JP3652387B2 - Penicillin-resistant pneumococcal gene fragment and its use - Google Patents

Description

[0001]
[Industrial application fields]
The present invention relates to a nucleic acid fragment, peptide, DNA probe and primer useful for detecting penicillin-resistant pneumococci, and a method for detecting the bacterium using these.
[0002]
[Prior art and problems to be solved by the invention]
Since the occurrence of Streptococcus pneumoniae resistant to penicillin in Australia in 1967, this resistant bacterium has been reported to be isolated in various parts of the world, and the number is increasing year by year.
[0003]
Since penicillin-resistant pneumococci exhibit cross-reactivity to all β-lactam agents currently used in clinical practice, they can be accurately called β-lactam-resistant pneumococci. In addition, many strains are resistant to drugs other than β-lactams, which is a very serious problem clinically.
[0004]
In such a situation, a rapid and highly sensitive detection method for penicillin-resistant pneumococci is required, but conventional drug susceptibility tests have problems with rapidity and reproducibility, and are not satisfactory. there were.
[0005]
On the other hand, from the study of the mechanism of penicillin-resistant pneumococci, it was considered that the mutation of penicillin-binding protein, which is a target enzyme of β-lactam, is directly involved in resistance. That is, there are six types of pneumococcal penicillin-binding proteins, PBP1A, 1B, 2A, 2B, 2X, and 3. Most penicillin-resistant pneumococci isolated in various parts of the world have an affinity for PBP1A, 2X / 2A, 2B. In many cases, the sex decreases at the same time. Subsequent studies have confirmed that there is a site (resistance block) that is significantly different in nucleotide sequence from the PBP 2B gene of the susceptible bacterium in a certain region of the PBP 2B gene of the penicillin-resistant bacterium (Dowson, C.G. , Et al. Proc, Natl. Acad. 86 , 8842-8846 (1989)). There are roughly two types of mutations, Class A and Class B, suggesting that these mutations are closely related to resistance. In addition, many of the penicillin-resistant pneumococci isolated in Japan were found to have mutations that could not be detected from susceptible strains, confirming the association between these mutations and resistance. (Shimizu et al., 42nd Annual Meeting of the Japanese Association for Infectious Diseases, East Japan Local Assembly Abstract (1993)).
[0006]
From this, it was considered that penicillin-resistant pneumococci can be detected rapidly and with high sensitivity by detecting the above-mentioned two types of gene mutations. Turned out not to be limited.
Accordingly, there has been a demand for the discovery of gene fragments more highly correlated with clinically important highly resistant bacteria and the accurate detection method of penicillin resistant pneumococci using this.
[0007]
[Means for Solving the Problems]
Therefore, as a result of investigating the correlation between drug sensitivity of clinically isolated resistant bacteria and the above gene mutation, the present inventor isolated a large number of novel resistant bacteria that do not have the above mutation despite high resistance. As a result of determination of the gene sequence of the fungus, it was found that the nucleic acid fragment having the base sequence represented by SEQ ID NO: 1 shown below is characteristic of penicillin high resistance. Furthermore, the present inventors have found that a resistant strain can be rapidly detected by an immunological technique using the characteristic amino acid sequence of a peptide encoded by the gene.
[0008]
That is, the present invention is a base sequence consisting of 10 to 100 bases of the base sequence represented by SEQ ID NO: 1 or a complementary base sequence thereof, wherein at least 10 or more of the base sequences represented by SEQ ID NO: 3 The present invention provides a nucleic acid fragment having a base sequence composed of bases or a base sequence complementary thereto.
[0009]
The present invention also provides a primer or probe for detecting penicillin-resistant pneumococci selected from the nucleic acid fragments, a method for detecting the resistant bacterium using the primer or probe, and the kit for detecting the resistant bacterium comprising the primer or probe. It is to provide.
[0011]
The nucleic acid fragment having the base sequence shown by SEQ ID NO: 1 and the nucleic acid fragment having the base sequence shown by SEQ ID NO: 3 which are the nucleic acid fragments of the present invention are prepared by, for example, the following steps (1), (2) and (3): Can be separated and determined.
