JPH06165698A - Method for detecting nucleic acid - Google Patents

Abstract

PURPOSE:To readily detect the presence of nucleic acid with high sensitivity in a short time without carrying out the electrophoresis. CONSTITUTION:A DNA after its production by a method such as polymerase chain reaction(PCR) or ligase chain reaction(LCR) is made to react with a labeling primer having one sequence of primers used in production simultaneously with denaturation and the resultant product is then simultaneously made to react with the labeled oligonucleotide having the sequence complementary to a part of the sequence in the produced gene and a solid phase capable of recognizing the labeling primer. A signal produced from the labeled oligonucleotide is measured to detect the presence of the nucleic acid.

Description

Detailed Description of the Invention

[0001]

The present invention relates to D having a specific nucleotide sequence.
It is a method of detecting NA or RNA, and is a method used for diagnosis of diseases caused by viruses or bacteria, genetic diseases, identification of species, and parentage discrimination.

[0002]

BACKGROUND OF THE INVENTION Hybridization methods are effective in diagnosing diseases caused by gene mutations and diseases caused by viruses.

[0003] Conventionally, at the time of detection, a physical method such as ultrasonic disruption of a target DNA or RNA from a bacterium, virus, leukocyte, etc., an enzyme such as proteinase K, or a surfactant such as SDS is used. Extract by chemical method. Subsequent phenol / chloroform treatment and ethanol precipitation for DN
After purifying A (RNA), it is denatured with an alkali such as NaOH to obtain single-stranded DNA (RNA). The well-known filter hybridization method is a method of immobilizing the desired single-stranded DNA (RNA) on a membrane filter (nitrocellulose, nylon).

When an oligonucleotide probe labeled with a radioisotope, an enzyme, biotin, a fluorescent substance or the like is added to the filter on which the DNA (RNA) is immobilized, both are detected when the oligonucleotide has a complementary sequence to the target DNA (RNA). A hydrogen bond is formed between the two to form a double strand. Oligonucleotide probes with no complementary strand or in excess are removed from the filter by washing. Then, by measuring the radioactivity, enzyme activity and fluorescence intensity, the objective D
NA (RNA) is detected.

In addition, a polymerase chain reaction (PCR) has been recently used as a method for increasing a small amount of DNA.
(Saiki, RK et al, Science 239 487-491 (1988)). This method can amplify only a target DNA region from a very small amount of gene (DNA) about 1,000,000 times in a few hours. That is, by synthesizing DNA primers (18 to 30 nucleotides) for the + strand and − strand across the gene region to be amplified and repeatedly synthesizing the DNA fragment by the DNA polymerase, the DNA is doubled every cycle. 2 after n cycles
Amplified ⁿ times. At this time, by selecting a sequence specific to the gene of interest as a DNA primer, a highly selective polymerase reaction occurs and it is sandwiched between two primers.
A double-stranded DNA fragment is produced. In the method for detecting this double-stranded fragment, it is a general method to bring the DNA amplified by the PCR reaction (amplified DNA) into the filter hybridization method described above.

As another method, each primer is labeled with biotin in advance to carry out a PCR reaction, followed by hybridization with a DNA probe labeled with a radioactive substance in a liquid phase, and then avidin-immobilized affinity matrix. Detection method (Ann-Chr
istine Syvanen et al, Nucl. Acids Res. 16 (1988) 113
27-38), followed by PCR and hybridization with two types of DNA probes, followed by adsorption to a solid phase for detection (Patrik, O. Dahlen et al, J. clin. Microbiol.
(1991) 798-804), or Adler et al.
There are issues such as 99.

Further, a method of directly analyzing amplified DNA by electrophoresis is known. This method is carried out by migrating a radioisotope-labeled or unlabeled DNA fragment in an acrylamide gel carrier and subjecting the gel to autoradiography, or placing it on a thin-layer silica gel plate and gelling with a UV lamp. Illuminate and take a photo. Alternatively, the DNA fragment is electrophoresed in an agarose gel carrier, the DNA is then stained with ethidium bromide, the gel is placed on a transilluminator (which emits ultraviolet light) from the electrophoretic bath, and a photograph is taken (T. Man
iatis et al, Molecular Cloning, Cold Spring Harbo
ur (1982)).

