KR100781559B1 - Nucleic Acid Probes for Detection of Candida albicans - Google Patents

Abstract

The present invention relates to nucleic acid probes derived from rRNA genes of nonviral infectious organisms and useful for detecting and identifying those organisms in biological samples and compositions and kits useful for diagnosing infectious diseases, including these nucleic acid probes.

Nucleic Acid Probes, Infectious Diseases, Detection, Identification

Description

Nucleic Acid Probes for Detection of Candida albicans

1 is Staphylococcus aureus, Pseudomonas aeruginosa, Proteus mirabilis, Crevciella pneumoniae, Acinetobacter Baumani, E. The design of a DNA chip for blind testing on specimens containing E. coli or Enterococcus fungus is shown.

FIG. 2 shows the results of hybridization reactions in the DNA chip of FIG. 1 retrieved using Scanarray 5000 in a blind test on a specimen containing Staphylococcus aureus.

FIG. 3 shows the results of hybridization reactions in the DNA chip of FIG. 1 retrieved using Scanarray 5000 in a blind test on specimens containing Pseudomonas aeruginosa. FIG.

FIG. 4 shows the results of hybridization reactions in the DNA chip of FIG. 1 retrieved using Scanarray 5000 in a blind test on specimens containing Proteus mirabilis.

FIG. 5 shows the results of hybridization reactions in the DNA chip of FIG. 1 retrieved using Scanarray 5000 in a blind test on a specimen containing Creebsiella pneumoniae.

FIG. 6 shows the results of hybridization reactions in the DNA chip of FIG. 1 retrieved using Scanarray 5000 in a blind test on specimens containing Acinetobacter Baumani. FIG.

7 is this. Blind test on specimens containing E. coli shows the results of hybridization reactions on the DNA chip of FIG. 1 retrieved using Scanarray 5000.

FIG. 8 shows the results of hybridization reactions in the DNA chip of FIG. 1 searched using Scanarray 5000 in a blind test on a specimen containing Enterococcus phenium bacteria.

Figure 9 shows the design of the DNA chip for the blind test on a sample containing Staphylococcus epidermidis bacteria.

FIG. 10 shows the results of hybridization reactions in the DNA chip of FIG. 9 retrieved using Scanarray 5000 in a blind test on a sample containing Staphylococcus epidermidis bacteria. FIG.

FIG. 11 shows the design of a DNA chip for blind testing of specimens containing Salmonella group E bacteria or Salmonella group B bacteria.

FIG. 12 shows hybridization results of the DNA chip of FIG. 11 retrieved using ScanAray 5000 in a blind test on a specimen including Salmonella group E bacteria.

FIG. 13 shows the results of hybridization reactions in the DNA chip of FIG. 11 retrieved using ScanAray 5000 in a blind test on specimens containing Salmonella group B bacteria.

FIG. 14 shows the design of a DNA chip for blind testing of specimens containing either Crevciella oxytoca or Vulcoderia cephacia.

FIG. 15 shows the results of hybridization reactions in the DNA chip of FIG. 14 retrieved using ScanAray 5000 in a blind test on specimens containing Crevciella oxytoca. FIG.

FIG. 16 shows the results of hybridization reactions in the DNA chip of FIG. 14 retrieved using ScanAray 5000 in a blind test on specimens containing Bulcoderia cephacia. FIG.

17 shows the location of primers used to amplify polynucleic acids in biological samples. (16S: 16S rRNA; ITS: Internal Transcribed Spacer Region (hereinafter referred to as “ITS”); 23S: 23S rRNA).

<Technology field>

The present invention relates to nucleic acid probes useful for detecting and identifying nonviral infectious organisms in biological samples and for use in diagnosing diseases caused by such nonviral infectious organisms. In particular, the present invention relates to nucleic acid probes derived from the rRNA genes of nonviral infectious organisms and useful for detecting and identifying those organisms, and compositions and kits useful for diagnosing infectious diseases, including these nucleic acid probes.

Background

Infectious diseases are diseases that occur when pathogens start to live in the blood, body fluids, and tissues, and may be life-threatening if accurate identification and proper treatment of causative organisms are not performed. More recently, the misuse of antibiotics has resulted in a reduction in the incidence of pathogens. Diagnostic methods for diagnosing infectious diseases are increasingly difficult. In particular, in the case of certain pathogens, including anaerobic bacteria, it causes a very fatal and serious disease in the human body, promptly diagnosing them and identifying the type of the pathogens are very important in the treatment. Due to this necessity, diagnostic methods for identifying microorganisms causing infectious diseases have been researched and developed for a long time. Significant advances have been made in detecting a large number of microorganisms over the past decade, but the diagnostic methods currently in use still require a lot of labor and are low in sensitivity and specificity.

Except for viruses, all prokaryotic organisms contain rRNA genes that encode homologs of prokaryotic 5S, 16S and 23S rRNA molecules. For eukaryotic cells, these rRNA molecules are 5S rRNA, 5.8S rRNA, 18S rRNA and 28S rRNA, which are substantially similar to those of prokaryotic cells. Many probes have been published for the specific targeting of rRNA subsequences of specific organisms or groups of organisms in biological samples. By using these nucleic acid probes in combination with well known polymerase chain reaction (PCR), many of these problems can be solved in conventional diagnostic methods. In nucleic acid probe technology for diagnosis, selection of target genes to be amplified is very important. In general, rRNA, in particular 23S rRNA gene and Internal Transcribed Spacer Region (ITS), are used, and nucleic acid probe sequences for these are advantageously suitable. It is known that the probability of cross-reaction with nucleic acids from other organisms under tightening conditions is low (P. Wattiau et. Al., Appl. Microbiol. Biotechnol., 56, 816-819, 2001; D, A. Stahlm et. al., J. Bacteriol., 172, 116-124, 1990; Boddinghaus. et.al., J. Clin., Microbiol., 28, 1751-1759, 1990; T. Rogall et al., J. Gen. Microbiol., 136, 1915-1920, 1990; T. Rogall, et.al., Int. J. System.Bacteriol., 40, 323-330, 1990; K. Rantakokko-Jalava et.al., J. Clin , Mirobiol., 38 (1), 32-39, 2000; Park et.al., J. Clin., Mirobiol., 38 (11), 4080-4085, 2000; A. Schmalenberger et.al, Appl. Microbiol.Biotechnol., 67 (8), 3557-3563, 2001; International Patent Publication WO98 / 55646, US Pat. No. 6025132 to Jannes et al., And US Pat. No. 6,277,577 to Rossau et al.).

However, for many pathogens, the nucleotide sequence of the rRNA gene is in an unidentified state, and thus there remains a need to develop a probe with a high specificity to identify and derive the nucleotide sequence of the rRNA gene of such pathogen. In addition, although for some pathogens the nucleotide sequence of the rRNA gene is revealed in whole or in part, new nucleic acid probes capable of detecting such pathogens more specifically need to be developed.

It is therefore an object of the present invention to develop nucleic acid probes useful for detecting and identifying the following nonviral pathogens:

(1) Acinetobacter baumanii;

(2) Unaerobiospyroom Succinsi Proder Sense

Anaerobiospirillum succiniciproducens;

(3) Bacteroides fragilis;

(4) Cardiobacterium hominis;

(5) Chryseobacterium meningosepticum;

(6) Clostridium ramosum;

(7) Comamonas acidovorans;

(8) Corynebacterium diphtheriae;

(9) Klebsiella oxytoca;

(10) Ochrobactrum anthropi;

(11) Peptostreptococcus prevotii;

(12) Porphyromonas gingivalis;

(13) Peptostreptococcus anaeroius;

(14) Peptostreptococcus magnus;

(15) Fusobacterium necrophorum;

(16) Proteus vulgaris;

(17) Enterobacter aerogenes;

(18) Streptococcus mutans;

(19) Kingella kingaep;

(20) Bacteroides ovatus;

(21) Bacteroides thetaiotaomicron;

(22) Clostridium diffcile;

(23) Haemophilus aprophilas;

(24) Neisseria gonorrhea;

(25) Eikenella corrodens;

(26) Bacteroides vulgatus;

(27) Branhamella catarrhalis;

(28) Sutterella wadsworthensis;

(29) Actinomyces israelii;

(30) Staphylococcus epidrmidis;

(31) Burkholderia cepacia;

* (32) Salmonella spp. (Enteritidis);

(33) Escherichia coli;

(34) Klebsiella pneumoniae;

(35) Proteus mirabilis;

(36) Streptococcus pneumoniae;

(37) Vibrio vulnificus;

(38) Pseudomonas aeruginosa;

(39) Aeromonas hydrophila;

(40) Listeria monocytogenes;

(41) Enterococcus faecium;

(42) Staphylococcus aureus;

(43) Neisseria meningitidis;

(44) Legionella pneumophila;

(45) Candida albicans; And

(46) Candida glabrata.

Summary of the Invention

The inventors have developed probes with sequences that specifically hybridize with the rRNA genes of each pathogen and do not cross-react with nucleic acids of other organisms, and also fabricate DNA chips incorporating these probes and conduct them through clinical trials. The object of the present invention was achieved by confirming the specificity of each. The nucleic acid probe for detecting and identifying each bacterium of (1) to (28) is derived from the 23S rRNA gene of each bacterium directly identified by the present inventors and the entire nucleotide sequence of ITS (SEQ ID NOS: 1 to 28). It has a specific base sequence that hybridizes specifically with the 23S rRNA or ITS of the bacteria of its origin and does not cross react with nucleic acids of other organisms. In the case of the bacteria of (29) to (44), a specific base which is derived from a known 23S rRNA gene and specifically hybridizes with the 23S rRNA gene of the bacterium of its origin and does not cross-react with nucleic acids of other organisms Has a sequence. In the case of the fungi of (45) and (46), the base sequence derived from the known 18S rRNA gene and specifically hybridized with the 18S rRNA gene of the fungus of which its origin is used and does not cross-react with the nucleic acid of other organisms Has

In one aspect, the present invention provides a nucleic acid molecule having the nucleotide sequences set forth in SEQ ID NOS: 1 to 28, respectively, as the entire nucleotide sequence of the 23S rRNA gene and the ITS of the bacteria of (1) to (28).

