KR20030087912A - DNA Probe Derived from ITS for Detection of Infectious Bacteria - Google Patents

Abstract

PURPOSE: DNA probes derived from ITS for detection of infectious bacteria are provided, thereby accurately diagnosing the infectious bacteria. CONSTITUTION: Isolated nucleic acid molecules selected from the nucleotide sequences of SEQ ID NO: 12 to SEQ ID NO: 14, and derived from ITS(internal transcribed spacer region) of Acinetobacter baumanii are provided. DNA probes for detection of Acinetobacter baumanii comprise the nucleic acid molecules of SEQ ID NO: 12 to SEQ ID NO: 14. Isolated nucleic acid molecules selected from the nucleotide sequences of SEQ ID NO: 15 to SEQ ID NO: 18, and derived from ITS of Anaerobiospirillum succiniciproducens are provided. The DNA probes for detection of Anaerobiospirillum succiniciproducens comprise the nucleic acid molecules of SEQ ID NO: 15 to SEQ ID NO: 18. The isolated nucleic acid molecules selected from the nucleotide sequences of SEQ ID NO: 19 to SEQ ID NO: 23, and derived from ITS of Cardiobacterium hominis are provided. The DNA probes for detection of Cardiobacterium hominis comprise the nucleic acid molecules of SEQ ID NO: 19 to SEQ ID NO: 23.

Description

DNA Probe Derived from ITS for Detection of Infectious Bacteria

The present invention relates to probes useful for the detection of the causative agent of infectious diseases and the diagnosis of related diseases. Specifically, the present invention relates to a DNA probe derived from the ITS of bacteria causing bacterial infectious diseases and useful for detecting the bacteria and a DNA chip in which the DNA probe is integrated on a substrate.

Bacterial infectious diseases are diseases that occur when bacteria start appearing and inhabiting blood, body fluids and tissues, and can lose life if the correct identification and proper treatment of bacteria are not performed. More recently, the misuse of antibiotics has resulted in a reduction in bacterial culture rates. As a result, a variety of causative strains have resulted from increased use of immunosuppressants following transplantation and increased drug administration due to chemotherapy. Diagnostic methods for diagnosing infectious diseases are increasingly difficult. In particular, the specific bacteria, including anaerobic bacteria cause a very fatal and serious disease in the human body, so it is important to diagnose them as soon as possible and identify the type of causative bacteria in the treatment. Due to this necessity, diagnostic methods for identifying infectious agents for a long time have been researched and developed. Significant advances have been made in detecting a large number of microorganisms over the past decade, but the diagnostic methods currently in use still require a lot of labor and are low in sensitivity and specificity.

Many of these problems could be solved by using nucleic acid probe techniques involving polymerase chain reaction (PCR). Except for viruses, all prokaryotic organisms contain rRNA genes that encode homologs of prokaryotic 5S, 16S and 23S rRNA molecules. In the case of eukaryotic cells, these rRNA molecules are 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, which are substantially similar to prokaryotic molecules. Many probes have been published for the specific targeting of rRNA subsequences of specific organisms or groups of organisms in biological samples. By using such nucleic acid probes with PCR, many of these problems in conventional diagnostic methods can be solved. In nucleic acid probe technology, the choice of target genes to be amplified is very important. In general, 23S rRNA genes and Internal Transcribed Spacer Regions (ITS) are used, and these probe sequences are advantageously isolated from other bacterial species or infectious organisms under moderate constriction conditions. It is known that the probability of cross-reaction with the derived nucleic acid is low (P. Wattiau et. Al., Appl. Microbiol. Biotechnol. , 56, 816-819, 2001; D, A. Stahlm et. Al., J. Bacteriol ., 172, 116-124, 1990; Boddinghaus. Et.al., J. Clin., Microbiol ., 28, 1751-1759, 1990; T. Rogall et al., J. Gen. Microbiol ., 136, 1915 -1920, 1990;.... . T. Rogall, et al, Int J. System Bacteriol, 40, 323-330, 1990;.... K. Rantakokko-Jalava et al, J. Clin, Mirobiol, 38 (1), 32-39, 2000; Park et. Al., J. Clin., Mirobiol ., 38 (11), 4080-4085, 2000; A. Schmalenberger et. Al, Appl.Microbiol.Biotechnol . , 67 (8), 3557-3563, 2001; WO 98/55646; Jannes et al. No. 6,025,132; and Rossau et al, US Patent No. 6,277,577).

However, for many bacteria, the nucleotide sequence of each bacterial ITS gene has not been identified, so there remains a need to develop a probe with a high specificity that identifies and derives the nucleotide sequence of the bacterial ITS gene. .

An object of the present invention is to identify the nucleotide sequence of the ITS gene of each of the following bacteria to develop a specific probe for each bacteria derived from the ITS gene and use the probe for the diagnosis of infectious diseases by each bacteria:

Acinetobacter baumanii ;

Unaerobiospyroom Succinsi Prodersense

Anaerobiospirillum succiniciproducens ;

Cardiobacterium hominis ;

Chryseobacterium meningosepticum ;

Ochrobactrum anthropi ;

Porphylomonas gingivalis ;

Proteus vulgaris (Proteus vulgaris);

Sutterella wadsworthensis ;

Eikenella corrodens ;

Haemohilus aphrophilas ; And

Neisseria gonorrhea .

The present inventors have developed a probe having a nucleotide sequence that identifies and specifically hybridizes to the 23S rRNA gene of each bacterium and the ITS whole nucleotide sequence (SEQ ID NOs: 1 to 11, respectively) and does not cross-react with nucleic acids of other organisms. In addition, the object of the present invention was achieved by fabricating DNA chips incorporating these probes and confirming each specificity of the probes through clinical experiments.

In one aspect, the invention provides an isolated nucleic acid molecule of the following base sequence derived from the ITS of Acinetobacter Baumanis:

ATACACAGTACTTCG (Acti3, SEQ ID NO: 12);

ATAGTGTTGCAAGGC (Acti002, SEQ ID NO: 13); And

TGAAAAGCCAGGGGA (Acti003, SEQ ID NO: 14).

In another aspect, the present invention provides a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 12 to 14.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising any one of the nucleotide sequences of 12 to 14.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for detecting Acinetobacter Baumani comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 12-14; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a previously formed hybrid, thereby providing a kit for detecting and identifying Acinetobacter Baumani bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NOs: 12-14.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a composition comprising a nucleic acid probe for detecting Acinetobacter Baumani, comprising the nucleic acid molecule of any one of SEQ ID NOs: 12 to 14 in the polynucleic acid of steps (a) and (b); Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying acinetobacter Baumani bacteria in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of the unaerobic pyrirum succinicis prodersense bacterium:

GTTCTTGATTCATTGC (Anas005, SEQ ID NO: 15);

CAGCCCAAAAGTTGA (Anas008, SEQ ID NO: 16);

AAACTGCAGGGCACA (Anas009, SEQ ID NO: 17); And

ATACTACCTGACGAC (Anas010, SEQ ID NO: 18).

In another aspect, the present invention provides a nucleic acid probe for detecting the aerobic pyrisum succinicis proundersense bacteria, characterized in that it comprises a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 15 to 18 .

In another aspect, the present invention provides a composition comprising a nucleic acid probe for the detection of Un-aerobispyrirum succinicis prodersense bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 15 to 18.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of the aerobic pyrisum succinicissiprodercene bacteria comprising a nucleic acid molecule of any one of SEQ ID NO: 15 to 18; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying un-aerobiopyrirum succinisiprocders bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 15 to 18.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a nucleic acid for detecting an aerobic pyrirum succinicis prodersense bacterium comprising the nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 15 to 18 in the polynucleic acid of steps (a) and (b) Contacting the composition comprising the probe with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying un-aerobiopyrirum succinicisprodersense bacteria in the biological sample. do.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Cardiobacterium hominis bacteria:

AAAGAGAGAACAGCA (Car3 (CarI), SEQ ID NO: 19);

TTGGCGACAACAGGC (Car001, SEQ ID NO: 20);

GCCCCGGGAAGCTGA (Car002, SEQ ID NO: 21);

TAGACTGCGGAAGCG (Car003, SEQ ID NO: 22); And

AATTAAGTTGCGTAT (Car004, SEQ ID NO: 23).

In another aspect, the present invention provides a nucleic acid probe for detecting Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 19 to 23.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for detecting Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 19 to 23.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 19 to 23; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Cardiobacterium hominis bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NOs: 19 to 23.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a composition comprising a nucleic acid probe for detecting a cardiobacterium homominis comprising the polynucleic acid of steps (a) and (b) comprising a nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 19 to 23; Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Cardiobacterium hominis bacteria in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule comprising the following base sequence derived from ITS of Chrysbacterium meningocystum fungus:

CTTAGGTGATCACTT (Chr001, SEQ ID NO: 24);

TAACCCCTTAGATTA (Chr003, SEQ ID NO: 25);

TCAAACCTCAAACTA (Chr004, SEQ ID NO: 26); And

AAGAAATCGAAGAGA (Chr005, SEQ ID NO: 27).

In another aspect, the present invention provides a nucleic acid probe for the detection of Chrysbacterium meningocystum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 24 to 27.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for the detection of Chrysbacterium meningocystum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 24 to 27.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of Chrysbacterium meningocceptum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 24 to 27; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Chrysbacterium meningocystum bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising a nucleic acid molecule comprising the base sequence of any one of SEQ ID NOS: 24-27.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a nucleic acid probe for detecting the Krysarbacterium meningocystum bacterium comprising the polynucleic acid of step (a) and (b) comprising the nucleic acid molecule of any one of SEQ ID NOS: 24 to 27; Contacting the composition under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Chrysbacterium meningocystum bacteria in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Ocrobactum antropy bacteria:

GTTGATTGACACTTG (Ochr004, SEQ ID NO: 28);

TACCGCTCACGAGCC (Ochr005, SEQ ID NO: 29); And

GGGTCCGGAGGTTCA (Ochr007, SEQ ID NO: 30).

In another aspect, the present invention provides a nucleic acid probe for the detection of Ocrobacrum antropy bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 28 to 30.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for the detection of Ocrobacrum antropy bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 28 to 30.

In another aspect, the present invention (a) composition comprising a nucleic acid probe for the detection of Ocrobacrum antropy bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 28 to 30; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying the okrobacterium antropy bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 28 to 30.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a composition comprising a nucleic acid probe for the detection of Ocrobacrum antropy bacteria, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 28 to 30 Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying the Okrobacrum antropy bacteria in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Popiromonas jinjibalis:

GTTTTTGTGAGTGGA (Por 001, SEQ ID NO: 31); And

TGATGGGTGGGGTTG (Por 002, SEQ ID NO: 32).

In still another aspect, the present invention provides a nucleic acid probe for detecting P. pylorimonas gingivalis, which comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 31 and 32.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 31 and 32.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of Popiromonas genjivalis bacteria comprising a nucleic acid molecule comprising the base sequence of any one of SEQ ID NO: 31 and 32; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Popiromonas zybacilli bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NOs: 31 and 32.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a composition comprising a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 31 and 32 in the polynucleic acid of steps (a) and (b) Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Popiromonas genjivalis bacteria in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Proteus vulgaris:

ATACGTGTTATGTGC (Pvulga01, SEQ ID NO: 33).

In another aspect, the present invention provides a nucleic acid probe for detecting Proteus vulgaris, characterized in that it comprises a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for detecting Proteus vulgaris, including a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for detecting the proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Proteus vulgaris in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of SEQ ID NO: 33.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) contacting the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33 under appropriate hybridization and washing conditions; ; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Proteus vulgaris in said biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Suterella wazworthensis:

TTCGGGTCCGTAATT (Swad02, SEQ ID NO: 34);

AATCAAGGCCGAGGC (Swad03, SEQ ID NO: 35); And

GCCGAGGCGTGATGA (Swad04, SEQ ID NO: 36).

In another aspect, the present invention provides a nucleic acid probe for detecting Suterella wazworthensis, characterized in that it comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 34 to 36.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for detecting Suterella wazworthensis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 34 to 36.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of Suterella wawoworthensis comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 34 to 36; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Suterella wazworthensis bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 34 to 36.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a composition comprising a nucleic acid probe for detecting Suterella wazworthensis, the polynucleic acid of steps (a) and (b) comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 34 to 36; Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Suterella wazworthis bacteria in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of E.ella corodens:

AGTCGTAGAGCGGAG (E.corro001, SEQ ID NO: 37)

In another aspect, the present invention provides a nucleic acid probe for the detection of E.ella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for the detection of E.ella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of E.ella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying E.ella corodens bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of SEQ ID NO: 37.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) appropriate hybridization and washing conditions of the polynucleic acid of step (a) and (b) with a composition comprising a nucleic acid probe for the detection of E.ella corodens comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37. Contacting under; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying E.ella corodens in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from ITS of Haemophilus apropylras:

TGGGAGTGGGTTGTC (H.aphro001, SEQ ID NO: 38); And

TAACAAACCGGAAAC (H.aphro002, SEQ ID NO: 39).

In another aspect, the present invention provides a nucleic acid probe for detection of Haemophilus apropyls bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 38 and 39.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for the detection of Haemophilus apropyl bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 38 and 39.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of Haemohilus apropyls bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 38 and 39; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Haemophilus apropyls in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NOs: 38 and 39.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) a composition comprising a nucleic acid probe for detecting Haemophilus apropyl bacterium, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 38 to 39 Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Haemophilus apropyl bacteria in the biological sample.

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from ITS of Neisseria gonohaea:

AACCTCTCGCAAGAG (N.gono002, SEQ ID NO: 40)

In another aspect, the present invention provides a nucleic acid probe for detection of Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40.

In another aspect, the present invention provides a composition comprising a nucleic acid probe for detecting Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40.

In another aspect, the present invention (a) a composition comprising a nucleic acid probe for the detection of Neisseria Gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Neisseria gonohea bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of SEQ ID NO: 40.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detection of Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40. Contact; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Neisseria gonohea bacteria in the biological sample.

In another aspect, the present invention is (a) one or more of the nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 12 to 14, any one of SEQ ID NO: 15 to 18 At least one of the nucleic acid probes for detecting the aerobic pyrirum succinicis deferens bacteria comprising a nucleic acid molecule containing one nucleotide sequence, comprising a nucleic acid molecule comprising any one of SEQ ID NO: 19 to 23 At least one of the nucleic acid probes for detecting the Cardiobacterium homominis, or at least one of the nucleic acid probes for detecting the bacterium meningocceptum bacterium comprising the nucleic acid molecule of any one of SEQ ID NOS: 24-27 , For the detection of Ocrobact antropy bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 28 to 30 One or more of the nucleic acid probes, one or more of the nucleic acid probes for detecting P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 31 and 32; One or more of a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule, a nucleic acid probe for detecting Suterella wazworthensis, including the nucleic acid molecule of any one of SEQ ID NOs: 34-36 Nucleic acid probe for detecting E.ella corodens, comprising a nucleic acid molecule comprising the nucleotide sequence of No. 37, Haemophilus apropyls comprising the nucleic acid molecule of any one of SEQ ID NOs: 38 and 39 Neseries comprising a nucleic acid molecule comprising at least one of the nucleic acid probes for detection of A composition comprising one or more probes selected from the group consisting of nucleic acid probes for detecting Agonohea bacteria; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying one or more species of said bacteria in a biological sample.

In another aspect, the present invention provides a DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 12 to 44.

In another aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) at least one of the nucleic acid probes for detecting Acinetobacter Baumani, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequences of SEQ ID NOs: 12-14; One or more of the nucleic acid probes for detecting the aerobic pyrirum succinicis prodense bacterium comprising a nucleic acid molecule comprising any one of 15 to 18, the base sequence of any one of SEQ ID NOs: 19 to 23 For detection of Chrysbacterium meningocystum bacteria comprising a nucleic acid molecule comprising at least one nucleic acid probe of any one of the nucleic acid probes of the Cardiobacterium hominis comprising the nucleic acid molecule Test for the bacterium Ocrobacrum antropy comprising at least one nucleic acid probe and a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 28-30 One or more of the nucleic acid probes for detecting P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising one or more of the nucleic acid probes of SEQ ID NOs: 31 and 32; At least one of a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule, and a nucleic acid probe for detecting Suterella wazworthensis, including the nucleic acid molecule of any one of SEQ ID NOs: 34 to 36, wherein Nucleic acid probe for the detection of the bacteria Ikenella corodens comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37, Haemophilus apropyls comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 38 and 39 An age comprising one or more of the nucleic acid probes for detecting the bacterium and a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40 above Contacting a composition comprising one or more probes selected from the group consisting of nucleic acid probes for detecting Ceria gonohea bacteria under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying one or more species of said bacteria in said biological sample.

1 shows the location of the primers used to amplify polynucleic acid in a biological sample. (16S: 16S rRNA; ITS: Internal Transcribed Spacer Region (hereinafter referred to as “ITS”); 23S: 23S rRNA).

Figure 2 is an embodiment of the present invention, the Acinetobacter Baumani, Unaerobicspyrium succinsiprodersense, Chrysbacterium meningocseptum, Ocrobacrum antropy and Popiromonas ginjivalis We show the design of a DNA chip in which probe candidates for 15 standard strains were integrated, including probes for bacteria.

FIG. 3 shows the results of hybridization of genomic DNA extracted from Acinetobacter Baumani bacteria in the DNA chip of FIG. 2 retrieved using Scanarray 5000. FIG.