[0008]

However, in the method using a filter, DNA (RNA) is used in the filter.
To fix DNA, to fix DNA (RNA) by heat or ultraviolet rays, and to wash the oligonucleotide probe that did not form a complementary strand. Further, there is also a disadvantage that the DNA probe is non-specifically adsorbed on the surface of the filter to lower the detection sensitivity and increase the background.

In addition, after the above-mentioned respective primers were labeled with biotin in advance and a PCR reaction was carried out, they were hybridized with a DNA probe labeled with a radioactive substance in a liquid phase, and then an avidin-immobilized affinity matrix was used. In the method of detecting by using, it is necessary to change the conditions of usual PCR reaction because the procedure is complicated because it is immobilized on the carrier after hybridization and the primer is labeled. In addition, a large amount of label primer is used for PCR, which is costly.

In the above method, primer 2 is used.
This required a total of 4 types of specific sequences including 2 types of DNA probes and 2 types of DNA probes, which made the sequence selection and synthesis very complicated.

Further, both of the reaction processes are multi-steps, and a centrifugal operation and the like are required.

Further, in the electrophoresis method, when a radioactive substance is used, a special facility is required, and since the gel cannot be stored for a long period of time, it needs to be prepared at any time and is expensive. In addition, it takes one and a half hours or more after completion of PCR.

Therefore, the present invention provides a method for detecting nucleic acids (DNA, RNA) which overcomes these problems, enables highly sensitive multi-sample processing in a short time, and produces objective output results without trouble. The purpose is to do.

[0014]

In order to solve the above-mentioned problems, the present invention makes at least one kind of oligonucleotide function as a chain reaction primer to selectively select a specific DNA in a target DNA by using a DNA synthase. In the step (first reaction), a reagent or temperature for inactivating the DNA synthase, and a labeled primer having a sequence of one of the primers used for the production are reacted to denature the gene to be produced. At the same time, a step of attaching a labeled primer to the generated gene (second reaction), in which the reaction product generated in the second reaction acts in a second reaction with a labeled oligonucleotide having a sequence complementary to a partial sequence of the generated gene A step of simultaneously reacting the labeled primer with a solid phase that recognizes the labeled primer (third reaction), Consisting the step of detecting the presence or absence of a nucleic acid of interest by performing constant (fourth reaction).

Here, the first reaction is a gene amplification method such as PCR reaction (Saiki et al., Science (230) 1350-4), LCR.
(Barany et al., Proc, Natl. Acad. Sci. USA (88) (89-93)),
Alternatively, it is carried out by a known method such as a primer extension method using a DNA enzyme. When using a PCR reaction, a method using a larger amount of one kind of primer than the other (Asymmetric PCR) is preferable. Examples of the primer used in the PCR reaction include, but are not limited to, those disclosed in Japanese Patent Application No. 3-59820 by the applicant of the present invention. The combination of two kinds of oligonucleotides is, for example, (a) 5'dGGTACTAAATGCGCTGACAT when detecting the heat-resistant hemolytic gene ( tdh gene) of Vibrio parahaemolyticus.
C (SEQ ID NO: 1) and (b) 5'dCCACTACCACTCTCATATG
When using C (SEQ ID NO: 2) to detect the cholera toxin gene, (e) 5'dACAGAGTGGAGTACTTTGAC
C (SEQ ID NO: 5) and (f) 5'dATACCCATCCATATAATTTTGG
GAG (SEQ ID NO: 6) is used.

The reagent for inactivating the DNA synthase used in the second reaction may be, for example, EDTA, and the labeled substance of the labeled primer may be biotin. Not limited.

In order to denature the amplified gene, the temperature of the amplified gene solution is raised to 90 ° C. to 95 ° C., or an alkaline solution such as NaOH is used.

The base sequence of the labeled oligonucleotide used in the third reaction is, for example, (c) when (b) is used in the second reaction when detecting the heat-resistant hemolytic gene ( tdh gene) of Vibrio parahaemolyticus. 5'dCCAAGTAAAATGTATTTTGG
The sequence that binds to A (SEQ ID NO: 3) is (a)
When using (d) 5'dTCCAAAACATATTTTACTTG
One having a sequence that binds to G (SEQ ID NO: 4) can be used, and when detecting the cholera toxin gene, when (f) is used in the second reaction, (h) 5'dTTCCACCCTCAATTTAGTTTG
When using (e) in the second reaction, the sequence that binds to AGAA (SEQ ID NO: 7) can be the sequence that binds to the complementary strand of (h).

