JPH0898699A - Penicillin-resistant streptococcus pneumoniae gene fragement and its utilization - Google Patents

Abstract

PURPOSE: To obtain the subject new gene having a specific base sequence or a base sequence complementary therewith, capable of simply, accurately and early judging penicillin-resistant streptococcus pneumoniae which has been judged to be penicillin sensitive and enabling adequate chemotherapy. CONSTITUTION: This new penicillin-resistant streptococcus pneumoniae gene fragment has a base sequence expressed by formula I or a base sequence complementary therewith or a base sequence consisting of at least 10 or more bases in a base sequence expressed by formula II or a base sequence complementary therewith. A penicillin-resistant streptococcus pneumoniae which has been judged hitherto to have no resistance to penicillin can accurately, simply and early be detected to have resistance to penicillin using the gene fragment as a primer or probe for detecting the penicillin-resistant streptococcus pneumoniae. The gene fragment is obtained by separating penicillin-resistant streptococcus pneumoniae, extracting the chromosomal DNA, determining the gene sequences, finding a sequence having a new variation characteristic to high resistance against penicillin and synthesizing this region.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to nucleic acid fragments, peptides and DNA useful for detecting penicillin-resistant Streptococcus pneumoniae.
The present invention relates to a probe and a primer, and a method for detecting the bacterium using these.

[0002]

PRIOR ART AND PROBLEM TO BE SOLVED BY THE INVENTION 196
Since the pneumococcus resistant to penicillin was reported in Australia in 7 years, isolation of this resistant strain has been reported all over the world, and the number is increasing year by year.

Penicillin-resistant Streptococcus pneumoniae is exactly β-lactam-resistant Streptococcus pneumoniae because it shows crossability to all β-lactam agents currently in clinical use. Furthermore, many strains are resistant to drugs other than β-lactam drugs, which is a clinically serious problem.

In this situation, there is a demand for a rapid and highly sensitive method for detecting penicillin-resistant Streptococcus pneumoniae.
In the conventional drug susceptibility test, there were problems in rapidity and reproducibility, and it was difficult to say that it was a satisfactory method.

On the other hand, from the study of the mechanism of penicillin-resistant Streptococcus pneumoniae, it was considered that the mutation in the penicillin-binding protein, which is the target enzyme of β-lactam agents, is directly involved in the resistance. That is, there are six types of pneumococcal penicillin-binding proteins, PBP1A, 1B, 2A, 2B, 2X and 3, and most of the penicillin-resistant pneumococci isolated in various parts of the world have an affinity for PBP1A, 2X / 2A, 2B. In many cases, the sex is decreasing at the same time. Subsequent studies confirmed that there was a site (resistance block) whose nucleotide sequence was significantly different from that of the PBP 2B gene of the susceptible bacterium in a certain region of the PBP 2B gene of the penicillin-resistant bacterium (Dowson, CG. , Et al. Pro
c, Natl. Acad. USA 86 , 8842-8
846 (1989)). The mutation is roughly divided into Cl
There are two types, ass A and Class B, suggesting that their mutations are closely associated with resistance.
In addition, mutations were found in many penicillin-resistant Streptococcus pneumoniae strains isolated in Japan and could not be detected in susceptible strains, supporting the association between these gene mutations and resistance. (Shimizu et al., 42nd Annual Meeting of the Japanese Society of Infectious Diseases East Japan Regional Assembly (199
3)).

From this, it was considered that penicillin-resistant Streptococcus pneumoniae can be detected rapidly and with high sensitivity by detecting the above-mentioned two types of gene mutations. It turns out that they do not always match. Therefore, the discovery of a gene fragment having a higher correlation with a clinically important highly resistant bacterium and an accurate method for detecting penicillin-resistant Streptococcus pneumoniae using this gene fragment has been desired.

