was named neuroglycan C (hereinafter referred to as NGC). NGC mRNA is detected as a 3.1 kb single mRNA in the brains of newborn and adult mammals by Northern blot analysis, but not in kidney, liver, lung or muscle. The core protein sequence showed no significant homology with any other known proteins. This indicates that neuroglycan C (NGC) is a novel proteoglycan.

In the present invention, 31 of SEQ ID NO: 2 in the Sequence Listing is used.
A protein which contains an amino acid sequence from the thirty-fourth valine (Val) to the 545th threonine (Thr) or an amino acid sequence having homology therewith, and which may have a sugar chain, the 283rd lysine of SEQ ID NO: 2 (Ly
It also includes a protein containing an amino acid sequence from s) to the 429th cysteine (Cys) or an amino acid sequence having homology thereto, which may have a sugar chain. Since these are human-derived proteins, they are particularly preferable as pharmaceuticals used for humans. Such a protein includes, for example, an amino acid sequence from the 1st methionine (Met) to the 545th threonine (Thr) shown in SEQ ID NO: 2 of the Sequence Listing or an amino acid sequence having homology thereto, and has a sugar chain. Optionally included proteins are included.

The protein of the present invention does not necessarily have to be a single protein, but may be a part of a fusion protein if necessary. The fusion protein can be produced by a known genetic engineering technique, and is usually expressed by recombinant DNA obtained by ligating the DNA encoding the protein of the present invention with the DNA encoding any protein. Obtainable.

The protein of the present invention has an amino acid sequence containing in common the amino acids common to the amino acid sequence shown in SEQ ID NO: 1 and the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, and has a sugar chain. Also included are proteins that may have: The amino acids that are not common between the amino acid sequence shown in SEQ ID NO: 1 and the amino acid sequence shown in SEQ ID NO: 2 may be any amino acid. However, it is assumed that there is no amino acid of SEQ ID NO: 1 in the Sequence Listing corresponding to the 282th methionine (Met) in SEQ ID NO: 2 in the Sequence Listing.

<8> DNA of the Present Invention The present invention includes the above-mentioned proteoglycan, glycoprotein and DNA encoding the protein. For example, a protein containing an amino acid sequence from the first valine (Val) to the 514th threonine (Thr) shown in SEQ ID NO: 1 of the Sequence Listing or an amino acid sequence having homology therewith, which may have a sugar chain, is encoded. Having a base sequence that
Specific examples of A include DNAs containing a nucleotide sequence from the 103rd guanine (G) to the 1644th cytosine (C) of SEQ ID NO: 1 in the sequence listing. In addition, it encodes a protein containing an amino acid sequence having an amino acid sequence from the 252nd lysine (Lys) to the 398th cysteine (Cys) of SEQ ID NO: 1 of the Sequence Listing or an amino acid sequence having homology therewith, which may have a sugar chain. Specific examples of the DNA include a DNA containing a nucleotide sequence from the 856th adenine (A) to the 1296th cytosine (C) of SEQ ID NO: 1 in the sequence listing. Such DNA includes adenine (A) to 1644 at the 13th position shown in SEQ ID NO: 1 in the Sequence Listing.
A DNA containing a nucleotide sequence up to the second cytosine (C) is also included.

The 31st valine of SEQ ID NO: 2 (V
al) to the 545th threonine (Thr) or an amino acid sequence having homology thereto, specifically, as a DNA having a nucleotide sequence encoding a protein which may have a sugar chain, An example is a DNA containing a nucleotide sequence from the 91st guanine (G) to the 1635th cytosine (C) of SEQ ID NO: 2 in the row listing. The 283rd lysine (Lys) of Sequence Listing SEQ ID NO: 2
To the 429th cysteine (Cys) or an amino acid sequence having homology therewith, specifically, as a DNA having a nucleotide sequence encoding a protein that may have a sugar chain, specifically, a sequence listing sequence Number 2
DNA containing the nucleotide sequence from the 847th adenine (A) to the 1287th cytosine (C) of the above.
Such a DNA also includes a DNA containing a nucleotide sequence from the first adenine (A) to the 1635th cytosine (C) shown in SEQ ID NO: 2 in the Sequence Listing.

It will be readily understood by those skilled in the art that the DNA of the present invention includes DNAs having different base sequences due to the degeneracy of the genetic code. All of these DNAs are included in the DNA of the present invention. The present invention also provides a DNA or RN complementary to the DNA of the present invention.
A is included. Furthermore, the DNA of the present invention may be a single strand only of the coding strand encoding the above protein, or a double strand consisting of this single strand and a DNA strand or RNA strand having a sequence complementary thereto. It may be. The DNA of the present invention is also a recombinant DNA obtained by ligating a DNA encoding an arbitrary protein or a DNA having a function to the DNA of the present invention by a known genetic engineering technique.
Are also included. It should be noted that the gene of the protein of the present invention derived from a chromosome is expected to contain an intron in the coding region. However, even if a DNA fragment interrupted by such an intron is used as long as it encodes the protein of the present invention, Invention D
Included in NA. That is, as used herein, the term “encode” also includes having a nucleotide sequence that can be subjected to processing or the like during transcription to finally yield the desired protein.

[0032]

BEST MODE FOR CARRYING OUT THE INVENTION

EXAMPLES The present invention will be specifically described below with reference to examples, but the present invention is not limited to the following examples.

Example 1 Extraction of Membrane-Bound Chondroitin Sulfate Proteoglycans 10-day-old Sprague-Daw
ley) Rat brain (normally 100 rats per experiment; Slc: SD strain; manufactured by SLC) containing 2 mM phenylmethylsulfonyl fluoride, 20 mM EDTA and 10 mM N-ethylmaleimide as a protease inhibitor. Ice cold phosphate buffered saline (phospha
te-buffered saline) (PBS) (2 ml / brain) was homogenized using a Teflon glass homogenizer. Homogenization and subsequent steps were all performed at 4 ° C unless otherwise indicated. The homogenate was centrifuged at 27,000 × g for 40 minutes. The precipitate was homogenized again with the same solution. After centrifugation, the PBS-insoluble material was mixed with the protease inhibitor and 1% Nonidet.
Homogenize in PBS containing P-40 (2 ml / brain) at 0 ° C. The homogenate was magnetically stirred for 60 minutes and then centrifuged at 27,000 xg for 40 minutes. The supernatant was set aside and the precipitate was treated again with a buffer containing a surfactant and centrifuged. After centrifugation, these surfactant-containing supernatants were combined and freeze-dried.

[0033]

Example 2 Partial Purification of Membrane-Bound Chondroitin Sulfate Proteoglycan The freeze-dried residue obtained in Example 1 was treated with 0.2% nonidet P-40, 0.1 M NaCl, 2 mM EDTA, 1 m.
Dispersion was carried out in 4M urea containing MN-ethylmaleimide and 0.2 mM phenylmethylsulfonylfluoride, 50 mM Tris-HCl buffer, pH 7.5 (urea buffer) at a rate of 1 ml per brain, and the dispersion was It dialyzed using the same buffer solution. After centrifugation at 27,000 × g for 30 minutes, the supernatant was mixed with DEAE Sephacel resin (Pharmacia) equilibrated with urea buffer at a ratio of 1 ml per brain, and the mixture was stirred with a magnetic stirrer for 2 hours. The DEAE Sephacel resin was recovered by centrifugation at 6,500 xg for 10 minutes and washed twice with urea buffer. The resin was packed in a glass column and the proteoglycan was eluted from the resin by a linear concentration gradient in urea buffer containing 0.1 M to 0.7 M NaCl.

The proteoglycan fraction (eluted at a NaCl concentration of 0.45 to 0.68 M) was collected and Diaflow Y
5m using M-10 membrane (Amicon)
and concentrated to 1. 0.2% nonidet P- was added to the concentrated solution.
Chromatography was performed on a column (diameter 1.6 cm × 100 cm) of Sepharose CL-4B (Pharmacia) using 4M guanidine hydrochloride containing 40 and the protease inhibitor, 50 mM Tris-HCl pH 7.5. Proteoglycan fractions (Kav 0.11 to 0.65) were collected and collected using a Diaflow YM-10 membrane for 3 m.
and concentrated to 1. The proteoglycan was precipitated from the solution by adding 3 volumes of 95% ethanol containing 1.3% (W / V) potassium acetate. The precipitate was washed twice at 0 ° C. with 75% ethanol containing 1% (W / V) potassium acetate, and under reduced pressure.
Dried with P2O5. The obtained dried product was dissolved at room temperature in 10 ml of 4 M guanidine hydrochloric acid, 50 mM Tris hydrochloric acid, pH 7.5 (guanidine hydrochloric acid buffer solution). Add this solution to a column of octyl sepharose (Pharmacia) (diameter 1.6
(cm diameter × 5.0 cm). Elution was carried out with a linear concentration gradient of guanidine hydrochloride buffer containing 0% to 0.8% (V / V) of Nonidet P-40. 0.3% to 0.6%
Fractions eluted at a concentration of Nonidet P-40 of 3 were collected, and the proteoglycans in the collected fractions were ethanol precipitated and dried as described above.