As the labeled form of the labeled oligonucleotide, an enzyme or a fluorescent dye can be used, and examples of the enzyme include, but are not limited to, alkaline phosphatase and peroxidase. Examples of fluorescent dyes include FITC,
Rhodamine can be mentioned.

As the solid phase for recognizing the labeled primer, for example, a 96-well microplate on which streptavidin or avidin is fixed is used.

The measurement in the fourth reaction is carried out using an enzyme substrate when the labeled form of the labeled oligonucleotide in the third reaction is an enzyme. The enzyme substrate is, for example, 4-methylumbelliferyl phosphate or p-nitrophenyl phosphate when the enzyme is alkaline phosphatase, and para-hydroxyphenylpropionic acid or 3,3 ′, 5,5′-in the case of peroxidase. Tetramethylbenzidine and O-phenylenediamine are used.

When the labeling substance is a fluorescent dye, the fluorescence generated by irradiating laser light is measured. When the target nucleic acid is RNA, it is transcribed into DNA using a reverse transcriptase to carry out the above reaction.

[0023]

According to the present invention, it becomes possible to detect the presence or absence of a target nucleic acid with high sensitivity without performing electrophoresis and in a short time without using radioisotope. Further, by using a tool such as a multi-well microplate capable of processing a large amount of sample at one time, it becomes possible to automate the detection of the target nucleic acid.

[0024]

【Example】

(Example 1) Vibrio parahaemolyticus which is a first reaction Kanagawa phenomenon positive strain
The WP1 strain was liquid-cultured and total DNA was extracted by a conventional method using phenol and chloroform. The amount of the DNA was quantified from the value at 260 nm using an ultraviolet-visible absorption spectrophotometer. This solution is serially diluted to 4fg, 40fg, 400fg, 4000fg / 3ul
TE solution (10 mM Tris-HCl buffer containing 1 mM EDTA, pH
8.0) and used for PCR. In addition, chromosomal DNA 4fg
Was used as one copy in the following experiments.

PCR reaction conditions are 10 × buffer 3 μ
l, dNTP 4.8 μl (each 1.25 mM), primer having a sequence specific to the Vibrio parahaemolyticus tdh gene (a) 0.75 μl (25 nmol / ml), (b) 0.75 μl (2.5 nmol / m)
l) Nonidet P-40, Tween 20 0.5% 3ul each, and thermostable DNA polymerase 0.15 µl (5 unit / ul) were added to prepare 30 µl of the reaction solution.

To the container containing this reaction solution, 50 μl of mineral oil (SIGMA) was added to prepare a reaction solution. The composition of each buffer is shown below.

10x buffer: 500 mM KCl 100 mM Tr
is HC1 (pH9.0) 15 mM MgCl ₂ , 0.1% gelatin, dNTP solution: dATP dCTP dGTP dTT
P mixture.

The reaction conditions are as shown below.

Thermal denaturation 94 ° C. for 1 minute Annealing 55 ° C. for 1 minute Polymerization reaction 72 ° C. for 1 minute 35 cycles were carried out.

The sequence of each primer is the sequence reported to the 64th Japanese Society for Bacteriology (Tada et al., JJBacteriol 199146 281). Sequence is primer (a) 5'dGGTACTAAATGGCTGACA
TC3 '(b) 5'd CCACTACCACTCTCATATGC3' and vibrio
M. Nishibuchi et al. (1990) Mol. Micro, which is a primer that can specifically detect the parahaemolyticus tdh gene.
The sequence in the sequence of tdh2 gene described in biology 4 87-99 is used. Both the primers (a) and (b) were prepared by a DNA synthesizer manufactured by Milligen, purified by reverse phase high performance liquid chromatography and used for PCR.

A labeled primer was prepared by labeling biotin on the 5'end of the sequence of the second reaction primer (b). This is the primer (b)
Monomethoxytritylamine linker was reacted with to bind hexanolamine (amino group) to the 5'end, and then oligonucleotide (25 nmol, 100 ul) 15 mM N-hydroxysuccinimide biotin ( It was carried out by reacting with 150 ul of DMF solution). Purification was performed by gel filtration with a PD-10 column (Pharmacia).

50 mM E containing 3.8 pmol of labeled primer labeled with biotin at the 5'end of the sequence of primer (b)
30 ul of DTA solution was added to each tube containing 30 ul of the solution after the PCR reaction, heated at 95 ° C for 5 minutes, and then heated to 25 ° C.