In another aspect (1-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Acinetobacter Baumani:

TGATGGAACTTGCTT (Acti004, SEQ ID NO: 29);

AGGGCACACATAATG (Acti23S01, SEQ ID NO: 30); or

ACGCTGTTGTTGGTG (Acti23S02, SEQ ID NO: 31).

In another aspect (1-i-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Acinetobacter Baumani:

ATACACAGTACTTCG (Acti3, SEQ ID NO: 32);

ATAGTGTTGCAAGGC (Acti002, SEQ ID NO: 33); or

TGAAAAGCCAGGGGA (Acti003, SEQ ID NO: 34).

In another aspect (1-ii), the present invention provides a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 29-34.

In another aspect (1-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 29-34.

In another aspect (1-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 29 to 34; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a previously formed hybrid, thereby providing a kit for detecting and identifying Acinetobacter Baumani bacteria in a biological sample.

In another aspect (1-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Acinetobacter Baumani, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 29 to 34, is immobilized on a solid support. To provide.

In another aspect (1-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Acinetobacter Baumani, comprising the nucleic acid molecule of any one of SEQ ID NOs: 29 to 34 as the polynucleic acid of steps (a) and (b); Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying acinetobacter Baumani bacteria in the biological sample.

In another aspect (2-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Unaerobiopyrirum succinisiprodersense bacterium:

TGACTCGTGCCCATG (Anas001, SEQ ID NO: 45);

TACCGGGGTTAAAAG (Anas002, SEQ ID NO: 46);

ATCAGTGATCTGAGA (Anas003, SEQ ID NO: 47);

GAGACGAAGCACCAT (Anas004, SEQ ID NO: 48);

AGTTGATACAGGTAG (Anas011, SEQ ID NO: 49);

GGCCCCATCCGGGGT (Anas013, SEQ ID NO: 50); or

CAGTTGGAAGCAGAG (Anas23S03, SEQ ID NO: 51).

In another aspect (2-ii-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of the unaerobic pyrirum succinicis deferens bacteria:

GTTCTTGATTCATTGC (Anas005, SEQ ID NO: 52);

CAGCCCAAAAGTTGA (Anas008, SEQ ID NO: 53);

AAACTGCAGGGCACA (Anas009, SEQ ID NO: 54); or

ATACTACCTGACGAC (Anas010, SEQ ID NO: 55).

In another aspect (2-ii), the present invention provides a nucleic acid probe for detecting an aerobic pyrirum succinicis prodersense bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 45 to 55. .

In another aspect (2-iii), the present invention relates to a composition comprising a nucleic acid probe for detecting an aerobic pyrirum succinicide prosthesis bacterium comprising the nucleic acid molecule of any one of SEQ ID NOs: 45 to 55. To provide.

In another aspect (2-iv), the present invention provides (a) a nucleic acid probe for detecting an aerobic pyrirum succinicis prodersense bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 45 to 55. Composition comprising; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing a hybrid formed under suitable washing conditions or the components necessary to produce such a solution: and (e) optionally means for detecting the hybrid formed previously. Provided are kits for detecting and identifying room succinic nitrodersens bacteria.

In view of (2-v), the present invention provides a nucleic acid probe for detecting an aerobic pyrirum succinicis prodercene bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 45 to 55. Provide an immobilized DNA chip.

In another aspect (2-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a nucleic acid for detecting an aerobic pyriroom succinicis prodersense bacterium comprising the nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 45 to 55 in the polynucleic acid of steps (a) and (b) Contacting the composition comprising the probe with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying un-aerobiopyrirum succinicisprodersense bacteria in the biological sample. do.

In another aspect (3-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from Bacteroides praxilli 's 23S rRNA:

GTCGAACCTGACAGT (Bf011, SEQ ID NO: 78).

In another aspect (3-ii), the present invention provides a nucleic acid probe for detecting Bacteroides prasilis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 78.

In another aspect (3-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Bacteroides prasilis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 78.

In another aspect (3-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Bacteroides prazilis, comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 78; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Bacteroides prasilis bacteria in a biological sample.

In another aspect (3-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Bacteroides prasilis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 78 is fixed to a solid support.

In another aspect (3-vi), the present invention relates to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detecting Bacteroides prasilis bacteria comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 78, wherein the polynucleic acid of step (a) and (b) Contacting under; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Bacteroides pragillis bacteria in the biological sample.

In another aspect (4-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Cardiobacterium homominis:

AACCCTGGTGAAGGG (Car 006, SEQ ID NO: 93);

ATATGAAGATATGTG (Car 007, SEQ ID NO: 94);

TAGATTGACTTACGG (Car 008, SEQ ID NO: 95);

* GTAAAGTTTTACTAC (Car 009, SEQ ID NO: 96); or

CCAGCACACTGTTGG (Car2, SEQ ID NO: 97).

In another aspect (4-i-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Cardiobacterium hominis bacteria:

AAAGAGAGAACAGCA (Car3 (CarI), SEQ ID NO: 98);

TTGGCGACAACAGGC (Car001, SEQ ID NO: 99);

GCCCCGGGAAGCTGA (Car002, SEQ ID NO: 100);

TAGACTGCGGAAGCG (Car003, SEQ ID NO: 101); or

AATTAAGTTGCGTAT (Car004, SEQ ID NO: 102).

In another aspect (4-ii), the present invention provides a nucleic acid probe for detecting Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 93-102.

In another aspect (4-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Cardiobacterium homominis comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 93-102.

In another aspect (4-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting Cardiobacterium hominis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 93 to 102; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Cardiobacterium hominis bacteria in a biological sample.

In another aspect (v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Cardiobacterium homominis comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 93 to 102 is fixed to a solid support. do.

In another aspect (vi), the present invention relates to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting a Cardiobacterium hominis bacterium comprising the nucleic acid molecule of any one of SEQ ID NOs: 93 to 102 as the polynucleic acid of steps (a) and (b); Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Cardiobacterium hominis bacteria in the biological sample.

In another aspect (5-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from 23S rRNA of Chrysbacterium meningocystum bacterium:

GGCATATTTAGATGA (Chr23S04, SEQ ID NO: 105).

In another aspect (5-i-b), the present invention provides an isolated nucleic acid molecule comprising the following base sequence derived from ITS of Chrysbacterium meningocystum fungus:

CTTAGGTGATCACTT (Chr001, SEQ ID NO: 106);

TAACCCCTTAGATTA (Chr003, SEQ ID NO: 107);

TCAAACCTCAAACTA (Chr004, SEQ ID NO: 108); or

AAGAAATCGAAGAGA (Chr005, SEQ ID NO: 109).

In another aspect (5-ii), the present invention provides a nucleic acid probe for detecting Chrysbacterium meningocceptum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 105 to 109.

In another aspect (5-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Chrysbacterium meningocceptum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 105 to 109. .

In another aspect (5-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Chrysbacterium meningocystum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 105 to 109. ; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Chrysbacterium meningocystum bacteria in a biological sample.

In another aspect (5-v), the present invention provides a method for immobilizing a nucleic acid probe for detection of bacteria of the bacterium bacterium meningocceptum comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 105 to 109 on a solid support. Provide a DNA chip.

In another aspect (5-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a nucleic acid probe for detecting the Krysarbacterium meningocystum bacterium comprising the nucleic acid molecule of any one of SEQ ID NOs: 105 to 109 in the polynucleic acid of steps (a) and (b); Contacting the composition under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Chrysbacterium meningocystum bacteria in the biological sample.

In another aspect (6-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Clostridium lammosomes:

CCAGTGTGTGAGGAG (C.ramosa04, SEQ ID NO: 115); or

CCCGGGAAGGGGAGT (C.ramo 004, SEQ ID NO: 116).

In another aspect (6-ii), the present invention provides a nucleic acid probe for the detection of Clostridium rhammosome bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 115 or 116.

In another aspect (6-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Clostridium lammosome bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 115 or 116.

In another aspect (6-iv), the present invention (a) composition comprising a nucleic acid probe for the detection of Clostridium rhammosome bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 115 or 116; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Clostridium rhammosomes in a biological sample.

In another aspect (6-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Clostridium rammosome bacteria comprising a nucleic acid nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 115 or 116 is fixed to a solid support. do.

In another aspect (6-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for the detection of Clostridium rhammosome bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 115 or 116 and Contacting under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Clostridium rhammosome in the biological sample.

In another aspect (7-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Coomamonas ashidoboranth bacteria:

TAGGGCGTCCAGTCG (Com 004, SEQ ID NO: 124);

CGCAGAGTACAGCTT (Com 005, SEQ ID NO: 125);

GTACCGATGTGTAGT (Com 006, SEQ ID NO: 126);

GAACTTGAACAAAGG (Com 007, SEQ ID NO: 127);

TGTGCTAGAGAAAAG (Coma2, SEQ ID NO: 128); or

ATCCGCCGGGCTTAG (Coma3, SEQ ID NO: 129).

In another aspect (7-ii), the present invention provides a nucleic acid probe for the detection of Komamonas acidoboranth bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 124 to 129.

In another aspect (7-iii), the present invention provides a composition comprising a nucleic acid probe for detection of Komamonas ashidoboranth bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 124 to 129.

In another aspect (7-iv), the present invention provides a composition comprising: (a) a nucleic acid probe for the detection of Komamonas asidoborance bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 124 to 129; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying the bacteria of Comamonas asidoborance in a biological sample.

In another aspect (7-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting the comamonas ashidoboranth bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 124 to 129 is fixed to a solid support. To provide.