[0007]

Therefore, as a result of investigating the correlation between the drug susceptibility of clinically isolated resistant strains and the above-mentioned gene mutation, the present inventor has found that, despite the high resistance, a novel strain that does not have the above-mentioned mutation. When a large number of resistant strains of Escherichia coli were isolated and the gene sequence of this strain was determined, it was found that the nucleic acid fragment having the nucleotide sequence represented by SEQ ID NO: 1 shown below is characteristic of highly resistant penicillin. It was found that, for example, the resistant bacterium can be detected rapidly and with high sensitivity, and the resistant amino acid sequence of the peptide encoded by the gene can be used to rapidly detect a resistant strain by an immunological method, thus completing the present invention. did.

That is, the present invention provides a base sequence represented by SEQ ID NO: 1 or a base sequence complementary thereto, or a base sequence consisting of at least 10 bases of the base sequence represented by SEQ ID NO: 3 or a complementary sequence thereto. A nucleic acid fragment having a unique base sequence is provided.

The present invention also provides a primer or probe for detecting a penicillin-resistant Streptococcus pneumoniae selected from the above nucleic acid fragments, a method for detecting the resistant bacterium using the primer or probe, and a kit for detecting the resistant bacterium. is there.

Further, the present invention is a peptide having at least 4 or more amino acid sequences of the amino acid sequence represented by SEQ ID NO: 2 or the amino acid sequence represented by SEQ ID NO: 4,
Also provided are an immunological detection method and a kit for immunological detection of penicillin-resistant Streptococcus pneumoniae using the peptide or an antibody against the peptide.

The nucleic acid fragment of the present invention which has the nucleotide sequence represented by SEQ ID NO: 1 and the nucleic acid fragment which has the nucleotide sequence represented by SEQ ID NO: 3 are, for example, the following (1):
It can be separated and determined by the steps (2) and (3).

(1) Isolation of pneumococci having penicillin resistance despite having no known mutated gene,
(2) A mutant gene other than a known mutant gene is separated and determined from the gene of the isolate, and (3) a nucleic acid fragment necessary for detecting the novel mutant gene is then designed and determined. Hereinafter, this step will be described in more detail.

(1) Isolation of Penicillin-Resistant Streptococcus pneumoniae Having No Known Mutant Gene: Isolation of this bacterium can be carried out by, for example, examining the above-mentioned properties from the correlation of a known PBP2B gene mutation in a drug susceptibility test. It is carried out by separating the strains that it has. That is, for many clinical isolates, three kinds of primers, a primer for amplifying PBP2B Class A mutant gene, a primer for amplifying PBP2B Class B mutant gene, and a primer for amplifying pneumococcal specific hemolytic enzyme (Autolysin) gene A penicillin-resistant Streptococcus pneumoniae having a PBP2B gene mutation is detected by PCR using. On the other hand, with respect to the same clinical isolate, the presence or absence of penicillin resistance is examined using several kinds of β-lactam antibiotics. By comparing these results, the strain having the above properties is isolated.

(2) Determination of the gene sequence of the isolate obtained in (1): The nucleotide sequence can be partially determined by, for example, the PCR direct sequencing method. The base sequence represented by SEQ ID NO: 1 is the 788 base sequence containing an active serine residue in the KK-3 strain. It was confirmed that this sequence was different from normal, Class A and Class B (see FIGS. 5 and 6).