The operations of the first and second reactions were carried out using a PCR thermal cycler and the same single tube.

Third reaction 96-well microplate on which streptavidin was immobilized
(Nunc) wells labeled with peroxidase (c) 5'dCCAAATCACTTTTACTTGG3'100pmol /
2XSSC containing 20ul of ml (XSSC is 0.15M, NaCl,
0.015M-3-sodium citrate), 1% Tween solution 3
A solution prepared by adding 75 ul of distilled water and 75 ul of TA solution was placed in 0 ul, 4 ul of the sample of the second reaction was added, and the microplate was washed after holding at room temperature for 1 hour.

The fact that the sequence of the oligonucleotide (c) used here is tdh gene-specific means that J. Tada et al. Mol. Cel.
l.Probe.1992.5477.

The method for preparing the peroxidase-labeled oligonucleotide used in the reaction is described by Murakami, A. et al, Nuc.
l. Acid Res. 1989.17.5587-5595).
That is, an oligonucleotide in which the 5'position is thiolated
(c) 22 nmol and SPDP-modified peroxidase (17 nmol) obtained by allowing SPDP to act on horseradish peroxidase (Boehringer) were finally added to 1 × PBS (pH 7.4) 200.
It was made ul and reacted overnight at room temperature. Biogel p-60 (Bio-Rad) column swollen with 0.5 x PBS (1.0
x45 cm) and eluted with 0.5 × PBS. Then, the absorbance at 403 nm and 260 nm was measured, and the fractions in which the molar ratio of DNA and peroxidase was 1: 1 were collected. At this time, ε403 of peroxidase (unit: l · cm ⁻¹ · mol ⁻¹ ) = 91,0
00, ε260 = 28,000, ε260 of DNA = 200,000 ε403
= 0 was used (ε is the molar spectral extinction coefficient). Final concentration after fractionation
It was stored at 4 ° C. until it was used as a 1 × PBS solution containing 0.01% BSA (bovine serum albumin, Sigma fraction V).

A 96-well microplate on which streptavidin was immobilized was prepared as follows. That is, bovine serum albumin (BSA, Fraction V, Sigma) 700n
mol was dissolved in 1X PBS, 500ul and 4.6mg of biotinamide capronsan (BRL, dimethylamide solution) was added and reacted at room temperature for 2-3 hours.

The reaction solution was purified by G-25 gel filtration column (PD-10, Pharmacia). The solution was dissolved in 1X PBS and dissolved so that the absorbance at 280 nm was 1.0 OD / ml.
200ul was added to the well microplate. After allowing to stand at 4 ° C. overnight, the solution was discarded and 1% BSA (200 ul) was added to each well to perform blocking at 4 ° C. overnight. The solution was discarded, the wells were washed twice with 1X PBS containing 0.1% Tween 20, 20 μg / ml of streptavidin (BRL) was added to each well, and the mixture was allowed to stand at room temperature for 2-3 hours. Then, the wells were stored at 4 ° C. until use, and the wells were washed twice with 1 × PBS containing 0.5% Tween 20 immediately before use and used.

The solution in the wells was discarded and the plate was then washed with 200 ul of 1 × PBS containing 0.5% Tween 20 at room temperature.
The cells were washed twice for 1 minute with 200 μl of 1 × PBS containing 0.5% Tween 20 preheated to 40 ° C. for 1 minute and again for 1 minute at room temperature.

Fourth reaction containing 0.56 mM 3,3 ', 5,5'-tetramethylbenzidine 0.1
150 ul of M acetate buffer (PH5.5) and 50 ul of 0.02% hydrogen peroxide solution were added, and after keeping at room temperature for 30 minutes, 25 ul of 1M sulfuric acid was added to stop the reaction. The absorbance of the solution in the microplate was measured at 450 nm with an ImmunoReader NJ-2000 (Intermed).

As a result, as shown in FIG. 1, 10 copies of the Vibrio parahaemolyticus WP-1 strain tdh gene could be detected.