FIG. 4 shows a scan array after hybridization with a target derived from a nucleic acid molecule isolated from a patient infected with Acinetobacter Baumani on the DNA chip of FIG. 2 (however, a probe derived from Acinetobacter Baumani is used with Acti002). Show the search results using 5000.

FIG. 5 shows the results of hybridization of genomic DNA extracted from the Unaerobiopyrirum succinicis deferens bacteria in the DNA chip of FIG. 2 retrieved using ScanAray 5000.

FIG. 6 shows a design of a DNA chip in which probe candidate groups for 15 standard strains are integrated, including probes for the Cardiobacterium hominis bacteria of the present invention.

FIG. 7 shows hybridization results of genomic DNA extracted from Cardiobacterium hominis bacteria in the DNA chip of FIG. 6 retrieved using ScanAray 5000.

FIG. 8 shows the results of hybridization of genomic DNA extracted from Chrysbacterium meningocystum bacteria in the DNA chip of FIG. 2 retrieved using ScanAray 5000.

FIG. 9 shows the results of hybridization of genomic DNA extracted from the Okrobacrum antropy bacteria in the DNA chip of FIG. 2 retrieved using ScanAray 5000.

FIG. 10 shows the results of hybridization of genomic DNA extracted from the P. pylorimonas genovalis bacteria in the DNA chip of FIG. 6 searched using ScanAray 5000.

FIG. 11 shows a design of a DNA chip in which probe candidate groups for five standard strains are integrated, including a probe for Proteus vulgaris of the present invention.

FIG. 12 shows the results of hybridization of genomic DNA extracted from Suterella wazworthensis bacteria in the DNA chip of FIG. 11 retrieved using ScanAray 5000.

FIG. 13 shows a design of a DNA chip in which probe candidate groups for six standard strains are integrated, including a probe for Suterella wazworthensis bacteria of the present invention.

FIG. 14 shows hybridization results of genomic DNA extracted from Suterella wazworthensis bacteria in the DNA chip of FIG. 13 searched using ScanAray 5000.

15 is a DNA chip in which probe candidate groups for eight standard strains are integrated, including probes against E. colidens, Haemohilus apropyllas, and Neisseria gonohea, according to another embodiment of the present invention. Shows the design.

FIG. 16 shows the results of hybridization of genomic DNA extracted from E.ella corodens bacteria in the DNA chip of FIG. 15 retrieved using ScanAray 5000. FIG.

FIG. 17 shows the results of hybridization of genomic DNA extracted from Haemohilus apropyls bacteria in the DNA chip of FIG. 15 retrieved using ScanAray 5000.

FIG. 18 shows hybridization results of genomic DNA extracted from Neisseria gonohhea bacteria in the DNA chip of FIG. 15 retrieved using ScanAray 5000.

Terms

A "isolated" nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid. For example, with respect to genomic DNA, the term “isolated” includes nucleic acid molecules isolated from chromosomes to which genomic DNA is naturally bound.

"Probe" refers to a single chain-specific oligonucleotide having a sequence that is sufficiently complementary to the target sequence to be detected and hybridizes.

"Target" means a nucleic acid molecule from a biological sample having a sequence complementary to any of the probes according to the invention. The target nucleic acid may be DNA (optionally obtained after amplification) or RNA.

A "biological sample" is a sample of a clinical sample (eg, juice, saliva, blood, urine, etc.), environmental sample, bacterial colony, contaminated or pure culture, purified nucleic acid, etc., for which a target sequence of interest is to be detected. Point to.

"Polynucleic acid" refers to whole nucleic acid or ribosomal RNA extracted from a biological sample, in particular ITS, or DNA obtained from reverse transcription of genomic DNA or ITS.

An "oligonucleotide" refers to a chain of nucleotide units characterized by the information sequence of a native (or optionally modified) nucleic acid that can hybridize, such as a natural nucleic acid, with a nucleotide fragment that is complementary or substantially complementary under predetermined conditions. This chain may contain nucleotide units of a structure different from that of the natural nucleic acid and may contain from 15 to 100 monomers. Oligonucleotides are generally obtainable by natural nucleic acid molecules and / or gene recombination and / or chemical synthesis.

A “nucleotide” is the basic unit of nucleic acid consisting of phosphate groups, 5-carbosaccharides and nitrogen bases. The 5-saccharide found in RNA is ribose. The 5-saccharide in DNA is 2-deoxyribose. In the case of 5-nucleotides, the sugars contain hydroxyl groups (-OH) in 5-saccharide-2. The term also includes analogs of these basic units, such as methoxy groups at the 2 position of ribose.

By "hybridization" is meant the process by which two nucleotide fragments with sufficiently complementary sequences can be joined under stable conditions and through a specific hydrogen bond to form a double strand.

"Primer" refers to an oligonucleotide that can act as an initiation point for synthesis under conditions predetermined for the initiation of enzymatic polymerization in amplification techniques such as PCR. Oligonucleotide primers may be natural or synthetically prepared, such as purified restriction enzyme digests.

"Tension" is used to describe the temperature and solvent composition during hybridization and subsequent processing.

“Complementarity” is provided by the base sequence of the Japanese chain of DNA or RNA capable of forming hybrid or double-stranded DNA: DNA, RNA: RNA or DNA: RNA via hydrogen bonding between individual stranded Watson-Crick base pairs. It indicates the nature of being. Adenine (A) is usually complementary to thymine (T) or uracil (U) and guanine (G) is usually complementary to cytosine (C).

“Fully complementary” or “substantially complementary” refers to a nucleic acid having a sufficient amount of combustive complementary nucleotides to form a stable hybrid for detection under high constriction hybridization conditions.

"Matched" refers to all pairs of two nucleotides that do not form normal Watson-Crick hydrogen bonds in a hybrid.

A "label" refers to any atom or molecule that provides a detectable (preferably quantifiable) signal and can be bound to a nucleic acid or protein. Labels can provide signals detectable by fluorescence, radioactivity, chromaticity, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like.

A "hybrid" or "duplex" is a complex formed between two single-stranded nucleic acid sequences by Watson-Crick base pairs or nonstandard base pairs between complementary bases.

"Probe specificity" refers to the characteristics of a probe to describe its ability to distinguish between target and nontarget sequences.

Sympathy

Acinetobacter Baumani, Unaerobiospyrium Succinsi Prodersense, Cardiobacterium Hominis, Chrysbacterium Meningocseptum, Ocrobacterium Antropy, Popiromonas Ginvivalis, Proteus Bulgari, Suterella In order to construct a probe for the detection of Wazworth tensis, Ikenella corrodens, Haemohilus apropylas or Neisseria gonohea bacteria, the specific probe candidate group must be selected for each bacteria. . The specific probe candidate group sorts and compares the sequences of all possible bacteria in a line through multiple alignments to separately classify specific sequences present only in each of the bacteria to prepare and select a probe candidate group present therein. Probe candidates are determined within the ITS site in each strain. The specificity of the probe candidate group is first confirmed by comparing the similarities between the bacterial strains through BLAST search, and the strains are applied to the hybridization reaction, and the probes that react only with each bacteria are selected for identification in the candidate group. Test strains applied to the hybridization reaction include, but are not limited to:

Porphylomonas gingivalis

Peptostreptococcus prevotii ;

Cardiobacterium hominis ;

Chryseobacterium meningosepticum ;

Ochrobactrum anthropi ;

Actinomyces israelii ;

Comamonas acid ovorans ;

Bacteroides fragilis ;

Anaerobiospirillum succiniproducens ;

Acinetobacter baumanii ;

Klebsiella oxytoca ;

Stomatococcus mucilaginosus ;

Shigella sonnei ;

Morganella morganii ;

Staphylococcus epidermidis ;

Streptococcus pyogenes ;

Burkholderia cepacia ;

Vibrio cholerae ;

Salmonella spp ;

Haemophilus influenza ;

Escherichia coli ;

Streptococcus viridans ;

Klebsiella pneumoniae ;

Proteus mirabilis ;

Strentrophomonas maltophila ;

Streptococcus pneumoniae ;

Vibrio vulnificus ;

Shigella flexneri ;

Pseudomonas aeruginosa ;

Aeromonas hydrophila ;

Listeria monocytogenes ;

Enterococcus faecium ;

Enterococcus faecalis ;

Staphylococcus aureus ;

Neisseria meningitidis ;

Serratia marcescens ;

Citrobacter freundii ;

Sutterella wadsworthii ;

Clostidium ramosum ;

Peptostreptococcus aerobius ;

Peptostreptococcus magnus ;

Fusobacterium necrophorum ;

Shigella dysenteriae ;

Proteus vulgaris (Proteus vulgaris);

Enterobacter aerogenes ;

Streptococcus mutans ;

Corynebacterium diphtheria ;

Kingella kingae ;

Bacteroides vulgatus ;

Bacteroides ovatus ;

Haemophilus actinomycetem comitans;

Bacteroides thetaiotaomicron ;

Clostridium diffcile ;

Enterobacter cloacae ;

Haemohilus aphrophilas ;

Neisseria gonorrhea ;

Branhamella catarrhalis ;

Eikenella corrodens ; And

Legionella pneumophila ; (59 strains in total)

Hereinafter, the probes identified according to the present invention will be described by bacteria. The probe of the present invention includes a mutant oligonucleotide having 15 oligonucleotides derived from the ITS gene of each bacterium identified in the present invention or one or more nucleotides added to both ends thereof.

Probes Derived from the Acinetobacter Baumani

Probes of the invention suitable for the detection and identification of Acinetobacter Baumani bacteria include nucleic acid molecules having the nucleotide sequences set forth in Table 1 below. This probe is derived from the ITS of Acinetobacter Baumani and exhibits specificity that hybridizes only with target DNA derived from Acinetobacter Baumani and does not hybridize with nucleic acids of other organisms. Preferred probes are Acti3 and Acti002.

designation Sequence location SEQ ID NO: Specificity Acti3 (Acti I) ATACACAGTACTTCG ITS 12 Among the 59 species, 56 species except Porphylomonas, Rothia, and Klebsiella did not cross-react with bacteria. Acti001 AGGTATTGCAACATG ITS 41 No signal appears when applying genome gene 4 of standard strain KCTC 2771 Acti002 ATAGTGTTGCAAGGC ITS 13 No cross reaction with any target DNA derived from the 59 strains Acti003 TGAAAAGCCAGGGGA ITS 14 Among the 59 species, 58 species except Salmonella spp. ActiIT01 CAGAAGTAGCTGCCT ITS 42 No signal appears when applying genome gene 4 of standard strain KCTC 2771 ActiIT02 AGAAGTAGCTGCCTA ITS 43 No signal appears when applying genome gene 4 of standard strain KCTC 2771 ActiIT03 GAAGTAGCTGCCTAA ITS 44 No signal appears when applying genome gene 4 of standard strain KCTC 2771 ActiIT04 AAGTAGCTGCCTAAC ITS 45 Two cross-reactions occur with the application of the genome gene 4 of the standard strain ATCC 2711 (50% efficiency) ActiIT05 AGTAGCTGCCTAACT ITS 46 Two cross-reactions occur with the application of the genome gene 4 of the standard strain ATCC 2711 (50% efficiency)

Standard Strain KCTC 2771: Acinetobacter Baumani

Probe Derived from Unaerobiopyrirum Succinic Nisder Prosthesis

Probes of the present invention suitable for the detection and identification of Unaerobiopyrirum succinicis prodersense bacteria include nucleic acid molecules having the nucleotide sequences set forth in Table 2 below. These probes are derived from the ITS of the unaerobic pyrisum succinic nis prosthesis bacterium, which hybridize only with the target DNA derived from the unaerobic pyrirum succinicis prosthesis bacterium and not with the nucleic acids of other organisms. Indicates. Preferred probes are Anas005, Anas008, Anas009 and Anas0010.

designation Sequence location SEQ ID NO: Specificity Anas005 GTTCTTGATTCATTGC ITS 15 No cross reaction with any target DNA derived from the 59 strains Anas008 CAGCCCAAAAGTTGA ITS 16 No cross reaction with any target DNA derived from the 59 strains Anas009 AAACTGCAGGGCACA ITS 17 No cross reaction with any target DNA derived from the 59 strains Anas0010 ATACTACCTGACGAC ITS 18 No cross reaction with any target DNA derived from the 59 strains Anas012 TAGCGTTCTGCGAGG ITS 47 All signals do not appear when applying genomic gene of standard strain ATCC 29305 AnasIT001 ACAGCGCAGCATGTG ITS 48 All signals do not appear when applying genomic gene of standard strain ATCC 29305 AnasIT002 AATTAGCAACTATTT ITS 49 All signals do not appear when applying genomic gene of standard strain ATCC 29305 AnasIT01 CTTCCCTCAGTGATT ITS 50 No signal after all 4 genomes of the standard strain ATCC 29305 AnasIT02 TTCCCTCAGTGATTC ITS 51 No signal after all 4 genomes of the standard strain ATCC 29305 AnasIT03 TCCCTCAGTGATTCA ITS 52 No signal after all 4 genomes of the standard strain ATCC 29305 AnasIT04 CCCTCAGTGATTCAA ITS 53 No signal after all 4 genomes of the standard strain ATCC 29305 AnasIT05 CCTCAGTGATTCAAG ITS 54 No signal after all 4 genomes of the standard strain ATCC 29305

Standard strain ATCC 29305: Unaerobiopyrirum

Probes Derived from Cardiobacterium Hominis

Probes of the invention suitable for the detection and identification of Cardiobacterium hominis bacteria include nucleic acid molecules having the nucleotide sequences set forth in Table 3 below. These probes are derived from the ITS of the Cardiobacterium hominis bacterium and exhibit specificity that hybridizes only with the target DNA derived from the Cardiobacterium homominis and does not hybridize with nucleic acids of other organisms. Preferred probes are Car3, Car 001, Car 002, Car 003 and Car 004.

designation Sequence location SEQ ID NO: Specificity Car3 (CarI) AAAGAGAGAACAGCA ITS 19 No cross reaction with any target DNA derived from the 59 strains Car 001 TTGGCGACAACAGGC ITS 20 No cross reaction with any target DNA derived from the 59 strains Car 002 GCCCCGGGAAGCTGA ITS 21 No cross reaction with any target DNA derived from the 59 strains Car 003 TAGACTGCGGAAGCG ITS 22 No cross reaction with any target DNA derived from the 59 strains Car 004 AATTAAGTTGCGTAT ITS 23 No cross reaction with any target DNA derived from the 59 strains

Standard strain ATCC 14900: Cardiobacterium hominis

Probes Derived from Chrysbacterium Meningocystum

Probes of the invention suitable for the detection and identification of Chrysbacterium meningocystum bacteria include nucleic acid molecules having the nucleotide sequences set forth in Table 4 below. These probes are derived from the ITS of Chrysbacterium meningocystum bacteria and exhibit specificity that hybridizes only with the target DNA derived from the Chrysbacterium meningocystum bacterium and not with nucleic acids of other organisms. Preferred probes are Chr003, Chr004 and Chr005.

designation Sequence location SEQ ID NO: Specificity Chry3 (ChryI) TCCTTGAGTGCAGAG ITS 55 No signal appears when applying genomic gene of standard strain ATCC 13253 Chr001 CTTAGGTGATCACTT ITS 56 Of the 59 species, 57 species except Actinomyces and Porphylomonas do not cross-react Chr002 AGCACAGCTTTGGTT ITS 57 No signal appears when applying genomic gene of standard strain ATCC 13253 Chr003 TAACCCCTTAGATTA ITS 25 No cross reaction with any target DNA derived from the 59 strains Chr004 TCAAACCTCAAACTA ITS 26 No cross reaction with any target DNA derived from the 59 strains Chr005 AAGAAATCGAAGAGA ITS 27 No cross reaction with any target DNA derived from the 59 strains

Standard strain ATCC 13253: Cresbacterium meningocystum

Probes Derived from the Ocrobact Antropy

Probes of the invention suitable for the detection and identification of Ocrobact antropy bacteria include nucleic acid molecules having the base sequences set forth in Table 5 below. These probes are derived from the ITS of Ocrobact antropy and exhibit specificity that hybridizes only with target DNA derived from Ocrobact antropy and does not hybridize with nucleic acids of other organisms. Preferred probes are Ochr004, Ochr005 and Ochr007.

designation Sequence location SEQ ID NO: Specificity Ochr3 (Ochr I) GATCCGACGATTTCC ITS 58 All signals do not appear when applying genomic gene of standard strain ATCC 49188 Ochr001 TAGGAAAGACGCAGT ITS 59 All signals do not appear when applying genomic gene of standard strain ATCC 49188 Ochr004 GTTGATTGACACTTG ITS 28 No cross reaction with any target DNA derived from the 59 strains Ochr005 TACCGCTCACGAGCC ITS 29 No cross reaction with any target DNA derived from the 59 strains Ochr007 GGGTCCGGAGGTTCA ITS 30 No cross reaction with any target DNA derived from the 59 strains

Standard Strain ATCC 49188: Ocrobact Antropy

Probes Induced from Popiromonas Genjivalis

Probes of the invention suitable for the detection and identification of P. pylorimonas bacilli include the nucleic acid molecules having the nucleotide sequences set forth in Table 6 below. These probes are derived from the ITS of Popiromonas genjivalis bacteria and exhibit specificity that hybridizes only with target DNA derived from the genus Popiromonas genjivalis bacteria but not with nucleic acids of other organisms. Preferred probes are Por 001 and Por 002.