In another aspect (7-vi), the present invention relates to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Komamonas ashidoboranth bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 124 to 129, wherein the polynucleic acid of step (a) and (b) Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method of detecting and identifying the coma monoma asidoborance bacteria in the biological sample.

In another aspect (8-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from Corynebacterium diphtheria bacteria:

ACCATCTTCCCAAGG (C.diph003, SEQ ID NO: 135).

In another aspect (8-ii), the present invention provides a nucleic acid probe for detecting Corynebacterium diphtheria bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 135.

In another aspect (8-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Corynebacterium diphtheria bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 135.

In another aspect (8-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Corynebacterium diphtheria bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 135; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Corynebacterium diphtheria bacteria in a biological sample.

In another aspect (8-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Corynebacterium diphtheria bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 135 is fixed to a solid support. .

In another aspect (8-vi), the present invention provides a process for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detecting Corynebacterium diphtheria bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 135; and Contacting under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Corynebacterium diphtheria bacteria in the biological sample.

In another aspect (9-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of the Crevciella oxytoca strain:

GAACGTTACTAACGC (Ko001, SEQ ID NO: 142).

In another aspect (9-ii), the present invention provides a nucleic acid probe for detecting Crebsiella oxytoca bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 142.

In another aspect (9-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Crebesciella oxytoca bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 142.

In another aspect (9-iv), the present invention provides a composition comprising: (a) a nucleic acid probe for detecting Crebesciella oxytoca bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 142; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Crevciella oxytoca bacteria in a biological sample.

In another aspect (9-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Crebciella oxytoca bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 142 is fixed to a solid support.

In another aspect (9-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for the detection of the Crebessiella oxytoca bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 142. Contacting under conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Crevsciella oxytoca in the biological sample.

In another aspect (10-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the 23S rRNA of Okrobacrum antropy:

GGACCAGGCCAGTGG (Ochr04, SEQ ID NO: 151); or

GACCAGGCCAGTGGC (Ochr05, SEQ ID NO: 152).

In another aspect (10-i-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of Okrobacrum antropy:

GTTGATTGACACTTG (Ochr004, SEQ ID NO: 153);

TACCGCTCACGAGCC (Ochr005, SEQ ID NO: 154); or

GGGTCCGGAGGTTCA (Ochr007, SEQ ID NO: 155).

In another aspect (10-ii), the present invention provides a nucleic acid probe for the detection of Ocrobacrum antropy bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 151 to 155.

In another aspect (10-iii), the present invention provides a composition comprising a nucleic acid probe for detecting the bacterium Okractrum, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 151 to 155.

In another aspect (10-iv), the present invention provides a composition comprising (a) a nucleic acid probe for the detection of Ocrobacrum antropy bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 151 to 155; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying the okrobacterium antropy bacteria in a biological sample.

In another aspect (10-v), the present invention provides a DNA in which a nucleic acid probe for detecting Ocrobacrum antropy, including a nucleic acid molecule comprising any one of SEQ ID NOs: 151 to 155, is immobilized on a solid support. Provide chips.

In another aspect (10-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for the detection of Ocrobacrum antropy bacteria, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 151 to 155 Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying the Okrobacrum antropy bacteria in the biological sample.

In another aspect (11-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of peptostreptococcus prevoti bacteria:

ACTAGGGAGAGCTCA (Pep002, SEQ ID NO: 166);

GCTTAGTAAAGCAAG (Pep003, SEQ ID NO: 167);

TACTAACATGTGACC (pep004, SEQ ID NO: 168);

AAGCAGAGAGAGCTC (Pep005, SEQ ID NO: 169);

CGAACGGTGAGGCCG (Pep006, SEQ ID NO: 170);

GTAGATGTTGATTAT (Pep007, SEQ ID NO: 171);

GTCGAATCATCTGGG (Pep23S02, SEQ ID NO: 172); or

TAAAACGTATCGGAT (Pep23S03, SEQ ID NO: 173).

In another aspect (11-ii), the present invention provides a nucleic acid probe for detecting peptostreptococcus prevoti bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 166 to 173.

In another aspect (11-iii), the present invention provides a composition comprising a nucleic acid probe for detecting peptostreptococcus prevoti bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 166 to 173.

In another aspect (11-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting peptostreptococcus prevoti bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 166 to 173; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying peptostreptococcus prevoti bacteria in biological samples.

In another aspect (11-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting peptostreptococcus prevoti bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 166 to 173 is fixed to a solid support. To provide.

In another aspect (11-vi), the invention provides for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs and ; (c) a composition comprising a nucleic acid probe for detecting peptostreptococcus prevoti bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 166 to 173 in the polynucleic acid of steps (a) and (b); Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying peptostreptococcus prevoti bacteria in the biological sample.

In another aspect (12-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the 23S rRNA of Popiromonas genjivalis bacterium:

AGTTGGTGAGCGAGC (Por 003, SEQ ID NO: 178); or

CTGAGCTGTCGTGCA (Por23S08, SEQ ID NO: 179).

In another aspect (12-i-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Popiromonas jinjivalis bacterium:

GTTTTTGTGAGTGGA (Por 001, SEQ ID NO: 180); or

TGATGGGTGGGGTTG (Por 002, SEQ ID NO: 181).

In another aspect (12-ii), the present invention provides a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 178 to 181.

In another aspect (12-iii), the present invention provides a composition comprising a nucleic acid probe for detection of P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 178 to 181.

In another aspect (12-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 178 to 181; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Popiromonas zybacilli bacteria in a biological sample.

In another aspect (12-v), the present invention relates to a DNA in which a nucleic acid probe for detecting P. pylorimonas genjivalis bacteria, comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 178 to 181, is immobilized on a solid support. Provide chips.

In another aspect (12-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a nucleic acid probe for detecting P. pylorimonas genjivalis bacterium comprising the nucleic acid molecule of any one of the above SEQ ID NOs: 178 to 181 as the polynucleic acid of step (a) and (b); Contacting the composition under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Popiromonas genjivalis bacteria in the biological sample.

In another aspect (13-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the Peptostreptococcus aeravius bacterium 23S rRNA:

AGGAGGAAGAGAAAG (P.anae003, SEQ ID NO: 186); or

GCGAAAGGAAAAGAG (P.anae004, SEQ ID NO: 187).

In another aspect (13-ii), the present invention provides a nucleic acid probe for the detection of a peptostreptococcus aeravius bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 186 or 187.

In another aspect (13-iii), the present invention provides a composition comprising a nucleic acid probe for detecting peptostreptococcus aerovirus bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 186 or 187.

In another aspect (13-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting a peptostreptococcus aeravius bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 186 to 187; (b) forward and reverse primer pairs optionally used to amplify polynucleic acids in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying peptostreptococcus aerobic bacteria in biological samples.

In another aspect (13-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting peptostreptococcus aeravius bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 186 or 187 is fixed to a solid support. do.

In another aspect (13-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detecting peptostreptococcus aeravius bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 186 or 187 And under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying peptostreptococcus aerobic bacteria in the biological sample.

In another aspect (14-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the Peptostreptococcus magnus 23S rRNA:

CATGCAACGATCCGT (P.magn002, SEQ ID NO: 190).

In another aspect (14-ii), the present invention provides a nucleic acid probe for detecting Peptostreptococcus magnus comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 190.

In another aspect (14-iii), the present invention provides a composition comprising a nucleic acid probe for detecting peptostreptococcus magnus comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 190.

In another aspect (14-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting peptostreptococcus magnus comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 190; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Peptostreptococcus magnus bacteria in a biological sample.

In another aspect (14-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting peptostreptococcus magnus comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 190 is fixed to a solid support.

In another aspect (14-vi), the present invention provides a method of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detecting peptostreptococcus magnus comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 190; Contact; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying peptostreptococcus magnus bacteria in the biological sample.

In another aspect (15-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Fusobacterium necrophorum bacteria:

TTTCGCAGACGTAAG (fnecro01, SEQ ID NO: 193);

GTTTTCTTGCGCTGT (fnecro02, SEQ ID NO: 194);

CCGTATTCATGTCAA (fnecro03, SEQ ID NO: 195);

CTGCAAGCTATTTCG (fnecro05, SEQ ID NO: 196);

CAGACGTAAGCAAAG (fnecro06, SEQ ID NO: 197); or

CCTGTATTGGTAGTT (fnecro07, SEQ ID NO: 198).

In another aspect (15-ii), the present invention provides a nucleic acid probe for detecting Fusobacterium necrophorum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 193 to 198.

In another aspect (15-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Fusobacterium necrophorum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 193 to 198.

In another aspect (15-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Fusobacterium necrophorum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 193 to 198; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Fusobacterium necrophorum bacteria in a biological sample.

In another aspect (15-v), the present invention provides a DNA in which a nucleic acid probe for detecting Fusobacterium necrophorum bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 193 to 198 is immobilized on a solid support. Provide chips.

In another aspect (15-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) amplifying the polynucleic acid with appropriate forward and reverse primer pairs, ; (c) a composition comprising a nucleic acid probe for the detection of Fusobacterium necrophorum bacteria, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 193 to 198 Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Fusobacterium necrophorum bacteria in the biological sample.

In another aspect (16-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the Proteus vulgaris bacterium:

AGAGGAGGCTTAGTG (Pvulga04, SEQ ID NO: 199).

In another aspect (16-i-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the ITS of Proteus vulgaris:

ATACGTGTTATGTGC (Pvulga01, SEQ ID NO: 200).

In another aspect (16-ii), the present invention provides a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 199 or 200.

In another aspect (16-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 199 or 200.

In another aspect (16-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 199 or 200; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Proteus vulgaris in a biological sample.

In another aspect (16-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 199 or 200 is fixed to a solid support.

In another aspect (16-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) is subjected to appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detecting Proteus vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 199 or 200. Contact at; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Proteus vulgaris in said biological sample.