[0012]
(1) Isolating pneumococci having penicillin resistance despite having no known mutant gene, (2) isolating and determining a mutant gene other than the known mutant gene from the gene of the isolate, ( 3) Next, a nucleic acid fragment necessary for detection of the novel mutant gene is designed and determined. Hereinafter, this process will be described in more detail.
[0013]
(1) Isolation of penicillin-resistant pneumococci that do not have a known mutated gene:
The isolation of this bacterium is carried out, for example, by isolating a strain having the above-mentioned properties from the examination of the correlation of a known PBP2B gene mutation with a drug sensitivity test. That is, for a large number of clinical isolates, there are three types of primers: a primer that amplifies the Class A mutant gene of PBP2B, a primer that amplifies the Class B mutant gene of PBP2B, and a primer that amplifies the pneumococcus-specific hemolytic enzyme (Autolysin) gene Penicillin-resistant pneumococci having a PBP2B gene mutation are detected by PCR using. On the other hand, the presence or absence of penicillin resistance is examined using several β-lactam antibiotics for the same clinical isolate. By comparing these results, a strain having the above properties is isolated.
[0014]
(2) Determination of the gene sequence of the isolate obtained in (1):
For example, the base sequence can be partially determined by PCR direct sequencing.
The base sequence shown in SEQ ID NO: 1 is a 788 base sequence including an active serine residue determined for the KK-3 strain. This sequence was confirmed to be different from normal, class A and class B (see FIGS. 5 and 6).
[0015]
(3) Design of nucleic acid fragment capable of detecting penicillin resistant pneumococci:
In order to design a probe from the nucleic acid of SEQ ID NO: 1 or its complementary nucleic acid, a nucleic acid fragment having at least 10 bases of SEQ ID NO: 3 or its complementary sequence may be used.
On the other hand, in order to design a primer from the nucleic acid of SEQ ID NO: 1 or its complementary nucleic acid, for example, when gene amplification is performed by the PCR method, the gene amplification product has at least 10 base pairs or more of the base sequence shown by SEQ ID NO: 3. Design to include.
Specifically, in the nucleic acid represented by SEQ ID NO: 1, if one primer (hereinafter abbreviated as primer 1) is designed to include at least 10 bases or more of the base sequence represented by SEQ ID NO: 3, the other The primer (hereinafter abbreviated as "primer 2") may be selected from any sequence 5 'to the complementary strand of primer 1) in the complementary strand of the nucleic acid represented by SEQ ID NO: 1.
In addition, in the nucleic acid represented by SEQ ID NO: 1, if primer 1) is selected from the sequence 5 'to the base sequence represented by SEQ ID NO: 3, primer 2) is the complementary strand of the nucleic acid represented by SEQ ID NO: 1, What is necessary is just to select from the sequence | arrangement 5 'side from the complementary sequence of the base sequence shown by sequence number 3. The size of the primer is not particularly limited as long as it can specifically bind to the nucleic acid of SEQ ID NO: 1 or its complementary nucleic acid, but is preferably a nucleic acid fragment of 10 to 100 bases. Products amplified from such primers can be identified by detection with the above probes or by comparing chain lengths.
[0016]
The nucleic acid fragment having at least 10 bases of SEQ ID NO: 3 in the nucleic acid fragment of the present invention has at least 10 consecutive bases of 18 bases of SEQ ID NO: 3, and a specific example of 10 bases is a sequence. Among the numbers 2, 1-10, 2-11, 3-12, 4-13, 5-14, 6-15, 7-16, 8-17, and 9-18 are each 10 bases.
[0017]
The nucleic acid fragment of the present invention can also be synthesized by a DNA synthesizer.
[0018]
Moreover, the peptide of the present invention has at least 4 amino acids of the amino acid sequence shown by SEQ ID NO: 2 or the amino acid sequence shown by SEQ ID NO: 4, and the peptide can be synthesized by a peptide synthesizer, It can also be produced by microorganisms using known gene recombination techniques.
[0019]
Penicillin-resistant pneumococci can be detected by using the nucleic acid fragment of the present invention as a primer or probe, but it is preferable to use a gene amplification method to achieve high-sensitivity detection.