Example 2 In order to examine the sensitivity of this method, a comparison was made with a conventional agarose electrophoresis method. First,
The reaction conditions were 94 ° C. for 10 seconds, 55 ° C. for 10 seconds, and 72 ° C. for 15 seconds for 35 cycles of PCR reaction. Other conditions were the same as those in Example 1, and then, at the 5 ′ position of the primer having the same sequence as one of the primers used in the PCR reaction, Example 1 was used.
2.6 pmol of a primer labeled with biotin in the same manner as in
A tube after PCR reaction with 20ul of 50mM EDTA solution containing (excluding the solution used for agarose electrophoresis)
20 ul) and heated at 95 ° C for 2 minutes and cooled to 25 ° C.

From the tube, 4 ul was preliminarily fixed with streptavidin and added to a 96-well microplate containing the following solution.

Solution contained in 96-well microplate: 20
0.3xSSC containing pmol / ml peroxidase-labeled oligonucleotide, O. Solution containing 15% Tween 20 Total 200 ul Immobilization of DNA on 96-well microplate and hybridization for 60 minutes, wash 1 (1xPBS, O. 5% Tween 20
200ul) for 1 minute, Wash 2 (1xPBS, O.5% Tween 20 200ul)
(Solution heated to 40 ° C) for 1 minute, wash 3 (1xPBS, O.
5% Tween 20 200ul) for 1 minute, then 0.56mM 3,3 ',
0.1M acetate buffer containing 5,5'-tetramethylbenzidine (p
H5.5) 150ul and 0.02% hydrogen peroxide 50ul were added and the enzymatic reaction was carried out at room temperature for 30 minutes.

After the above reaction, 25 ul of 0.2N sulfuric acid was added to stop the reaction, and the absorbance at 450 nm was measured with an immunoreader. The result is shown in FIG. From FIG. 2 (a), according to the present invention, about 10 copies of Vibrio parahaemolyticus WP-1 strain tdh gene can be detected in a short time of PCR reaction time of about 1.5 hours and time thereafter (DNA detection time) of 1.5 hours. Can be seen (number 3 in FIG. 2 (a)).

For comparison, the result of detection of DNA after PCR by agarose electrophoresis is shown in FIG. 2 (b). In addition,
The numbers in FIG. 2B and the numbers in FIG. 2A are the same, and are the results of detecting the same PCR amplified DNA by each method. In FIG. 2 (b), M is the φX174 Hinc II DNA marker, and the position of the arrow indicates the position of the DNA amplified by PCR (250
Base pair).

From these figures, it can be seen that the method of the present invention is one to two orders of magnitude more sensitive than the agarose electrophoresis method.

Example 3 Addition after PCR reaction (second step)
The experiment was performed by changing the amount of oligonucleotide (primer) added in the reaction). In addition, 100 copies of Vibrio parahaemolyticus WP strain DNA was used in the PCR reaction.

The procedure was carried out in the same manner as in Example 1 except that the amount of the oligonucleotide (primer) added after the PCR reaction was the same as that used in the sample 1; 1.9 pmol sample 2; 1.0 pmol in 15 ul of 50 mM EDTA solution. Sample 3; 0.
5 pmol of biotin primer was used. Note that 15 ul of the solution after the PCR reaction was used.

As shown in FIG. 3 (a), it was found that the signal per 1 ul of the reaction solution decreased when the amount of the oligonucleotide (primer) was decreased.

However, the amount of solution used for the microtiter plate assay was sample 1; 3 ul, sample 2;
The signal did not decrease even if the amount of oligonucleotide was decreased by increasing the amount such as 6ul and sample 3; 12ul (Fig. 3 (b)).

Thus, according to the present invention, the target DNA can be obtained without impairing the sensitivity even when the amount of the labeled primer used is extremely small (about 1/20 of the amount used in the usual PCR reaction). Can be detected.

Example 4 The specificity of this method was examined by increasing the number of strains used in the experiment (the strains used in the experiment are 43 strains shown in Table 1).

The sample used for PCR was strain L
Take 10 ul of cell culture liquid that was shake-cultured in B medium, add 90 ul of TE buffer (10 mM Tris, 1 mM EDTA, pH8.0),
After heating for 5 minutes, centrifuge at 5000 rpm for 1 minute, and then using 3ul of supernatant, the labeled primer in the second reaction is 0.1pmol of 50mM EDTA
Mix 20ul and 20ul of liquid after PCR reaction, and use 30ul of this,
DNA fixation / hybridization to the microplate in the third reaction was performed at room temperature for 15 minutes, and enzyme reaction was performed for 30
The same procedure as in Example 1 was carried out except that the procedure was carried out at 15 ° C for 15 minutes.