In another aspect (17-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequence derived from the Enterobacter aerogenes 23S rRNA:

TTCCGACGGTACAGG (e.aero01, SEQ ID NO: 207);

GTATCAGTAAGTGCG (e.aero03, SEQ ID NO: 208); And

TTATCCAGGCAAATC (e.aero04, SEQ ID NO: 209).

In another aspect (17-ii), the present invention provides a nucleic acid probe for detecting Enterobacter aerogenes bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 207 to 209.

In another aspect (17-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Enterobacter aerogenes bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 207 to 209.

In another aspect (17-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Enterobacter aerogenes comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 207 to 209; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Enterobacter aerogenes in a biological sample.

In another aspect (17-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Enterobacter aerogenes comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 207 to 209 is fixed to a solid support. To provide.

In another aspect (17-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Enterobacter aerogenes bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 207 to 209 in the polynucleic acid of steps (a) and (b); Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Enterobacter aerogenes in the biological sample.

In another aspect (18-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from Streptococcus mutans bacteria:

TAGGTATTCTCTCCT (S.mutan001, SEQ ID NO: 212).

In another aspect (18-ii), the present invention provides a nucleic acid probe for detecting Streptococcus mutans bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 212.

In another aspect (18-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Streptococcus mutans bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 212.

In another aspect (18-iv), the present invention provides a composition comprising a nucleic acid probe for detecting Streptococcus mutans bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 212; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Streptococcus mutans bacteria in a biological sample.

In another aspect (18-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Streptococcus mutans bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 212 is fixed to a solid support.

In another aspect (18-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detecting Streptococcus mutans comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 212. Contact; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Streptococcus mutans bacteria in the biological sample.

In another aspect (19-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of the Kinzela Kingap strain:

GGTTAGCAAACTGTT (k.king02, SEQ ID NO: 218);

CCAGTAGGTGGAAAG (k.king03, SEQ ID NO: 219);

AACACCGAGACGTGA (k.king04, SEQ ID NO: 220); or

TATTCAATGCGATGG (k.king09, SEQ ID NO: 221).

In another aspect (19-ii), the present invention provides a nucleic acid probe for detection of Kinzelella kin gap bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 218 to 221.

In another aspect (19-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Kinzelella kin gap bacteria comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 218 to 221.

In another aspect (19-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting the Kinzelella kin gap bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 218 to 221; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Kinzelella Kingap bacteria in a biological sample.

In another aspect (19-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting a Kinzelella kingap bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 218 to 221 is fixed to a solid support. do.

In another aspect (19-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detecting the Kinzelella kin gap bacteria comprising the nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 218 to 221. And contacting under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Kinzelella kin gap bacteria in the biological sample.

In another aspect (20-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from Bacterides obatus 23S rRNA:

TAGAAGGAAGCATTC (b.ovatus01, SEQ ID NO: 227);

CCAATGTTGTTACGG (b.ovatus02, SEQ ID NO: 228); or

TGTAGGACCACGATG (b.ovatus05, SEQ ID NO: 229).

In another aspect (20-ii), the present invention provides a nucleic acid probe for the detection of Bacterides obatus bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 227 to 229.

In another aspect (20-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Bacteroides obatus, including a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 227 to 229.

In another aspect (20-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting Bacteroides obatus comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 227 to 229; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a previously formed hybrid, thereby providing a kit for detecting and identifying Bacteroides obatus bacteria in a biological sample.

In another aspect (20-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Bacterides obatus bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 227 to 229 is fixed to a solid support. To provide.

In another aspect (20-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Bacterides obatus, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 227 to 229; Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Bacteroides obatatus bacteria in the biological sample.

In another aspect (21-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from Bacteroides tetaiotamicron bacteria:

GCTAACGCAGGGAAC (b.thetaio006, SEQ ID NO: 234).

In another aspect (21-ii), the present invention provides a nucleic acid probe for the detection of Bacteroides tetaotaomicron bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 234.

In another aspect (21-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Bacteroides tetaotaomicron bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 234.

In another aspect (21-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for the detection of Bacteroides tetaiotamicron bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 234; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Bacteroides tetaotaomicron bacteria in a biological sample.

In another aspect (21-v), the present invention provides a DNA chip comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 234.

In another aspect (21-vi), the present invention relates to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for the detection of Bacteroides tetaotaomicron bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 234 And under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Bacteroides tetaotaomicron bacteria in the biological sample.

In another aspect (22-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the Clostridium difficill bacillus:

GTTCGTCCGCCCCTG (C.diffc005, SEQ ID NO: 240).

In another aspect (22-ii), the present invention provides a nucleic acid probe for detecting Clostridium difficile bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 240.

In another aspect (22-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Clostridium difficile bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 240.

In another aspect (22-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Clostridium diffyl bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 240; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Clostridium difficill bacteria in a biological sample.

In another aspect (22-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Clostridium difficile including a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 240 is fixed to a solid support.

In another aspect (22-vi), the present invention provides a process for (a) isolating and / or concentrating a polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing conditions of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for the detection of Clostridium diffyl bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 240; Contacting under; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Clostridium difficile bacteria in the biological sample.

In another aspect (23-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from 23S rRNA of Haemophilus apropylas:

GGTGAAGAACCCACT (H.aphro003, SEQ ID NO: 245).

In another aspect, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from ITS of Haemophilus apropylas:

TGGGAGTGGGTTGTC (H.aphro001, SEQ ID NO: 246); or

TAACAAACCGGAAAC (H.aphro002, SEQ ID NO: 247).

In another aspect (23-ii), the present invention provides a nucleic acid probe for detecting Haemophilus apropyl bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 245 to 247.

In another aspect (23-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Haemophilus apropyl bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 245 to 247.

In another aspect (23-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting Haemophilus apropyl bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 245 to 247; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Haemophilus apropyl bacteria in a biological sample.

In another aspect (23-v), the present invention provides a DNA in which a nucleic acid probe for detecting Haemophilus apropylas, including the nucleic acid molecule comprising any one of SEQ ID NOs: 245 to 247, is immobilized on a solid support. Provide chips.

In another aspect (23-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Haemophilus apropyl bacterium, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 245 to 247 Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Haemophilus apropyl bacteria in the biological sample.

In another aspect (24-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from 23S rRNA of Neisseria gonohaea:

TATCAAAGTAGGGAT (N. gono005, SEQ ID NO: 254); or

AGTCAACGGGTAGGT (N.gono006, SEQ ID NO: 255).

In another aspect (24-i-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from ITS of Neisseria gonohaea:

AACCTCTCGCAAGAG (N.gono002, SEQ ID NO: 256)

In another aspect (24-ii), the present invention provides a nucleic acid probe for detecting Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 254 to 256.

In another aspect (24-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 254 to 256.

In another aspect (24-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 254 to 256; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or a component necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Neisseria gonohea bacteria in a biological sample.

In another aspect (24-v), the present invention provides a DNA chip in which a nucleic acid probe for detection of Neisseria gonohea bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 254 to 256 is fixed to a solid support. to provide.

In another aspect (24-Vi), the present invention provides for (a) separating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of step (a) and (b) is suitable for a composition comprising a nucleic acid probe for detection of Neisseria gonohaea comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 254-256. Contacting under hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Neisseria gonohea bacteria in the biological sample.

In another aspect (25-i-a), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from 23S rRNAs of E.ella corodens:

GGATAGGAGAAGGAA (E.corro005, SEQ ID NO: 262); or

ACTCATCATCGATCC (E.corro006, SEQ ID NO: 263).

In another aspect (25-i-b), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of E.ella corodens:

AGTCGTAGAGCGGAG (E.corro001, SEQ ID NO: 264).

In another aspect (25-ii), the present invention provides a nucleic acid probe for detecting the bacteria of E.ella corodens comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 262 to 264.

In another aspect (25-iii), the present invention provides a composition comprising a nucleic acid probe for the detection of E.ella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 262 to 264.

In another aspect (25-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting E.ella corodens bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 262 to 264; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying E.ella corodens bacteria in a biological sample.

In another aspect (25-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting E.ella corodens, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 262 to 264, is immobilized on a solid support. To provide.

In another aspect (25-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting E.ella corodens bacteria comprising the nucleic acid molecule of any one of SEQ ID NOs: 262 to 264, using the polynucleic acid of steps (a) and (b); Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying E.ella corodens in the biological sample.

In another aspect (26-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the Bacteroides buccus 23S rRNA:

AGTCAGCGTCGAAGG (b.vulga03, SEQ ID NO: 268); or

CGAATGCGCATCAGT (b.vulga07, SEQ ID NO: 269).

In another aspect (26-ii), the present invention provides a nucleic acid probe for detecting Bacteroides vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 268 or 269.

In another aspect (26-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Bacteroides vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 268 or 269.

In another aspect (26-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting Bacteroides vulgaris comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 268 or 269; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Bacteroides vulgaris in a biological sample.

In another aspect (26-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Bacteroides buccus bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 268 or 269 is fixed to a solid support. .

In another aspect (26-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Bacteroides vulgaris comprising the polynucleic acid of steps (a) and (b) comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NO: 268 or 269; Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Bacteroides vulgaris in the biological sample.

In another aspect (27-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from 23S rRNA of Branhamela catarrhalis fungus:

ATATCTTCGCGCTGT (B.catar005, SEQ ID NO: 280).

In another aspect (27-ii), the present invention provides a nucleic acid probe for detection of Branhamella catarrhalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 280.

In another aspect (27-iii), the present invention provides a composition comprising a nucleic acid probe for detection of Branhamella catarrhalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 280.

In another aspect (27-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detection of Branhamella catarrhalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 280; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component required to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Branhamella catarrhalis bacteria in a biological sample.

In another aspect (27-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Branhamella catarrhalis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 280 is fixed to a solid support.

In another aspect (27-vi), the present invention provides a process for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detecting Branhamella catarrhalis comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 280 in the polynucleic acid of steps (a) and (b) Contacting under; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Branhamella catarrhalis bacteria in the biological sample.