Examples of gene amplification methods include PCR, LCR, 3SR, SDA, etc. (Manak, MM DNA Probes 2nd Edition p255-291, Stockton Press (1993)). It can be used as a primer for these amplification reactions (probe in the LCR method) or as a probe for detecting whether the nucleic acid fragment of the present invention is present in the amplified product.
When the nucleic acid fragment of the present invention is used as a primer or probe, a site capable of binding to a label or a solid phase carrier is introduced into the primer or probe, or a single-stranded nucleic acid containing the probe or the probe is immobilized. Detection can be facilitated by immobilization on a carrier.
Here, as the labeling substance, either a non-radioactive substance or a radioactive substance may be used, but a non-radioactive substance is preferable. Non-radioactive labels include fluorescent substances (for example, fluorescein and derivatives thereof (fluorescein isothiocyanate, etc.), rhodamine and derivatives thereof (tetramethylrhodamine isothiocyanate, Texas red, etc.)), Examples include chemiluminescent substances (for example, acridine) and substances that emit delayed fluorescence (DTTA: manufactured by Pharmacia).
[0020]
In detecting these labeled products, the labeled products can also be detected indirectly by using a substance that specifically binds to the labeled product. Examples of the label in this case include biotin or hapten. In the case of biotin, avidin or streptavidin that specifically binds to this can be used, and in the case of hapten, an antibody that specifically binds to this can be used. . As the hapten, a compound having a 2,4-dinitrophenyl group, digoxigenin can be used, and biotin or a fluorescent substance can also be used as the hapten. Any of these labels can be introduced into the primer or the probe by known means (see JP-A-59-93098 and JP-A-59-93099), either alone or in combination of a plurality of types if necessary. it can.
In addition, as an example of a site capable of binding to the solid phase carrier (solid phase carrier binding site), the non-radioactive labeling substance can be used. Preferred examples thereof include fluorescent substances such as biotin or fluorescein, compounds having a 2,4-dinitrophenyl group, and haptens such as digoxigenin. These may be used alone or in combination of two or more if necessary. It can be previously introduced into the primer of the present invention (for details, see JP-A-1-252300).
Furthermore, as a method for immobilizing the probe of the present invention or the single-stranded nucleic acid containing the probe on a solid phase carrier, in addition to the method for introducing a site capable of binding to the solid phase carrier described above, a solid phase into which an amino group is introduced. A method in which a carrier and a nucleic acid are bound using a crosslinking agent such as glutaraldehyde, or a method in which a functional group is introduced into a nucleic acid and a functional group introduced on a solid phase carrier is bound using an appropriate crosslinking agent (Nucleic Acid Res., 15, 5373-5390 (1987)) or non-specific binding such as adsorption (JP-A-61-219400, JP-A-5-192198).
The detection method of the present invention can detect a target gene amplification reaction product by adding a primer of the present invention to a subject and performing a gene amplification reaction, but is non-radioactive in terms of simplicity and speed. ED-PCR method using labeled primers (Ubukata, K. et al., J. Clin. Microbiol. 30 , P1728-1733 (1992)).
When the nucleic acid fragment of the present invention is used as a probe, a microplate hybridization method (Kawai, S. et al., Anal. Biochem. 209 63-69 (1993)) is more preferable because it can be automated.
[0021]
The immunological detection method of the present invention is performed using the peptide or an antibody against the peptide, and the antibody used here may be either polyclonal or monoclonal. As the polyclonal antibody, antiserum obtained by immunizing an animal by a usual means or a purified product thereof can be used. Moreover, as a monoclonal antibody, the thing collected by proliferating the hybridoma obtained by the normal cell fusion method can be used.
[0022]
Examples of the immunological detection method of the present invention include enzyme immunization (EIA), radioisotope immunization (RIA), and fluorescence immunization, and EIA is preferred. The immune reaction may be either a competitive method or a sandwich method, and among these, the sandwich method, particularly an ELISA using a solid phase antigen or a solid phase antibody is preferred.
[0023]
【Example】
EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not restrict | limited at all by this.