designation Sequence location SEQ ID NO: Specificity Por3 (PorI) TGTTTGTGCGACGTG ITS 60 No signal 2 occurs when applying genomic gene 4 of the standard strain ATCC 33277 (50% efficiency) Por 001 GTTTTTGTGAGTGGA ITS 31 Of the 59 species, 57 species except Actinomyces and Rothia do not cross-react Por 002 TGATGGGTGGGGTTG ITS 32 Of the 59 species, 57 species except Actinomyces and Rothia do not cross-react

Standard strain ATCC 33277: Popiromonas ginjivalis

Probes derived from Proteus vulgaris

Probes of the present invention suitable for detecting and identifying Proteus vulgaris include nucleic acid molecules having the nucleotide sequences set forth in Table 7 below. These probes are derived from ITS of Proteus vulgaris and exhibit specificity that hybridizes only with target DNA derived from Proteus vulgaris and not with nucleic acids of other organisms. Preferred probe is Pvulga01.

designation Sequence location SEQ ID NO: Specificity Pvulga01 ATACGTGTTATGTGC ITS 33 No cross reaction with any target DNA derived from the 59 strains p.vulga02 CTCACACAGACTTGT ITS 61 No signal appears when applying genomic gene of standard strain KCCM 11539 p.vulga005 GTGGGTTGCAAAATA ITS 62 No signal appears when applying genomic gene of standard strain KCCM 11539

Standard Strain KCCM 11539: Proteus vulgaris

Probes Derived from Suterella Wausworthis

Probes of the invention suitable for the detection and identification of Suterella wazworthensis bacteria include nucleic acid molecules having the nucleotide sequences set forth in Table 8 below. These probes are derived from the ITS of Suterella Wausworthis bacteria and exhibit specificity that hybridizes only with target DNA derived from Suterella Wausworthis bacteria and not with nucleic acids of other organisms. Preferred probes are Swad02, Swad03 and Swad04.

designation Sequence location SEQ ID NO: Specificity s.wad 01 CTCAGTAAGACGTTT ITS 63 All signals do not appear when applying genomic gene of standard strain ATCC 51579 Swad02 TTCGGGTCCGTAATT ITS 34 No cross reaction with any target DNA derived from the 59 strains Swad03 AATCAAGGCCGAGGC ITS 35 No cross reaction with any target DNA derived from the 59 strains Swad04 GCCGAGGCGTGATGA ITS 36 No cross reaction with any target DNA derived from the 59 strains

Standard strain ATCC 51579: Suterella Wausworthis

Probes Derived from the Ikenella Corodens

Probes of the invention suitable for the detection and identification of E.ella corodens bacteria include nucleic acid molecules having the nucleotide sequences set forth in Table 9 below. These probes are derived from the ITS of E.ella corodens and exhibit specificity that hybridizes only with the target DNA derived from E. ella corodens and does not hybridize with nucleic acids of other organisms. Preferred probes

designation Sequence location SEQ ID NO: Specificity E.corro001 AGTCGTAGAGCGGAG ITS 37 Of the 59 species, 58 species except N.gonorrhoeae do not cross-react E.corro002 AGATCCGCCCAGGTA ITS 64 All signals do not appear when applying genomic gene of standard strain ATCC 51724 E.corro003 GTTGCTGCATCTTGC ITS 65 All signals do not appear when applying genomic gene of standard strain ATCC 51724 E.corro004 GCAGGATTCGGACAC ITS 66 All signals do not appear when applying genomic gene of standard strain ATCC 51724

Standard strain ATCC 51724: Ichenella corrodens

Probes Derived from Haemophilus Apropyls

Probes of the present invention suitable for the detection and identification of Haemophilus apropyl bacteria include nucleic acid molecules having the nucleotide sequences set forth in Table 10 below. These probes are derived from the ITS of Haemohilus apropylas and exhibit specificity that hybridizes only with target DNA derived from Haemohilus apropylas but not with nucleic acids of other organisms. Preferred probes are H.aphro001, H.aphro002.

designation Sequence location SEQ ID NO: Specificity H.aphro001 TGGGAGTGGGTTGTC ITS 38 No cross reaction with any target DNA derived from the 59 strains H.aphro002 TAACAAACCGGAAAC ITS 39 No cross reaction with any target DNA derived from the 59 strains

Standard Strain ATCC 13252: Haemohilus Apropyls

Probes Derived from Neisseria Gonohea

Probes of the invention suitable for the detection and identification of Neisseria gonohea bacteria include nucleic acid molecules having the base sequences set forth in Table 11 below. These probes are derived from the ITS of Neisseria gonohea bacteria and exhibit specificity that hybridizes only with target DNA derived from the Neisseria gonohea bacteria, but not with nucleic acids of other organisms. Preferred probe is N. gono002.

designation Sequence location location Specificity N.gono001 AATGAGTTTGTTTTG ITS 67 No signal appears when applying genomic gene of standard strain ATCC 10150 N.gono002 AACCTCTCGCAAGAG ITS 40 No cross reaction with any target DNA derived from the 59 strains N.gono007 CAATGAGTTTGTTTT ITS 68 No signal appears when applying genomic gene of standard strain ATCC 10150

Standard strain ATCC 10150: Neisseria gonoha

Probe

The probes of the present invention can be used for all known hybridization techniques for testing for the presence of target nucleic acids in biological samples for diagnostic purposes, such as point deposition techniques on filters called “dot-blot” (MANIATIS et al., Molecular Cloning, Cold Spring Harbor, 1982), DNA delivery technology called Southern Blotz (SOUTHERN, EM, J. Mol. Biol., 98, 503 (1975)), and RNA delivery technology called Northern Blotz.

The probes of the invention can also be used in sandwich hybridization systems that enhance the specificity of nucleic acid probe-based assays. The principles and uses of sandwich hybridization in nucleic acid probe-based assays are known (eg, DUNN and HASSEL, Cell, 12: 23-36, 1977; and RNAKI et al., Gene, 21: 77-85, 1983). The sandwich hybridization technique uses a capture probe and / or a detection probe, which can hybridize with two different regions of the target nucleic acid and at least one of them (generally the detection probe) is specific for the desired bacterium or group of fungi. May hybridize with the region of the target. Capture probes and detection probes should have at least partially different nucleotide sequences. While direct hybridization assays offer advantageous kinetics, sandwich hybridization is advantageous in that it has a high signal-to-noise ratio. In addition, sandwich hybridization can increase the specificity of nucleic acid probe-based assays. Incubation and subsequent washing steps, which constitute the main step of the sandwich hybridization process, are conducted at constant temperature, about 20-65 ° C., respectively. Nucleic acid hybrids are dependent on the number of hybridized bases (the temperature increases in proportion to the size of the hybrid) and also have a dissociation temperature that is dependent on the nature of the hybridized base and the nature of the adjacent base for each hybridized base. It is known. The hybridization temperature used in the sandwich hybridization technique should be selected below the half-dissociation temperature of the hybrid formed between the given probe and the target of the complementary sequence. This semi-dissociation temperature can be determined by simple routine experimentation.

In addition, the probes of the present invention can be used in a competitive hybridization protocol. In competitive hybridization, the target molecule competes with hybrid formation between a particular probe and its complement. The more targets are present, the less hybrid is formed between the probe and its complement. Positive signals indicating the presence of a specific target appear to decrease the hybridization response compared to a system without a target added. In certain embodiments, conveniently labeled specific oligonucleotide probes are hybridized with a target molecule. Subsequently, the mixture is placed in a microtiter dish well immobilized with oligonucleotides complementary to the specific probe, allowing the hybridization to continue. After washing, the hybrid between the complementary oligonucleotide and the probe is preferably quantified according to the label used.

The probe of the present invention can also be used for reversed hybridization (Proc. Natl. Acad. Sci. USA, 86: 6230-6234, 1989). In this case, first, the target sequence can be enzymatically amplified by performing PCR using 5 biotinylated primers. The product amplified in the second step is detected by hybridization with specific oligonucleotides immobilized on a solid support. Reverse hybridization can be carried out without amplification. In such cases, the nucleic acid present in the biological sample must be labeled or modified specifically or nonspecifically by chemical or specific dye addition prior to hybridization.

Probe production

The probe of the present invention can be manufactured according to a conventional method, and there are two main methods. First, a single stranded probe is obtained. As the most representative example, a deprotection reaction may be performed by synthesizing by using a dimethoxytrityl (DMT) off method in an automatic chemical synthesizer, and then a probe having a desired number of bases may be synthesized. The probe thus prepared can be attached to a fluorescent substance such as fluorescein isothiocyanate (FITC) at one end of the strand to confirm the presence of a specific nucleic acid. Alternatively, single-stranded DNA is used as a template to make a probe having a base sequence complementary thereto. The primer is hybridized to the DNA of the template, and the Klenow enzyme and the fluorescent material are attached from the primer. Base (dNTP) will be used to synthesize the probe. Since the fluorescent material is attached to the inside of the DNA, it is possible to synthesize a probe having high sensitivity and specificity. Second, there is a way to get a double stranded probe. Genomic DNA or plasmid DNA can be cut with specific restriction enzymes to obtain probes containing genes or bases of desired portions. Random priming is a method of hybridizing six random hexamers and template DNA, and then synthesizing probes of various lengths to which fluorescent substances are attached. ³² P at the end of the T4 polynucleotide kinase (polynucleotide kinase) by using a fluorescent material attached to the probe can be synthesized, DNA cleavage (DNase) I using a DNA strand (double-stranded) to make a cleavage, Using this DNA as a template, a probe can be synthesized using DNA polymerase I and a base (dNTP) to which a fluorescent substance is attached. This double-stranded probe is used for hybridization after denaturation to make it single-stranded.

Probes of the invention can be advantageously labeled. Any conventional label can be used. Probes can be labeled using radioactive isotopes such as ³² P, ³⁵ S, ¹²⁵ I, ³ H and ¹⁴ C. Radiolabeling can be carried out according to conventional methods such as end labeling the 3 or 5 position with radiolabeled nucleotides, polynucleotide kinases, terminal transferases or ligases. Another method of radiolabeling is to chemically iodide the probe of the present invention, which results in the binding of several ¹²⁵ I atoms onto the probe. As such, when one of the probes of the present invention is labeled as radioactive, radiation is generally detected using autoradiography, liquid scintillation, gamma coefficients, or other conventional methods. In addition, the probes of the present invention may include residues with immune properties (eg, antigens or haptens), residues with specific affinity for some reagents (eg ligands), residues that provide a detectable enzymatic reaction (eg enzymes, Coenzymes, enzyme substrates or substrates participating in enzymatic reactions) or in combination with residues which provide physical properties of fluorescence, luminescence or absorption at certain wavelengths. Moreover, the antibody which specifically detects the hybrid formed by a probe and a target can be used. Non-radioactive labels can be provided when chemically synthesizing the probe of the present invention. Adenosine, guanosine, cytidine, thymidine and uracil residues readily bind to other chemical residues and allow detection of hybrids formed between the probe or probe and complementary DNA or RNA fragments.

DNA chip

The probe of the present invention is also used as a gene chip. A preferred embodiment of the present invention provides a DNA chip comprising the probe of the present invention. A DNA chip is a high density accumulation of fragments of several nucleotide sequences on a small substrate and is used to detect DNA of an unknown sample by hybridization between DNA immobilized on a substrate and an unknown DNA sample complementary thereto. The substrate on which the probe is to be fixed is made of an inorganic material such as glass or silicone, or a polymer material such as acrylic, polyethylene terephtalate (PET), polystylene, polycarbonate, polypropylene, and the like. Flat or multiple holes can be used. The probe is fixed either covalently to the substrate at either 5 'or 3'. The immobilization method is a conventional technique, for example using an electrostatic force or by attaching an amine group on the synthesized oligo to an aldehyde coated slide to induce bonding between the two, or on an amine group coated slide or L-lysine It can be done by integrating on this coated slide or on a slide with a nitrocellulose membrane coated. In one embodiment of the present invention, when the probe is synthesized, a base having an amino residue in the 3 'position is inserted to covalently bond to a glass plate coated with an aldehyde residue.

Fixing and arranging different probes on a substrate surface uses methods such as pin microarrays, inkjets, photolithography, electrical arrays, and the like. In one embodiment of the present invention (Yoon et al, J. Microbiol. Biotechnol., 10 (1), 21-) using a microarrayer prepared according to a known method while the probe is dissolved in a buffer solution . 26, 2000). The principle of microarrays is that the microfabricated pins carry DNA from the plate and transfer it to the same location specified by the computer on the substrate. Between the amine groups on the 3 'position of the probe and the aldehyde groups coated on the glass plate, under conditions where the humidity is maintained between 45% and 65%, preferably between 50% and 55%, for fixing the probe transferred by the microarray. In order to facilitate the reaction, the reaction is induced for at least 1 hour, and left for at least 6 hours to fix the DNA probe.

If necessary to detect cells derived from a living organism or the organism itself, these cells may be partially or completely lysed by chemical and / or physical methods to facilitate access to the RNA and / or DNA of those cells and Contact. The contact can be carried out on a suitable support such as nitrocellulose, cellulose or nylon filters in a liquid medium or solution. Such contact may occur under optimal conditions, suboptimal conditions or constraint conditions. These conditions reduce the temperature, reactant concentrations, the presence of substances that lower the base pair optimal temperature of the nucleic acid (eg formamide, dimethylsulfoxide and urea) and those that reduce the reaction volume and / or accelerate hybrid formation (eg dextran). Sulfates, polyethylene glycols or phenols).

Target

The nucleic acid is extracted from the sample to provide a nucleic acid substrate for use in detecting and identifying bacteria in the biological sample. Nucleic acids can be extracted from various samples using standard techniques or commercially available kits. For example, kits for separating RNA or DNA from tissue samples may be found in Qiagen, Inc. (California, USA) and Stratagene (California, USA). The QIAAMP Blood Kit allows for the separation of DNA from blood as well as bone marrow, body fluids or cell suspensions. The QIAAMP Tissue Kit allows for the separation of DNA from muscles and organs. As a preferred method of determining whether a biological sample contains RNA or DNA of the ITS indicating the presence of each bacterium, sonication of nucleic acids from bacterial cells, for example the method described in US Pat. No. 5,374,522 to Murphy et al. Can be released. Other known methods of crushing cells include enzyme use, osmotic shock, chemical treatment, and vortexing with glass beads. Other suitable methods for releasing nucleic acids from strains are described in US Pat. No. 5,837,452 to Clark et al. And US Pat. No. 5,364,763 to Kacian et al. Labeled probes may be added after or concurrent with the release of ITS in the presence of a hybridization promoter and incubated for the time necessary to reach a significant hybridization reaction at the optimal hybridization temperature.

If the target nucleic acid is double stranded, it is preferable to perform denaturation before performing the detection process. Modification of the double-stranded nucleic acid can be carried out by known methods of chemical, physical or enzymatic modification, in particular by heating to an appropriate temperature, a temperature of at least 80 ℃.

In addition, the target DNA that hybridizes with the probe may be prepared by two kinds of methods. First, the method used in Southern blot or Northern blot, genomic DNA or plasmid DNA is cut with a suitable restriction enzyme and subjected to electrophoresis on an agarose gel to separate the DNA fragments by size. The second method is to amplify and use DNA of a desired portion using a PCR method. At this time, if you look at the PCR method used, asymmetric amplification method that can obtain a double strand and a single strand at the same time by asymmetrically adding the most popular PCR and primer asymmetrically to amplify the forward and reverse primer using the same amount (Asymmetric PCR), multiplex amplification method (multiplex PCR) that can be amplified at the same time by inserting several primers, ligase that amplifies by using a specific four primers and ligase (Ligase) and then fluorescence by enzyme immunoassay Ligase Chain Reaction (LCR) method, as well as hot start PCR, nest PCR, modified oligonucleotide primer PCR, reverse transcriptase PCR, semi-quantitative reverse transcriptase PCR, real time PCR, Rapid Amplification of cDNA Ends (RACE), Competitive PCR, Short Tandem Repeats (STR), Single Strand Polymorphization (Single) Strand Conformation Polymorphism (SSCP), in situ PCR, and DDRT-PCR (Differential Display Reverse Transcriptase PCR).

As a template for the amplification of certain PCR products, relatively homogeneous samples (e.g. blood, bacterial colonies or cerebrospinal fluid) are known to be more suitable than more complex samples (e.g. urine, saliva or feces) (Shibata in PCR: The Polymerase). Chain Reaction, Mullis et al., Eds., Birkhauser, Boston (1994), pp. 47-54). Samples containing relatively few copies of the target nucleic acid to be amplified, such as cerebrospinal fluid, can be added directly to the PCR. Blood samples should be specially handled during PCR because of the inhibitory properties of red blood cells, and red blood cells should be removed before using blood for PCR. Many methods are used for this purpose, for example passing through a CHELEX 100 column (BioRad) and the like and using QIAAMP blood kits. Extracting nucleic acids from saliva requires a preliminary purification process that kills or inhibits growth of other bacterial species other than the desired organism. This purification process is accomplished by treating the sample with N-acetyl-L-cysteine and NaOH. This purification process is necessary only when incubating before saliva samples are analyzed.