(3) Design of nucleic acid fragment capable of detecting penicillin-resistant Streptococcus pneumoniae: In order to design a probe from the nucleic acid of SEQ ID NO: 1 or its complementary nucleic acid, it has at least 10 bases of SEQ ID NO: 3 or its complementary sequence. A nucleic acid fragment may be used. On the other hand, for designing a primer from the nucleic acid of SEQ ID NO: 1 or its complementary nucleic acid, for example, P
When gene amplification is performed by the CR method, the gene amplification product may be designed so as to include at least 10 base pairs or more of the base sequence represented by SEQ ID NO: 3. Specifically, in the nucleic acid represented by SEQ ID NO: 1, if one primer (hereinafter abbreviated as primer 1) is designed to include at least 10 bases or more of the base sequence represented by SEQ ID NO: 3, The primer (hereinafter abbreviated as primer 2)) may be selected from any sequence on the 5 ′ side of the sequence complementary to primer 1) in the complementary strand of the nucleic acid represented by SEQ ID NO: 1. Further, in the nucleic acid represented by SEQ ID NO: 1, if the primer 1) is selected from the sequence 5'to the base sequence represented by SEQ ID NO: 3, the primer 2) is selected.
In the complementary strand of the nucleic acid represented by SEQ ID NO: 1 may be selected from the sequence 5 ′ to the complementary sequence of the base sequence represented by SEQ ID NO: 3. The size of the primer is not particularly limited as long as it can specifically bind to the nucleic acid of SEQ ID NO: 1 or its complementary nucleic acid, but is preferably 10 bases to 10 bases.
It is a 0 base nucleic acid fragment. The product amplified from such a primer can be identified by detection with the above probe or comparison of chain lengths.

The nucleic acid fragment having at least 10 bases of SEQ ID NO: 3 in the nucleic acid fragment of the present invention is a nucleic acid fragment having at least 10 consecutive bases of 18 bases of SEQ ID NO: 3, and specific examples of 10 bases As 1-10, 2-11, 3-12, 4-13, 5 of SEQ ID NO: 2
There are 10 bases each of -14, 6-15, 7-16, 8-17 and 9-18.

The nucleic acid fragment of the present invention can also be synthesized by a DNA synthesizer.

The peptide of the present invention has at least 4 amino acids of the amino acid sequence shown by SEQ ID NO: 2 or the amino acid sequence shown by SEQ ID NO: 4, and the peptide may be synthesized by a peptide synthesizer. Alternatively, it can be produced by a microorganism or the like using a known gene recombination technique.

Penicillin-resistant Streptococcus pneumoniae can be detected by using the nucleic acid fragment of the present invention as a primer or a probe, but it is preferable to use a gene amplification method to achieve highly sensitive detection. As a gene amplification method, PCR
Method, LCR method, 3SR method, SDA method, etc. (Mana
k, M. M. DNA Probes 2nd Edit
ion p255-291, Stockton Pre
ss (1993)), the nucleic acid fragment of the present invention is a primer (probe in the LCR method) for these amplification reactions.
Or as a probe for detecting whether or not the nucleic acid fragment of the present invention is present in the amplified product. When the nucleic acid fragment of the present invention is used as a primer or a probe, a site capable of binding to a labeled substance or a solid-phase carrier is introduced into the primer or the probe, or the probe or a single-stranded nucleic acid containing the probe is immobilized. Immobilization on a carrier can facilitate detection. Here, the label may be either a non-radioactive substance or a radioactive substance, but is preferably a non-radioactive substance. As the non-radioactive label, a fluorescent substance that can be directly measured (for example, fluorescein and its derivative (fluorescein isothiocyanate, etc.), rhodamine and its derivative (tetramethylrhodamine isothiocyanate, Texas red, etc.)), Chemiluminescent substances (such as acridine) and substances that emit delayed fluorescence (DTT)
A: manufactured by Pharmacia) and the like.