Further, the obtained proteoglycan was subjected to RPS by a CsCl density gradient with an initial density of 1.38 g / ml (4M guanidine hydrochloride, 50 mM Tris hydrochloric acid, pH 7.5).
150,00 at 10 ° C using -65T rotor (Hitachi)
Purified by ultracentrifugation at 0Xg for 30 hours. After centrifugation, samples were collected in 7 fractions. Samples of fraction numbers 2 to 6 were collected and dialyzed against PBS at 4 ° C. The contents of hexuronate and protein in the proteoglycan solution were measured by the Bitter and Muir method (Reference 26) and protein analysis kit (Bio-Rad), respectively. By this purification method, proteoglycans having a hexuronic acid content of about 3 μmol (protein content of 2.2 mg) were obtained from 100 brains.

Further, soluble proteoglycan was extracted from the brain of a 10-day-old rat with PBS containing a protease inhibitor and purified by a known method (Reference 3). That is, proteoglycan was subjected to column chromatography using DEAE Sepharose and Sepharose CL-4B.
It was fractionated and purified by gel filtration with. From 0.45
Fractions with Kav in the 0.60 range were used for Western blot analysis.

[0037]

Example 3 Treatment of Membrane-Bound Chondroitin Sulfate Proteoglycans with Glycosidase In order to remove chondroitin sulfate side chains and heparan sulfate side chains from the proteoglycan core protein, membrane-bound chondroitin sulfate proteoglycans (uronic acid content 50 n
mol) is a chondroitinase ABC containing no protease (EC 4.2.2.4; Seikagaku Corporation)
) And then heparitinase I
(EC 4.2.2.8; manufactured by Seikagaku Corporation) (see Reference 8). The resulting protein (core glycoprotein) was subsequently treated with neuraminidase 2 mlIU (EC) in 50 mM sodium acetate buffer, pH 5.0100 μl containing 2 mM EDTA, 1 mM N-ethylmaleimide, 0.2 mM phenylmethylsulfonyl fluoride and 0.07 mM pepstatin. 3.2.1.18; manufactured by Nacalai Tesque, Inc.) at 37 ° C. for 1 hour. Enzyme reaction at 0 ℃
300 μl of 95% ethanol containing 1.3% potassium acetate
Was stopped by the addition of. After 1 hour, core glycoprotein (hereinafter referred to as core glycoprotein) was precipitated by centrifugation. After denaturing the core glycoprotein according to the instructions in the instruction manual, 1 IUN-Glycosidase F (EC 3.2.2.18; Boehringer Mannheim) was used, or 1 mIU of O-glycosidase (EC 3.2. 1.97; manufactured by Boehringer Mannheim) to perform deglycosylation by digesting at 37 ° C. for 24 hours.

[0038]

Example 4 Gel Electrophoresis and Western Blot Analysis Sodium dodecylsulfate-polyacrylamide gel electrophoresis under reducing conditions of membrane-bound chondroitin sulfate proteoglycans using dithiothreitol using 6% separating gel and 3% stacking gel ( Separation by SDS-PAGE). They were added to 25 mM Tris, 192 mM glycine (pH 8.) containing 20% (V / V) methanol at 4 ° C.
In 3), it was electrophoretically transferred (transferred) to a polyvinylidene difluoride (PVDF) membrane (Immobilon-P (trade name); manufactured by Millipore) at 60 V overnight. The membrane was incubated in PBS with 1% skim milk (DIFCO Laboratories) to block non-specific binding of antibodies. Next, this membrane was treated with the culture supernatant of the hybridoma of Example 5 (including mouse monoclonal antibody) at 4 ° C. for a whole day and night, and the vector stain (Vec
tastain) P using the ABC kit (Vector Laboratories)
Stained in BS. In some experiments, the intensity of immunostaining was quantified using an image scanner (GT-6500; Epson), a computer (LC520; Apple), application software, and a NIH image program (public domain).

[0039]

Example 5 Production of Monoclonal Antibody Various monoclonal antibodies are known methods (see Reference 27).
Manufactured by. That is, a preparation of membrane-bound chondroitin sulfate proteoglycan (50 μg protein /
(Administration) was intraperitoneally injected into BALB / c mice with complete and incomplete Freund's adjuvant at 2-week intervals.
After the fourth administration as a booster, the mice were sacrificed, and the resulting spleen cells were PA-treated with polyethylene glycol.
I was fused with myeloma cells. RPMI1 containing 10% fetal bovine serum from hybridomas selected in HAT medium
The cells were cultured in 640 medium (manufactured by Sigma). Cultured hybridomas were screened by Western blotting using the culture supernatant for the presence or absence of antibodies that react with proteoglycans. Positive hybridomas were cloned by the limiting dilution method. Monoclonal antibodies C1, C3, C5 and C1 obtained from selected hybridomas
5 reacted with the membrane-bound chondroitin sulfate proteoglycan of Example 2. All of these four antibodies were determined to be IgG1 using a mouse monoclonal antibody isotyping kit (Immunotype (trade name); manufactured by Sigma).

[0040]

Example 6 Purification of Core Glycoprotein Core glycoprotein was purified according to the method used for partial purification of the proteoglycan type protein tyrosine phosphatase described by Maeda et al. (Reference 22) (Reference 22). That is, 1% CHAPS (3-
[(3-Choramidopropyl) dimethylammonio]
-1-Propanesulfonic acid). The solubilized product was loaded onto a column of DEAE Toyopearl (manufactured by Tosoh Corp.), washed with 0.25M NaCl, and then washed.
Elute with 0.6 M NaCl. Fractionation was performed by CsCl density gradient ultracentrifugation in order to separate proteoglycan from the eluate (negatively charged partially purified product obtained from the column). After centrifugation, the gradient was collected in 10 fractions. Analysis of these fractions after digestion with chondroitinase ABC revealed 140 kDa and 120 kDa in the three lowest density fractions.
Protein was detected as a major component (Reference 22)
(See Figure 2 inside). Therefore, the proteoglycans in these fractions were digested with chondroitinase ABC and the resulting core glycoproteins were separated by SDS-PAGE (6% polyacrylamide). The core glycoprotein was transferred to a PVDF membrane and a 120 kDa core glycoprotein band was cut out with a scalpel. The 120 kDa core glycoprotein was labeled with four monoclonal antibodies C1 and C on Western blots.
3, C5 and C15.

Amino acid sequence analysis of this purified 120 kDa core glycoprotein was performed. A fragment of the 120-kDa core glycoprotein was used by Scott et a
It was obtained by treatment with cyanogen bromide (CNBr) as described in the article (l) (l). Complete core glycoprotein and its fragments were SDS-PAGE as described above.
Separated. Then, the protein and its fragment were added to a 10 mM CAPS (3- (cyclohexylamino) propanesulfonic acid) buffer solution (pH containing 10% methanol).
11) PVD at 0.3 A (amps) at 4 ° C for 3 hours
Transferred to F membrane. 0.5% Ponshu Red (Ponce
After staining with 1% acetic acid containing au Red), the protein band was excised from the membrane and the amino acid sequence of the protein was analyzed by an automated protein sequencer (PPSQ-10;
Shimadzu).

[0042]

Example 7 Separation of cDNA Library and cDNA Clone 18-day-old (P18) Sprague-Dawle
y) λg constructed using random primers using poly (A) ⁺ RNA obtained from rat whole brain as a template
A t11 cDNA library was used. Other λgt1
1 cDNA library is 8 day old (P8) sprag-
Poly (A) ⁺ RNA obtained from whole brain of Dawley rat
Was used as a template and constructed with oligo (dT) primers. These cDNA libraries were immunologically screened for 1 × 10 6 plaques using a mixture of culture supernatants of monoclonal antibodies C1, C3, C5 and C15. For immunological screening, Sambrook et al. (S
ambrook et al) (Vectastain A) for immunological detection as described in (29).
It was performed using a BC kit.