In a preferred embodiment of the present invention, a fragment gene is prepared by using DNA of an isolated sample as a template and performing asymmetric amplification (Asymmetric PCR). The fragment gene is obtained by one polymerase chain reaction by differentiating the ratio of forward primer and reverse primer 1: 5. The primers used here were part of the nucleotide sequence present in 16S rRNA to 23S rRNA in common to bacteria (Pirkko K. et al., Clin. Micorbiol ., 36 (8), 2205-2209, 1999):

Primer 1 (sense): TTGTACACACCGCCCGTC (SEQ ID NOs: 262, 1585F)

Primer 2 (antisense): F-TTTCGCCTTTCCCTCACGGTACT (SEQ ID NOs: 263, 23BR);

Primer 3 (sense): AGTACCGTGAGGGAAAGG (SEQ ID NOs: 264, 23BF)

Primer 4 (antisense): F-TGCTTCTAAGCCAACATCCT (SEQ ID NOs: 265, 37R); And

Primer 5 (Sense): AGGATGTTGGCTTAGAAGCA (SEQ ID NOs: 266, 37F)

Primer 6 (antisense): F-CCCGACAAGGAATTTCGCTACCTTA (SEQ ID NOs: 267, 38R).

Approximate location maps for these primers are shown in FIG. 1 and F indicates the FITC fluorescent material attached to the 5 'end. In order to identify DNA bound to the probe during PCR, amplification using a 5-FITC attached primer is performed to confirm the binding through fluorescence so that the infection can be identified and the type of infection. In addition, in order to obtain a portion that cannot be amplified by these primers, primers are designed by performing multi-alignment and BLAST by a bioinformatics method.

As a preferred embodiment of the present invention, the PCR reaction is carried out under the following conditions. The first denaturation is carried out at 94 ° C. for 7 minutes and the second denaturation at 94 ° C. for 1 minute. Annealing is performed at 52 ° C. for 1 minute and extension at 72 ° C. for 1 minute, and this is repeated 10 times. Then, the third denaturation was performed at 94 ° C. for 1 minute, annealing at 54 ° C. for 1 minute, and extension at 72 ° C. for 1 minute, and this was repeated 30 times. The final extension is then performed once at 5 ° C. for 5 minutes. The resulting product is confirmed by agarose gel electrophoresis.

Hybridization and Washing

Hybridization conditions are determined by stringency, i.e. the stringency of the operating conditions. The higher the tightening that hybridization takes place, the more specific the hybridization becomes. Constriction is a function of not only the base composition of the probe / target conjugate but also the degree of mismatch between the two nucleic acids. Constriction may also be a function of hybridization reaction variables such as the concentration and type of ions present in the hybridization solution, the nature and concentration of the denaturant and / or the hybridization temperature. The basis of the conditions under which the hybridization reaction should be carried out depends in particular on the probe used. All these data are well known and the appropriate conditions can be determined by routine experimentation in the individual case. Generally, depending on the length of the probe used, the temperature of the hybridization reaction is about 20 ° C. to 65 ° C., in particular 35 ° C. to 65 ° C., in a saline solution at a concentration of about 0.8 to 1 M.

Hybridization between the labeled oligonucleotide probe and the target nucleic acid can be increased using unlabeled helper oligonucleotides following the procedure described in US Pat. No. 5,030,557 to Hogan et al. Helper oligonucleotides bind to a region of the target nucleic acid other than the region bound by the assay probe. This binding takes on new secondary and tertiary structures in the target region of single-stranded nucleic acids, accelerating the binding speed of the probe.

Those skilled in the art will appreciate that factors affecting the thermal stability of the hybrid formed between the probe and the target may also affect probe specificity. Therefore, the melting point profile, including the melting point temperature of the probe and target hybrid, must be determined empirically for each probe and hybrid of the target. This determination can be made according to the method described in US Pat. No. 5,283,174 to Arnold et al. One method of determining the melting point temperature of the probe and target hybrids involves performing hybridization protection assays. According to this assay method a hybrid of the probe and the target is formed under conditions of excess target in a lithium succinate buffer solution containing lithium lauryl sulfate. A portion of the preformed hybrid is diluted in hybridization buffer and incubated for 5 minutes at various temperatures starting at or below the expected melting point temperature (typically 55 ° C.) and increasing 2 to 5 degrees. This solution is then diluted with weakly alkaline borate buffer and incubated at lower temperature (eg 50 ° C.) for 10 minutes. The acridinium esters linked to single chain probes are hydrolyzed under these conditions while the acridinium esters linked to hybridized probes are relatively protected. This procedure is called hybridization protection assay. The amount of chemiluminescence remaining is proportional to the amount of hybrid and is measured with a luminometer by adding hydrogen peroxide followed by alkali. This data is dipped as a percentage of the maximum signal (usually the lowest temperature) to the temperature. The melting point temperature is defined as the point at which 50% of the maximum signal remains. Alternatively, the melting point temperature for the hybrid of the probe and the target can be determined using a probe labeled with a radioisotope. In all cases, the melting point temperature for a given hybrid may vary by the concentration of salts, detergents and other solutes contained in the hybridization solution. All these factors affect the relative hybrid stability during heat denaturation (Molecular Cloning: A Laboratory Manual Sambrook et al., Eds. Cold Spring Harbor Lab Publ., 9.51 (1989)).

Hybridization conditions can be monitored taking into account several parameters, for example, the hybridization temperature, the nature and concentration of the media components, the temperature at which the formed hybrid is washed, and the like. Hybridization and wash temperatures are limited to higher values depending on the base sequence, type and length of the probe and the maximum hybridization or wash temperature is about 30 ° C. to 60 ° C. At higher temperatures it competes with duplexing and dissociation or denaturation of the hybrid formed between the probe and the target. Hybridization media are for example about 3xSSC (1xSSC = 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), about 25 mM phosphate buffer pH 7.1 and 20% deion formamide, 0.02% picol, 0.02% bovine serum albumin, 0.02 % Polyvinylpyrrolidone and about 0.1 mg / ml cut and denatured salmon sperm DNA. The wash medium contains, for example, about 3 × SSC, 25 mM phosphate buffer pH 7.1 and 20% deion formamide. Depending on the modification of the probe and medium, the hybridization or washing temperature should be changed according to known associations to achieve the desired specificity (BD HAMES and SJ HIGGINS, (eds.). Nucleic acid hybridzation.A practical approach, IRL Press, Oxford , UK, 1985). In this regard, since DNA: DNA hybrids are generally less stable than RNA: DNA or RNA: RNA hybrids, hybridization conditions must be appropriately adjusted to achieve specific detection, depending on the nature of the hybrid to be detected.

As an embodiment of the present invention, hybridization buffer (hybridization buffer: 6 × SSPE (0.15M NaCl, 5mM C6H5Na3O7, pH 7.0), 20% (v / v) formamide) is mixed with the PCR amplification gene and the probe is fixed on a glass plate After dispensing, the reaction was conducted at 30 ° C. for 6 hours to induce complementary binding. After the passage of time, wash for 3 minutes in the order of 3 × SPE, 2 × SSPE, 1 × SSPE.

Kit

The present invention provides a kit for detecting each of the above bacteria. The kit of the present invention comprises: (i) a probe specific for each of the above bacteria, that is, a nucleic acid molecule comprising any one of the base sequences 12 to 44; (ii) a forward and reverse primer pair, optionally used to amplify 23S rDNA genes and / or ITS or fragments thereof in a biological sample; (iii) a buffer or component that provides a buffering capacity to induce a hybridization reaction between these probes and only the DNA and / or RNA of each of the above bacteria; (iv) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (v) means for detecting the hybrid formed optionally as a result of the hybridization reaction that occurred previously.

Quantification of the hybrid can be accomplished by labeling the target with fluorescent or radioisotopes, as in the probes described above, according to conventional methods. Labeling may be on the primer itself or by using base residues labeled with fluorescent and radioisotopes for amplification and transcription.

Diagnostic purpose

The probe of the present invention can be diagnosed by infecting a disease caused by each bacterium by detecting each bacterium specifically by applying it to a kit, especially a DNA chip, or by applying two or more probes, By detecting, several infectious diseases can be diagnosed simultaneously. The infectious diseases of the bacterium according to the present invention are as follows, and those skilled in the art will understand that all of these diseases can be diagnosed alone or simultaneously using the probe of the present invention.

Acinetobacter Baumani can cause purulent infections in all organs of the human body (Glew RH. Et al., Medicine (Baltimore) . 56, 79-97, (1977)). The mortality rate of bacteremia caused by Acinetobacter spp . Is 17-46%, and the clinical course is more severe when Acinetobacter baumanii is the causative organism (Seifert H et al., Medicine (Baltimore)). , 74, 340-349, (1995)). It also causes pyelonephritis and cystitis associated with urethral or urolithiasis (Glew RH et al., Medicine (Baltimore) , 56, 79-97, (1977)). In addition, meningitis (Berk SL et al., Arch. Neurol. 38, 95-98, (1981)), cellulitis (Gervich DH et al, Am. J. Infect.Control . 13, 210-215, (1985)) , Wound infection (Tong MJ. JAMA . 219, 1044-1047, (1972)), necrotizing fasciitis (Amsel MB et al., Curr. Surg . 42, 370-372, (1985)), endophthalmitis (Peyman GA et al., Am. J. Ophthalmol. 80, 764-765, (1975)), endocarditis (Gradon JD, et al., Clin. Infect. Dis. 14, 1145-1148, (1992)), osteomyelitis, bacterial Arthritis, liver abscess, pancreatic abscess (Henricksen SD. Bacteriol. Rev. 37, 522-561, (1973)), and the like.

Unaerobiopyrirum succinicis prodersense is clinically mainly bacteremia (see Tee W et al., J. Clin. Microbiol. 36 (5), 1209-1213, (1998)), sepsis (see Marcus L et al., Eur. J. Clin. Microbiol. Infect. Dis. 15 (9), 741-744, (1996)), and diarrhea (Malnick H et al., J. Clin. Pathol. , 36) . (10), 1097, (1983), and the like.

Cardiobacterium hominis bacteria mainly cause endocarditis, especially in patients with structural heart diseases such as rheumatoid heart disease, ventricular septal defect and congenital adjunct valves, and also in patients with artificial valves (TraverasJ.Md) et al., South Med. J. , 86, 1439-1440, (1993). The development of new methods for diagnosing endocarditis caused by Cardiobacterium hominis is important and urgent because it takes about 2-5 months to be diagnosed (Robison WJ et al., South Med. J.) . , 78, 1020-1021, (1985)). Complications can lead to embolism throughout the body, aneurysms in the brain, and heart failure to progress.

Chrysler bacterium meningocceptum is the most clinically causing disease (Bloch KC et al., Medicine , 76, 30-41, (1997)). Severe disability follows (Plotkin SA et al., JAMA, 198, 194-196, (1966); Pokrywka M. et al., Am. J. Infect. Control , 21, 139-145, (1993)). Infection in adults occurs mainly in hospitals, especially in immunocompromised patients. Most commonly causes respiratory infections (Brown RB et al., Am. J. Infect. Control , 17, 121-125, (1989)), sepsis, endocarditis, cellulitis, wound infections, celiac abscess, peritonitis, endophthalmitis, etc. Causing various infections (Olsen H. et al., Lancet, 1, 1294-1296, (1965); Sheridan RL et al., Clin. Infect. Dis ., 17, 185-187, (1993)).

The incidence of infections with Ocrobatrum antropy is increasing (Cieslak TJ et al., Clin. Infect. Dis ., 22, 845-847, (1996)), bacteremia associated with vascular conduits (Kern WV et al., Infection, 21, 306-310, (1993)) and endocarditis (Mahmood MS et al., J. Infect ., 40, 287-290, (2000)) are the most common infections. In addition, endophthalmitis (Berman AJ et al., Am. J. Ophthalmol. , 123, 560-562, (1997)), pancreatic abscess, necrotizing fasciitis (Brivet F. et al., Clin. Infect. Dis. , 17, 516-518, (1993)), chondritis (Barson WJ et al., J. Clin. Microbiol. , 25, 2014-2016, (1987)), and the like. Also, bacteria can be identified in bile, urine, wounds, feces, pharynx, vagina (Alnor D. et al., Clin. Infect. Dis. , 18, 914-920, (1994)).

There are many different infections caused by Popyromonas gingivalis. Oral infections, periodontal abscess, periodontitis, acute necrotic ulcerative periodontitis (Darby I et al., Periodontol. 2000, 26, 33-53, (2001)), breast abscess (Edmiston CE et al., J. Infect. Dis. , 162, 695-699, (1990)), chronic osteomyelitis (Brook I. et al., Am. J. Med . 94 (1), 21-28, (1993)), sore throat (Brook I., J. Fam.Pract. , 38 (2), 175-179, (1994)), pneumonia, lung abscess, empyema, otitis media, wound infection, peritonitis, peritonitis, chronic sinusitis (Brook I., J. Med. Microbiol 42 (5), 340-347, (1995)), yeast infection, pelvic infection (. Buerden BI, FEMS Immunol Med . Microbiol. 6 (2-3), 223-227, (1993)), bacteremia (Lee SC et al., J. Microbiol. Immunol. Infect. 32 (3), 213-216, (1999)), endocarditis (van Winkelhoff AJ et al., Periodontol. 2000, 20, 122-135, (1999)) And so on.

Proteus vulgaris, like other Enterobacteriae, have cilia, which colonize the epithelial cell layer and spread the infection of the urinary tract (Silverblatt FJ.Host-parasite interaction in the rat renal pelvis.A possible role for pili in the pathogensis of pyelonephritis.J Exp Med. 1974; 140: 1696; and Wray SK, Hull SI, Cook RG, et al. Identification and characterization of a uropathogenic isolate of Proteus mirabilis . Infect Immun. 1986; 54: 43-49) . Proteus with urinary tract infectivity produces several types of toxic hemolysine (Mobley HL, Chippendale GR. Hemagglutinin, urease, and hemolysin production by Proteus mirabilis from clinical sources. J Infect Dis. 1990; 161: 525- 530). In addition to such urinary tract infections, meningitis and the like may be caused, and cavernous vein thrombosis may be accompanied (Bodur H, Colpan A, Gozukuck R et al. Scand J Infect Dis. 2002; 34 (9): 694-6).

Suterella Wausworthis is a bile-resistant anaerobic Gram-negative bacillus that has been reported to cause a variety of diseases, particularly appendicitis, peritonitis, and intraperitoneal abscess (Clin Infect Dis. 1997; 25). (Suppl 2): S88-S93).

The most common form of infection with Akenella corodens is human biting (Goldstein EJC. Bite wounds and infections. Clin Infect Dis. 1992; 14: 633-640), head and neck infections (Tveteras K, Kristensten S, Bach). V, et al. Eikenella corrodens: A recently recognized pathogen in head and neck infections.J Laryngol Otol. 1987; 101: 592-594), respiratory infections (Suwanagool S, Rothkopf MM, Smith SM, et al. Pathogenicity of Eikenella corrodens) in humans.Arch Intern Med. 1983; 143: 2265-2268), which are susceptible to "clenched fist injury" and to people who are chronically biting their fingers or nails, and those with insulin-dependent diabetes or drug abuse. Gynecologic infections may also occur, some of which are associated with intrauterine contraceptives (Jeppson KG, Reimer LG. M, et al. Eikenella corrodens and intrauterine contraceptive device.Lancet. 1987; 2: 1089), lung infections, including empyema, pneumonia, and pulmonary embolism with carpal vein thrombosis, are typically chronic diseases. Or in patients with malignant intrathoracic tumors (Joshi N, O'Bryan T, Appelbaum PC. Pleuropulmonary infections caused by Eikenella corrodens. Rev Infect Dis. 1991; 13: 1207-1212). E.ella corodens bacteria A bacterium belonging to the HACEK group, which can cause endocarditis and occurs mainly in patients with abnormal heart valves, including intravenous injections or artificial valves (Decker MD, Graham BS, Hunter EB, et al. Endocarditis and infections of intravascular devices due to Eikenella corrodens.Am J Med Sci. 1986; 292: 209-212).

Haemophilus apropylas is a fungus that colonizes the mouth and pharynx and can cause head or respiratory infections or systemic diseases locally. In other words, sinusitis, otitis media, pneumonia (Kiddy K, Webberley J. Haemophilus aphrophilus as a cause of chronic suppurative pulmonary infection and intraabdominal abscesses.J Infect. 1987; 15: 161-163), empyema, bacteremia, endocarditis (Geraci JE, Wilkowske CJ, Wilson WR, et al. Haemophilus endocarditis: Report of 14patients.Mayo Clin Proc. 1977; 52: 209-215) vertebral osteomyelitis and suppurative psoas abscess.Am J Med. 1985; 78: 159-162), soft tissue abscess, wound infection, necrotizing fasciitis, meningitis (Petty BG, Burrow CR, Robinson RA, et al. Haemophilus aphrophilus meningitis followed by vertebral osteomyelitis and suppurative psoas abscess.Am J Med. 1985; 78: 159-162), causing brain abscess (Kilian M. A taxonomic study of the genus Haemophilus with the proposal of a new species.J Gen Microbiol. 1976; 9-62; Page MI, King EO.Infection due to Actinobacillus actinomycetemco mitans and Haemophilus aphrophilus. N Engl J Med. 1966; 275: 181-188; Sutter VL, Finegold SM. Haemophilus aphrophilus infections: Clinical and bacteriologic studies. Ann NY Acad Sci. 1970; 174: 468-487; Kraut MS, Attebery HR, Finegold SM, et al. Detection of Haemophilus aphrophilus in the human oral flora with a selective medium. J Infect Dis. 1972; 126: 189-192; Elster SK, Mattes LM, Meyers BR, et al. Haemophilus aphrophilus endocarditis: Review of 23 cases. AmJ Cardiol. 1975; 35: 72-79; And Bieger RC, Brewer NS, Washington JA II. Haemophilus aphrophilus: A microbiologic and clinical review and report of 42 cases. Medicine (Baltimore). 1978; 57: 345-355).