In addition, the genetic engineering technique in the following experimental examples was performed according to Maniatis et al., Molecular Cloning 2nd Edition [Cold Spring Harbor Laboratory Press (1989)]. Oligonucleotides used as PCR primers were used with an automated synthesizer model 381A manufactured by Applied Biosystems, and were used after being deprotected and purified by a general method [Oligonucleotide Synthesis, IRL Press (1984)]. In addition, biotin-labeled oligonucleotides used for sequencing were introduced with aminolink II (trademark) (Applied Biosystems) at the end of oligonucleotide synthesis to introduce an amino group. US Pat. No. 4,849,336 It was obtained by reacting with biotin succinimide ester according to the method described in the publication No. 1. A fluorescently labeled primer was also prepared by labeling an oligonucleotide having an amino group prepared in the same manner with fluorescein isothiocyanate.
Sequencing was performed by direct sequencing (Rao, VB Anal. Biochem. 216 1-14 (1994)) Shimadzu DNA sequencer (DSQ1).
[0024]
The clinical isolates used in the experiments were subjected to an optohin sensitivity test, an inulin degradation test and a bile dissolution test. In addition, the properties were examined by API-20 STREP, and it was confirmed that the API code was pneumococci.
[0025]
The sensitivity of the test bacteria to various β-lactams is determined by the standard method of the Japanese Society of Chemotherapy (Japanese Society of Chemotherapy: Minimal Growth Inhibitory Concentration (MIC) Measurement Method Revised: Chemotherapy) 29 , 76-79, 1981). As the medium, Mueller Hinton agar medium (manufactured by Eiken Chemical Co., Ltd.) was used, and defibrinated blood of sheep was added at a ratio of 5%.
[0026]
Example 1
Detection of autolysin gene, normal PBP2B gene, Class A mutant PBP2B gene and Class B mutant PBP2B gene by PCR:
Six types of antibacterial drugs, penicillin G (PCG), oxacillin (MPIPC), ampicillin (ABPC), imipenem (IPM), cefotaxime (CTX) and cefdinir (CFDN), were used for the drug sensitivity test. Gene detection was performed by PCR.
The four types of primer pairs shown below were mixed in pairs to make PCR mix 1 and PCR mix 2 shown below.
[0027]
Primer that amplifies the autolysin gene
5′TGAAGCGGATTATCACTGGC AUT-1
5′GCTAAACTCCCTGTATCAAGCG AUT-2
[0028]
Primer that amplifies normal PBP2B
5′ATCAATTCTTGGTATACTCAGG PBP-N1
5'AGTAGATTCATCTGGTAGGTC PBP-N2
[0029]
Primer for amplifying Class A mutant PBP2B gene
5′CTAGGCCAATGCCGATTACG PBP-A1
5′AGTAGATTCATCTGGTAGGTC PBP-A2
[0030]
Primer that amplifies Class B mutant PBP2B gene
5′CCAAACCTTAACAGATCAGC PBP-B1
5'AGTAGATTCATCTGGTAGGTC PBP-B2
[0031]
PCR mix 1
5 μg / ml AUT-1, 5 μg / ml AUT-2, 5 μg / ml PBP-A1, 5 μg / ml PBP-A2, 10 mM Tris-HCl pH 8.9, 1.5 mM MgCl ₂ 80 mM KCl, 0.5 mg / ml BSA, 0.1 (w / v)% sodium cholate, 0.1 (w / v)% Triton X-100, 1 mM dATP, 1 mM dGTP, 1 mM dCTP, 1 mM dTTP, 100 U / Ml Tth DNA polymerase
[0032]
PCR mix 2
5 μg / ml PBP-N1, 5 μg / ml PBP-N2, 5 μg / ml PBP-B1, 5 μg / ml PBP-B2, 10 mM Tris-HCl pH 8.9, 1.5 mM MgCl ₂ 80 mM KCl, 0.5 mg / ml BSA, 0.1 (w / v)% sodium cholate, 0.1 (w / v)% Triton X-100, 1 mM dATP, 1 mM dGTP, 1 mM dCTP, 1 mM dTTP, 100 U / Ml Tth DNA polymerase
[0033]
Streptococcus pneumoniae grown on a blood agar medium is 20 μl of lysate (110 mM Tris-HCl pH 8.9, 1.5 mM MgCl). ₂ , 80 mM KCl, 0.5 mg / ml BSA, 0.1 (w / v)% sodium cholate, 0.1 (w / v)% Triton X-100, 0.45 (w / v)% NP40,. One colony was fished using a platinum loop to a microtube into which 45 (w / v)% Tween 20, 0.2 mg / ml protease K) had been dispensed in advance. In addition, it lysed using two said microtubes per strain. The tube was set in Gene Amp PCR System 9600-R (manufactured by Nippon Roche) and treated at 60 ° C. for 20 minutes and subsequently at 90 ° C. for 10 minutes. Next, 5 μl of the above PCR mix 1 and PCR mix 2 was added to each tube. PCR was performed 30 cycles under the temperature conditions of 50 ° C.-30 seconds, 70 ° C.-30 seconds, and 94 ° C.-15 seconds. After the reaction, analysis was performed using 3% agarose electrophoresis.