When detecting these labeled substances, it is also possible to indirectly detect the labeled substances by using a substance that specifically binds to the labeled substances. Examples of the labeling substance in such a case include biotin and hapten, and in the case of biotin, avidin or streptavidin that specifically binds to this, and in the case of hapten,
Antibodies that specifically bind to this are available. As the hapten, a compound having a 2,4-dinitrophenyl group, digoxigenin, can be used, and further, biotin or a fluorescent substance can be used as the hapten. Any of these labeled substances may be used alone or, if necessary, in combination of plural types by known means (JP-A-59-93098).
And Japanese Patent Application Laid-Open No. 59-93099)). Also,
As an example of the site capable of binding to the solid phase carrier (solid phase carrier binding site), the above non-radioactive labeling substance can be used. Specific examples thereof include biotin, a fluorescent substance such as fluorescein, a compound having a 2,4-dinitrophenyl group, or a hapten such as digoxigenin, and these may be used alone or in combination of two or more kinds if necessary. It can be introduced into the primer of the present invention in advance (for details, see JP-A 1-25).
2300 publication). Further, as a method of immobilizing the probe of the present invention or a single-stranded nucleic acid containing the probe on a solid phase carrier, in addition to the method of introducing a site capable of binding to the above solid phase carrier, a solid phase having an amino group introduced thereinto is used. A method of binding the carrier and the nucleic acid using a cross-linking agent such as glutaraldehyde, or a method of introducing a functional group into the nucleic acid and binding the functional group introduced on the solid phase carrier using an appropriate cross-linking agent (Nucleic Acids Res., 15, 53
73-5390 (1987)) or by non-specific binding such as adsorption (Japanese Patent Laid-Open No. 61-61).
219400, JP-A-5-192198). The detection method of the present invention can detect a target gene amplification reaction product by adding the primer of the present invention to an analyte and performing a gene amplification reaction, but it is non-radioactive in terms of simplicity and speed. ED-PCR method using labeled primer (Ubukata, K. et al., J. Clin. Micro)
biol. 30 , p1727-1733 (1992)).
Is preferred. When the nucleic acid fragment of the present invention is used as a probe, a microplate hybridization method (Kawai, S. et al., Anal. Bioc) in which the probe is immobilized on a microplate in advance and used.
hem. 209 , 63-69 (1993)) is more preferable because it can be automated.

The immunological detection method of the present invention is carried out using the above-mentioned peptide or an antibody against the peptide, and the antibody used here may be either polyclonal or monoclonal. As the polyclonal antibody, an antiserum obtained by immunizing an animal by an ordinary means or a purified product thereof can be used. In addition, as the monoclonal antibody, a hybridoma obtained by proliferating a hybridoma obtained by a usual cell fusion method can be used.

The immunological detection method of the present invention is, for example, enzyme immunoassay (EIA) or radioisotope immunoassay (RI).
AIA, fluorescent immunoassay and the like can be mentioned, but EIA is preferable. The immunoreaction may be either a competitive method or a sandwich method, of which the sandwich method, particularly the ELISA using a solid phase antigen or a solid phase antibody, is preferable.

[0023]

The present invention will be described in detail below with reference to examples, but the present invention is not limited thereto. In addition,
The genetic engineering method in the following experimental examples is described by Maniatis et al., Molecular Cloning, Second Edition [Cold Sp.
ring Harbar Laboratory Pr
ess (1989)]. The oligonucleotide used as a primer for PCR was performed using an automatic synthesizer model 381A manufactured by Applied Biosystems, and a general method [Oligonucleotide] was used.
Synthesis, IRL Press (198
4)] was used for deprotection and purification. In addition, the biotin-labeled oligonucleotide used for sequencing should be amino linked at the end of the oligonucleotide synthesis.
II (trademark) (manufactured by Applied Biosystems) was added to introduce an amino group, and the amino group was obtained by reacting with biotin succinimide ester according to the method described in US Pat. No. 4,849,336. A fluorescently labeled primer was also prepared by labeling an amino group-introduced oligonucleotide prepared in the same manner with fluorescein isothiocyanate. Sequencing is performed by a direct sequencing method (Rao, V. B. Anal. Biochem. 21 ).
6 , 1-14 (1994)) Shimadzu DNA sequencer (DSQ1).

The clinical isolates used in the experiments were subjected to an optohin susceptibility test, an inulin degradation test and a bile dissolution test. At the same time, its properties were examined by API-20 STREP, and it was confirmed that it was Streptococcus pneumoniae even by the API code.

The susceptibility of the test bacterium to various β-lactam drugs is determined by the standard method of the Japanese Society of Chemotherapy (The Japanese Society of Chemotherapy: Minimum Inhibitory Concentration (MIC) Assay Re-revision: Chemotherapy 29 , 76-79, 1).
981). Mueller Hinton agar medium (manufactured by Eiken Kagaku Co., Ltd.) was used as a medium, and defibrinated blood of cotton sheep was added at a ratio of 5% for use.