Neisseria gonohea bacteria cause acute urethritis, acute epididymitis, peri-genital lymphadenitis, peri-urinary abscess, acute prostatitis, infection of Tyson's gland and Kaufer's gland in males (Cohen MS, Cannon JG, Jerse) AE, et al. Human experimentation with Neisseria gonorrhoeae: Rationale, methods and implications for the biology of infection and vaccine development.J Infect Dis. 1994; 169: 532-537). Reproductive infections in women cause cervicitis, urethritis, and meningitis (Platt R, Rice PA, McCormack WM. Risk of acquiring gonorrhea and prevalence of abnormal adnexal findings among women recently exposed to gonorrhea. JAMA. 1983; 250: 3205-35) 3209). The fungus also causes anal rectal gonorrhea and pharyngeal gonorrhea through other sexual contacts (Handsfield HH, Knapp JS, Diehr PK, et al. Correlation of auxotype and penicillin susceptibility of Neisseria gonorrhoeae with sexual preference and clinical manifestations of gonorrhea.Sex Transm Dis. 1980; 7: 1-5). Ocular infections may also occur, with acute palatitis, unexplained oral ulcers, skin infections, and oral abscesses. Ascending germline infection results in pelvic inflammatory disease, most commonly symptoms of lower abdominal pain (Quinn TC, Stamm WE, Goodell SE, et al. The polymicrobial origin of intestinal infections in homosexual men. N Engl J Med. 1983; 309: 576-582). Usually has reproductive infections previously (Centers for Disease Control and Prevention. 1998 Guidelines for treatment of sexually transmitted diseases.MMWR Morb Mortal Wkly Rep. 1997; 47 (Suppl RR-1): S59-S69). Fever and leukocytosis are often accompanied by elevated ESR or CRP. However, in one third of patients with laparoscopic pelvic inflammatory disease, these findings may not be observed (Westrom L. Incidence, prevalence and trends of acute pelvic inflammatory disease and its consequences in industrialized countries. Am J Obstet Gynecol. 1980; 138: 880-892).

In order to confirm the probe specificity of the present invention, the names and sequences of the probes integrated and used in the DNA chip in the following examples and other experiments not presented herein are as follows. Hereinafter, the present invention will be described in more detail with reference to Examples. However, the following examples are illustrative of the present invention and the scope of the present invention is not limited by these examples.

Acti002: ATAGTGTTGCAAGGC (SEQ ID NO: 13) derived from ITS of Acinetobacter baumanii

Acti004: TGATGGAACTTGCTT (SEQ ID NO: 69) derived from 23S rRNA of Acinetobacter baumanii

Act3 (Acti I): ATACACAGTACTTCG derived from ITS of Acinetobacter baumanii (SEQ ID NO: 12)

Acti23S01: AGGGCACACATAATG derived from 23S rRNA of Acinetobacter baumanii (SEQ ID NO: 70)

Acti23S02: ACGCTGTTGTTGGTG (SEQ ID NO: 71) derived from 23S rRNA of Acinetobacter baumanii

Acii1: AACCTGGCTGGTGGC derived from 23S rRNA of Actinomyces israelii (SEQ ID NO: 72)

Acii2: GACACTTTTGTGTCA (SEQ ID NO: 73) derived from 23S rRNA of Actinomyces israelii

Acii3: GTTGGGTGGTTGCCT derived from ITS of Actinomyces israelii (SEQ ID NO: 74)

Acti1: GGGCACACATAATGA (SEQ ID NO: 75) derived from 23S rRNA of Acinetobacter baumanii

Acti2: CGGGGTACTCTATAC derived from 23S rRNA of Acinetobacter baumanii (SEQ ID NO: 76)

Acti3: ATACACAGTACTTCG derived from ITS of Acinetobacter baumanii (SEQ ID NO: 77)

Ah: GGCGCCTCGGTAGGG (SEQ ID NO: 78) derived from 23S rRNA of Aeromonas hydrophila

Anas23S03: CAGTTGGAAGCAGAG (SEQ ID NO: 79) derived from 23S rRNA of Anaerospirillum succiniciproducens

Anas1: AAAGTGCAGGGCACA (SEQ ID NO: 80) derived from 23S rRNA of Anaerospirillum succiniciproducens

Anas2: TGGATTGTGGTGAAA derived from 23S rRNA of Anaerospirillum succiniciproducens (SEQ ID NO: 81)

Anas3: TAGCGTTCTGCGAGG (SEQ ID NO: 82) derived from 23S rRNA of Anaerospirillum succiniciproducens

Anas4: TTAAAAGACTGGTAT (SEQ ID NO: 83) derived from 23S rRNA of Anaerospirillum succiniciproducens

Anas001: TGACTCGTGCCCATG derived from 23S rRNA of Anaerospirillum succiniciproducens (SEQ ID NO: 84)

Anas002: TACCGGGGTTAAAAG derived from 23S rRNA of Anaerospirillum succiniciproducens (SEQ ID NO: 85)

Anas003: ATCAGTGATCTGAGA derived from 23S rRNA of Anaerospirillum succiniciproducens (SEQ ID NO: 86)

Anas005: GTTCTTGATTCATTGC from ITS of Anaerospirillum succiniciproducens (SEQ ID NO: 15)

Anas008: CAGCCCAAAAGTTGA (SEQ ID NO: 16) derived from ITS of Anaerospirillum succiniciproducens

Anas009: AAACTGCAGGGCACA derived from ITS of Anaerospirillum succiniciproducens (SEQ ID NO: 17)

Anas010: ATACTACCTGACGAC (SEQ ID NO: 18) derived from ITS of Anaerospirillum succiniciproducens

Bacf1 (Bf23): GGTAACCGAAGCGTA (SEQ ID NO: 87) derived from 23S rRNA of Bacteroides fragilis

Bacf2 (Bf): CTCGGAAAACGGTAA (SEQ ID NO: 88) derived from 23S rRNA of Bacteroides fragilis

Bacf3: GGTTCAGATCCTTTT (SEQ ID NO: 89) derived from ITS of Bacteroides fragilis

CACGGTGGATGCCCT derived from BaP1 01: Bacteria positive control (SEQ ID NO: 90)

GACCGATAGTGAACC (SEQ ID NO: 91) derived from BaP1 06: Bacteria positive control

Bap2 01: AGAACCTGAAACCGT from Bacteria positive control (SEQ ID NO: 92)

GTACCTTTTGTATAA from BaP2 03: Bacteria positive control (SEQ ID NO: 93)

B.ovatus01:Bacteroides ovatusof TAGAAGGAAGCATTC derived from 23S rRNA (SEQ ID NO: 94)

B.ovatus02:Bacteroides ovatusof CCAATGTTGTTACGG derived from 23S rRNA (SEQ ID NO: 95)

b.theta01: Bacteroides thetaiotaomicronof TTATTGTACTACTGG from ITS (SEQ ID NO: 96)

b.theta03: Bacteroides thetaiotaomicronof TTGTCGTTGCCAATA derived from ITS (SEQ ID NO: 97)

b.theta04: Bacteroides thetaiotaomicronof CAGTGTTGGAATGTT from ITS (SEQ ID NO: 98)

b.theta05: Bacteroides thetaiotaomicronof ACTATACTATAGTCA derived from 23S rRNA (SEQ ID NO: 99)

b.thetaio01: Bacteroides thetaiotaomicronof TTATTGTACTACTGG from ITS (SEQ ID NO: 100)

b.thetaio02: Bacteroides thetaiotaomicronof ATCAGGTAGACAAGG derived from ITS (SEQ ID NO: 101)

b.thetaio03: Bacteroides thetaiotaomicronof TTGTCGTTGCCAATA derived from ITS (SEQ ID NO: 102)

b.thetaio04: Bacteroides thetaiotaomicronof CAGTGTTGGAATGTT (SEQ ID NO: 103) derived from ITS

b.thetaio05: Bacteroides thetaiotaomicronof ACTATACTATAGTCA from ITS (SEQ ID NO: 104)

B.theta01:Bacteroides thetaiotaomicronof TTATTGTACTACTGG from ITS (SEQ ID NO: 105)

B.theta02:Bacteroides thetaiotaomicronof ATCAGGTAGACAAGG derived from ITS (SEQ ID NO: 106)

B.theta03:Bacteroides thetaiotaomicronof TTGTCGTTGCCAATA derived from ITS (SEQ ID NO: 107)

B.theta04:Bacteroides thetaiotaomicronof CAGTGTTGGAATGTT from ITS (SEQ ID NO: 108)

B.theta05:Bacteroides thetaiotaomicronof ACTATACTATAGTCA derived from 23S rRNA (SEQ ID NO: 109)

B.theta006:Bacteroides thetaiotaomicronof GCTAACGCAGGGAAC (SEQ ID NO: 110) derived from 23S rRNA

Bur (Bur23): TTGTTAGCCGAACGC (SEQ ID NO: 111) derived from 23S rRNA of Burkholderia cepacia

Bur01: GGGTGTGGCGCGAGC (SEQ ID NO: 112) derived from 23S rRNA of Burkholderia cepacia

b.vulga01: CATCTTGAGATGTGC derived from 23S of Bacteroides vulgatus (SEQ ID NO: 113)

b.vulga02: AGTCGGGCGTGGATA (SEQ ID NO: 114) derived from 23S of Bacteroides vulgatus

b.vulga03: AGTCAGCGTCGAAGG (SEQ ID NO: 115) derived from 23S rRNA of Bacteroides vulgatus

b.vulga04: ACGCTAATCGGATCA derived from 23S of Bacteroides vulgatus (SEQ ID NO: 116)

b.vulga05:Bacteroides vulgatusof GACCGATAGAGCATG derived from 23S (SEQ ID NO: 117)

b.vulga06:Bacteroides vulgatusof TGACACACTGTAACT derived from 23S (SEQ ID NO: 118)

b.vulga07:Bacteroides vulgatusof CGAATGCGCATCAGT (SEQ ID NO: 119) derived from 23S rRNA

b.vulga08:Bacteroides vulgatusof ATTGTCATGAGCCAC (SEQ ID NO: 120) from 23S

Car3 (CarI): AAAGAGAGAACAGAGCA (SEQ ID NO: 19) derived from 23S rRNA of Cardiobacterium hominis

Car2 (CarM): CCAGCACACTGTTGG (SEQ ID NO: 121) derived from 23S rRNA of Cardiobacterium hominis

Car001: TTGGCGACAACAGGC (SEQ ID NO: 20) derived from ITS of Cardiobacterium hominis

Car002: GCCCCGGGAAGCTGA (SEQ ID NO: 21) derived from ITS of Cardiobacterium hominis

Car003: TAGACTGCGGAAGCG (SEQ ID NO: 22) derived from ITS of Cardiobacterium hominis

Car004: AATTAAGTTGCGTAT (SEQ ID NO: 23) derived from ITS of Cardiobacterium hominis

Car006: AACCCTGGTGAAGGG (SEQ ID NO: 122) derived from 23S rRNA of Cardiobacterium hominis

Car007: ATATGAAGATATGTG derived from 23S rRNA of Cardiobacterium hominis (SEQ ID NO: 123)

Car008: TAGATTGACTTACGG (SEQ ID NO: 124) derived from 23S rRNA of Cardiobacterium hominis

Car009: GTAAAGTTTTACTAC (SEQ ID NO: 125) derived from 23S rRNA of Cardiobacterium hominis

C.diffc001:Clostridium diffcileof Derived from 23S rRNA GCATATATATTTAGT (SEQ ID NO: 126)

C.diph001:Corynebacterium diphtheriaDerived from ITS of ACCACGCAGCAGTTT (SEQ ID NO: 127)

C.diph002: CGAGTCGGTAGGGTA (SEQ ID NO: 128) derived from ITS of Corynebacterium diphtheria

C.diph003: ACCATCTTCCCAAGG (SEQ ID NO: 129) derived from 23S rRNA of Corynebacterium diphtheria

C.dipht01: TAACTAGATAAGAAA derived from ITS of Corynebacterium diphtheria (SEQ ID NO: 130)

Chr003: TAACCCCTTAGATTA derived from the ITS of Chryseobacterium meningosepticum (SEQ ID NO: 25)

Chr004: TCAAACCTCAAACTA (SEQ ID NO: 26) derived from ITS of Chryseobacterium meningosepticum

Chr005: AAGAAATCGAAGAGA (SEQ ID NO: 27) derived from ITS of Chryseobacterium meningosepticum

Chr23S04: GGCATATTTAGATGA (SEQ ID NO: 131) derived from 23S rRNA of Chryseobacterium meningosepticum

Chr23S05: ATCGTGAGGTTACGA (SEQ ID NO: 132) derived from 23S rRNA of Chryseobacterium meningosepticum

Chry1 (Chry3): ATTTAGATGATAAAT derived from 23S rRNA of Chryseobacterium meningosepticum (SEQ ID NO: 55)

Chry2: TAATCTTACTAGCGA derived from 23S rRNA of Chryseobacterium meningosepticum (SEQ ID NO: 133)

Chry3 (ChryI): TCCTTGAGTGCAGAG (SEQ ID NO: 55) derived from ITS of Chryseobacterium meningosepticum

Coma1: AAAACCGACTGGTGG derived from 23S rRNA of Comamonas acidovorans (SEQ ID NO: 134)

Coma2 (Com7): TGAGCTAGAGAAAAG (SEQ ID NO: 135) derived from 23S rRNA of Comamonas acidovorans

Coma3 (ComM): ATCCGCCGGGCTTAG (SEQ ID NO: 136) derived from 23S rRNA of Comamonas acidovorans

Coma4: ACGCGCGAGGTGAGA derived from ITS of Comamonas acidovorans (SEQ ID NO: 137)

C.ramo 001:Clostidium ramosumof Derived from ITS TAGTTGATGATAGTA (SEQ ID NO: 138)

C.ramo 002:Clostidium ramosumof GCTTATCTGTGGATG from ITS (SEQ ID NO: 139)

C.ramo 003:Clostidium ramosumof GGAATCCCTCCTTGT (SEQ ID NO: 140) derived from 23S rRNA

c.ramo 004: CCCGGGAAGGGGAGT derived from 23S rRNA of Clostidium ramosum (SEQ ID NO: 141)

c.ramo 05: GTATTGGAGTTGCTA derived from 23S rRNA of Clostidium ramosum (SEQ ID NO: 142)

Citf: CCGGTACCTTTTTAA derived from 23S rRNA of Citrobacter freundii (SEQ ID NO: 143)

Citf02: GGAGGTTCCAGGTAA derived from 23S rRNA of Citrobacter freundii (SEQ ID NO: 144)

Citf03: GGTACCTTTTTAACG derived from 23S rRNA of Citrobacter freundii (SEQ ID NO: 145)

Com004: TAGGGCGTCCAGTCG derived from 23S rRNA of Comamonas acidovorans (SEQ ID NO: 146)

Com005: CGCAGAGTACAGCTT (SEQ ID NO: 147) derived from 23S rRNA of Comamonas acidovorans

Coma3ComM: ATCCGCCGGGCTTAG (SEQ ID NO: 148) derived from 23S rRNA of Comamonas acidovorans

e.aero01: TTCCGACGGTACAGG derived from 23S rRNA of Enterobacter aerogenes (SEQ ID NO: 149)

e.aero02: GAGCGGGGTAGTTGA (SEQ ID NO: 150) derived from 23S rRNA of Enterobacter aerogenes

e.aero03: GTATCAGTAAGTGCG derived from 23S rRNA of Enterobacter aerogenes (SEQ ID NO: 151)

e.aero04: TTATCCAGGCAAATC (SEQ ID NO: 152) derived from 23S rRNA of Enterobacter aerogenes

Eco1 (Eco23): GAGCCTGAATCAGTG (SEQ ID NO: 153) derived from 23S rRNA of Escherichia coli

Eco2 (Ecoli): GTTAGCGGTAACGCG derived from 23S rRNA of Escherichia coli (SEQ ID NO: 154)

E coli 003: CTGAAGCGACAAATG derived from 23S rRNA of Escherichia coli (SEQ ID NO: 155)

E.faecium002: TTACGATTGTGTGAA derived from 23S rRNA of Enterococcus faecium (SEQ ID NO: 156)

E.faecium003: ATAGCACATTCGAGG (SEQ ID NO: 157) derived from 23S rRNA of Enterococcus faecium

Efalis: GCTTCTTTTCTTAAG derived from 23S rRNA of Enterococcus faecalis (SEQ ID NO: 158)

Efclum1: GTTCTTTCAGATAGT derived from 23S rRNA of Enterococcus faecium (SEQ ID NO: 159)

Efclum2: CTGAAGAGGAGTCAA derived from 23S rRNA of Enterococcus faecium (SEQ ID NO: 160)

Enfaeci23: GTTCTTTCAGATAGT derived from 23S rRNA of Enterococcus faecium (SEQ ID NO: 161)

EnfaeciM: CTGAAGAGGAGTCAA derived from 23S rRNA of Enterococcus faecium (SEQ ID NO: 162)

Ente1: Enterobacter spp. GTACACGAAAATGCA derived from 23S rRNA of SEQ ID NO: 163

Ente2 (Efacalis23): TCTGTTAGTATAGTT (SEQ ID NO: 164) derived from 23S rRNA of Enterococcus faecalis