[0034]
The distinction between penicillin-resistant pneumococci (abbreviated as PRSP) and penicillin-susceptible pneumococci (abbreviated as PSSP) in the drug susceptibility test is recommended by NCCLS [National Committee for Clinical Laboratory Standards. Performance Standards for Antimicrobial Disk Susceptibility Tests. 4th. ed. M2-A4, National Committee for Clinical Laboratory Standards, Villanova, Pa. (1990)], a strain showing MIC of 0.1 μg / ml or more with respect to PCG or a strain showing MIC of 1.0 μg / ml or more with MPIPC was designated as PRSP. In addition, in the genetic test by PCR, it was assumed that the gene was present in the band where the band was observed at the target position by agarose electrophoresis. The relationship between genetic testing and drug susceptibility testing performed on 30 clinical isolates is shown in FIGS. As a result, 4 strains were found that did not have Class A or Class B mutant genes despite being PRSP. In addition, when an equivalent test was performed by increasing the number of clinical isolates, it became clear that about 10% of the total strains of pneumococci existed in resistant strains not belonging to Class A or Class B.
[0035]
Example 2
Determination of partial base sequence of penicillin resistant pneumococci PBP2B:
The partial base sequence of the PBP2B gene of penicillin-resistant pneumococci not belonging to Class A and Class B was determined by PCR direct sequencing using the sequencing primers shown in FIG. First, from a penicillin-resistant pneumococcal clinical isolate not belonging to Class A and Class B according to Example 1, Splatt et al. (Molecular Microbiology). 3 , 95-102 (1989)), a gene amplification product of 1481 bases was obtained. Using this gene fragment as a template, gene amplification was performed using a combination of PBP2 and PBP5 and PBP1 and PBP6 primers shown in FIG. 10, and the resulting amplified product was used as a template for sequencing. However, when PBP4 or PBP5 is used as a sequencing primer, biotin-labeled PBP5 is used for PCR using a combination of PBP2 and PBP5. When PBP3 or PBP6 is used as a sequencing primer, a combination of PBP1 and PBP6 Biotin-labeled PBP6 was used for PCR. Gene amplification products prepared with biotin-labeled primers were captured on a solid phase using Dynabead M-280 Streptavidin (Veritas) according to the protocol, and the strand opposite to the biotin-labeled strand by alkali denaturation was released into the solution. This was used as a template for sequencing reaction. A Shimadzu fluorescent DNA sequencer kit (manufactured by Shimadzu Corporation) was used for the sequencing reaction.
[0036]
According to the above method, several types of penicillin-resistant pneumococci that do not belong to either Class A or Class B are selected, and a partial nucleotide sequence is obtained by PCR direct sequencing in the direction from the active serine residue to the carboxy terminus of the trump peptidase region. It was determined.
[0037]
As a result, characteristic genetic mutations with amino acid mutations were commonly found in several strains. From this, one kind of strain (KK-3, this strain was applied for deposit at the Institute of Biotechnology, Institute of Industrial Science and Technology on September 19, 1994. It is stored in a state where it can be distributed to the Hiroshima Laboratory.) And the base sequence of 788 bases including the active serine residue was determined as shown in SEQ ID NO: 1. (Hereinafter, this type of mutation is called Class C).