Example 1 PCR-based autolysin gene, normal PB
Detection of P2B gene, Class A mutant PBP2B gene and Class B mutant PBP2B gene: Penicillin G (PCG), oxacillin (MPIPC), ampicillin (ABPC), imipenem (IPM), cefotaxime (CTX) and Six types of antibacterial agents, Cefdinir (CFDN), were used. In addition, gene detection was performed by PCR. Two kinds of each of the four types of primer pairs shown below were mixed to obtain PCR mix 1 and PCR mix 2 shown below.

Primer for amplifying autolysin gene 5'TGAAGCGGATTATCACTGGC AUT-1 5'GCTAAACTCCCTGTATCAAGCG AUT-2

Primer for amplifying normal PBP2B 5'ATCAATTCTTGGTATACTCAGG PBP-N1 5'AGTAGATTCATCTGGTAGGTC PBP-N2

Primer for amplifying Class A mutant PBP2B gene 5'CTAGGCCAATGCCGATTACG PBP-A1 5'AGTAGATTCATCTGGTAGGTC PBP-A2

Primer for amplifying Class B mutant PBP2B gene 5'CCAAACCTTAACAGATCAGC PBP-B1 5'AGTAGATTCATCTGGTAGGTC PBP-B2

PCR mix 1 5 μg / ml AUT-1, 5 μg / ml AUT-2, 5
μg / ml PBP-A1, 5 μg / ml PBP-A2,
10 mM Tris-HCl pH 8.9, 1.5 mM Mg
Cl ₂ , 80 mM KCl, 0.5 mg / ml BSA, 0.
1 (w / v)% sodium cholate, 0.1 (w / v)
% Triton X-100, 1 mM dATP, 1 mM
dGTP, 1 mM dCTP, 1 mM dTTP, 100U
/ MlTth DNA polymerase

PCR mix 2 5 μg / ml PBP-N1, 5 μg / ml PBP-N
2,5 μg / ml PBP-B1, 5 μg / ml PBP-
B2, 10 mM Tris-HCl pH 8.9, 1.5 mM
MgCl ₂ , 80 mM KCl, 0.5 mg / ml BS
A, 0.1 (w / v)% sodium cholate, 0.1
(W / v)% Triton X-100, 1 mM dAT
P, 1 mM dGTP, 1 mM dCTP, 1 mM dTT
P, 100 U / ml Tth DNA polymerase

The number of Streptococcus pneumoniae grown on the blood agar medium is 2
0 μl of lysate (110 mM Tris-HCl pH8.
9, 1.5 mM MgCl ₂ , 80 mM KCl, 0.5 mg
/ Ml BSA, 0.1 (w / v)% sodium cholate,
0.1 (w / v)% Triton X-100, 0.
45 (w / v)% NP40, 0.45 (w / v)%
Tween 20, 0.2 mg / ml Protease K) was pre-dispensed, and one colony was picked using a platinum loop. Two microtubes were used for each strain to lyse the cells. The tube is Gene A
mp PCR System 9600-R (manufactured by Nippon Roche), set at 60 ° C. for 20 minutes, and then 90 ° C. for 1 minute.
It was processed for 0 minutes. Then PCR mix 1 and PC as described above
5 μl of R mix 2 in each tube
Added one by one. PCR is 50 ° C-30 seconds, 70 ° C-30
For 30 seconds under the temperature condition of 94 ° C. for 15 seconds.
After the reaction, analysis was performed using 3% agarose electrophoresis.