Ente3: GCTTCTTTTCTTAAG derived from 23S rRNA of Enterococcus faecalis (SEQ ID NO: 165)

fnecro 01: TTTCGCAGACGTAAG derived from 23S rRNA of Fusobacterium necrophorum (SEQ ID NO: 166)

fnecro 02: GTTTTCTTGCGCTGT derived from 23S rRNA of Fusobacterium necrophorum (SEQ ID NO: 167)

fnecro 03: CCGTATTCATGTCAA (SEQ ID NO: 168) derived from 23S rRNA of Fusobacterium necrophorum

fnecro 04: GGGGTAGAGCCTAAA derived from 23S rRNA of Fusobacterium necrophorum (SEQ ID NO: 169)

fnecro 06: CAGACGTAAGCAAAG derived from 23S rRNA of Fusobacterium necrophorum (SEQ ID NO: 170)

fnecro 07: CCTGTATTGGTAGTT (SEQ ID NO: 171) derived from 23S rRNA of Fusobacterium necrophorum

h.actino01:Haemophilus actinomycetmcomiof AAGTCTGGGTCGTGG derived from 23S rRNA (SEQ ID NO: 172)

h.actino02:Haemophilus actinomycetmcomiof AATCCTAGGGTAATG (SEQ ID NO: 173) derived from 23S rRNA

h.actino03:Haemophilus actinomycetmcomiof AACCGGGTAGAACTG derived from 23S rRNA (SEQ ID NO: 174)

Hin (Hin23): GGAGAATGTGTTGGG (SEQ ID NO: 175) derived from 23S rRNA of Haemophilus influenza

k.king01: TGATTCAATGCGATG (SEQ ID NO: 176) derived from 23S rRNA of Kingella kingae

k.king02: GGTTAGCAAACTGTT derived from 23S rRNA of Kingella kingae (SEQ ID NO: 177)

k.king03: CCAGTAGGTGGAAAG (SEQ ID NO: 178) derived from 23S rRNA of Kingella kingae

k.king04: AACACCGAGACGTGA (SEQ ID NO: 179) derived from 23S rRNA of Kingella kingae

k.king05: TATAATTAAACGCAT from ITS of Kingella kingae (SEQ ID NO: 180)

k.king06: AATGTTGTCGATTTG from ITS of Kingella kingae (SEQ ID NO: 181)

k.king07: AGGCAACAAATCGAA from ITS of Kingella kingae (SEQ ID NO: 182)

k.king08: TATCAACTAATCTTG from ITS of Kingella kingae (SEQ ID NO: 183)

k.king09: TATTCAATGCGATGG derived from 23S rRNA of Kingella kingae (SEQ ID NO: 184)

K.pneu002: GCTGAGACCAGTCGA (SEQ ID NO: 185) derived from 23S rRNA of Klebsiella pneumoniae

Ko001: GAACGTTACTAACGC derived from 23S rRNA of Klebsiella oxytoca (SEQ ID NO: 186)

Koxy1: CCGGAACGTTACTAA derived from 23S rRNA of Klebswiella oxytoca (SEQ ID NO: 187)

Koxy2: CGCGACACGACGATG (SEQ ID NO: 188) derived from ITS of Klebswiella oxytoca

Koxy3: AAGAGCGCCAGCTCA derived from 23S rRNA of Klebswiella oxytoca (SEQ ID NO: 189)

Kpneu (Kpneu23): GTACACCAAAATGCA derived from 23S rRNA of Klebsiella pneumoniae (SEQ ID NO: 190)

Kpneu01: ACCTTCGGGTGTGAC derived from 23S rRNA of klebsiella pneumoniae (SEQ ID NO: 191)

LM: GGGTGCAAGCCCGAG derived from 23S rRNA of Listeria monocytogenes (SEQ ID NO: 192)

Nm1: CCCTGGAGGGTCGCA derived from 23S rRNA of Neisseria meningitidis (SEQ ID NO: 193)

Nm2: TTTGAATTGAACCGT (SEQ ID NO: 194) derived from 23S rRNA of Neisseria meningitidis

Nm002: AGATGTGAGAGCATC derived from 23S rRNA of Neisseria meningitidis (SEQ ID NO: 195)

Mor1: TAGGGTGCAAGCCCA derived from 23S rRNA of Morganella morganii (SEQ ID NO: 196)

AGAACACTCACAGA derived from ITS of Mor2: Morganella morganii (SEQ ID NO: 197)

Ochr1 (Ochr3): CGGCGCGTGAGCGAG (SEQ ID NO: 55) derived from 23S rRNA of Ochrobacterium anthropi

Ochr2: GAACACCTGTTTCC derived from 23S rRNA of Ochrobacterium anthropi (SEQ ID NO: 198)

Ochr3: GATCCGACGATTTCC derived from ITS of Ochrobacterium anthropi (SEQ ID NO: 199)

Ochr04: GGACCAGGCCAGTGG (SEQ ID NO: 200) derived from 23S rRNA of Ochrobacterium anthropi

Ochr05: GACCAGGCCAGTGGC (SEQ ID NO: 201) derived from 23S rRNA of Ochrobacterium anthropi

Ochr004: GTTGATTGACACTTG (SEQ ID NO: 26) derived from ITS of Ochrobacterium anthropi

Ochr005: TACCGCTCACGAGCC (SEQ ID NO: 27) derived from ITS of Ochrobacterium anthropi

Ochr007: GGGTCCGGAGGTTCA (SEQ ID NO: 30) derived from ITS of Ochrobacterium anthropi

Pa: GTTTCCCGTGAAGGC (SEQ ID NO: 202) derived from 23S rRNA of Pseudomonas aeruginosa

Pa03: GGATCTTTGAAGTGA (SEQ ID NO: 203) derived from 23S rRNA of Pseudomonas aeruginosa

P.anae001:Peptostreptococcus anaerobiusof TGCATTACTAAGTGA (SEQ ID NO: 204) derived from 23S rRNA

P.anae002:Peptostreptococcus anaerobiusof GTAAGGTCGATACCC derived from 23S rRNA (SEQ ID NO: 205)

P.anae003:Peptostreptococcus anaerobiusof AGGAGGAAGAGAAAG derived from 23S rRNA (SEQ ID NO: 206)

Pep1: ACTAAATAAACCAGG (SEQ ID NO: 207) derived from 23S rRNA of Peptostreptococcus prevotii

Pep2: ATAATCAACATCTAC (SEQ ID NO: 208) derived from 23S rRNA of Peptostreptococcus prevotii

Pep3: TCTGTATAATAGTTC derived from ITS of Peptostreptococcus prevotii (SEQ ID NO: 209)

Pep002: ACTAGGGAGAGCTCA Derived from 23S rRNA of Peptostreptococcus prevotii (SEQ ID NO: 210)

Pep003: GCTTAGTAAAGCAAG (SEQ ID NO: 211) derived from 23S rRNA of Peptostreptococcus prevotii

Pep23S02: GTCGAATCATCTGGG derived from 23S rRNA of Peptostreptococcus prevotii (SEQ ID NO: 212)

Pep23S03: TAAAACGTATCGGAT derived from 23S rRNA of Peptostreptococcus prevotii (SEQ ID NO: 213)

Pm: GTTACCAACAATCGT derived from 23S rRNA of Proteus mirabilis (SEQ ID NO: 214)

Pm01: AGGCAGAGTGATTAG (SEQ ID NO: 215) derived from 23S rRNA of Proteus mirabilis

Pm002: GGCGACGGTCGTCCC derived from 23S rRNA of Proteus mirabilis (SEQ ID NO: 216)

Pm003: GATGACGAACCACCA derived from 23S rRNA of Proteus mirabilis (SEQ ID NO: 217)

Pm004: TGAAGCAATTGATGC derived from 23S rRNA of Proteus mirabilis (SEQ ID NO: 218)

Por1: GTTGGATGTTATCAT derived from 23S rRNA of Porphylomonas gingivalis (SEQ ID NO: 219)

Por2: CGGGCAGCTAAAACC (SEQ ID NO: 220) derived from 23S rRNA of Porphylomonas gingivalis

Por3: TGTTTGTGCGACGTG (SEQ ID NO: 60) derived from ITS of Porphylomonas gingivalis

Por23S08: CTGAGCTGTCGTGCA (SEQ ID NO: 221) derived from 23S rRNA of Porphylomonas gingivalis

P.vulga01: ATACGTGTTATGTGC derived from ITS of Proteus vulgaris (SEQ ID NO: 33)

P.vulga02: CTCACACAGACTTGT derived from ITS of Proteus vulgaris (SEQ ID NO: 61)

P.vulga03: ATATCCAATGGATAT derived from 23S rRNA of Proteus vulgaris (SEQ ID NO: 222)

P.vulga04: AGAGGAGGCTTAGTG (SEQ ID NO: 223) derived from 23S rRNA of Proteus vulgaris

Rot1 (Rot23): TGGTAGGCGAACTGG (SEQ ID NO: 224) derived from 23S rRNA of Stomatococcus mucilaginosus (Rothia)

Rot2 (RotM): GCCGGTTGTGTGTCT (SEQ ID NO: 225) derived from 23S rRNA of Stomatococcus mucilaginosus (Rothia )

Rot3 (RotI): TATATAGTGGACGCG (SEQ ID NO: 226) derived from ITS of Stomatococcus mucilaginosus (Rothia )

Rot4 (Rot7): TAAGAGCGTGTGGAG (SEQ ID NO: 227) derived from 23S rRNA of Stomatococcus mucilaginosus (Rothia )

Saur: GTTAACGCCCAGAAG derived from 23S rRNA of Staphylococcus aureus (SEQ ID NO: 228)

S.aureus 004: GATTGCACGTCTAAG derived from 23S rRNA of Staphylococcus aureus (SEQ ID NO: 229)

S.aureus 005: AATCCGGTACTCGTT derived from 23S rRNA of Staphylococcus aureus (SEQ ID NO: 230)

Saure03: TCTTCGAGTCGTTGA (SEQ ID NO: 231) derived from 23S rRNA of Staphylococcus aureus

S.dysen01: CAGCCTGTTAAGTCT derived from ITS of Shigella dysenteriae (SEQ ID NO: 232)

S.dysen02: CCTCTTTAATGGGGT (SEQ ID NO: 233) derived from 23S rRNA of Shigella dysenteriae

Se1: TTCTCTCTTGAGTGG (SEQ ID NO: 234) derived from 23S rRNA of Staphylococcus epidermidis

Se2: CGTGCTGTTGGAGTG (SEQ ID NO: 235) derived from 23S rRNA of Staphylococcus epidermidis

Se3: GCTATTTATTTTGAA derived from ITS of Staphylococcus epidermidis (SEQ ID NO: 236)

SeM01: GATAGATAACAGGTG derived from 23S rRNA of Staphylococcus epidermidis (SEQ ID NO: 237)

SeM02: AGGGTTCACGCCCAG derived from 23S rRNA of Staphylococcus epidermidis (SEQ ID NO: 238)

Sflex: GCTGATACGTAGGTG (SEQ ID NO: 239) derived from 23S rRNA of Shigella flexneri

Sflexneri01: AATCAAGGCCGAGGC (SEQ ID NO: 240) derived from 23S rRNA of Shigella flexineri

Sflexneri04: GCCGAGGCGTGATGA (SEQ ID NO: 241) derived from 23S rRNA of Shigella flexineri

Sm: TTTGGATCTTTGGCA derived from 23S rRNA of Strentrophomonas maltophila (SEQ ID NO: 242)

Sm02: AAGCTGGATTGGTTC derived from 23S rRNA of Strentrophomonas malthophilia (SEQ ID NO: 243)

S.mutans01:Streptococcus mutansof GAAAAACGAAGGGTA derived from 23S rRNA (SEQ ID NO: 244)

S.mutans02:Streptococcus mutansof ATGACTACGTGGTCG derived from 23S rRNA (SEQ ID NO: 245)

S.mutans03:Streptococcus mutansof GTAATGCAAGATATC derived from 23S rRNA (SEQ ID NO: 246)

S.mutan001: TAGGTATTCTCTCCT derived from 23S rRNA of Streptococcus mutans (SEQ ID NO: 247)

S.mutan002: TAGCACAGGAATACT (SEQ ID NO: 248) derived from 23S rRNA of Streptococcus mutans

S.mutan003: AAGGGGTACAGATCC derived from 23S rRNA of Streptococcus mutans (SEQ ID NO: 249)

Spy1: TTGAGCCCTAGCAGT (SEQ ID NO: 250) derived from 23S rRNA of Streptococcus pyogenes

Spy2: TTCTATGTGTGAAGA (SEQ ID NO: 251) derived from 23S rRNA of Streptococcus pyogenes

Spy3: ACGCTGTGATTATTT (SEQ ID NO: 252) derived from 23S rRNA of Streptococcus pyogenes

Ss1: TGAAACACTGAACAA derived from 23S rRNA of Shigella sonnei (SEQ ID NO: 253)

GCCTGAATCAGCATG derived from 23S rRNA of Styp: Salmonella spp. ( Enteritidis) (SEQ ID NO: 254)

Strepp (StreppM): TAGGACTGCAATGTG derived from 23S rRNA of Streptococcus pneumoniae

CAGCATG (SEQ ID NO: 255)

s.wad 01: CTCAGTAAGACGTTT from ITS of Sutterella wadsworthii (SEQ ID NO: 63)

S.wad 02: GCTCCGACAAGAACT (SEQ ID NO: 34) from ITS of Sutterella wadsworthii

S.wad 03: CGAGTTGTTGAATTC (SEQ ID NO: 35) derived from ITS of Sutterella wadsworthii

S.wad 04: GTCGTCTTGTGCTTT from ITS of Sutterella wadsworthii (SEQ ID NO: 36)

S.wad 05: TCTTCAAAGAACCGA (SEQ ID NO: 256) derived from ITS of Sutterella wadsworthii

Svi1 (SviM): ACAGGTGCTAATACC derived from 23S rRNA of Streptococcus viridans (SEQ ID NO: 257)

Svi2 (Svi2M): GAGTGAAGAAGGTTT (SEQ ID NO: 258) derived from 23S rRNA of Streptococcus viridans

Vcho: CCCAACTGCATAAGC (SEQ ID NO: 259) derived from 23S rRNA of Vibrio cholerae

Vvul02: GTTGACGATGCATGT (SEQ ID NO: 260) derived from 23S rRNA of Vibrio vulnificus

VvulM (Vvul): AGTAACAGCCACTTG derived from 23S rRNA of Vibrio vulnificus (SEQ ID NO: 261)

Example 1

Acinetobacter Baumani fungus (G-)

A. Determination of 23S rDNA and ITS Sequences of Acinetobacter Baumani

Acinetobacter baumanii strains were purchased directly (KCTC2771). Strains were cultured and chromosomal DNA was extracted using a GIAmp DNA mini kit (QIAGEN, USA). In order to determine the nucleotide sequence, multiple primers and BLAST were performed on the 16S, ITS, and 23S rDNA sites of known bacteria by using the extracted DNA as a template to prepare a common primer common to all the bacteria. Common primers of the 16S site that can amplify the ITS site of the prepared common primers (1585F; 5-TTGTACACACCGCCCGTC, SEQ ID NO: 262) and 520R, 23S 750F × 23S 750F, 970F, 930R, 2960R of the common primer of the 23S site (T ) And 2960RC were prepared by the inventors, and the remaining primers were prepared by using a common primer of 23S rDNA (Anthony. RM, et al., J. Clin. Microbiol. 38 (2), 781-788, 2000). It was. Sequences of the prepared common primers used in sequencing and their approximate positions are shown in Table 12 below.

denomination Seq (5 --- 3) location 1585F TTGTACACACCGCCCGTC (SEQ ID NO: 262) 16S rRNA (1390-1407) 23BR TTTCGCCTTTCCCTCACGGTACT (SEQ ID NO: 263) 23S rRNA (454-477) 23BF AGTACCGTGAGGGAAAGG (SEQ ID NO: 264) 23S rRNA (454-477) 37F F-TGCTTCTAAGCCAACATCCT (SEQ ID NO: 266) 23S rRNA (1050-1073) 37F AGGATGTTGGCTTAGAAGCA (SEQ ID NO: 266) 23S rRNA (1050-1073) 38R CCCGACAAGGAATTTCGCTACCTTA (SEQ ID NO: 265) 23S rRNA (1923-1946) 520 R GCCAAGGCATCCACC (SEQ ID NO: 268) 23S rRNA (20-34) 23S 750F AGTAGCGGCGAGCGAA (SEQ ID NO: 269) 23S rRNA (238-253) 23S 750F (T) AGTAGTGGCGAGCGAA (SEQ ID NO: 270) 23S rRNA (238-253) 930R AWTTTGCYGAGTTCCTT (SEQ ID NO: 271) 23S rRNA (1658-1675) 970 F AACTGGAGGACCGAACC (SEQ ID NO: 272) 23S rRNA (701-734) 2960R (T) GCTTAGATGCTTTCAGCA (SEQ ID NO: 273) 23S rRNA (2739-2756) 2960RC GCTTAGATGCTTTCAGCG (SEQ ID NO: 274) 23S rRNA (2739-2756)

In order to determine the sequence, the product was purified by chromosomal DNA of the Acinetobacter Baumani strain as a template using these common primers. PCR reaction was performed under the following conditions. The first denaturation was performed at 94 ° C. for 7 minutes and the second denaturation at 94 ° C. for 1 minute. Hybridization was performed at 52 ° C. for 1 minute and extension at 72 ° C. for 1 minute, which was repeated 10 times. Thereafter, the third denaturation was performed at 94 ° C. for 1 minute, hybridization at 54 ° C. for 1 minute, and extension at 72 ° C. for 1 minute, which was repeated 30 times. Thereafter, the last extension was performed once at 72 ° C. for 5 minutes. The resulting product was confirmed by agarose gel electrophoresis. The amplified PCR product was purified and sequenced using appropriate primers according to the site of nucleotide sequence to be analyzed by DNA auto sequencer (Perkin Elmer, ABI prism 3700 sequencer). The primer used in the analysis of the nucleotide sequence was applied to the first prepared common primer, and then the base sequence was analyzed by applying the primer prepared on the basis of the obtained nucleotide sequence. The analysis of the nucleotide sequence is described by SEQ ID NO: 1.