In another aspect 28-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the ITS of Suterella wazworthensis;

TTCGGGTCCGTAATT (Swad02, SEQ ID NO: 292);

AATCAAGGCCGAGGC (Swad03, SEQ ID NO: 293); or

GCCGAGGCGTGATGA (Swad04, SEQ ID NO: 294).

In another aspect (28-ii), the present invention provides a nucleic acid probe for detecting Suterella wazworthensis comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 292 to 294.

In another aspect (28-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Suterella wazworthensis comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 292 to 294.

In another aspect (28-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting Suterella wazworthissis comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 292 to 294; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Suterella wazworthensis bacteria in a biological sample.

In another aspect (28-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Suterella wazworthensis comprising a nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 292 to 294 is immobilized on a solid support. To provide.

In another aspect (28-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Suterella wazworthensis, the polynucleic acid of steps (a) and (b) comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 292 to 294; Contacting under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Suterella wazworthis bacteria in the biological sample.

In another aspect (29-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the bacterium 23S rRNA of Actinomyces Israel:

AACCTGGCTGGTGGC (Aciil, SEQ ID NO: 296).

In another aspect (29-ii), the present invention provides a nucleic acid probe for detecting an bacterium of Extinomyse Israel comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 296.

In another aspect (29-iii), the present invention provides a composition comprising a nucleic acid probe for detecting an bacterium of Extinomyse Israel comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 296.

In another aspect (29-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for detecting an bacterium of Extinomyse Israel comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 296; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying bacteria by actinomyces Israel in biological samples.

In another aspect (29-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting an actinomyces Israeli bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 296 is fixed to a solid support.

In another aspect (29-vi), the present invention provides a process for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detecting the bacterium Extinomyse Israel comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 296 Contacting under conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying bacteria in said biological sample.

In another aspect (30-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Staphylococcus epidermidis bacteria:

GATAGATAACAGGTG (SeM01, SEQ ID NO: 299); or

AGGGTTCACGCCCAG (SeM02, SEQ ID NO: 300).

In another aspect (30-ii), the present invention provides a nucleic acid probe for detecting Staphylococcus epidermidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 299 or 300.

In another aspect (30-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Staphylococcus epidermidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 299 or 300.

In another aspect (30-iv), the present invention (a) composition comprising a nucleic acid probe for the detection of Staphylococcus epidermidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 299 or 300; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, to provide a kit for detecting and identifying Staphylococcus epidermidis bacteria in a biological sample.

In another aspect (30-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Staphylococcus epidermidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 299 or 300 is fixed to a solid support. do.

In another aspect (30-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detecting Staphylococcus epidermidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 299 or 300 And under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Staphylococcus epidermidis bacteria in the biological sample.

In another aspect (31-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from 23S rRNAs of the bacterium Sephacia:

TTGTTAGCCGAACGC (Bur23, SEQ ID NO: 304); or

GGGTGTGGCGCGAGC (Bur01, SEQ ID NO: 305).

In another aspect (31-ii), the present invention provides a nucleic acid probe for the detection of Bulcoderia cephacia bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 304 or 305.

In another aspect (31-iii), the present invention provides a composition comprising a nucleic acid probe for the detection of Bulcoderia cephacia bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 304 or 305.

In another aspect (31-iv), the present invention provides a composition comprising (a) a nucleic acid probe for the detection of Bulcoderia sefacia bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 304 or 305; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Bulcoderia cephacia bacteria in a biological sample.

In another aspect (31-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting a Bulcoderia cephacia comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 304 or 305 is fixed to a solid support. .

In another aspect (31-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for the detection of Bulcoderia cephacia bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 304 or 305; and Contacting under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Bulcoderia cephacia bacteria in the biological sample.

In another aspect (32-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from Salmonella enteritidis bacteria 23S rRNA:

GCCTGAATCAGCATG (Styp23, SEQ ID NO: 307).

In another aspect (32-ii), the present invention provides a nucleic acid probe for the detection of Salmonella enteritidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 307.

In another aspect (32-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Salmonella enteritidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 307.

In another aspect (32-iv), the present invention provides a composition comprising a nucleic acid probe for detecting Salmonella enteritidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 307; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Salmonella enteritidis bacteria in a biological sample.

In another aspect (32-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Salmonella enteritidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 307 is fixed to a solid support.

In another aspect (32-vi), the present invention provides a method of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for the detection of Salmonella enteritidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 307; Contact; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Salmonella enteritidis bacteria in the biological sample.

In another aspect (33-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from 23S rRNA of Escherichia coli.

CTGAAGCGACAAATG (E coli 003, SEQ ID NO: 312).

In another aspect (33-ii), the present invention provides a nucleic acid probe for detecting Escherichia coli, including a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 312.

In another aspect (33-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Escherichia coli, including a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 312.

In another aspect (33-iv), the present invention provides a composition comprising a nucleic acid probe for detecting Escherichia coli, comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 312; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Escherichia coli bacteria in a biological sample.

In another aspect (33-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Escherichia coli comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 312 is fixed to a solid support.

In another aspect (33-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detection of Escherichia coli comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 312. Contact; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Escherichia coli bacteria in the biological sample.

In another aspect 34-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the 23S rRNA of the Crevciella pneumoniae bacterium:

GTACACCAAAATGCA (Kpneu 23, SEQ ID NO: 317); or

GCTGAGACCAGTCGA (K.pneu002, SEQ ID NO: 318).

In another aspect (34-ii), the present invention provides a nucleic acid probe for detecting Crebesciella pneumoniae comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 317 or 318.

In another aspect (34-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Crebesciella pneumoniae comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 317 or 318.

In another aspect (34-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Crebesciella pneumoniae comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 317 or 318; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying CrebSiela pneumoniae in a biological sample.

In another aspect (34-v), the present invention provides a nucleic acid probe for detecting Crebesciella pneumoniae comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 317 to 318 to a solid support. Provide a DNA chip.

In another aspect 34-vi, the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of step (a) and (b) is suitable for a composition comprising a nucleic acid probe for the detection of the Crebessiella pneumoniae comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 317 or 318. Contacting under hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying the Crebeciella pneumoniae bacteria in the biological sample.

In another aspect (35-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from 23S rRNA of Proteus mirabilis:

GTTACCAACAATCGT (Pm, SEQ ID NO: 321);

GGCGACGGTCGTCCC (Pm002, SEQ ID NO: 322);

GATGACGAACCACCA (Pm003, SEQ ID NO: 323); or

TGAAGCAATTGATGC (Pm004, SEQ ID NO: 324).

In another aspect (35-ii), the present invention provides a nucleic acid probe for detecting Proteus mirabilis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 321 to 324.

In another aspect (35-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Proteus mirabilis, which comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 321 to 324.

In another aspect (35-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Proteus mirabilis comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 321 to 324; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Proteus mirabilis bacteria in a biological sample.

In another aspect (35-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Proteus mirabilis, including a nucleic acid molecule comprising any one of the nucleotide sequences of SEQ ID NOs: 321 to 324, is immobilized on a solid support. to provide.

In another aspect (35-vi), the present invention provides a method for (a) isolating and / or concentrating a polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with an appropriate forward and reverse primer pair; (c) the polynucleic acid of step (a) and (b) is suitable for a composition comprising a nucleic acid probe for detecting Proteus mirabilis, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 321 to 324. Contacting under hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Proteus mirabilis bacteria in the biological sample.

In another aspect 36-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the Streptococcus pneumoniae 23S rRNA:

TAGGACTGCAATGTG (StreppM, SEQ ID NO: 328).

In another aspect (36-ii), the present invention provides a nucleic acid probe for detecting Streptococcus pneumoniae comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 328.

In another aspect (36-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Streptococcus pneumoniae comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 328.

In another aspect (36-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Streptococcus pneumoniae comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 328; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Streptococcus pneumoniae bacteria in a biological sample.

In another aspect (36-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Streptococcus pneumoniae comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 328 is fixed to a solid support.

In another aspect 36-vi, the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detecting Streptococcus pneumoniae comprising the polynucleic acid of step (a) and (b) comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 328 Contacting under; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Streptococcus pneumoniae bacteria in the biological sample.

In another aspect (37-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 23S rRNA of Vibrio Bernique Picus:

GTTGACGATGCATGT (Vvul02, SEQ ID NO: 333).

In another aspect (37-ii), the present invention provides a nucleic acid probe for the detection of Vibrio Bernickus bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 333.

In another aspect (37-iii), the present invention provides a composition comprising a nucleic acid probe for the detection of Vibrio Bernique Picus bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 333.

In another aspect (37-iv), the present invention provides a composition comprising: (a) a composition comprising a nucleic acid probe for the detection of Vibrio Bernoulcus bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 333; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Vibrio Bernoullican bacteria in a biological sample.

In another aspect (37-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting a Vibrio Bernique Picus bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 333 is fixed to a solid support.

In another aspect (37-vi), the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for the detection of Vibrio Bernique Picus bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 333. Contact; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Vibrio Bernoullican bacteria in the biological sample.

In another aspect 38-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from Pseudomonas aeruginosa 23S rRNA:

GAAGTGCCGAGCATG (P.aeru001, SEQ ID NO: 339); or

GGATCTTTGAAGTGA (Pa03, SEQ ID NO: 340).

In another aspect (38-ii), the present invention provides a nucleic acid probe for detecting Pseudomonas aeruginosa bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 339 or 340.

In another aspect (38-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Pseudomonas aeruginosa bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 339 or 340.

In another aspect (38-iv), the present invention provides a composition comprising a nucleic acid probe for detecting Pseudomonas aeruginosa bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 339 or 340; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Pseudomonas aeruginosa bacteria in a biological sample.

In another aspect (38-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Pseudomonas aeruginosa comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 339 or 340 is fixed to a solid support.