Penicillin-resistant pneumococcus (abbreviated as PRSP) and penicillin-sensitive pneumococcus (PS) in drug susceptibility test
Identification of (abbreviated as SP) is recommended by NCCLS [Nation
alCommittee for Clinical
Laboratory Standards. Perf
orance Standards for Ant
microbiological Disk Susceptib
ility Tests. 4th. ed. M2-A
4, National Committee for C
linear Laboratory Standard
rds, Villanova, Pa. (1990)], a strain showing MIC of 0.1 μg / ml or more for PCG, or MI of 1.0 μg / ml or more for MPIPC.
The strain showing C was designated as PRSP. In addition, it was determined that the gene was found when a band was found at a target position by agarose electrophoresis in a gene test by PCR. The relationships between the genetic tests and the drug susceptibility tests conducted on 30 clinical isolates are shown in FIGS. As a result, despite being PRSP, Class A or Class
Four strains having no s B mutant gene were found. In addition, when an equivalent test was performed with an increased number of clinical isolates, it was revealed that resistant strains not belonging to Class A or Class B existed in about 10% of the total pneumococci.

Example 2 Determination of partial nucleotide sequence of penicillin-resistant Streptococcus pneumoniae PBP2B: Class by PCR direct sequencing method using sequencing primers shown in FIG.
A partial nucleotide sequence of the PBP2B gene of penicillin-resistant Streptococcus pneumoniae which does not belong to A and Class B was determined. First, according to Example 1, Class A and Class
From penicillin-resistant Streptococcus pneumoniae clinical isolates not belonging to B,
Splatt et al. (Molecular Microbi
A gene amplification product of 1481 bases was obtained by using the primer of LOGY 3 , 95-102 (1989)). Using this gene fragment as a template, the PB shown in FIG.
Gene amplification was performed using a combination of primers P2 and PBP5 and PBP1 and PBP6, and the obtained amplificates were used as a template for the sequencing method. However, PBP4
Alternatively, when PBP5 is used as a sequencing primer, PCR using a combination of PBP2 and PBP5
For this, biotin-labeled PBP5 is used, and when PBP3 or PBP6 is used as a sequencing primer, PCR is performed using a combination of PBP1 and PBP6.
The biotin-labeled PBP6 was used for this. The gene amplification product prepared with each biotin-labeled primer was captured on the solid phase according to the protocol using Dynabeads M-280 Streptavidin (Veritas), and the strand opposite to the biotin-labeled strand was released into the solution by alkaline denaturation. Then, it was used as a template for the sequencing reaction. A Shimadzu fluorescent DNA sequencer dedicated kit (manufactured by Shimadzu Corporation) was used for the sequencing reaction.

According to the above method, Class A and C
Several types of penicillin-resistant Streptococcus pneumoniae that do not belong to any of the class B were selected, and the base sequence was partially determined by the PCR direct sequencing method in the direction from the active serine residue of the Trump peptidase region to the carboxy terminus.

As a result, characteristic gene mutations accompanied by amino acid mutations were commonly found in several strains. From this, one kind of strain (KK-3, this strain applied for deposit to the Institute of Biotechnology, Institute of Biotechnology, Institute of Industrial Science on September 19, 1994, but the deposit was rejected, so Yukunaga Pharmaceutical Co., Ltd. It is stored in the Hiroshima Institute in a state where it can be distributed.), And the nucleotide sequence of 788 nucleotides containing the active serine residue was determined, and is shown in SEQ ID NO: 1. (Hereinafter, those having a mutation similar to this mutation are referred to as Class C). In FIGS. 5, 6 and 7, normal, Class A, Class B, and the presently determined base sequence, and the base sequence of Class C and FIG.
The amino acid sequences were compared in.

Example 3 Search for new mutant strain (Class C) in clinically isolated penicillin-resistant Streptococcus pneumoniae: PCR was performed to determine the proportion of the resistant strain having the above-mentioned gene mutation in the clinical isolate. It was detected using the method.

First, a primer capable of amplifying only the Class C PBP2B gene was designed and synthesized.