B. Screening of DNA Probes to Identify Acinetobacter Baumani

In order to confirm the presence and identification of Acinetobacter Baumani, a specific probe was made only for Acinetobacter Baumani. For the production of Acinetobacter Baumani-specific probes, it is necessary to have specificity only for Acinetobacter Baumani. For this purpose, a specific probe candidate group for Acinetobacter Baumani was selected. The specific probe candidate group is present only in the Acinetobacter Baumani by aligning and comparing the sequence sequences of all possible bacteria along with the 23S rRNA and ITS sequences of the Acinetobacter Baumani identified in Example 1 in a line through multiple alignments. Specific base sequences were separately classified to prepare a candidate candidate group present therein. Probe candidates were determined within 23S rRNA and / or ITS sites in all bacteria. The specificity of the probe candidate group was first confirmed by comparing the similarities between the different strains through BLAST search, and the probes that reacted only in the Acinetobacter Baumani strain were selected for identification in the candidate group by actually applying the strains to the hybridization reaction.

The locations and base sequences of the probes identified are shown in Table 13 below.

Sympathetic strain Probe name location Sequence SEQ ID NO: Acinetobacter baumanii KCTC 2771 Acti002 ITS ATAGTGTTGCAAGGC 13

C. Immobilization of the Bacterial Identification Probe

In order to immobilize the DNA probe, the binding of the aldehyde group-amine period was used. When synthesizing all DNA fragment probes to immobilize the DNA probe, a base having an amino residue was inserted using an aminolinker column (Aminolinker column, Cruachem, Glasgrow, Scotland) in the 3-first position, and a glass plate Slide glass was coated with an aldehyde residue (CEL Associates, Inc. Huston, Texas, USA).

When fixing the probe, the probe was dissolved in 3X SSC (0.45M NaCl, 15 mM C6H5Na3O7, pH 7.0) buffer solution using a microarrayer made according to the known technique (Yoon. SH, et al, J.). Microbiol.Biotechnol.10 (1), 21-26, 2000), and then immobilized the DNA probe by inducing a chemical reaction for at least 1 hour and leaving it for at least 6 hours under conditions of 55% humidity. . The bacteria detection probe was integrated with the total probes at a concentration of 100 μm at intervals of 280 μm in order to prepare a DNA chip composed of bacteria identification probes.

Figure 2 shows the DNA chip produced. The designation indicated in FIG. 2 indicates a specific probe candidate group for the above-mentioned strain.

In order to confirm that the reaction between the amine group of the probe and the aldehyde on the glass plate was smooth and well immobilized, it was confirmed by staining with SYBRO green II (Molecular Probe, Inc., Leiden, Netherlands).

D. Isolation and Amplification of Specimen Samples

Genomic DNA extraction from bacteria present in the specimen was performed as follows. The bacteria grown in the titration medium were suspended in 200 µl sterile distilled water, centrifuged at 14,000 rpm for 10 minutes, and the supernatant was discarded, leaving only pellets. Acinetobacter Baumani bacteria were Gram-negative bacteria, so they were suspended in 180 µl of ATL solution (Tissue Lysis solution, DNeasy Tissue Kit, QIAGEN), 20 µl of Proteinase K was lysed, and incubated at 55 ° C for 1 hour. After vortexing for 15 seconds, 200 μl of AL solution (Lysis solution, DNeasy Tissue Kit, QIAGEN) was mixed and incubated at 70 ° C. for 10 minutes. After 200 μl of ethanol (100%) was added and mixed, the solution was transferred to a 2-ml tube containing a DNeasy mini column and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, DNeasy Tissue Kit, Qiagen), centrifuge at 8,000 rpm or more for 1 minute, discard the effluent, and add 500 µl of AW2 solution (Wash solution 2, DNeasy Tissue Kit, QIAGEN). The DNeasy membranes were dried by centrifugation at full speed for 3 minutes and the effluent was discarded. After inserting the DNeasy mini-column for 15 minutes at room temperature, the genomic DNA was eluted by centrifugation for 1 minute at 8,000 rpm or more.

A fragment gene was prepared by using the DNA of the sample isolated as described above as a template and performing asymmetric amplification (Asymmetric PCR). The fragment gene was obtained by one polymerase chain reaction by differentiating the ratio of the forward primer and the reverse primer to 1: 5. In order to identify DNA bound to the probe during PCR, amplification was carried out using a primer with 5-FITC attached to confirm the binding through fluorescence to determine whether the infection and the type of infection. Primers used for PCR reactions are as follows:

Primer 1 (sense): TTGTACACACCGCCCGTC (SEQ ID NOs: 262, 1585F)

Primer 2 (antisense): F-TTTCGCCTTTCCCTCACGGTACT (SEQ ID NOs: 263, 23BR)

Primer 3 (sense): AGTACCGTGAGGGAAAGG (SEQ ID NOs: 264, 23BF)

Primer 4 (antisense): F- TGCTTCTAAGCCAACATCCT (SEQ ID NOs: 265, 37R)

Primer 5 (Sense): AGGATGTTGGCTTAGAAGCA (SEQ ID NOs: 266, 37F)

Primer 6 (antisense): F-CCCGACAAGGAATTTCGCTACCTTA (SEQ ID NOs: 267, 38R)

(F: FITC)

PCR reaction was performed under the following conditions. The first denaturation was performed at 94 ° C. for 7 minutes and the second denaturation at 94 ° C. for 1 minute. Annealing was performed at 52 ° C. for 1 minute and extension at 72 ° C. for 1 minute, which was repeated 10 times. Then, the third denaturation was performed at 94 ° C. for 1 minute, annealing at 54 ° C. for 1 minute, and extension at 72 ° C. for 1 minute, which was repeated 30 times. Then, the last extension was performed once at 72 ° C. for 5 minutes. The product produced as a result of the PCR reaction was confirmed by agarose gel electrophoresis. As a result, it was confirmed that DNA double strand and fragment strand were synthesized at the same time for each bacteria, and 23S rRNA and ITS of all bacterial species using the primers used in the present invention when using 23S rRNA and ITS for the identification of bacteria It was found that can be amplified.

E. Hybridization and Washing

In order to confirm the specificity and sensitivity of the selected probe, the PCR product (step D) amplified from the sample was applied to the DNA chip (step C) to which the probe was immobilized to perform a hybridization reaction. 30 μl of amplified gene (Asymmetric PCR) was added to the hybridization buffer (hybridization buffer: 6 × SSPE, 20% (v / v) formamide) to prepare a total volume of 200 μl. After dispensing the prepared solution on the glass plate to which the probe is immobilized, and then covered with a probe-clip press-seal incubation chamber (Sigma Co., St. Louis, MO.), 30 ℃ constant temperature shaking The reaction was induced for 6 hours in a shaking incubator to induce complementary binding. After elapse of time 3 × SPE (0.45M NaCl, 15mM C6H5Na3O7, pH 7.0), 2 × SSPE (0.3M NaCl, 10mM C6H5Na3O7, pH 7.0), 1 × SSPE (0.15M NaCl, 5mM C6H5Na3O7, pH 7.0) 5 minutes each.

F. Detection and Interpretation of Hybrids

The results of the hybridization reaction were searched using Scanarray 5000 (GSI Lumonics Inc., Bedford, MA.). The results of the hybridization reaction are shown in FIG. 3. In FIG. 3, the yellow ellipse means a positive control (probe) and the red ellipse means a bacterial specific probe. Therefore, the selected probe of the present invention is a specific probe with no cross-reaction within 21 species of the standard strain group, and when the probe is used, the presence of Acinetobacter Baumani bacteria in clinical specimens and whether they are infected You can check it.

Example 2

Detection of Acinetobacter Baumani Strains from Body Fluid Samples

It was carried out according to the same procedure as in Example 1. Acti002 (SEQ ID NO: 13) was used as the probe used in the probe derived from Acinetobacter Baumani. The produced DNA chip is shown in FIG. Samples were prepared for each of seven other patients infected with Acinetobacter Baumani as follows.

Ten ml of body fluid were collected in EDTA tubes or plain tubes, respectively, from seven patients infected with Acinetobacter Baumani. If the amount of the sample is more than 10ml centrifuged for 15 minutes at 5,000 xg, if less than 10ml was centrifuged for 15 minutes at 14,000rpm and the precipitate was collected in 1-2 1.5ml tube. Suspend in 180µl of lysozyme buffer (20mM Tris-Cl, pH 8.0, 2mM EDTA, 1.2% Triton X-100, 20mg / ml lysozyme), incubate for 30 minutes at 37 ℃, and 20µL of Proteinase K and AL solution (Lysis solution). 200 μl of QIAamp DNA Blood Mini Kit, QIAGEN) was gently mixed, incubated at 55 ° C. for 2 hours, and then incubated at 95 ° C. for 10 minutes. After adding 200 μl of ethanol (100%) and mixing, the whole solution was transferred to a 2-ml tube containing a QIAamp spin column, and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, QIAamp DNA Blood Mini Kit, QIAGEN), centrifuge at 8,000 rpm for 1 minute, discard the effluent, and then again 500 µl of AW2 solution (Wash solution 2, QIAamp DNA Blood Mini Kit, QIAGEN). The mixture was centrifuged at 14,000 rpm for 1 minute to discard the effluent. The QIAamp spin column was transferred to a 1.5 ml tube, and 300 µl of AE solution (Elution solution, DNA Blood Mini Kit, QIAGEN) was placed at room temperature for 15 minutes, followed by centrifugation at 8,000 rpm for 3 minutes to elute genomic DNA. After adding 750 μl of ethanol (100%) for 1 hour at −20 ° C., centrifuging at 14,000 rpm for 20 minutes, discarding the ethanol, which was the supernatant, drying, and pellets were dissolved in 20 μl sterile distilled water and concentrated.

Example 3

Detection of Acinetobacter Baumani Strains from Blood Samples

It was carried out according to the same procedure as in Example 3. However, the sample was prepared as follows. 10 ml blood each was sampled into EDTA tubes from seven patients infected with Acinetobacter Baumani. The plasma layer was divided into 1.5 ml tubes by centrifugation at 1,800 rpm for 10 minutes, centrifuged at 14,000 rpm for 10 minutes, and the precipitate was divided into 1.5 ml tubes. Suspend in 180µl of lysozyme buffer (20mM Tris-Cl, pH 8.0, 2mM EDTA, 1.2% Triton X-100, 20mg / ml lysozyme), incubate for 30 minutes at 37 ℃, and 20µL of Proteinase K and AL solution (Lysis solution). 200 μl of QIAamp DNA Blood Mini Kit, QIAGEN) was gently mixed, incubated at 55 ° C. for 30 minutes, and then incubated at 95 ° C. for 10 minutes. After adding 200 μl of ethanol (100%) and mixing, the whole solution was transferred to a 2-ml tube containing a QIAamp spin column, and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, QIAamp DNA Blood Mini Kit, QIAGEN), centrifuge at 8,000 rpm for 1 minute, discard the effluent, and again add 500 µl of AW2 solution (Wash solution 2, QIAamp DNA Blood Mini Kit, QIAGEN). The mixture was centrifuged at 14,000 rpm for 1 minute to discard the effluent. The QIAamp spin column was transferred to a 1.5 ml tube, 300 µl of AE solution (Elution solution, DNA Blood Mini Kit, QIAGEN) was added thereto, and allowed to stand at room temperature for 15 minutes, followed by centrifugation at 8,000 rpm for 3 minutes to elute genomic DNA. After adding 750 μl of ethanol (100%) for 1 hour at −20 ° C., centrifuging at 14,000 rpm for 20 minutes, discarding the ethanol, which was the supernatant, drying, and pellets were dissolved in 20 μl sterile distilled water and concentrated.

Example 4

Unaerobiopyrirum Succinic Niss Prodersense Strain (G-)

The same procedure as in Example 1 was performed. The full nucleotide sequence of 23S rRNA and ITS of the unaerobic pyrirum succinicisprodersense strain is shown in SEQ ID NO: 2. The locations and base sequences of the probes identified are shown in Table 14 below.

Identification strain Probe name location Sequence SEQ ID NO: Anaerobiospirillum succiniciproducens ATCC 29305 Anas005Anas008Anas009Anas010 ITSITSITSITS GTTCTTGATTCATTGCCAGCCCAAAAGTTGAAAACTGCAGGGCACAATACTACCTGACGAC 15161718

The selected probe of the present invention is a specific probe having no cross-reaction within 21 species of the standard strain group, and when the probe is used, it is possible to confirm the presence of Acinetobacter Baumani bacteria in clinical specimens and whether they are infected with the bacteria. there was.

Example 5

Cardiobacterium hominis strain (G-)

The same procedure as in Example 1 was performed. The full base sequence of 23S rRNA and ITS of the Cardiobacterium hominis strain is shown in SEQ ID NO: 3. The locations and base sequences of the probes identified are shown in Table 15 below.

Identification strain Probe name location Sequence SEQ ID NO: Cardiobacterium hominis ATCC 14900 Car3 (CarI) ITS AAAGAGAGAACAGCA 19

The produced DNA chip is shown in FIG. The results of the hybridization reaction are shown in FIG. 5. In FIG. 5, a yellow rectangle means a positive control (probe) and a red rectangle means fungal specific probe. Therefore, the selected probe of the present invention is a specific probe with no cross-reaction within 37 species of the standard strain group. When the probe is used, the presence of Cardiobacterium hominis bacteria in clinical specimens and whether it is infected with the bacterium You can check it.

Example 6

Chrysler bacterium meningocystum strain (G-)

The same procedure as in Example 1 was performed. The full base sequence of 23S rRNA and ITS of Chrysbacterium meningocystum strain is shown in SEQ ID NO: 4. The locations and base sequences of the probes identified are shown in Table 16 below.

Identification strain Probe name location Sequence SEQ ID NO: Chryseobacterium meningosepticum ATCC 13253 Chr003Chr004Chr005 ITSITSITS TAACCCCTTAGATTATCAAACCTCAAACTAAAGAAATCGAAGAGA 252627

The selected probe of the present invention is a specific probe without cross-reaction within 34 species of the standard strain group. When the probe is used, it is determined whether the presence of Chrysbacterium meningocystum bacillus in clinical specimens and whether it is infected with the bacterium. I could confirm it.

Example 7

Ocrobact antropy strain (G-)

The same procedure as in Example 1 was performed. The full base sequence of 23S rRNA and ITS of the Okrobacrum antropy strain is shown in SEQ ID NO: 5. The locations and base sequences of the probes identified are shown in Table 17 below.

Identification strain Probe designation location Sequence SEQ ID NO: Ochrobactrum anthropi ATCC 49188 Ochr004Ochr005Ochr007 ITSITSITS TCAAACCTCAAACTATACCGCTCACGAGCCGGGTCCGGAGGTTCA 282930

The selected probe of the present invention is a specific probe without cross-reaction within 34 species of the standard strain group. When the probe is used, it is confirmed whether or not the presence of Ocrobact antropy in the clinical sample and whether it is infected with the bacterium. Can be.

Example 8

Popiromonas ginjivalis strain (G +)

The same procedure as in Example 1 was performed. Popiromonas Ginzy Balis The full base sequence of the 23S rRNA and ITS of the strain is shown in SEQ ID NO: 6. The locations and base sequences of the probes identified are shown in Table 18 below.

Identification strain Probe designation location Sequence SEQ ID NO: Porphyromonas gingivalis ATCC 33277 Por 001 ITS GTTTTTGTGAGTGGA 31

Since the P. pylorimonas strains are Gram-positive bacteria, they are suspended in 180 µl of lysozyme lysate solution (20mm Tris-Cl, pH8.0, 2mM EDTA, 1.2% TritonX-100, 20mg / ml lysozyme) for 30 minutes at 37 ℃. After culturing, 25 μl of Proteinase K and 200 μl of AL solution (solution solution, DNeasy Tissue Kit, QIAGEN) were mixed well and incubated at 70 ° C. for 30 minutes. After 200 μl of ethanol (100%) was added and mixed, the solution was transferred to a 2-ml tube containing a DNeasy mini column and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, DNeasy Tissue Kit, Qiagen), centrifuge at 8,000 rpm or more for 1 minute, discard the effluent, and add 500 µl of AW2 solution (Wash solution 2, DNeasy Tissue Kit, QIAGEN). The DNeasy membranes were dried by centrifugation at full speed for 3 minutes and the effluent was discarded. After inserting the DNeasy mini-column for 15 minutes at room temperature, the genomic DNA was eluted by centrifugation for 1 minute at 8,000 rpm or more.

The selected probe of the present invention is a specific probe without cross-reaction within 34 species of the standard strain group, and when the probe is used, it is confirmed whether or not the infection of the bacterium P. pylorimonas jinjivalis in the clinical sample and the infection Could.

Example 9

Proteus vulgaris strain (G-)

The same procedure as in Example 1 was performed. Proteus Bulgari The full base sequence of the 23S rRNA and ITS of the strain is shown in SEQ ID NO: 7. The locations and base sequences of the probes identified are shown in Table 19 below.