In another aspect 38-vi, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for the detection of Pseudomonas aeruginosa bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 339 or 340 Contacting under conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Pseudomonas aeruginosa bacteria in the biological sample.

In another aspect 39-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequence derived from the 23S rRNA of Eromonas hydrophila:

GGCGCCTCGGTAGGG (Ah, SEQ ID NO: 347).

In another aspect (39-ii), the present invention provides a nucleic acid probe for the detection of E. hydronas bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 347.

In another aspect (39-iii), the present invention provides a composition comprising a nucleic acid probe for the detection of E. hydronas bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 347.

In another aspect (39-iv), the present invention provides a composition comprising (a) a nucleic acid probe for the detection of E. hydronas bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 347; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying the E. hydromonas bacteria in a biological sample.

In another aspect (39-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting an E. monella hydrophilic bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 347 is fixed to a solid support.

In another aspect 39-vi, the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) amplifying the polynucleic acid in an appropriate ; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for the detection of Eromonas hydrophila comprising the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 347. Contact; (d) detecting the hybrid formed in step (c); (e) identifying the strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying the E. hydronas bacteria in the biological sample.

In another aspect (40-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from 23S rRNA of Listeria monocytogenes fungus:

GGGTGCAAGCCCGAG (LM, SEQ ID NO: 354).

In another aspect (40-ii), the present invention provides a nucleic acid probe for detecting Listeria monocytogenes bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 354.

In another aspect (40-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Listeria monocytogenes bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 354.

In another aspect (40-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Listeria monocytogenes bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 354; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Listeria monocytogenes bacteria in a biological sample.

In another aspect (40-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Listeria monocytogenes bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 354 is fixed to a solid support.

In another aspect (40-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with appropriate forward and reverse primer pairs; (c) the polynucleic acid of steps (a) and (b) under appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for detecting Listeria monocytogenes bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 354. Contact; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Listeria monocytogenes bacteria in the biological sample.

In another aspect (41-i), the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following nucleotide sequences derived from the 23S rRNA of Enterococcus pesium bacterium:

TTACGATTGTGTGAA (E.faecium002, SEQ ID NO: 359); or

ATAGCACATTCGAGG (E.faecium003, SEQ ID NO: 360).

In another aspect (41-ii), the present invention provides a nucleic acid probe for detecting enterococcus pesium bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 359 or 360.

In another aspect (41-iii), the present invention provides a composition comprising a nucleic acid probe for detecting enterococcus bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 359 or 360.

In another aspect (41-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Enterococcus pesium bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 359 or 360; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying enterococcus bacterium in a biological sample.

In another aspect (41-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting enterococcus bacterium comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 359 or 360 is fixed to a solid support.

In another aspect (41-vi), the present invention provides a method for (a) isolating and / or enriching polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for the detection of Enterococcus pesium bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 359 or 360 And under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Enterococcus pesium bacteria in the biological sample.

In another aspect 42-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from 23S rRNA of Staphylococcus aureus fungus:

GATTGCACGTCTAAG (S.aureus 004, SEQ ID NO: 365);

AATCCGGTACTCGTT (S.aureus 005, SEQ ID NO: 366); or

TCTTCGAGTCGTTGA (Saure03 (Saureus03), SEQ ID NO: 367).

In another aspect (42-ii), the present invention provides a nucleic acid probe for detecting Staphylococcus aureus, including a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 365 to 367.

In another aspect (42-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Staphylococcus aureus, comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 365 to 367.

In another aspect (42-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Staphylococcus aureus comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 365 to 367; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Staphylococcus aureus bacteria in a biological sample.

In another aspect (42-v), the present invention provides a DNA in which a nucleic acid probe for detecting Staphylococcus aureus comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 365 to 367 is fixed to a solid support. Provide chips.

In another aspect 42-vi, the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) a composition comprising a nucleic acid probe for detecting Staphylococcus aureus, wherein the polynucleic acid of steps (a) and (b) comprises a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 365 to 367 Contacting with appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Staphylococcus aureus bacteria in the biological sample.

In another aspect 43-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from 23S rRNA of Neisseria meningitidis bacteria:

AGATGTGAGAGCATC (Nm002, SEQ ID NO: 377).

In another aspect (43-ii), the present invention provides a nucleic acid probe for detection of Neisseria meningitidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 377.

In another aspect (43-iii), the present invention provides a composition comprising a nucleic acid probe for detection of Neisseria meningitidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 377.

In another aspect (43-iv), the present invention (a) a composition comprising a nucleic acid probe for the detection of bacteria Neisseria meningitidis comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 377; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Neisseria meningitidis bacteria in biological samples.

In another aspect (43-v), the present invention provides a DNA chip in which a nucleic acid probe for detection of Neisseria meningitidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 377 is fixed to a solid support.

In another aspect (43-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detection of Neisseria meningitidis bacteria comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 377 Contacting under conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Neisseria meningitidis bacteria in the biological sample.

In another aspect 44-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the Legionella pneumophila 23S rRNA:

TGGAGAGCATTTTAT (L.pneu011, SEQ ID NO: 383);

GTGATTTTGAGGTGA (L.pneu012, SEQ ID NO: 384); or

AGATGGTAAAGAAGA (L.pneu013, SEQ ID NO: 385).

In another aspect (44-ii), the present invention provides a nucleic acid probe for detecting Legionella pneumophila, comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 383 to 385.

In another aspect (44-iii), the present invention provides a composition comprising a nucleic acid probe for detecting Legionella pneumophila comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 383 to 385.

In another aspect (44-iv), the present invention provides a composition comprising (a) a nucleic acid probe for detecting Legionella pneumophila comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 383 to 385; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for detecting and identifying Legionella pneumophila in a biological sample.

In another aspect (44-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Legionella pneumophila comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 383 to 385 is immobilized on a solid support. to provide.

In another aspect 44-vi, the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization of the polynucleic acid of steps (a) and (b) with a composition comprising a nucleic acid probe for detection of Legionella pneumophila comprising a nucleic acid molecule comprising any one of SEQ ID NOs: 383 to 385 And under washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Legionella pneumophila in the biological sample.

In another aspect 45-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 18S rRNA of Candida albicans fungus:

TGGTAGCCATTTATG (C.alic 001, SEQ ID NO: 396);

CTGGACCAGCCGAGC (C.alic 003, SEQ ID NO: 397);

TCAAGAACGAAAGTT (C.alic 006, SEQ ID NO: 398);

AAGGATTGACAGATT (C.alic 007, SEQ ID NO: 399); or

CATTAATCAAGAACG (C.alic 008, SEQ ID NO: 400).

In another aspect (45-ii), the present invention provides a nucleic acid probe for the detection of Candida albicans fungus comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 396 to 400.

In another aspect (45-iii), the present invention provides a composition comprising a nucleic acid probe for the detection of Candida albicans fungi comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 396-400.

In another aspect (45-iv), the present invention provides a composition comprising a nucleic acid probe for detecting Candida albicans fungi comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 396 to 400; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, providing a kit for detecting and identifying Candida albicans fungi in a biological sample.

In another aspect (45-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Candida albicans fungi comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 396 to 400 is immobilized on a solid support. do.

In another aspect (45-vi), the present invention provides a method for (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) the polynucleic acid of step (a) and (b) is suitable for a composition comprising a nucleic acid probe for detecting Candida albicans fungus comprising a nucleic acid molecule comprising the nucleotide sequence of any one of SEQ ID NOs: 396 to 400. Contacting under hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Candida albicans fungi in the biological sample.

In another aspect 46-i, the present invention provides an isolated nucleic acid molecule selected from the group consisting of nucleic acid molecules comprising the following base sequence derived from the 18S rRNA of Candida glabrata fungus:

CTGGAATGCACCCGG (C.glab 001, SEQ ID NO: 404); or

TGGCTTGGCGGCGAA (C.glab 003, SEQ ID NO: 405).

In another aspect 46-ii, the present invention provides a nucleic acid probe for the detection of Candida glabrata fungi comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 404 or 405.

In another aspect (46-iii), the present invention provides a composition comprising a nucleic acid probe for the detection of Candida glabrata fungi comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 404 or 405.

In another aspect (46-iv), the present invention provides a composition comprising a nucleic acid probe for detecting Candida glabrata fungi comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 404 or 405; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a previously formed hybrid, providing a kit for detecting and identifying Candida glabrata fungi in a biological sample.

In another aspect (46-v), the present invention provides a DNA chip in which a nucleic acid probe for detecting Candida glabrata fungi comprising a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 404 or 405 is fixed to a solid support.

In another aspect 46-vi, the present invention is directed to (a) optionally separating and / or concentrating polynucleic acid present in a biological sample, and (b) optionally amplifying the polynucleic acid with the appropriate forward and reverse primer pairs; (c) appropriate hybridization and washing conditions with a composition comprising a nucleic acid probe for the detection of Candida albicans fungus comprising the nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO: 404 or 405 in the polynucleic acid of steps (a) and (b) Contacting under; (d) detecting the hybrid formed in step (c); (e) identifying a strain present in the sample from the different hybridization signals obtained in step (d), thereby providing a method for detecting and identifying Candida glabrata fungi in the biological sample.

In a further aspect, the present invention provides a composition comprising at least two probes selected from said probes.

In another further aspect, the present invention provides a composition comprising two or more probes selected from the above probes; (b) forward and reverse primer pairs optionally used to amplify polynucleic acid in a biological sample; (c) a buffer or component necessary to produce such a buffer to induce a hybridization reaction between the probe contained in the composition and the polynucleic acid or amplified product thereof present in the biological sample; (d) a solution for washing the hybrid formed under suitable washing conditions or the components necessary to produce such a solution; And (e) optionally means for detecting a hybrid previously formed, thereby providing a kit for simultaneously detecting and identifying two or more of said bacteria in a biological sample.

In a still further aspect, the present invention provides a DNA chip in which at least two probes selected from the probes are fixed to a solid support.