5′ATTCCTTGGGAACGGTAACC PBP-C1 5′TAAGCCTGAGTATACCAAGT PBP-C2

A PCR mix was prepared in the same manner as in Example 1 and detection was performed using colonies. In addition, various conditions under which distinction from a normal gene can be made clear were examined, and PCR conditions were determined to be 30 cycles of 94 ° C for 30 seconds, 57 ° C for 30 seconds, and 72 ° C for 60 seconds. Class A using this method
Alternatively, when a resistant strain not belonging to Class B (48 strains) was examined, the target gene amplification product was obtained in 11 strains (FIGS. 8 and 9).

From these results, Class in clinical isolates
It was revealed that about 23% of the resistant strains not belonging to A or Class B belong to Class C. These are all highly resistant and clinically important strains.

[0043]

INDUSTRIAL APPLICABILITY According to the present invention, penicillin-resistant Streptococcus pneumoniae, which has been liable to be inaccurate in the conventional determination, can be accurately, easily and promptly determined to be penicillin-resistant. Therefore,
Appropriate chemotherapy can be achieved early.

[0044]

[Sequence list]

 SEQ ID NO: 1 Sequence length: 777 Sequence type: Nucleic acid Topology: Linear Sequence type: Genomic DNA Hypothetical: NO Antisense: Sense Origin organism name: Streptococcus pneumoniae strain name: KK-3 sequence AAAACAGGTG CTGTTTTGTC TATGTCAGAA CTCAAACATG ACCTGAAAAC GGGAGACTTG 60 ACGCCTGATT CCTTGGGAAC GGTAACCAAT GTCTTTGTCC CAGGTTCGGT TGTCAAGGCT 120 GCGACCATCA GCTCTGGCTG GGAAAATGGA GTCTTATCAG GAAACCAGAC CTTGACAGAC 180 CAGTCCATTG TCTTTCAAGG TTCATCTCCC ATCAATTCTT GGTATACTTG GTATACTCAG 240 GCTTACGGTT CATTCCCTAT CACAGCAGTC CAAGCTCTGG AGTATTCATC TAATAGCTAT 300 ATGGTCCAAA CAGCTCTAGG TCTTATGGGG CAGACTTACC AACCCAATAT GTTTGTCGGC 360 ACCAGCAACC TAGAGTATGC TATGGGGAAA TTGCGTTCAA CCTTTGGTGA ATATGGTTTG 420 GGGGCTGCGA CAGGAATTGA CCTACCAGAT GAATCTACTG GATTTGTTCC CAAAGAGTAT 480 AGCTTTGCTA ATTACATTAC TAATGCATTT GGGCAGTTTG ATAACTATAC GCCGATGCAG 540 TTGGCTCAGT ATGTAGCAAC TATTGCAAAT GATGGTGTTC GTGTGGCTCC TCGTATTGTT 600 GAAGGCATTT ATGGTAATAA TGATAA GGGA GGCCTAGGCG ACTTGATTCA GCAACTGCAA 660 CCGACAGAGA TGAATAAGGT CAATATATCC GACTCCGATA TGAGTATCTT GCACCAAGGT 720 TTTTATCAGG TTGCTCATGG TACTCGTGGG TTGACAACTG GACGTGCCTT TTCAAAT 777