In FIGS. 5, 6 and 7, normal, Class A, Class B, and the base sequence of Class C whose base sequence was determined this time, and the amino acid sequence in FIG. 7 were compared.
[0038]
Example 3
Search for a new mutant (Class C) in clinically isolated penicillin-resistant pneumococci:
The PCR method was used to detect the proportion of resistant strains having the above gene mutations in clinical isolates.
[0039]
First, a primer capable of amplifying only the Class C PBP2B gene was designed and synthesized.
[0040]
5′ATTCCTTGGGAACGGTAACC PBP-C1
5'TAAGCCTGAGTATACCAAGT PBP-C2
[0041]
A PCR mix was prepared in the same manner as in Example 1, and detection was performed using colonies. Various conditions for clearly distinguishing from normal genes were examined, and PCR conditions were determined to be 30 cycles of 94 ° C. for 30 seconds, 57 ° C. for 30 seconds, and 72 ° C. for 60 seconds.
Using this method, resistant strains (48 strains) not belonging to Class A or Class B were examined, and 11 gene amplification products were obtained (FIGS. 8 and 9).
[0042]
From this result, it became clear that approximately 23% of the resistant strains not belonging to Class A or Class B in clinical isolates belong to Class C. These are all highly resistant and clinically important strains.
[0043]
【The invention's effect】
According to the present invention, a penicillin-resistant pneumococcus that has been prone to inaccurate determination can be determined to be penicillin resistant accurately, simply, and early. Therefore, appropriate chemotherapy can be performed at an early stage.
[0044]
[Sequence Listing]
SEQ ID NO: 1
Sequence length: 777
Sequence type: Nucleic acid
Topology: Linear
Sequence type: Genomic DNA
Hypothetical: NO
Antisense: Sense
origin
Name of organism: Streptococcus pneumoniae
Stock name: KK-3
Array
AAAACAGGTG CTGTTTTGTC TATGTCAGAA CTCAAACATG ACCTGAAAAC GGGAGACTTG 60
ACGCCTGATT CCTGGGGAAC GGTAACCAAT GTCTTTGTCC CAGGTTCGGT TGTCAAGGGCT 120
GCGACCATCA GCTCTGGCTG GGAAAATGGGA GTCTTATCAG GAAAACCAGAC CTTGACAGAC 180
CAGTCCCATTG TCTTTCAAGG TTCATCTCCCC ATCAATTCTT GGTACTACTG GATATACTCAG 240
GCTTACGGTT CATCCCCTAT CACAGCAGTC CAAGCTCTGG AGTATTCATC TAATACCTAT 300
ATGGTCCAAA CAGCTCTAGGG TCTTATGGGGG CAGCACTACC AACCCAATAT GTTTGTCGGC360
ACCAGCAACC TAGAGTATGC TATGGGGAAA TTGCGTTCAA CCTTTGGTGA ATATGGTTTG 420
GGGGCTGCGA CAGGAATTGA CCTACCAGAT GAATCTACTG GATTTGTTCC CAAAGAGTAT 480
AGCTTTGCTA ATTACATTAC TAATGCATTTT GGGCAGTTTG ATAACTATAC GCCGATGCAG 540
TTGGCTCAGT ATGTAGCAAC TATTGCAAAT GATGGTGTTC GTGTGCTCC TCGTATTGTTT 600
GAAGGCATTTTGGTAATAA TGATAAGGGGA GGCCTAGGGCG ACTTGATTCA GCAACTGCAA 660
CCGACAGAGA TGAATAAGGT CAATATACCC GACTCCGATA TGAGTATCTT GCACCAAGGT 720
TTTTATCAGGG TTGCTCATGG TACTCGTGGG TTGACAACTG GACGTGCCTT TTCAAAT 777
[0045]
SEQ ID NO: 2
Sequence length: 259
Sequence type: amino acid
Topology: Linear
Sequence type: Protein
Hypothetical: YES
origin
Name of organism: Streptococcus pneumoniae
Stock name: KK-3
Array
Lys Thr Gly Ala Val Leu Ser MET Ser Glu Leu Lys His Asp Leu Lys 16
Thr Gly Asp Leu Thr Pro Asp Ser Leu Gly Thr Val Thr Asn Val Phe 32