The first two clones, λNGC1 (from the random primer cDNA library) and (from the oligo-d (T) primer cDNA library).
λNGC3 was isolated by immunological screening and subsequently clones were obtained by plaque hybridization with a ³² P-labeled cDNA probe. CDNA probe for plaque hybridization and north blotting is Megaprime
Labeling was performed using a DNA labeling system (Amersham International). The cDNA insert from the λgt11 clone was purified and pBluescript I
It was subcloned into an I plasmid vector (Stratogene Cloning System).

[0044]

Example 8 Sequencing of DNA For cloning, subcloning was performed by means of restriction enzyme using restriction enzyme. Automatic DNA sequencing
NA sequencer (AlfII / Alfred combined system; Pharmacia) was used using Taq polymerase and dye-labeled primers. Sequence editing and analysis were performed using GENETYX software (Software Development Co., Ltd.). The reading frame was corroborated from our data on the N-terminal amino acid sequence of the 120 kDa core glycoprotein and its fragment obtained by CNBr treatment. GeneBank (Re
lease87) and Swiss-Plot (Swiss-P)
Rot) (Release 31) was compared with the sequence in the sequence search tool (Reference 30).

[0045]

Example 9 Northern Blot Analysis Total RNA was determined by Chomjinsky and Sucky (Chomczyns).
Ky and Sacchi) et al. (Reference 31) extracted from brains of 7-day-old and adult rats as well as kidney, liver, lung and muscle. Poly (A) ⁺ RNA was purified using Oligotex-dT30 (manufactured by Takara Biochemical) according to the method procedure. Poly (A) ⁺ RNA (5 μg) was electrophoresed on a 1% agarose gel containing 2.2 M formaldehyde and transferred (transcribed) to a PVDF membrane (Immobilon-N, Millipore). labeled 682 bp insert from λNGC1 in ³² P-dCTP and 3 × 106 cpm /
Used as a probe at a concentration of ml. This filter is finally 0.2 × SSC (SSC: 0.15 NaCl and 0.015
M sodium acetate) at 68 ° C. and exposed to X-ray film (Fuji Film) for autoradiography.

[0046]

Example 10 Characteristics of Monoclonal Antibody The present inventors have developed four types of hybridoma cell lines (C1,
C3, C5 and C15) were established. Each produced antibodies (monoclonal antibodies C1, C3, C5 and C15) that reacted with a preparation of membrane-bound chondroitin sulfate proteoglycans on Western blots. All four monoclonal antibodies (MAbs) recognized a very broad band corresponding to an average molecular weight of 150 kDa when tested on a membrane-bound chondroitin sulfate proteoglycan preparation used as antigen (Fig. 3A lane 1, MAb C5). Immunoblot). When a preparation of membrane-bound chondroitin sulfate proteoglycans was digested with chondroitinase ABC, a 120 kDa protein band was detected by immunoblotting with MAb C5 (FIG. 3A lane 2 and FIG. 3B lane 1). This band did not move upon treatment with heparitinase (Fig. 3A lane 3). 75 kD when analyzed by Western blot with a large amount of PBS-soluble proteoglycan preparation obtained from the brains of 10-day-old rats.
The core glycoprotein of a was weakly detected in MAb C5. MAb C5 did not react with any proteoglycan core glycoprotein prepared from sources other than the nervous system such as liver, lung, kidney, muscle and cartilage.

To test the possibility that proteoglycans have oligosaccharide side chains in addition to chondroitin sulfate chains,
As shown in FIG. 3B, the core glycoprotein has three glycosidases (neuramidase, O-glycosidase,
N-glycosidase) and the molecular weight of the deglycosylated core protein was determined by SDS-PAGE.
(FIG. 3B lanes 2, 3, 4). Each treatment with glycosidase caused an increase in the mobility of the core protein band on SDS-PAGE. The ability of MAb C5 to recognize the core protein was not affected by digestion with either glycosidase. Therefore, M
The epitope recognized by Ab C5 appears to reside in the polypeptide portion.

The expression of proteoglycans in rat cerebral cortex was examined by immunohistochemical staining with MAb C5. That is, the proteoglycan was associated with developing neurons at 0 days after birth based on the result of immunostaining with MAb C5 (FIG. 4A). A similar staining pattern was also found in postnatal 7-day cerebral cortex (FIG. 4B). In the adult brain, the intensity of cerebral cortex immunostaining was reduced. To quantify transient expression of proteoglycans in the cerebral cortex, PBS-insoluble extracts of cerebral cortex at various developmental stages (embryonic day 12 (E12) to maturity) were digested with chondroitinase ABC and immunobloted. Then, the intensity of the immunolabeled band was quantified. A small amount of proteoglycan was introduced from the 16th day embryo (E16) to the 18th day embryo (E1).
Detected in 8). The amount of proteoglycan increased to reach the maximum level around 20 days after birth (P20) (Fig. 4C). After P20, the amount of proteoglycan decreased. And in the mature cerebral cortex, this proteoglycan was about half the maximum level of expression.

[0049]

Example 11 Separation of cDNA Clones A 120 kDa core glycoprotein was purified and digested into several peptides by treating it with CNBr to obtain the complete core glycoprotein and partial N-terminal amino acid sequences of the two peptides. Decided. The N-terminal sequence of the complete core glycoprotein is VPA in single letter amino acid code.
It was REAGSAIEAEEL. Completely different N
The terminal sequence was found in two products (15 kDa and 24 kDa) digested with CNBr. 15k
(M) V for Da and 24 kDa peptides, respectively
PGGSISLRPRPGDPGKDLA and (M) G
It was RFPGSP.

Four MAbs C1, C3, C5 and C1
Λgt11 induced from P18 rat brain by immunological screening with a mixture of 5
One positive clone (λNGC1) was isolated from the cDNA library (random primer), and the other positive clone (λNGC3) was first extracted from the λgt11 cDNA library (oligo-d (T) primer) derived from P8 rat brain. Isolated. λNGC1 and λNG
C3 contains insert cDNAs of 682 base pairs and 1398 base pairs, respectively (FIG. 5). The fusion protein with β-galactosidase derived from λNGC1 is MA
MAb C3, C5 and C15 react only with b C1
Did not react with. In contrast, the fusion protein derived from λNGC3 reacted with MAbs C3, C5 and C15 but not MAb C1. ΛNGC1 and λNGC3 were added to pBluesc for further analysis.
It was subcloned into a riptII plasmid vector (hereinafter referred to as pNGC1 and pNGC3, respectively). The reliability of these clones was within the range of the amino acid sequences of the 120 kDa core glycoprotein and the 24 kDa CNBr-treated fragment, which were deduced from the insert cDNA in pNGC1 (see the underlined portion in FIG. 6). And was clearly demonstrated by the fact that the amino acid sequence of the 15 kDa CNBr treated fragment matched within the amino acid sequence deduced from the insert cDNA in pNGC3 (see FIG. 6, underlined).

The insert cDNA in pNGC1 was [ ³²
CD labeled with and overlaid with P] -dCTP
Used as a probe to identify NA clones, P
Λgt11 cDNA derived from 18 rat brains
4 kinds of cDNA from library (random primer)
NA clones (λNGC7, λNGC13, λNGC1
5 and λNGC19) contained overlapping cDNA portions and obtained a cDNA encoding all proteoglycan core proteins. Figure 5 shows the positions of the different cDNA clones used for the determination of the complete sequence of proteoglycan, neuroglycan C (NGC).

[0052]

Example 12 Predicted structure of NGC core protein The cDNA sequence encoding all NGC core proteins and the deduced amino acid sequence are shown in FIG. 5 of these clones
It covers more than 2,107 base pairs including the open reading frame that encodes 44 amino acids. The calculated molecular mass is 58,6
It was 12 Da. The 3'untranslated region consists of 463 nucleotides and is a polyadenylation signal (AATAAA).
including. In this coding region, the sequences (underlined parts) of two kinds of products by the cleavage of CNBr were identified. The N-terminal amino acid sequence of the 120-kDa core glycoprotein (the sequence starting at amino acid residue number 31 in FIG. 6 (underlined portion)) was determined. The nucleotide sequence near the ATG triplet starting from the 13th nucleotide corresponds to the sequence corresponding to the translation start site (Reference 32).
The 12 base pairs in the 5'region of the cDNA are the 5'untranslated region. There is a hydrophobic amino acid sequence from the first methionine to the first amino acid residue (valine) of the mature core protein, which is probably the signal peptide sequence. Analysis of whether the predicted protein amino acid sequence is hydrophobic or hydrophilic by the method of Kyte and Doolittle et al. (Reference 33) (FIG. 2) shows 24 basic amino acids following two basic residues (FIG. 6). Amino acid residue number of 426-450)
A second hydrophobic sequence was revealed near the carboxyl terminus (Fig. 6, dashed line). This sequence is based on Sabatini et al.
This is in agreement with the property for the transmembrane domain proposed by et al) (ref. 34).