In another further aspect, the present invention provides a method for the preparation of (a) isolating and / or concentrating polynucleic acid, optionally present in a biological sample, and (b) optionally amplifying the polynucleic acid with appropriate forward and reverse primer pairs; (c) contacting the polynucleic acid of steps (a) and (b) with a composition comprising two or more probes selected from the probes under appropriate hybridization and washing conditions; (d) detecting the hybrid formed in step (c); (e) identifying the strains present in the sample from the different hybridization signals obtained in step (d), thereby providing a method of simultaneously detecting and identifying two or more of said bacteria in said biological sample.

A. Definition of terms

The following definitions describe terms and expressions used in other aspects of the invention as described below.

A "isolated" nucleic acid molecule is one that is separated from other nucleic acid molecules present in the natural source of the nucleic acid. For example, with respect to genomic DNA, the term “isolated” includes nucleic acid molecules isolated from chromosomes to which genomic DNA is naturally bound.

"Probe" or "nucleic acid probe" refers to a single-chain oligonucleotide having a base sequence that is sufficiently complementary to the target base sequence to be detected and hybridizes.

"Composition" means that a probe complementary to a bacterial or fungal rRNA may be pure or combined with other probes. In addition, the probe may be combined with a salt or a buffer in a dried state, as a precipitate, in the form of an alcohol solution or an aqueous solution.

"Target" means a nucleic acid molecule from a biological sample having a sequence complementary to any of the probes according to the invention. The target nucleic acid may be single stranded or double stranded DNA (optionally obtained after amplification) or RNA and contains a sequence having at least partial complementarity with at least one probe oligonucleotide.

A "biological sample" is a sample of a clinical sample (eg, juice, saliva, blood, urine, etc.), environmental sample, bacterial colony, contaminated or pure culture, purified nucleic acid, etc., for which a target sequence of interest is to be detected. Point to.

"Polynucleic acid" corresponds to a single-stranded or double-stranded cDNA or genomic DNA or RNA with at least 10, 20, 30, 40 or 50 nucleotides in sequence. Polynucleic acids having a length of 100 or fewer nucleotides are often referred to as oligonucleotides. Single-chain polynucleic acid sequences are always represented from the 5 'end to the 3' end in the present invention.

"Oligonucleotide" generally refers to a nucleotide polymer consisting of about 10 to about 100 nucleotides. However, the length of the nucleotides may be 100 or more or 10 or less.

A “nucleotide” is the basic unit of nucleic acid consisting of phosphate groups, 5-carbosaccharides and nitrogen bases. 5-Tanose in RNA is ribose. The 5-saccharide in DNA is 2-deoxyribose. In the case of 5-nucleotides, the sugars contain hydroxyl groups (-OH) in 5-saccharide-2. The term also includes analogs of these basic units, such as methoxy groups at the 2 position of ribose.

"Homologous" is synonymous with identity, meaning that a polynucleic acid, for example 90% homology, exhibits 90% identical base pairs at the same position in the arrangement of the sequences.

"Hybridization" means the annealing of complementary sequences to a target nucleic acid (the sequence to be detected). The ability of two nucleic acid polymers, including complementary sequences, to find each other and hybridize through base pair interactions is a well known phenomenon.

"Primer" refers to a single stranded DNA oligonucleotide sequence that can serve as a starting point for the synthesis of extension products complementary to the nucleic acid backbone to be replicated. The length and sequence of the primers may be such that they can initiate the synthesis of extension products, preferably consisting of about 5 to 50 nucleotides. The specific length and sequence will be determined by the complexity of the desired DNA or RNA target as well as the conditions of primer use such as temperature and ionic strength.

"Tension" is used to describe the temperature and solvent composition during hybridization and subsequent processing. Under highly tightening conditions only highly complementary nucleic acid hybrids will be formed. In contrast, hybrids do not form when they lack a sufficient degree of complementarity. Thus, the tightening of the assay conditions determines the amount of complementarity required between the two nucleic acid backbones that form the hybrid. Contraction is chosen to maximize the difference in stability between the target and non-target nucleic acids and the hybrids formed and formed.

“Complementarity” is provided by the base sequence of the Japanese chain of DNA or RNA capable of forming hybrid or double-stranded DNA: DNA, RNA: RNA or DNA: RNA via hydrogen bonding between individual stranded Watson-Crick base pairs. It indicates the nature of being. Adenine (A) is usually complementary to thymine (T) or uracil (U) and guanine (G) is usually complementary to cytosine (C).

"Matched" refers to all pairs of two nucleotides that do not form normal Watson-Crick hydrogen bonds in a hybrid.

A "label" refers to any atom or molecule capable of providing a detectable (preferably quantifiable) signal and capable of binding to a nucleic acid. The label can provide a signal detectable by fluorescence, radioactivity, chromaticity, X-ray diffraction or absorption, magnetism, and the like.

A "hybrid" is a complex formed between two single-stranded nucleic acid sequences by Watson-Crick base pairs or non-standard base pairs between complementary bases.

"Probe specificity" refers to the characteristics of a probe to describe its ability to distinguish between target and nontarget sequences. In this regard, the fact that the probe is specific means that the nucleotide sequence hybridizes with a given target sequence and is substantially hybridized with the nontarget sequence or with minimal hybridization with the nontarget sequence. Probe specificity depends on sequence and assay conditions.

"Tm" refers to the temperature at which 50% of the probe is converted from the hybridized form to the unhybridized form.

"Standard strain" refers to a strain that is commercially available or readily available.

Sympathy

In order to produce a nucleic acid probe for the detection of bacteria, it is necessary to have specificity only for each bacterium. For this purpose, a specific probe candidate group for each bacterium is selected. The specific probe candidate group sorts and compares the sequences of all possible bacteria in a line through multiple alignments to separately classify specific sequences present only in each of the bacteria to prepare and select a probe candidate group present therein. Probe candidates are determined within the 23S rRNA gene and / or ITS site in each bacterium for bacteria and within the 18S rRNA gene site for fungi. The specificity of the probe candidate group is first confirmed by comparing the similarities between the bacterial strains through BLAST search, and the strains are applied to the hybridization reaction, and the probes that react only with each bacteria are selected for identification in the candidate group. In addition, the nucleic acid probes selected as described above are adapted to clinical trials involving multiple biological samples to confirm their sensitivity.

The nucleic acid probes selected according to the invention are at least 15 oligonucleotides of oligonucleotide and preferably have at least 70%, 80%, 90% or 95% homology with the full complement sequence of the target to be detected. The length of the oligonucleotide of the nucleic acid probe for detecting and identifying each bacterium according to the present invention may be 50 or more. The nucleotides used in the present invention may also be modified nucleotides such as ribonucleotides, deoxyribonucleotides and nucleotides containing inosine or modified groups, but they must not affect hybridization characteristics.

Probe

Nucleic acid probes of the present invention can be used for all known hybridization techniques for testing the presence or absence of a target nucleic acid in a biological sample for diagnostic purposes, such as point deposition on a filter called dot-blot (MANIATIS et al., Molecular Cloning, Cold Spring Harbor, 1982), a DNA transfer technique called Southern blot (SOUTHERN, EM, J. Mol. Biol., 98, 503 (1975)), and an RNA transfer technique called Nothon blot.

In addition, the nucleic acid probes of the present invention can be used in sandwich hybridization systems that enhance the specificity of nucleic acid probe-based assays. The principle and use of sandwich hybridization in nucleic acid probe-based assays is known (DUNN and HASSEL, Cell, 12: 23-36, 1977; and RNAKI et al., Gene, 21: 77-85, 1983). The sandwich hybridization technique employs a capture probe and / or a detection probe, which can hybridize with two different regions of the target nucleic acid and at least one of them (generally the detection probe) has a region of the target specific for the desired bacterium. May hybridize. Capture probes and detection probes should have at least partially different nucleotide sequences. While direct hybridization assays offer advantageous kinetics, sandwich hybridization is advantageous in that it has a high signal-to-noise ratio. In addition, sandwich hybridization can increase the specificity of nucleic acid probe-based assays. Incubation and subsequent washing steps, which constitute the main step of the sandwich hybridization process, are carried out at constant temperature, about 20-65 ° C., respectively. Nucleic acid hybrids are dependent on the number of hybridized bases (the temperature increases in proportion to the size of the hybrid) and also have a dissociation temperature that is dependent on the nature of the hybridized base and the nature of the adjacent base for each hybridized base. It is known. The hybridization temperature used in the sandwich hybridization technique should be selected below the half-dissociation temperature of the hybrid formed between the given probe and the target of the complementary sequence. This semi-dissociation temperature can be determined by simple routine experimentation.

In addition, the nucleic acid probes of the invention can be used in a competitive hybridization protocol. In competitive hybridization, the target molecule competes with hybrid formation between a particular probe and its complement. The more targets are present, the less hybrid is formed between the probe and its complement. Positive signals indicating the presence of a specific target appear to decrease the hybridization response compared to a system without a target added. In certain embodiments, conveniently labeled specific oligonucleotide probes are hybridized with a target molecule. Subsequently, the mixture is placed in a microtiter dish well immobilized with oligonucleotides complementary to the specific probe, allowing the hybridization to continue. After washing, the hybrid between the complementary oligonucleotide and the probe is preferably quantified according to the label used.

In addition, the nucleic acid probes of the present invention can be used for reversed hybridization (Proc. Natl. Acad. Sci. USA, 86: 6230-6234, 1989). In this case, first, the target sequence can be enzymatically amplified by performing PCR using 5 biotinylated primers. The product amplified in the second step is detected by hybridization with specific oligonucleotides immobilized on a solid support. Reverse hybridization can be carried out without amplification. In such cases, the nucleic acid present in the biological sample must be labeled or modified specifically or nonspecifically by chemical or specific dye addition prior to hybridization.