Val Pro Gly Ser Val Val Lys Ala Ala Thr Ille Ser Ser Gly Trp Glu 48
Asn Gly Val Leu Ser Gly Asn Gln Thr Leu Thr Asp Gln Ser Ile Val 64
Phe Gln Gly Ser Pro Ile Asn Ser Trp Tyr Thr Trp Tyr Thr Gln 80
Ala Tyr Gly Ser Phe Pro Ile Thr Ala Val Gln Ala Leu Glu Tyr Ser 96
Ser Asn Ser Tyr MET Val Gln Thr Ala Leu Gly Leu MET Gly Gln Thr 112
Tyr Gln Pro Asn MET Phe Val Gly Thr Ser Asn Leu Glu Tyr Ala MET 128
Gly Lys Leu Arg Ser Thr Phe Gly Glu Ty Gly Leu Gly Ala Ala Thr 144
Gly Ile Asp Leu Pro Asp Glu Ser Thr Gly Phe Val Pro Lys Glu Tyr 160
Ser Phe Ala Asn Tyr Ile Thr Asn Ala Phe Gly Gln Phe Asp Asn Tyr 176
Thr Pro MET Gln Leu Ala Gln Tyr Val Ala Thr Ile Ala Asn Asp Gly 192
Val Arg Val Ala Pro Arg Ile Val Glu Gly Ile Tyr Gly Asn Asn Asp 208
Lys Gly Gly Leu Gly Asp Leu Ile Gln Gln Leu Gln Pro Thr Glu MET 224
Asn Lys Val Asn Ile Ser Asp Ser Asp MET Ser Ile Leu His Gln Gly 240
Phe Tyr Gln Val Ala His Gly Thr Arg Gly Leu Thr Thr Gly Arg Ala 256
Phe Ser Asn 259
[0046]
SEQ ID NO: 3
Sequence length: 18
Sequence type: Nucleic acid
Number of chains:
Topology: Linear
Sequence type: Genomic DNA
Hypothetical: NO
Antisense: Sense
origin
Name of organism: Streptococcus pneumoniae
Stock name: KK-3
Array
5′TGGTATACTTGGTATACT
[0047]
SEQ ID NO: 4
Sequence length: 6
Sequence type: amino acid
Topology: Linear
Sequence type: Peptide
Hypothetical: YES
origin
Name of organism: Streptococcus pneumoniae
Stock name: KK-3
Array
Trp Tyr Thr Trp Tyr Thr
1 5
[Brief description of the drawings]
FIG. 1 is a diagram showing the relationship between genetic testing and drug susceptibility testing.
FIG. 2 is a diagram showing the relationship between genetic testing and drug sensitivity testing.
FIG. 3 is a diagram showing the relationship between genetic testing and drug susceptibility testing.
FIG. 4 is a diagram showing the relationship between genetic testing and drug susceptibility testing.
FIG. 5 is a diagram showing the base sequences of normal, Class A, Class B, and Class C.
FIG. 6 shows normal, class A, class B, and class C base sequences.
FIG. 7 is a view showing amino acid sequences of normal, Class A, Class B, and Class C.
FIG. 8 is a graph showing the relationship between penicillin-resistant pneumococci having a Class C gene and drug sensitivity.
FIG. 9 is a diagram showing the relationship between drug sensitivity and penicillin-resistant pneumococci having a Class C gene.
10 shows primers used for direct sequencing in Example 2. FIG.

Claims (4)

  A base sequence consisting of 10 to 100 bases of the base sequence represented by SEQ ID NO: 1 or a base sequence complementary thereto, and a base sequence consisting of at least 10 bases of the base sequence represented by SEQ ID NO: 3 Alternatively, a nucleic acid fragment having a complementary base sequence.   A primer or probe for detecting penicillin-resistant pneumococci selected from the nucleic acid fragment according to claim 1.   A method for detecting penicillin-resistant pneumococci using the primer or probe according to claim 2.   A kit for detecting penicillin-resistant pneumococci comprising the primer or probe according to claim 2.

Images