NGC core glycoproteins are glycine (10.5%), leucine (9.9%), proline (9.0
%), Glutamic acid (8.1%), serine (7.9%) and threonine (7.7%) residues. The calculated pI of NGC is 4.9. A total of 10 cysteine residues were found in core glycoprotein.
All of these are located in the center of NGC and are located outside the cell with respect to the transmembrane domain. The Putative Extracellular Domain of NGC Core Glycoprotein Includes Three N-Glycosylated Sites (Reference 35) and O
-Three serine-threonine clusters capable of binding to sugar chains (amino acid residue numbers 143-144, 18 in Fig. 6)
8-189 and 271-272) (Reference 36).

The N-terminal region of amino acid number residues 31 to 281 in FIG. 6 contains eight serine-glycine (SG) or glycine-serine (GS) dipeptide sequences. These dipeptides are considered to be core-site sequences that match the binding site of chondroitin sulfate (References 18, 37). The amino acid sequences around these eight serine residues are SGXG (Reference 37) and (E / D) GS.
It is different from the sequence corresponding to the binding site of glycosaminoglycan shown in G (E / D) (Reference 18). However, these corresponding sequences are not the only sequences that glycosaminoglycans can bind to the core protein. For example, in neurocan, the sequence near the serine residue to which the chondroitin sulfate chain is bound is EEVASGQED
(Reference 16). Amino acid sequences characteristic of chondroitin sulfate binding sites in proteoglycans such as aggrecan, versican, syndecan, decorin and type IX collagen have been reported to be preceded by SG / GS and acidic amino acid residues (Figure 7). The importance of acidic amino acid residues in the binding of chondroitin sulphate has also been described elsewhere (refs. 18, 37, 3).
8). The sequences corresponding to these are aligned near the eight SG / GS-dipeptides of the NGC core protein. NGC
Contains two additional dipeptide sequences in the predicted extracellular domain (serine residues 341 and 374 in FIG. 2). However, these dipeptides were not associated with the sequence corresponding to the binding site for chondroitin sulfate. Therefore, the N-terminal domain was designated as the putative chondroitin sulfate binding domain. Short sequence KR of basic amino acids
RKRRRRIR (amino acid residue number 282-2 in FIG. 6
91) was found in close proximity to the tentative chondroitin sulfate binding domain (double underlined). Further, after a short sequence of basic amino acids, 133 amino acids including 10 cysteine residues (amino acid residue number 292-in FIG. 6).
425) was found.

The cytoplasmic domain of NGC also contains serine and threonine residues, which are sites that can be phosphorylated by protein kinases. Amino acid residue number 46 in FIG.
Amino acid sequence near the 5th threonine residue (KLRRT
NK) and the amino acid sequence near the serine residue at position 521 (S
PK) is a sequence (X (R / K) XX (T / S) X (R / R) corresponding to the phosphorylation site by protein kinase C proposed by Graff et al (Reference 42).
K)) is similar. Although it has not been determined whether NGCs are phosphorylated, it is possible that NGCs are involved in signal transduction. Temporary cytoplasmic domain is 2
Contains two tyrosine residues. However, the sequences connecting these tyrosine residues differ from the corresponding sequences reported for tyrosine phosphorylation (43). FIG. 8 is a schematic representation of the proposed domain structure of the NGC core protein.

A database search at the amino acid level shows that a small site of NGC is similar to the core protein of aggrecan and cartilage chondroitin sulfate proteoglycan (Reference 44). This similar region is all distributed within the putative extracellular domain of NGC. In the putative chondroitin sulfate binding domain, 11 homologous clusters were identified: amino acid residues 45-94 in Figure 2 of NGC and residues 907-9 of aggrecan.
56 (32% identity / 48% chemical similarity); the same applies to the residue numbers and their identities and similarities, 26-70 and 967-1011 (29% / 56%); 53-103. 955-1005 (22% / 47%); 88-113 and 1585-1610 (42% / 54%); 117-
151 and 1649-1683 (31% / 40%); 43
-92 and 1130-1179 (28% / 38%); 50
-94 and 892-936 (27% / 47%); 59-1
08 and 1233-1282 (22% / 44%); 122
-163 and 1293-1337 (29% / 36%); 1
09-153 and 1705-1749 (31% / 40
%); And 90-114 and 1108-1132 (32%
/ 56%). All homologous clusters in aggrecan are localized to the putative chondroitin sulfate binding site domain. In the cysteine containing domain of NGC we found three homologous clusters: amino acid residue number 287 in FIG.
-322 and 1827 and 1862 (31% identity / 42%
Chemical similarity); and so on, 348-386 and 1898.
-1936 (23% / 38%); and 401-411 and 1998-2008 (55% / 55%). All of the corresponding homologous clusters in aggrecan are also localized to one of the cysteine-containing domains of aggrecan. A schematic sequence of homologous sequences of rat aggrecan and NGC is shown in FIG. Aggrecan consists of several structurally distinct domains,
That is, the immunoglobulin-like domain and the hyaluronan-binding region in the N-terminal region are repeated twice, the central chondroitin sulfate-binding site domain and the EGF-like domain,
It consists of a lectin-like domain and a complement regulatory protein-like domain at the carboxy-terminal site (Reference 44) (see Figure 9). Some other chondroitin sulfate proteoglycans, such as versican (ref. 18), neurocan (ref. 16), brevican (ref. 17) and BEHA.
B (Reference 19) likewise contains these domains. Therefore, they are all considered to be members of the aggrecan family. NGC is not a member of this family because the NGC core protein does not have any of these domains except the chondroitin sulfate binding domain (Figure 9).

[0057]

Example 13 Northern Blot Analysis The tissue distribution of NGC mRNA was examined by Northern blot analysis (FIG. 10), showing a 3.1 kb single transcript of 7
It was detected by analysis of the brain of day-old and adult rats. NG here
The difference in length between the C coding region and the NGC mRNA is attributed to the presence of 5'untranslated region and 3'uncoding region (Fig. 5, arrow) in the mRNA. This transcript was not detected in kidney, liver, lung and muscle analyses.

[0058]

Example 14 Cloning of human-derived NGC The ³² P-labeled cDNA probe was used for DN of rat NGC.
It was prepared based on the A fragment (restriction enzyme XbaI-HindIII digested DNA fragment: base numbers 624 to 1735 of Sequence Listing 1). Using this as a probe, a commercially available cDNA library (Stratagene Cl) prepared from the temporal cortex of a 2-year-old healthy woman was used.
oning System) was used to isolate a clone having a highly homologous base sequence by plaque hybridization. As a host for plaque hybridization, Escherichia coli XL-1 blue MRF '(Stratagene Cl
oning System) was used. The hybridization conditions were 60 ° C. and 3 × SSC (SSC: 0.15M NaCl, 0.015M sodium acetate), and washing was performed at 60 ° C. and 0.1 × SSC. The isolated DNA clone is pBluescriptII (St
ratagene Cloning System).

The nucleotide sequence of the DNA was determined in the same manner as in Example 8. CDNA encoding all core proteins of NGC
The A sequence and the deduced amino acid sequence are shown in SEQ ID NO: 2. These clones cover over 1740 base pairs containing an open reading frame encoding 545 amino acids. The calculated molecular weight of the protein is
It was 58538.89 (excluding three undetermined amino acid residues).
The homology with the rat NGC gene was 83.6%. In addition, the amino acid sequence deduced from the nucleotide sequence of human-derived NGC-encoding DNA is also shown in SEQ ID NO: 2. The homology with rat NGC was 83.9%.

[0060]

INDUSTRIAL APPLICABILITY Since the novel chondroitin sulfate proteoglycans of the present invention are considered to contribute to the normal formation of neural networks, they can be used for the development of new diagnostic methods for neurological diseases and the prevention and treatment of neurological diseases.