Experimental Results As shown in Table 1, the target td
Large measurement values were obtained only in strains carrying the h gene (1.179 to 1.908), indicating that other Vibrio spp .
micus, V.furnissii, V.cholerae) at a small value was obtained (-0.006～0.023). This shows that this method can specifically detect the tdh gene.

[0056]

[Table 1] (Example 5) The cholera toxin gene was detected by this method. Strains used are, V.cholerae O1 eltor Ogawa ctx (cholera toxin gene) + (9 strains), V.cholerae O1 eltor Inaba ctx + (7 strains), V. cholerae O1 classical Inaba c
tx + (3 shares), V.cholerae O1 classical Ogawa ctx +
(2 shares), V.chol erae O1 eltor Ogawa ctx- (2
Co., Ltd., V. cholerae O1 eltor Inaba ctx-(3 strains), V.
cholerae non O1 ctx + (143 strains), V.cholerae n
on O1 ctx- (16 shares), E.coli (LT +) (6 shares) 1 in total
91 shares.

In this experiment, 5'dACAGAGGTGAGACTTT was used as a primer for the PCR reaction of the first reaction.
GACC (SEQ ID NO: 5) and 5'dATACCATCC
ATATATTTGGGAC (SEQ ID NO: 6) is used, the second reaction labeled primer is SEQ ID NO: 6, and the third reaction labeled oligonucleotide is 5'dTTCCACCCTCAATTTAGTTTG.
An experiment was performed in the same manner as in Example 1 except that the one having a sequence complementary to AGAA (SEQ ID NO: 7) was used (however,
DNA immobilization on the microplate and hybridization are the same as in Example 3). In addition, the above sequence is Mekalano
s, JJ et al. Nature (1983.306.550) was used.

The experimental results are shown in FIG. From this figure, in the cholera toxin gene positive strain, the absorbance is 0.55 to 1.73.
It can be seen that the negative strain has a value of 0.000 to 0.042. Therefore, this result shows that this method is specific to the cholera toxin gene.

[0059]

EFFECTS OF THE INVENTION According to the present invention, since a labeled primer is not used in PCR, existing primers can be used without changing the conditions, and hybridization of a labeled oligonucleotide and solid-phase immobilization are simultaneously performed.
The reaction time and the operation steps until detection can be shortened.

[0060]

[Sequence list]

Sequence ID (SEQ ID NO); 1 Sequence length 20 bases Sequence type Number of nucleic acid strands Single-stranded topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Vibrio parahaemolyticus features Determined method S sequence GGTACTAAATGGCTGA
CATC

SEQ ID NO: (SEQ ID NO); 2 Sequence length 20 bases Sequence type Number of nucleic acid strand Single strand topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Vibrio parahaemolyticus sequence Features Method of determining features S Sequence CCACTACCACTCTCAT
ATGC

SEQ ID NO: (SEQ ID NO); 3 Length of sequence 20 bases Sequence type Number of nucleic acid strand Single strand topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Vibrio parahaemolyticus sequence CHARACTERISTICS METHOD FOR DETERMINING CHARACTERISTICS S SEQUENCE CCAAGTAAAATGTATTT
TGGA

SEQ ID NO: (SEQ ID NO); 4 Sequence length 20 bases Sequence type Nucleic acid Number of strands Single-stranded topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin Vibrio parahaemolyticus sequence Features Method of determining features S Sequence TCCAAAATACATTTTAC
TTGG

SEQ ID NO: (SEQ ID NO); 5 Sequence length 20 bases Sequence type Number of nucleic acid strands Single-stranded topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin V. cholerae sequence Features of method of determining features S sequence ACAGAGTGAGTACTTT
GACC

SEQ ID NO: (SEQ ID NO); 6 Sequence length 22 bases Sequence type Number of nucleic acid strand Single strand topology Linear sequence type Genomic DNA hypothetical sequence NO antisense NO origin V. cholerae sequence Features of the method The features were determined S sequence ATACCCATCCATATTATT
TGGGAG

SEQ ID NO: (SEQ ID NO); 7 Sequence length 23 nucleotides Sequence type Number of nucleic acid strand Single strand topology Linear sequence type Genomic DNA Hypothetical sequence NO antisense NO Origin V. cholerae sequence Features of the method of determining the features S sequence TTCCACCTCAATTTAGT
TTGAGAA

[Brief description of drawings]

FIG. 1 is a diagram in which the DNA of the tdh gene of Vibrio parahaemolyticus WP-1 strain was detected by the present invention.