SEQ ID NO: 2 Sequence length: 259 Sequence type: Amino acid Topology: Linear Sequence type: Protein Hypothetical: YES Origin Biological name: Streptococcus pneumoniae Strain name: KK-3 Sequence Lys Thr Gly Ala Val Leu Ser MET Ser Glu Leu Lys His Asp Leu Lys 16 Thr Gly Asp Leu Thr Pro Asp Ser Leu Gly Thr Val Thr Asn Val Phe 32 Val Pro Gly Ser Val Val Lys Ala Ala Thr Ile Ser Ser Gly Trp Glu 48 Asn Gly Val Leu Ser Gly Asn Gln Thr Leu Thr Asp Gln Ser Ile Val 64 Phe Gln Gly Ser Ser Pro Ile Asn Ser Trp Tyr Thr Trp Tyr Thr Gln 80 Ala Tyr Gly Ser Phe Pro Ile Thr Ala Val Gln Ala Leu Glu Tyr Ser 96 Ser Asn Ser Tyr MET Val Gln Thr Ala Leu Gly Leu MET Gly Gln Thr 112 Tyr Gln Pro Asn MET Phe Val Gly Thr Ser Asn Leu Glu Tyr Ala MET 128 Gly Lys Leu Arg Ser Thr Phe Gly Glu Tyr Gly Leu Gly Ala Ala Thr 144 Gly Ile Asp Leu Pro Asp Glu Ser Thr Gly Phe Val Pro Lys Glu Tyr 160 Ser Phe Ala Asn Tyr Ile Thr Asn Ala Phe Gly Gln Phe Asp Asn Tyr 176 Thr P ro MET Gln Leu Ala Gln Tyr Val Ala Thr Ile Ala Asn Asp Gly 192 Val Arg Val Ala Pro Arg Ile Val Glu Gly Ile Tyr Gly Asn Asn Asp 208 Lys Gly Gly Leu Gly Asp Leu Ile Gln Gln Leu Gln Pro Thr Glu MET 224 Asn Lys Val Asn Ile Ser Asp Ser Asp MET Ser Ile Leu His Gln Gly 240 Phe Tyr Gln Val Ala His Gly Thr Arg Gly Leu Thr Thr Gly Arg Ala 256 Phe Ser Asn 259

SEQ ID NO: 3 Sequence length: 18 Sequence type: Nucleic acid Number of chains: Topology: Linear Sequence type: Genomic DNA Hypothetical: NO Antisense: Sense Origin Biological name: Streptococcus pneumoniae Strain name : KK-3 sequence 5'TGGTATACTTGGTATACT

SEQ ID NO: 4 Sequence length: 6 Sequence type: Amino acid Topology: Linear Sequence type: Peptide Hypothetical: YES Origin organism name: Streptococcus pneumoniae strain name: KK-3

[Brief description of drawings]

FIG. 1 is a diagram showing the relationship between a genetic test and a drug susceptibility test.

FIG. 2 is a diagram showing the relationship between a genetic test and a drug susceptibility test.

FIG. 3 is a diagram showing the relationship between a genetic test and a drug susceptibility test.

FIG. 4 is a diagram showing the relationship between a genetic test and a drug susceptibility test.

FIG. 5: Normal, Class A, Class B and C
It is a figure which shows the base sequence of lass C.

FIG. 6 Normal, Class A, Class B and C
It is a figure which shows the base sequence of lass C.

FIG. 7: Normal, Class A, Class B and C
It is a figure which shows the amino acid sequence of lass C.

FIG. 8 shows the relationship between penicillin-resistant Streptococcus pneumoniae having Class C gene and drug sensitivity.

FIG. 9 is a diagram showing the relationship between penicillin-resistant Streptococcus pneumoniae having a Class C gene and drug sensitivity.

FIG. 10 shows the primers used for direct sequencing in Example 2.

Claims (7)

[Claims] 1. A base sequence represented by SEQ ID NO: 1 or a base sequence complementary thereto, or a base sequence consisting of at least 10 bases of the base sequence represented by SEQ ID NO: 3 or a base sequence complementary thereto. A nucleic acid fragment having: 2. A peptide having at least 4 or more amino acid sequences of the amino acid sequence represented by SEQ ID NO: 2 or the amino acid sequence represented by SEQ ID NO: 4. 3. A primer or probe for detecting penicillin-resistant Streptococcus pneumoniae selected from the nucleic acid fragments according to claim 1. 4. A method for detecting penicillin-resistant Streptococcus pneumoniae using the primer or probe of claim 3. 5. A kit for detecting penicillin-resistant Streptococcus pneumoniae, which comprises the primer or probe according to claim 3. 6. An immunological detection method for penicillin-resistant Streptococcus pneumoniae, which comprises using the peptide according to claim 2 or an antibody thereto. 7. A kit for immunological detection of penicillin-resistant Streptococcus pneumoniae, which comprises the peptide according to claim 2 or an antibody thereto.