Reference 1. Ruoslahti, E. (1989) J. Biol. Chem. 264, 13369-
13372 2. Ruoslahti, E. and Yamaguchi, Y. (1991) Cell 64,
867-869 3. Oohira, A., Matsui, F., Matsuda, M., Takida, Y.
and Kuboki, Y. (1988) J. Biol. Chem. 263, 10240-10
246 4. Herndon, ME and Lander, AD (1990) Neuron
4, 949-961 5. Maeda, N., Matsui, F. and Oohira, A. (1992) De
v. Biol. 151, 564-574 6. Sur, M., Frost, DO and Hockfield, S. (1988)
J. Neurosci. 8, 874-882 7. Crossin, KL, Hoffman, S., Tan, S.-S. and Ede
lman, GM (1989) Dev. Biol. 136, 381-392 8. Oohira, A., Matsui, F., Watanabe, E., Kushima,
Y. and Maeda, N. (1994) Neuroscience 60, 145-157 9. Watanabe, E., Aono, S., Matsui, F., Yamada, Y.,
Naruse, I. and Oohira, A. (1995) Eur. J. Neurosc
i. 7, 547-554 10. Lander, AD, Fujii, DK and Reichardt, L.
F. (1985) Proc. Natl. Acad. Sci. USA 82, 2183-2187

11. Riopelle, RJ and Dow, KE (19
90) Brain Res. 525, 92-100 12. Cole, GJ and McCabe, CF (1991) Neuron 7,
1007-1018 13. Oohira, A., Matsui, F. and Katoh-Semba, R. (19
91) J. Neurosci. 11, 822-827 14. Grumet, M., Flaccus, A. and Margolis, RU (1
993) J. Cell Biol. 120, 815-824 15. Dou, C.-L. and Levine, JM (1994) J. Neurosc
i. 14, 7616-7628 16. Rauch, U., Karthikeyan, L., Maurel, P., Margol
is, RU and Magolis, RK (1992) J. Biol. Chem.
267, 19536-19547 17. Yamada, H., Watanabe, K., Shimonaka, M. and Ya
maguchi, Y. (1994) J. Biol. Chem. 269, 10119-10126 18. Zimmermann, DR and Rouslahti, E. (1989) EMB
O J. 8, 2975-2981 19. Jaworski, DM and Kelly, GM (1994) J. Cel
l Biol. 125, 495-509 20. Carey, DJ, Evans, DM, Stahl, RC, Asun
di, VK, Conner, KJ, Garbes, P. and Cizmeci-Sm
ith, G. (1992) J. Cell Biol. 117, 191-201

21. Maurel, P., Rauch, U., Flad, M., M
argolis, RK and Margolis, RU (1994) Proc. Nat
l. Acad. Sci. USA 91, 2512-2516 22. Maeda, N., Hamanaka, H., Shintani, T., Nishiwa
ki, T. and Noda, M. (1994) FEBS Letters 354, 67-70 23. Nishiyama, A., Dahlin, KJ, Prince, JT, J
ohnstone, SR and Stallcup, WB (1991) J. Cell
Biol. 114, 359-371 24. Karthikeyan, L., Maurel, P., Rauch, U., Margol
is, RK and Margolis, RU (1992) Biochem. Biop
ys. Res. Commun. 188, 395-401 25. Stripp, CS, Litwack, ED and Lander, A.
D. (1994) J. Cell Biol. 124, 149-160 26. Bitter, T. and Muir, HE (1962) Anal. Bioche
m. 4, 330-334 27. Watanabe, E., Fujita, SC, Murakami, F., Hay
ashi, M. and Matsumura, M. (1989) Neuroscience 29,
645-657 28. Scott, MG, Crimmins, DL, McCourt, DW,
Tarrand, JJ, Eyerman, MC and Nahm, MH (1
988) Biochem. Biophys. Res. Commun. 155, 1353-1359 29. Sambrook, J., Fritsch, EF and Maniatis, T.
(1989) Molecular Cloning: a Laboratory Manual, 2nd
Ed., Cold Spring Harbor Laboratory Press, Cold Sp
ring Harbor, NY 30. Altschul, SF, Gish, W., Miller, W., Myers,
EW and Lipman, DJ (1990) J. Mol. Biol. 215,
403-410

31. Chomczynski, P. and Sacchi, N. (19
87) Anal. Biochem. 162, 156-159 32. Kozak, M. (198
4) Nucleic Acids Res. 12, 857-872 33. Kyte, J. and Doolittle, RF (1982) J. Mol. B
iol. 157, 105-132 34. Sabatini, DD, Kreibich, G., Morimoto, T. an
d Adesnik, M. (1982) J. Cell Biol. 92, 1-22 35. Hubbard, SC and Ivatt, RJ (1981) Ann. Re
v. Biochem. 50, 555-583 36. Tomita, M., Furthmayr, H, and Marchesi, VT
(1978) Biochemistry 17, 4756-4770 37. Bourdon, MA, Krusius, T., Campbell, S., Sch
wartz, NB and Ruoslahti, E. (1987) Proc. Natl.
Acad. Sci. USA 84, 3194-3198 38. Krueger Jr, RC, Fields, TA, Hildreth IV,
J. and Scwartz, NB (1990) JB Biol. Chem. 26
5, 12075-12087 39. Doolittle, RF, Feng, DF and Johnson, M.
S. (1984) Nature 307,558-560 40. William, AF and Barklay, AN (1988) Annu.
Rev. Immunol. 6, 381-405

41. Naeme, PJ, Christopher, JE a
nd Baker, JR (1986) J. Biol. Chem. 261, 3519-35
35 42. Graff, JM, Stumpo, DJ and Blackshear, P.
J. (1989) J. Biol. Chem. 264, 11912-11919 43. Kemp, BE and Pearson, RB (1990) Trends B
iochem. Sci. 15, 342-346 44. Doege, KJ, Sasaki, M., Kimura, T. and Yamad
a, Y. (1991) J. Biol. Chem. 266, 894-902 45. Bernfield, M., Kokenyasi, R., Kato, M., Hinke
s, MT, Spring., J., Gallo, RJ and Lose, EJ
(1992) Annu. Rev. Cell. Biol. 8, 365-398 46. Levine, JM and Card, JP (1987) J. Neuros
ci. 7, 2711-2720 47. Goldstein, LA, Zhou, LJ, Picker, CN,
Mintry, RF, Bargatze, RF, Ding, JF and Bu
tcher, EC (1989) Cell 56, 1063-1072 48. Jackman, RW, Beeler, DL, Van de Water,
L. and Rosenberg, RD (1986) Proc. Natl. Acad. Sc
i. USA 83, 8834-8838 49. Barnea, G., Grumet, M., Milev, P., Silvennoine
n, O., Levy, JB, Sap, J. and Schlessinger, J.
(1994) J. Biol. Chem. 269, 14349-14352 50. Strubin, M., Mack, B. and Long, EO (1984) E
MBO J. 3, 869-972

51. Segrest, JP and Jackson, RL
(1972) Methods Enzymol. 28, 54-63 52. Saunders, S., Jalkanen, M., O'Farrell, S. and
Bernfield, M. (1989) J. Cell Biol. 108, 1547-1556 53. Breuner, B., Quentin, E., Cully, Z., Gotte, M.
and Kresse, H. (1991) J. Biol. Chem. 266, 13224-13
232 54. Hawkins, RL and Seeds, NW (1986) Brain R
es. 398, 63-70 55. Jalink, K. and Moolenaar, WH (1992) J. Cell
Biol. 118, 411-419 56. Monard, D., Niday, E., Limat, A. and Solomon,
F. (1983) Prog. BrainRes. 58, 359-364 57. Monard, D. (1988) Trends Neurosci. 11, 541-544 58. Pottman, RN, Ivins, JK and Buettner, H.
M. (1989) J. Neurosci. 9, 4269-4280 59. Suiden, HS, Stone, SR, Hemmings, B, A. a
nd Monard, D. (1992) Neuron 8, 363-375 60. Matsui, F., Watanabe, E. and Oohira, A. (1994)
Neurochem. International 25, 425-431

61. Doege, K., Sasaki, M., Horigan,
E., Hassel, JR and Yamada, Y. (1987) J. Biol. C
hem. 262, 17757-17767 62. Huber, S., Winterhalter, KH and Vaughan, L.
(1988) J. Biol. Chem. 263, 752-756 63. Kurusius, T. and Rouslahti, E. (1986) Proc. N
atl. Acad. Sci. USA 83, 7683-7687