FIG. 2 (a) is a diagram in which DNA after PCR was detected by the present invention, and (b) is a diagram in which DNA after PCR was detected by agarose electrophoresis.

FIG. 3 (a) is a diagram in which an experiment was carried out by changing the amount of oligonucleotide (primer) added after the PCR reaction (added in the second reaction), and FIG. 3 (b) shows the amount of solution used in the microtiter plate assay increased. Figure detected

FIG. 4 is a diagram in which the DNA of the cholera toxin gene is detected by the present invention.

Claims (5)

[Claims] 1. A step of causing at least one kind of oligonucleotide to function as a chain-length reaction primer to selectively generate a specific DNA in a target DNA using a DNA synthase (first reaction), wherein the DNA synthase is lost. A step of reacting a reagent or temperature to be activated with a labeled primer having one of the primers used for the production to denature the produced gene and at the same time attaching the labeled primer to the produced gene (second reaction ), A step of simultaneously reacting the reaction product produced in the second reaction with a labeled oligonucleotide having a sequence complementary to a partial sequence of the gene produced and a solid phase recognizing the labeled primer acted in the second reaction ( Third reaction), a step of detecting the presence or absence of the target nucleic acid by measuring a signal generated from the labeled oligonucleotide used in the third reaction (first 4 reaction). 2. A naturally occurring nucleic acid or artificial nucleic acid such as bacteria or virus is used as a target gene, and a labeled primer whose sequence is partially complementary is allowed to act to denature the labeled gene and at the same time Attaching step (first reaction), the reaction product produced in the first reaction is labeled with a labeled oligonucleotide having a sequence complementary to a partial sequence of the target gene and having the same direction as the labeled primer, and the first reaction. A step of simultaneously reacting the reacted labeled primer with a recognizing solid phase (second reaction), a step of detecting the presence or absence of the target nucleic acid by measuring a signal generated from the labeled oligonucleotide used in the second reaction (third step) Reaction) and a method for detecting a nucleic acid. 3. The sequence of the oligonucleotide in the case of chain length extension in the first reaction of claim 1 is (a) 5′dGGTACTAAATGGCTGACAT
C and (b) 5'dCCACTACCACTCTCATATG
C or on the other hand, when both (a) and (b) are used, the labeled primer in the second reaction has the same sequence as nucleotide (b),
In the reaction, it binds to a labeled nucleotide having the following base sequence (c), and (c) 5'dCCAAGTAAAATGTATTTTGG
A When either (a) or (b) is used in the first reaction, it has the same sequence as the nucleotide in the first reaction in the second reaction, and when (b) is used in the first reaction And (b) is used in the first reaction, and it binds with a sequence complementary to (c) in the third reaction. Item 1. A method for detecting a heat-resistant hemolytic gene ( tdh gene) of Vibrio parahaemolyticus according to Item 1. 4. The labeled primer used in the second reaction of claim 1 has the same sequence as the nucleotide (a) of claim 2,
The nucleotide sequence of the labeled oligonucleotide of the third reaction is nucleotide (d) 5'dTCCAAAATACATTTTACTG.
The method for detecting a heat-resistant hemolytic gene ( tdh gene) of Vibrio parahaemolyticus according to claim 1, which comprises binding to G. 5. The sequence of the oligonucleotide during chain length extension in the first reaction of claim 1 is (e) 5'dACAGAGTGGAGACTTTTGAC.
C and (f) 5'dATACCATCCATATAATTTTGG
On the other hand, when using both (e) and (f), the labeled primer in the second reaction has the same sequence as nucleotide (f), and
In the reaction, it binds to a labeled nucleotide having the following base sequence (h), and (h) 5'dTTCCACCCTCAATTTAGTTTG
AGAA When (e) is used in the second reaction, it binds to the complementary strand of (h) in the third reaction, and when either (e) or (f) is used in the first reaction, In the reaction, it has the same sequence as the nucleotide in the first reaction, and when (e) is used in the first reaction, it binds with a sequence complementary to (h) above and (f) in the first reaction. The method for detecting a cholera toxin gene according to claim 1, which comprises binding to the sequence of (h) above when used.