Identification strain Probe designation location Sequence SEQ ID NO: Proteus vulgaris KCCM 11539 P.vulga01P.vulga02 ITSITS ATACGTGTTATGTGCCTCACACAGACTTGT 3361

The produced DNA chip is shown in FIG. The results of the hybridization reaction are shown in FIG. In Figure 7, the green dot means a positive control (probe) and the red circle means a fungal specific probe. Therefore, the selected probe of the present invention is a specific probe having no cross-reaction in the five standard strain groups, and when the probe is used, it is possible to confirm the presence of Proteus vulgaris in clinical specimens and whether it is infected with the bacterium. .

Example 10

Suterella Wausworthis strain (G +)

The same procedure as in Example 8 was performed. The full nucleotide sequence of 23S rRNA and ITS of Suterella wazworthensis strain is shown in SEQ ID NO: 8. The locations and base sequences of the probes identified are shown in Table 20 below.

Identification strain Probe designation location Sequence SEQ ID NO: Sutterella wadsworthensis ATCC 51579 Swad02Swad03Swad04 ITSITSITS TTCGGGTCCGTAATTAATCAAGGCCGAGGCGCCGAGGCGTGATGA 343536

The produced DNA chip is shown in FIG. 8. The results of the hybridization reaction are shown in FIG. 9. In Figure 9, the green ellipse means a positive control (probe) and the red ellipse means a bacteria specific probe. Therefore, the selected probe of the present invention is a specific probe having no cross-reaction in the six standard strain groups. When the probe is used, the presence of Suterella wazworthensis strain in clinical specimens and whether it is infected with the bacterium You can check it.

Example 11

Ichenella corodens strain (G +)

The same procedure as in Example 8 was performed. The full nucleotide sequence of 23S rRNA and ITS of the Ikenella corodens strain is shown in SEQ ID NO: 9. The locations and base sequences of the probes identified are shown in Table 21 below.

Identification strain Probe designation location Sequence SEQ ID NO: Eikenella corrodens ATCC 51724 E.corro001 ITS AGTCGTAGAGCGGAG 37

The produced DNA chip is as shown in FIG. The results of the hybridization reaction are shown in FIG. In Figure 11, the green dot means a positive control (probe) and the red ellipse means a bacteria specific probe. Therefore, the selected probe of the present invention is a specific probe with no cross-reaction within the 8 standard strain groups. When the probe is used, it is determined whether the Ikenella corodens strain is present in the clinical specimen and whether it is infected with the bacterium. You can check it.

Example 12

Haemohilus apropylas strain (G-)

The same procedure as in Example 1 was performed. The full nucleotide sequence of 23S rRNA and ITS of Haemohilus apropylas strain is shown in SEQ ID NO: 10. The locations and base sequences of the probes identified are shown in Table 22 below.

Identification strain Probe designation location Sequence SEQ ID NO: Haemohilus aphrophilas ATCC 13252 H.aphro001H.aphro002 ITSITS TGGGAGTGGGTTGTCTAACAAACCGGAAAC 3839

The produced DNA chip is as shown in FIG. The result of the hybridization reaction is shown in FIG. 12. In Figure 12, the green dot means a positive control (probe) and the red ellipse means a bacteria specific probe. Therefore, the selected probe of the present invention is a specific probe with no cross-reaction within the 8 standard strain groups. When the probe is used, the presence of Haemophilus apropyllas strain in clinical specimens and whether it is infected with the bacterium You can check.

Example 13

Neisseria Gonohea strain (G-)

The same procedure as in Example 1 was performed. The full nucleotide sequence of 23S rRNA and ITS of Neisseria gonohhea strain is shown in SEQ ID NO: 11. The locations and base sequences of the probes identified are shown in Table 23 below.

Identification strain Probe designation location Sequence SEQ ID NO: Neisseria gonorrhea ATCC 10150 N.gono001N.gono002 ITSITS AATGAGTTTGTTTTGAACCTCTCGCAAGAG 6740

The produced DNA chip is as shown in FIG. The result of the hybridization reaction is shown in FIG. 13. In Figure 13, the green dot means a positive control (probe) and the red ellipse means a bacteria specific probe. Therefore, the selected probe of the present invention is a specific probe with no cross-reaction within the 8 standard strain groups. When the probe is used, the presence of Neisseria gonohhea strains in clinical specimens and whether they are infected with the bacterium are identified. Can be.

The probes of the present invention exhibit a high degree of specificity.

Claims (69)

An isolated nucleic acid molecule of the following base sequence derived from the ITS of Acinetobacter Baumani: ATACACAGTACTTCG (Acti3, SEQ ID NO: 12); ATAGTGTTGCAAGGC (Acti002, SEQ ID NO: 13); And TGAAAAGCCAGGGGA (Acti003, SEQ ID NO: 14). A nucleic acid probe for detecting Acinetobacter Baumani bacteria, comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 12 to 14. A composition comprising a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising any one of the nucleotide sequences of 12 to 14. (a) a composition comprising a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 12-14; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying Acinetobacter Baumani bacteria in a biological sample. A DNA chip comprising at least one nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 12-14. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Acinetobacter Baumani, comprising the nucleic acid molecule of any one of SEQ ID NOs: 12 to 14 in the polynucleic acid of steps (a) and (b); Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) A method for detecting and identifying Acinetobacter Baumani bacteria in the biological sample, characterized by identifying the strains present in the sample from the different hybridization signals obtained in step (d). An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of the unaerobic pyrirum succinicis prodersense bacterium: GTTCTTGATTCATTGC (Anas005, SEQ ID NO: 15); CAGCCCAAAAGTTGA (Anas008, SEQ ID NO: 16); AAACTGCAGGGCACA (Anas009, SEQ ID NO: 17); And ATACTACCTGACGAC (Anas010, SEQ ID NO: 18). Nucleic acid probe for the detection of the un-aerobiopyrirum succinisiprodersense bacteria, characterized in that it comprises a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 15 to 18. A composition comprising a nucleic acid probe for the detection of un-aerobiopyrirum succinisiprodercene bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 15 to 18. (A) a composition comprising a nucleic acid probe for the detection of the un-aerobiopyrirum succinisiprodersense bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 15 to 18; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing a hybrid formed under suitable washing conditions or a component necessary to produce such a solution; and (e) optionally means for detecting a hybrid formed previously. Kit for the detection and identification of room succinyl prosthesis bacteria. A DNA chip comprising at least one nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 15 to 18. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a nucleic acid for detecting an aerobic pyrirum succinicis prodersense bacterium comprising the nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 15 to 18 in the polynucleic acid of steps (a) and (b) Contacting the composition comprising the probe with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) A method for detecting and identifying un-aerobiopyrirum succinisiprodersense bacteria in the biological sample, characterized by identifying strains present in the sample from different hybridization signals obtained in step (d). An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from Cardiobacterium hominis ITS: AAAGAGAGAACAGCA (Car3, SEQ ID NO: 19); TTGGCGACAACAGGC (Car001, SEQ ID NO: 20); GCCCCGGGAAGCTGA (Car002, SEQ ID NO: 21); TAGACTGCGGAAGCG (Car003, SEQ ID NO: 22); And AATTAAGTTGCGTAT (Car004, SEQ ID NO: 23). A nucleic acid probe for detecting Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 19 to 23. A composition comprising a nucleic acid probe for detecting Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 19 to 23. (a) a composition comprising a nucleic acid probe for detecting Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 19 to 23; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying Cardiobacterium hominis bacteria in a biological sample. A DNA chip comprising at least one nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 19 to 23. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting a cardiobacterium homominis comprising the polynucleic acid of steps (a) and (b) comprising a nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 19 to 23; Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) A method for detecting and identifying Cardiobacterium hominis bacteria in the biological sample, characterized by identifying the strains present in the sample from the different hybridization signals obtained in step (d). An isolated nucleic acid molecule comprising the following base sequence derived from the ITS of Chrysbacterium meningocystum bacillus: CTTAGGTGATCACTT (Chr001, SEQ ID NO: 24); TAACCCCTTAGATTA (Chr003, SEQ ID NO: 25); TCAAACCTCAAACTA (Chr004, SEQ ID NO: 26); And AAGAAATCGAAGAGA (Chr005, SEQ ID NO: 27). A nucleic acid probe for the detection of Chrysbacterium meningocystum bacteria, characterized in that it comprises a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 24 to 27. A composition comprising a nucleic acid probe for detecting Chrysbacterium meningocystum bacteria comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 24 to 27. (a) a composition comprising a nucleic acid probe for the detection of Chrysbacterium meningocystum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 24 to 27; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying Chrysbacterium meningocystum bacteria in a biological sample. DNA chip comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 24 to 27. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a nucleic acid probe for detecting the Krysarbacterium meningocystum bacterium comprising the polynucleic acid of step (a) and (b) comprising the nucleic acid molecule of any one of SEQ ID NOS: 24 to 27; Contacting the composition under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby detecting and identifying Chrysbacterium meningocystum bacteria in the biological sample. Provided are isolated nucleic acid molecules selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of Okrobacrum antropy bacteria: GTTGATTGACACTTG (Ochr004, SEQ ID NO: 28); TACCGCTCACGAGCC (Ochr005, SEQ ID NO: 29); And GGGTCCGGAGGTTCA (Ochr007, SEQ ID NO: 30). A nucleic acid probe for the detection of Ocrobact antropy bacteria, characterized in that it comprises a nucleic acid molecule comprising any one of SEQ ID NO: 28 to 30. Composition comprising a nucleic acid probe for the detection of Ocrobacrum antropy bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 28 to 30. (a) a composition comprising a nucleic acid probe for the detection of Ocrobacrum antropy bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 28 to 30; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed. 17. A kit for detecting and identifying said Okrobacterium antropy bacterium in a biological sample. A DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 28 to 30. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for the detection of Ocrobacrum antropy bacteria, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 28 to 30 Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby detecting and identifying the acrobat bacterium antropy in the biological sample. An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of Popiromonas genjivalis bacterium: GTTTTTGTGAGTGGA (Por 001, SEQ ID NO: 31); And TGATGGGTGGGGTTG (Por 002, SEQ ID NO: 32). A nucleic acid probe for detecting P. pylorimonas genjivalis bacteria, comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 31 and 32. A composition comprising a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 31 and 32. (a) a composition comprising a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 31 and 32; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying Popiromonas zybacilli bacteria in a biological sample. A DNA chip comprising at least one nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 31 and 32. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 31 and 32 in the polynucleic acid of steps (a) and (b) Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), wherein the method comprises the steps of detecting and identifying Popiromonas genjivalis bacteria in the biological sample. An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from ITS of Proteus vulgaris: ATACGTGTTATGTGC (Pvulga01, SEQ ID NO: 33). A nucleic acid probe for detecting Proteus vulgaris, characterized in that it comprises a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33. A composition comprising a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33. (a) a composition comprising a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed. 17. A kit for detecting and identifying Proteus vulgaris in a biological sample. A DNA chip comprising at least one nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) contacting the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37 under appropriate hybridization and washing conditions; ; (d) detecting the hybrid formed in step (c); (e) A method for detecting and identifying Proteus vulgaris in said biological sample, characterized by identifying strains present in the sample from different hybridization signals obtained in step (d). An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from ITS of Suterella wazworthensis: TTCGGGTCCGTAATT (Swad02, SEQ ID NO: 34); AATCAAGGCCGAGGC (Swad03, SEQ ID NO: 35); And GCCGAGGCGTGATGA (Swad04, SEQ ID NO: 36). A nucleic acid probe for detecting Suterella wazworthensis, characterized in that it comprises a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 34 to 36. A composition comprising a nucleic acid probe for detecting Suterella wazworthensis comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 34-36. (a) a composition comprising a nucleic acid probe for detecting Suterella wazworthensis comprising a nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 34 to 36; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying Suterella wazworthensis bacteria in a biological sample. A DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 34 to 36. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Suterella wazworthensis, the polynucleic acid of steps (a) and (b) comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 34 to 36; Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) A method for detecting and identifying Suterella wazworthensis bacteria in the biological sample, characterized by identifying the strains present in the sample from the different hybridization signals obtained in step (d). An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of E.ella corodens: AGTCGTAGAGCGGAG (E.corro001, SEQ ID NO: 37) A nucleic acid probe for the detection of Ikenella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37. A composition comprising a nucleic acid probe for the detection of Ikenella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37. (a) a composition comprising a nucleic acid probe for the detection of E.ella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying E.ella corodens in a biological sample. A DNA chip comprising at least one nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing conditions of the polynucleic acid of step (a) and (b) with a composition comprising a nucleic acid probe for the detection of E.ella corodens comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37. Contacting under; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby detecting and identifying E.ella corodens in the biological sample. An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from ITS of Haemohilus apropyls: TGGGAGTGGGTTGTC (H.aphro001, SEQ ID NO: 38); And TAACAAACCGGAAAC (H.aphro002, SEQ ID NO: 39). A nucleic acid probe for detecting Haemophilus apropyls bacteria, characterized in that it comprises a nucleic acid molecule comprising any one of SEQ ID NOs: 38 and 39. A composition comprising a nucleic acid probe for detecting Haemophilus apropyls bacteria comprising a nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 38 and 39. (a) a composition comprising a nucleic acid probe for detecting Haemophilus apropyl bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 38 and 39; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying Haemophilus apropyl bacteria in a biological sample. A DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 38 and 39. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Haemophilus apropyl bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 38 and 39 in the polynucleic acid of steps (a) and (b) Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) A method for detecting and identifying Haemophilus apropyl bacteria in the biological sample, characterized by identifying the strains present in the sample from the different hybridization signals obtained in step (d). An isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from ITS of Neisseria gonohaea: AACCTCTCGCAAGAG (N.gono002, SEQ ID NO: 40) Nucleic acid probe for detection of bacteria Neyeria Gonohea characterized in that it comprises a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40. A composition comprising a nucleic acid probe for detection of Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40. (a) a composition comprising a nucleic acid probe for detecting Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying Neisseria gonohea bacteria in a biological sample. A DNA chip comprising at least one nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detection of Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40. Contact; (d) detecting the hybrid formed in step (c); (e) identifying the strain present in the sample from the different hybridization signals obtained in step (d), and detecting and identifying Neisseria gonohea bacteria in the biological sample. (a) one or more of the nucleic acid probes for detecting Acinetobacter Baumani, including the nucleic acid molecules comprising the nucleotide sequences of SEQ ID NOs: 12 to 14, and a nucleic acid molecule comprising any one of SEQ ID NOs: 15 to 18 Detection of one or more of the nucleic acid probe for detecting the aeroerobic pyrium succinic nis prosthesis bacterium comprising a, Cardiobacterium homominis comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 19 to 23 At least one of the nucleic acid probes for detecting bacteria of the bacterium bacterium meningocyst comprising at least one of the nucleic acid probes of any of the above-mentioned nucleic acid probes, and the nucleic acid molecule of any one of SEQ ID NOs: 24 to 27, At least one of nucleic acid probes for the detection of the bacterium Ocrobacrum antropy comprising a nucleic acid molecule containing any one nucleotide sequence, the Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 33 or one or more of the nucleic acid probes for detecting P. pylorimonas zygobacilli comprising the nucleic acid molecule of any one of SEQ ID NOs: 31 and 32 At least one of a nucleic acid probe for detecting a bacterium, a nucleic acid probe for detecting Suterella wazworthensis comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 34 to 36, and comprising the base sequence of SEQ ID NO: 37 One of the nucleic acid probes for detecting E.ella corodens comprising a nucleic acid molecule, and the nucleic acid probes for detecting Haemohilus apropylas comprising the nucleic acid molecule of any one of SEQ ID NOs: 38 and 39 Nucleus for the detection of Neisseria gonohea bacteria comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40 and above Composition comprising at least one probe selected from the group consisting of a probe; (b) a forward and reverse primer pair, optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, wherein the kit is for detecting and identifying one or more species of said organism in a biological sample. A DNA chip comprising one or more nucleic acid molecules comprising the nucleotide sequence of any one of SEQ ID NO: 12 to 40. (a) optionally isolating and / or concentrating polynucleic acid present in the biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) at least one of the nucleic acid probes for detecting Acinetobacter Baumani, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequences of SEQ ID NOs: 12-14; One or more of the nucleic acid probes for detecting the aerobic pyrirum succinicis prodense bacterium comprising a nucleic acid molecule comprising any one of 15 to 18, the base sequence of any one of SEQ ID NOs: 19 to 23 For detection of Chrysbacterium meningocystum bacteria comprising a nucleic acid molecule comprising at least one nucleic acid probe of any one of the nucleic acid probes of the Cardiobacterium hominis comprising the nucleic acid molecule Test for the bacterium Ocrobacrum antropy comprising at least one nucleic acid probe and a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 28-30 One or more of the nucleic acid probes for detecting P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising one or more of the nucleic acid probes of SEQ ID NOs: 31 and 32; At least one of a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule, and a nucleic acid probe for detecting Suterella wazworthensis, including the nucleic acid molecule of any one of SEQ ID NOs: 34 to 36, wherein Nucleic acid probe for the detection of the bacteria Ikenella corodens comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 37, Haemophilus apropyls comprising a nucleic acid molecule comprising any one of the nucleotide sequence of SEQ ID NO: 38 and 39 An age comprising one or more of the nucleic acid probes for detecting the bacterium and a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 40 above Contacting a composition comprising one or more probes selected from the group consisting of nucleic acid probes for detecting Ceria gonohea bacteria under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) A method for detecting and identifying one or more species of said bacteria in said biological sample, characterized by identifying strains present in the sample from different hybridization signals obtained in step (d).