[0068]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 2107 Sequence type: Nucleic acid Number of strands: Single strand Topology: Linear Sequence type: cDNA Origin: Rat brain Sequence: GGG CTC CGC GCA ATG GGC CGA GCT GGA GGC GGG GGC CCG GGC 42 Met Gly Arg Ala Gly Gly Gly Gly Pro Gly -30 -25 TGG GGG CCG CCG CCA GTG CTG CTG CTT CTG GGG GTC ACG CTG GTG 87 Trp Gly Pro Pro Pro Leu Leu Leu Leu Gly Val Thr Leu Val -20 -15 -10 CTC ACC GCT GGG GCT GTA CCG GCA CGG GAA GCA GGC AGT GCG ATC 132 Leu Thr Ala Gly Ala Val Pro Ala Arg Glu Ala Gly Ser Ala Ile -5 -1 1 5 10 GAG GCT GAA GAG CTG GTG AGG AGC GGC CTT GCA TGG GAG TCG CGT 177 Glu Ala Glu Glu Leu Val Arg Ser Gly Leu Ala Trp Glu Ser Arg 15 20 25 GCC AAT GAC ACG CGG GAG GAA GCT GGC CTG CCA GCA GCA GGG GAA 222 Ala Asn Asp Thr Arg Glu Glu Ala Gly Leu Pro Ala Ala Gly Glu 30 35 40 GAT GAG ACC TCG TGG ACA GAG CGG GGC AGT GAG CTG GCT GCG GTG 267 Asp Glu Thr Ser Trp Thr Glu Arg Gly Ser Glu Leu Ala Ala Val 45 50 55 GGC CCT GGG GTC GGG CCA GAG GAG ACA CTA GAG GCA TCG GCT GCA 312 Gly Pro Gly Val Gly Pro Glu Glu Thr Leu Glu Ala Ser Ala Ala 60 65 70 GTG ACT GGG ACT GCC TGG CTA GAG GCA GAT GGC ACA GGC CTG GGT 357 Val Thr Gly Thr Ala Trp Leu Glu Ala Asp Gly Thr Gly Leu Gly 75 80 85 GGA GTG ACT GCA GAG GCT GGT AGT GGC GAC GCC CAG ACC CTT CCA 402 Gly Val Thr Ala Glu Ala Gly Ser Gly Asp Ala Gln Thr Leu Pro 90 95 100 GCT ACA CTC CAG GCT CCT GAC GAG GCC CTT GGG TCA TCT ACA ATG 447 Ala Thr Leu Gln Ala Pro Asp Glu Ala Leu Gly Ser Ser Thr Met 105 110 115 CCC CCT GCC ATC CCT GAG GCT ACT GAA GCC AGT GGA CCT CCC TCC 492 Pro Pro Ala Ile Pro Glu Ala Thr Glu Ala Ser Gly Pro Pro Ser 120 125 130 CCC ACC CTC CGT GAT AAA CCT AGC CTA GTC CCT GAA CTC CCT AAG 537 Pro Thr Leu Arg Asp Lys Pro Ser Leu Val Pro Glu Leu Pro Lys 135 140 145 GAG ATC CCC TTG GAA GTT TGG CTG AAC CTG GGA GGC AGC ACA CCT 582 Glu Ile Pro Leu Glu Val Trp Leu Asn Leu Gly Gly Ser Thr Pro 150 155 160 GAC CCT CAA AGG CCA GAG CCT ACT TTT CCC CTT CAG GGC ACT CTA 627 Asp Pro Gln Arg Pro Glu Pro Thr Phe Pro Leu Gln Gly Thr Leu 165 170 175 GAG ACA CAA CCA GCC TCA GAT ATA ATT GAC ATT GAT TAC TTT GAA 672 Glu Thr Gln Pro Ala Ser Asp Ile Ile Asp Ile Asp Tyr Phe Glu 180 185 190 GGA TTG GAT AGC GAG GGC CGA GGC ACA GAC ATG GGC AGG TTC CCG 717 Gly Leu Asp Ser Glu Gly Arg Gly Thr Asp Met Gly Arg Phe Pro 195 200 205 GGC TCA CCA GGA ACC TCA GAA AAT CAC CCT GAT ACT GAA GGA GAG 762 Gly Ser Pro Gly Thr Ser Glu Asn His Pro Asp Thr Glu Gly Glu 210 215 220 ACC CCC TCC TGG AGC CTG CTT GAC TTA TAT GAT GAC TTC ACC CCT 807 Thr Pro Ser Trp Ser Leu Leu Asp Leu Tyr Asp Asp Phe Thr Pro 225 230 235 TTG ATG AGT CTG ATT TCT ACC CCA CCA CAT CCT TCT ATG ATG ACT 852 Leu Met Ser Leu Ile Ser Thr Pro Pro His Pro Ser Met Met Thr 240 245 250 TGG AAG AGG AGG AAG AGG AGG AGG AGG ATA AGG ATG CAG TGG GAG 897 Trp Lys Arg Arg Lys Arg Arg Arg Arg Ile Arg Met Gln Trp Glu 255 260 265 GCG GAG ACC TGG AAG ATG AAA GTG ACC TCC TCC TGC CCT CTC AGA 942 Ala Glu Thr Trp Lys Met Lys Val Thr Ser Ser Cys Pro Leu Arg 270 275 280 AGCCTG GTG TGG GGC CCT GGG ACG GGA CAG CCC ACC AGT CGA TGG 987 Ser Leu Val Trp Gly Pro Gly Thr Gly Gln Pro Thr Ser Arg Trp 285 290 295 CAT GCA GTT CCT CCA CAG CAT ACT CTG GGG ATG GTA CCT GGT GGC 1032 His Ala Val Pro Pro Gln His Thr Leu Gly Met Val Pro Gly Gly 300 305 310 AGC ATC TCT CTT AGG CCC CGC CCT GGA GAT CCA GGC AAG GAC CTG 1077 Ser Ile Ser Leu Arg Pro Arg Pro Gly Asp Pro Gly Lys Asp Leu 315 320 325 GCC ACG AGC GAA AAT GGA ACA GAG TGC CGA GTT GGC TTT GTC AGA 1122 Ala Thr Ser Glu Asn Gly Thr Glu Cys Arg Val Gly Phe Val Arg 330 335 340 CAC AAT GGC TCC TGT CGG TCA GTC TGT GAC CTC TTC CCG AGT TAC 1167 His Asn Gly Ser Cys Arg Ser Val Cys Asp Leu Phe Pro Ser Tyr 345 350 355 TGT CAC AAT GGC GGC CAA TGC TAC CTG GTG GAG AAC ATA GGG GCT 1212 Cys His Asn Gly Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly Ala 360 365 370 TTC TGC AGG TGT AAC ACC CAG GAC TAT ATC TGG CAC AAG GGG ATG 1257 Phe Cys Arg Cys Asn Thr Gln Asp Tyr Ile Trp His Lys Gly Met 375 380 385 CGC TGT GAG TCC ATC ATC ACC GAC TTC CAG GTG A TG TGC GTG GCC 1302 Arg Cys Glu Ser Ile Ile Thr Asp Phe Gln Val Met Cys Val Ala 390 395 400 GTC GGC TCG GCT GCG TTG GTG CTG CTC CTT CTG TTC ATG ATG ACT 1347 Val Gly Ser Ala Ala Leu Val Leu Leu Leu Leu Phe Met Met Thr 405 410 415 GTG TTC TTT GCC AAG AAA CTC TAT CTG CTC AAG ACT GAG AAC ACC 1392 Val Phe Phe Ala Lys Lys Leu Tyr Leu Leu Lys Thr Glu Asn Thr 420 425 430 AAG CTG AGG AGG ACC AAC AAA TTC CGG ACC CCA TCT GAG CTC CAC 1437 Lys Leu Arg Arg Thr Asn Lys Phe Arg Thr Pro Ser Glu Leu His 435 440 445 AAT GAT AAC TTC TCC CTC TCC ACC ATT GCC GAG GGC TCC CAT CCA 1482 Asn Asp Asn Phe Ser Leu Ser Thr Ile Ala Glu Gly Ser His Pro 450 455 460 AAT GAT GAC CCC AGC GCT CCC CAC AAA ATC CAG GAA GCT CTC AAG 1527 Asn Asp Asp Pro Ser Ala Pro His Lys Ile Gln Glu Ala Leu Lys 465 475 475 TCC CGC CTG AAG GAG GAA GAG TCC TTT AAC ATC CAG AAC TCC ATG 1572 Ser Arg Leu Lys Glu Glu Glu Ser Phe Asn Ile Gln Asn Ser Met 480 485 490 TCA CCC AAA CTC GAG GGT GGC AAA GGT GAC CAG GGA TAC TTG GAG 1617 Ser Pro Lys Leu Glu G ly Gly Lys Gly Asp Gln Gly Tyr Leu Glu 495 500 505 GTG AAC TTT CTC CAG AAT AAC CTG ACC TGAGACGGAG GAGGGAGAGG 1664 Val Asn Phe Leu Gln Asn Asn Leu Thr 510 GGAGAGGGGGGTGGGGGAGG GAAGGACCGT GGTCTCCTCT CGTCGACTGAC CTTAAAATAA GCAAAGAAAC CGAGCAGGGT TGCGTACATT GGATGGTTCT 1844 CGTCTGTGCT CTTTGTACGT TGCTTCTACA GCTGTGATTT CTAAGCCTAT GCTGGCACTC 1904 AGCTGACTTG TTTTTTTGGT TTTTTGGTTT TTGTTTTTTC TGGGTTTTTG TTTTGTTTTG 1964 TTTTGTTTTG TTTCTTTGTT TTTTGGTTTG GTTTTTTTTT GTTTGTTTGT TTTTGTTTTT 2024 TTGTACTTTG ACCCACCTTT TTTTGGAATA CCAGTTTAAA AAAACAAAAC AAACAAGGTT 2084 CTTGAAATAA AACTTTTTAA AAA 2107

SEQ ID NO: 2 Sequence Length: 1740 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: cDNA Origin: Human Brain Sequence: ATG GGG CGA GCC GGG GGC GGG GGC CCG GGC CGG GGG CCG CCG CCA CTG 48 Met Gly Arg Ala Gly Gly Gly Gly Pro Gly Arg Gly Pro Pro Pro Leu 1 5 10 15 CTG CTG TTT CTG GGG GCC GCG CTG GTC CTG GSC TCT GGG GCC GTA GCG 96 Leu Leu Phe Leu Gly Ala Ala Leu Val Leu Xaa Ser Gly Ala Val Ala 20 25 30 GCG CGT GAG GCG GGC AGC GCG GTT GAG GCC GAA GAG CTG GTG AAG GGC 144 Ala Arg Glu Ala Gly Ser Ala Val Glu Ala Glu Glu Leu Val Lys Gly 35 40 45 AGC CCG GCG TGG GAG CCG CCT GCC AAC GAC ACG CGG GAA GAA GCC GGC 192 Ser Pro Ala Trp Glu Pro Pro Ala Asn Asp Thr Arg Glu Glu Ala Gly 50 55 60 CCA CCA GCG GCT GGG GAA GAT GAG GCG TCG TGG ACG GCG CCC GGT GGC 240 Pro Pro Ala Ala Gly Glu Asp Glu Ala Ser Trp Thr Ala Pro Gly Gly 65 70 75 80 GAG CTG GCC GCC CGG TGG CGA SCT GCC GGG CCA GAA GAG GTG CTG CAG 288 Glu Leu Ala Ala Arg Trp A rg Xaa Ala Gly Pro Glu Glu Val Leu Gln 85 90 95 GAG CCG GCT GCG GTG ACT GGC ACC GCC TGG CTG GAA GCT GAC AGC CCA 336 Glu Pro Ala Ala Val Thr Gly Thr Ala Trp Leu Glu Ala Asp Ser Pro 100 105 110 GGC CTG GGA GGA GTG ACC GCA GAG GCG GGC AGC GGC GAT GCC CAG GCC 384 Gly Leu Gly Gly Val Thr Ala Glu Ala Gly Ser Gly Asp Ala Gln Ala 115 120 125 CTT CCA GCT ACG CTC CAG GCT CCC CAC GAG GTC CTC GGG CAG TCA ATC 432 Leu Pro Ala Thr Leu Gln Ala Pro His Glu Val Leu Gly Gln Ser Ile 130 135 140 ATG CCC CCT GCC ATT CCT GAG GCT ACA GAG GCC AGC GGG CCA CCC TCC 480 Met Pro Pro Ala Ile Pro Glu Ala Thr Glu Ala Ser Gly Pro Pro Ser 145 150 155 160 CCC ACC CTC CGC GAC AAG CTG AGC CCA GCT TCT GAA CTC CCC AAG GAG 528 Pro Thr Leu Arg Asp Lys Leu Ser Pro Ala Ser Glu Leu Pro Lys Glu 165 170 175 AGC CCC TTG GAG GTT TGG CTG AAC CTG GGG GGC AGC ACA CCC GAC CCT 576 Ser Pro Leu Glu Val Trp Leu Asn Leu Gly Gly Ser Thr Pro Asp Pro 180 185 190 CAA GTG CCA GAG CTG ACT TAC CCA TTT CAG GGC ACC CTG GAG CCC CAA 624 Gln Val Pro Glu Leu Thr Tyr Pro Phe Gln Gly Thr Leu Glu Pro Gln 195 200 205 CCG GCA TCA GAT ATC ATT GAC ATC GAC TAC TTC GAA GGA CTG GAT GGT 672 Pro Ala Ser Asp Ile Ile Asp Ile Asp Tyr Phe Glu Gly Leu Asp Gly 210 215 220 GAG GGT CGT GGC GCA GAT CTG GGG AGC TTC CCA GGG TCA CCA GGA ACC 720 Glu Gly Arg Gly Ala Asp Leu Gly Ser Phe Pro Gly Ser Pro Gly Thr 225 230 235 240 TCA GAG AAC CAC CCT GAT ACT GAG GGA GAG ACC CCT TCC TGG AGC CTG 768 Ser Glu Asn His Pro Asp Thr Glu Gly Glu Thr Pro Ser Trp Ser Leu 245 250 255 CTT GAC TTA TAC GAT GAT TTC ACC CCT TCG ATG AAT CTG ATT TCT ACC 816 Leu Asp Leu Tyr Asp Asp Phe Thr Pro Ser Met Asn Leu Ile Ser Thr 260 265 270 CCA CCA CAT CCT TTT ATG ATG ACT TGG ATG AAG AGG AGG AGG AAG AGG 864 Pro Pro His Pro Phe Met Met Thr Trp Met Lys Arg Arg Arg Lys Arg 275 280 285 AGG ATG ACA AAG ATG CAG TGG GAG GTG GAG ACC TGG AAG ATG AAA ATG 912 Arg Met Thr Lys Met Gln Trp Glu Val Glu Thr Trp Lys Met Lys Met 290 295 300 AGC TTC TAC TGC CCA CTG GGA AGC CTG GTC TGG GGC CCG GGG ACA GGC 960 SerPhe Tyr Cys Pro Leu Gly Ser Leu Val Trp Gly Pro Gly Thr Gly 305 310 315 320 CAG CCC ACC AGT CGG TGG CAT GCT GTC CCT CCA CAG CAC ACT CTG GGG 1008 Gln Pro Thr Ser Arg Trp His Ala Val Pro Pro Gln His Thr Leu Gly 325 330 335 TCG GTC CCC GGC AGC AGC ATC GCC CTC AGG CCC CGC CCA GGA GAG CCA 1056 Ser Val Pro Gly Ser Ser Ile Ala Leu Arg Pro Arg Pro Gly Glu Pro 340 345 350 GGC AGG GAC TTG GCC TCC AGT GAA AAT GGC ACT GAG TGC CGC AGT GGC 1104 Gly Arg Asp Leu Ala Ser Ser Glu Asn Gly Thr Glu Cys Arg Ser Gly 355 360 365 TTT GTG CGG CAT AAC GGC TCC TGC CGG TCA GTG TGC GAC CTC TTC CCA 1152 Phe Val Arg His Asn Gly Ser Cys Arg Ser Val Cys Asp Leu Phe Pro 370 375 380 AGT TAC TGT CAC AAT GGC GGC CAG TGC TAC CTG GTG GAG AAC ATA GGG 1200 Ser Tyr Cys His Asn Gly Gly Gln Cys Tyr Leu Val Glu Asn Ile Gly 385 390 395 400 GCC TTC TGC AGG TGC AAC ACG CAG GAC TAC ATC TGG CAC AAG GGG ATG 1248 Ala Phe Cys Arg Cys Asn Thr Gln Asp Tyr Ile Trp His Lys Gly Met 405 410 415 CGC TGC GAG TCC ATC ATC ACC GAC TTC CAG GTG ATG TG C GTB GCC GTG 1296 Arg Cys Glu Ser Ile Ile Thr Asp Phe Gln Val Met Cys Val Ala Val 420 425 430 GGC TCG GCT GCC CTC GTC CTG CTC CTG CTC TTC ATG ATG ACG GTG TTC 1344 Gly Ser Ala Ala Leu Val Leu Leu Leu Leu Phe Met Met Thr Val Phe 435 440 445 TTT GCC AAG AAG CTC TAC CTG CTC AAG ACG GAG AAT ACC AAG CTG CGT 1392 Phe Ala Lys Lys Leu Tyr Leu Leu Lys Thr Glu Asn Thr Lys Leu Arg 450 455 460 AGG ACC AAC AAA TTC CGG AMC CCA TCT GAG CTC CAC AAT GAT AAC TTC 1440 Arg Thr Asn Lys Phe Arg Xaa Pro Ser Glu Leu His Asn Asp Asn Phe 465 470 475 480 TCC CTC TCC ACC ATT GCC GAG GGC TCT CAC CCA AAT GAT GAC CCC AGT 1488 Ser Leu Ser Thr Ile Ala Glu Gly Ser His Pro Asn Asp Asp Pro Ser 485 490 495 GCT CCC CAC AAA ATC CAG GGG GTT CTC AAG TCC TGC CTG AAG GAG GAG 1536 Ala Pro His Lys Ile Gln Gly Val Leu Lys Ser Cys Leu Lys Glu Glu 500 505 510 GAG TCA TTT AAC ATC CAG AAC TCC ATG TCG CCC AAA CTT GAG GGT GGC 1584 Glu Ser Phe Asn Ile Gln Asn Ser Met Ser Pro Lys Leu Glu Gly Gly 515 520 525 AAA GGT GAC CAG GCT GAC CTG GAT GTG AAC TGT CTT CAG AAT AAT TTA 1632 Lys Gly Asp Gln Ala Asp Leu Asp Val Asn Cys Leu Gln Asn Asn Leu 530 535 540 ACC TAA AGC AGA GCA AGA AGA GAG GAA GCG GGG TAG TGG GTG GGG GTA 1680 Thr *** Ser Arg Ala Arg Arg Glu Glu Ala Gly *** Trp Val Gly Val 545 (stop) 550 555 560 GGG AAG AAA CAT TAT CTC CTC TTG TAC AGA GTC TAT TTC TTG TAA CCA 1728 Gly Lys Lys His Tyr Leu Leu Leu Tyr Arg Val Tyr Phe Leu *** Pro 565 570 575 TTT GTT AAA CTC 1740 Phe Val Lys Leu 580

[Brief description of the drawings]

FIG. 1 shows a schematic diagram of the chondroitin sulfate proteoglycan of the present invention. It consists of a CS-attachment domain, a basic amino acid cluster domain, a cysteine containing domain, a transmembrane domain and a cytoplasmic amino acid sequence domain.

FIG. 2 shows the results of hydrophobicity and hydrophilicity analysis of the amino acid sequence of chondroitin sulfate proteoglycan of the present invention. The horizontal axis represents the amino acid residue numbers shown in FIG. 6, the vertical axis represents minus hydrophobicity, and plus represents hydrophilicity.

FIG. 3 shows an electrophoretogram of membrane-bound chondroitin sulfate proteoglycans partially purified from 10-day-old rats on a polyacrylamide gel.

FIG. 4 shows the expression pattern of NGC in rat cerebral cortex. (A) Anterior segment of cerebral cortex of 0-day-old rat was subjected to MAb C
Immunostained in 5. (B) Anterior section of cerebral cortex of 7-day-old rat was subjected to MAb C
Immunostained in 5. (C) Changes in the relative abundance of core glycoprotein of the proteoglycan of the present invention.

FIG. 5 shows a clone encoding the rat NGC of the present invention.

FIG. 6 shows the cDNA sequence and deduced amino acid sequence of rat NGC of the present invention. The single letter notation was used for amino acids.

FIG. 7 shows the amino acid sequences of glycosaminoglycan-binding or binding sites of rat NGC, versican, aggrecan, neurocan, syndecane, decorin and type IX collagen of the present invention.

FIG. 8 shows a schematic diagram of the structure of NGC core protein.

FIG. 9 shows a comparison between the amino acid sequence of rat NGC and the amino acid sequence of rat aggrecan (Reference 61). NGC
A line was drawn between the central regions of similar clusters of rat and aggrecan. CS, CS1, CS2 and CS3 are chondroitin sulfate binding domains, IG is an immunoglobulin-like domain, H1 and H2 are hyaluronan binding domains, KS is a keratan sulfate binding domain, G
(ELC) indicates a globular domain including an EGF-like domain, a lectin-like domain and a complement regulatory protein-like domain, G indicates a globular domain, T indicates a transmembrane domain, and CP indicates a cytoplasmic domain. The number of amino acid residues is shown on a scale.

FIG. 10: Northern of NGC mRNA from 7-day-old rat brain (B7), adult rat brain (Ba), adult rat kidney (K), liver (Li), lung (Lu) and muscle (M). The blot is shown.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C12P 21/08 G01N 33/53 V G01N 33/53 9282-4B C12N 15/00 ZNAA // (C12P 21/08 C12R 1:91)

Claims (13)

[Claims] 1. A chondroitin sulfate proteoglycan comprising a core protein and a sugar chain having the following properties. (A) Primary structure of core protein: 1st valine (Val) to 514th threonine (T
It has an amino acid sequence up to hr) or an amino acid sequence having homology thereto. (B) Sugar chain: Contains chondroitin sulfate having a molecular weight of about 30 kilodaltons. (C) When a neuraminidase, O-glycosidase or N-glycosidase is allowed to act on this proteoglycan, sugar chains are released. 2. The chondroitin sulfate proteoglycan according to claim 1, which has a molecular weight of about 150 kilodaltons in sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing conditions. 3. A glycoprotein having the following properties: (A) molecular weight: (a) sodium dodecyl sulfate-polyacrylamide gel electrophoresis under reducing conditions of about 12
Forming a band of 0 kilodalton, (b) after enzymatic reaction of neuraminidase, O-glycosidase and N-glycosidase, forming a band of about 100 kilodalton under reducing conditions by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, (B) Protein primary structure: SEQ ID NO: 1 from the first valine (Val) to the 514th threonine (Th)
It has an amino acid sequence up to r) or an amino acid sequence having homology thereto. 4. The first valine (V of SEQ ID NO: 1 in the sequence listing)
al) to the 514th threonine (Thr), or a protein containing an amino acid sequence having homology thereto and optionally having a sugar chain. 5. An amino acid sequence from the 252nd lysine (Lys) to the 398th cysteine (Cys) of SEQ ID NO: 1 in the Sequence Listing or an amino acid sequence having homology thereto, which may have a sugar chain. protein. 6. An amino acid sequence from the 31st valine (Val) to the 545th threonine (Thr) of SEQ ID NO: 2 in the sequence listing or an amino acid sequence having homology thereto, which may have a sugar chain. protein. 7. An amino acid sequence from the 283rd lysine (Lys) to the 429th cysteine (Cys) of SEQ ID NO: 2 in the sequence listing or an amino acid sequence having homology thereto, which may have a sugar chain. protein. 8. An amino acid sequence having an amino acid sequence common to the amino acid sequence shown in SEQ ID NO: 1 and the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing, even if it has a sugar chain. Good protein. 9. The first valine (V of SEQ ID NO: 1 in the sequence listing)
DNA containing a nucleotide sequence encoding an amino acid sequence from al) to the 514th threonine (Thr) or an amino acid sequence having homology thereto. 10. A DNA comprising a nucleotide sequence encoding an amino acid sequence from the 252nd lysine (Lys) to the 398th cysteine (Cys) of SEQ ID NO: 1 in the Sequence Listing or an amino acid sequence having homology thereto. 11. A DNA containing a nucleotide sequence encoding an amino acid sequence from the 31st valine (Val) to the 545th threonine (Thr) of SEQ ID NO: 2 in the Sequence Listing or an amino acid sequence having homology therewith. 12. A DNA containing a base sequence encoding an amino acid sequence from the 283rd lysine (Lys) to the 429th cysteine (Cys) of SEQ ID NO: 2 in the Sequence Listing or an amino acid sequence having homology thereto. 13. A mammal other than human can be immunized with the proteoglycan, protein or peptide fragment thereof according to any one of claims 1 to 8 and collected from the body fluid of the animal, or An antibody produced by an antibody-producing cell of an animal, which reacts with the proteoglycan and / or the protein.