The nucleic acid probe of the present invention can be included in a kit that can be used to quickly determine the presence or absence of a pathogen of interest in the present invention. The kit includes all the components necessary to assay for the presence of the pathogen. In a conventional concept, a kit may contain a stable preparation of a labeled probe, a hybridization solution in anhydrous or liquid form to induce hybridization of a target and probe nucleic acid, a solution for washing and removing unwanted or unhybridized nucleic acid, and a labeled hybrid. Substrates for detection and optionally instruments for detecting labels.

One particular embodiment of the present invention includes a kit that utilizes the concept of a sandwich assay. The kit includes a first element for collecting a sample at a particular site of a patient, such as a sample scraping tool or patter point, a receiving vial, dispersion and lysis buffer. The second element includes an anhydrous or liquid medium for hybridization between the target and the probe nucleic acid and a medium for washing and removing unhybridized and unwanted forms. The third element comprises a solid support on which an unlabeled nucleic acid probe complementary to a portion of the target nucleic acid is immobilized or bound. In the case of analyzing multiple targets, one or more capture probes specific for their respective rRNAs are applied to different individual regions of the dipstick. The fourth element contains a labeled probe that is complementary to a second, different region of the same rRNA backbone where the fixed and unlabeled nucleic acid probe of the third element hybridizes. Here, the nucleic acid probe includes a combination of the probe either in anhydrous form such as lyophilized nucleic acid or in precipitate form such as alcohol precipitated nucleic acid or as a buffer. Any known label labeled may be possible. For example, the probe can be biotinylated by conventional means and the presence of the biotinylated probe is visually noticed when the avidin bound to an enzyme such as horseradish peroxidase is added and then reacted with the peroxidase. Detection can be made by contacting with a substrate that can be monitored or monitored using a colorimeter or spectrometer. Such labeling methods and labels of other enzyme forms have the advantage of being economical, highly sensitive and relatively safe compared to radiolabeling methods. The finished product of the assay kit includes various reagents for the detection of labeled probes and those included in other kits, such as instructions, positive and negative controls, and containers for mixing and reacting the various components.

DNA  chip

In addition, the nucleic acid probe of the present invention is used as a gene chip. A preferred embodiment of the present invention provides a DNA chip in which the nucleic acid probe of the present invention is immobilized on a solid support. A DNA chip is a high density accumulation of fragments of several nucleotide sequences on a small substrate and is used to detect DNA of an unknown sample by hybridization between DNA immobilized on a substrate and an unknown DNA sample complementary thereto. The substrate on which the probe is to be fixed is made of an inorganic material such as glass or silicon, or a polymer material such as acrylic, polyethylene terephtalate (PET), polystylene, polycarbonate, polypropylene, etc. The surface of the substrate may be flat or have a plurality of holes. The probe is fixed either covalently to the substrate at either 5 'or 3'. The immobilization method is a conventional technique, for example using an electrostatic force or by attaching an amine group on the synthesized oligo to an aldehyde coated slide to induce bonding between the two, or on an amine group coated slide or L-lysine It can be done by integrating on this coated slide or on a slide with a nitrocellulose membrane coated. In one embodiment of the present invention, when the probe is synthesized, a base having an amino residue in the 3 'position is inserted to covalently bond to a glass plate coated with an aldehyde residue.

Fixing and arranging different probes on a substrate surface uses methods such as pin microarrays, inkjets, photolithography, electrical arrays, and the like. In one embodiment of the present invention by using a microarrayer prepared according to a known method in a state in which the probe is dissolved in a buffer solution (Yoon et al, J. Microbiol. Biotechnol., 10 (1), 21- 26, 2000). The principle of microarrays is that the microfabricated pins carry DNA from the plate and transfer it to the same location specified by the computer on the substrate. Between the amine group on the 3 'position of the probe and the aldehyde group coated on the glass plate under the condition that the humidity of about 45% to 65%, preferably 50% to 55% is maintained for fixing the probe transferred by the microlayer. In order to facilitate the reaction of the reaction is induced for 1 hour or more, and left for 6 hours or more to fix the DNA probe.

If necessary to detect cells derived from a living organism or the organism itself, these cells may be partially or completely lysed by chemical and / or physical methods to facilitate access to the RNA and / or DNA of those cells and Contact. The contact can be carried out on a suitable support such as nitrocellulose, cellulose or nylon filters in a liquid medium or solution. Such contact may occur under optimum conditions, suboptimal conditions or limit conditions, which conditions include the temperature, the reactant concentration, the presence of substances that lower the base pair optimal temperature of the nucleic acid (eg formamide, dimethylsulfoxide and urea) and the reaction volume. And / or the presence of a substance (eg, dextran sulfate, polyethyleneglycol or phenol) to reduce and / or accelerate hybrid formation.

Probe production

Nucleic acid probes can be cloned using conventional cloning methods (Maniatis, T., et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1982) or chemically using commercially available DNA synthesizers. It can be synthesized and obtained in large quantities.

The probe of the present invention can be produced in single strand or double strand according to a conventional method. As a method of obtaining a single chain probe, the most representative example is a synthesis by a DMT (dimethoxytrityl) off method in an automated synthesizer, subjected to a deprotection reaction, and then a probe composed of a desired number of bases. The probe thus prepared can be attached to a fluorescent substance such as fluorescein isothiocyanate (FITC) at one end of the strand to confirm the presence of a specific nucleic acid. Another method is to make a probe having a nucleotide sequence complementary to the DNA of a Japanese chain, and the primer is hybridized to the DNA of the template, and the Klenow enzyme and the fluorescent substance are attached from the primer. Base (dNTP) is used to synthesize the probe. Since the fluorescent material is attached to the inside of the DNA, it is possible to synthesize a probe having high sensitivity and specificity. As a method of obtaining a double-stranded probe, genomic DNA or plasmid DNA can be cut with a specific restriction enzyme to obtain a probe including a gene or a base portion of a desired portion. Random priming is a method of hybridizing six random hexamers and template DNA, and then synthesizing probes of various lengths to which fluorescent substances are attached. ³² P at the end of the T4 polynucleotide kinase (polynucleotide kinase) (transfer) can also be synthesized by the fluorescent probe attached, DNA cleavage (DNase) I using a DNA cleavage of the double strands, Using this DNA as a template, a probe can be synthesized using DNA polymerase I and a base (dNTP) to which a fluorescent substance is attached. The double-stranded probe is made into a Japanese chain after denaturation and used for hybridization.

Probes of the invention can be advantageously labeled. Any conventional label can be used. Probes can be labeled using radioactive isotopes such as ³² P, ³⁵ S, ¹²⁵ I, ³ H and ¹⁴ C. Radiolabeling can be carried out according to conventional methods such as end labeling the 3 or 5 position with radiolabeled nucleotides, polynucleotide kinases, terminal transferases or ligases. Another method of radiolabeling is to chemically iodide the probe of the present invention, which results in the binding of several ¹²⁵ I atoms onto the probe. As such, when one of the probes of the present invention is labeled as radioactive, radiation is generally detected using autoradiography, liquid scintillation, gamma coefficients, or other conventional methods. In addition, the probes of the present invention may include residues having immune properties (eg, antigens or haptens), residues having specific affinity for some reagents (eg ligands), residues providing detectable enzymatic reactions (eg enzymes, Coenzymes, enzyme substrates or substrates participating in enzymatic reactions) or in combination with residues which provide physical properties of fluorescence, luminescence or absorption at certain wavelengths. Moreover, the antibody which specifically detects the hybrid formed by a probe and a target can be used. Non-radioactive labels can be provided when chemically synthesizing the probe of the present invention. Adenosine, guanosine, cytidine, thymidine and uracil residues readily bind to other chemical residues and allow detection of hybrids formed between the probe or probe and complementary DNA or RNA fragments.

Target

The nucleic acid is extracted from the sample to provide a nucleic acid substrate for use in detecting and identifying bacteria in the biological sample. Nucleic acids can be extracted from various samples using standard techniques or commercially available kits. For example, kits for separating RNA or DNA from tissue samples may be found in Qiagen, Inc. (California, USA) and Stratagene (California, USA). The QIAAMP Blood Kit allows for the separation of DNA from blood as well as bone marrow, body fluids or cell suspensions. The QIAAMP Tissue Kit allows for the separation of DNA from muscles and organs. As a preferred method of determining whether a biological sample contains rRNA or rDNA indicating the presence of the desired strain, nucleic acid is sonicated from strain cells, for example according to the method described in US Pat. No. 5,374,522 to Murphy et al. Can be released. Other known methods of crushing cells include enzyme use, osmotic shock, chemical treatment, and vortexing with glass beads. Other suitable methods for releasing nucleic acids from strains are described in US Pat. No. 5,837,452 to Clark et al. And US Pat. No. 5,364,763 to Kacian et al. Labeled probes may be added after or concurrent with release of the rRNA in the presence of a hybridization promoter and incubated for the time necessary to reach a significant hybridization reaction at the optimal hybridization temperature.

If the target nucleic acid is double stranded, it is preferable to perform denaturation before performing the detection process. Modification of the double-stranded nucleic acid can be carried out by known methods of chemical, physical or enzymatic modification, in particular by heating to an appropriate temperature, a temperature of at least 80 ℃.

In addition, target DNA that hybridizes with the probe can usually be prepared in two ways. First, a method used in Southern blot or Northern blot, genomic DNA or plasmid DNA is cut with a suitable restriction enzyme and subjected to electrophoresis on an agarose gel to separate DNA fragments by size. The second method is to amplify and use DNA of a desired portion using a PCR method. In this case, using the PCR method, the most common PCR that amplifies the forward and reverse primer pairs using the same amount and the asymmetric addition of the forward and reverse primer pairs of the double strand and the single strand Asymmetric PCR (Asymmetric PCR) to obtain bands at the same time, Multiple amplification method (Multiplex PCR) that can be amplified at the same time by putting several primer pairs, After amplification using four specific primers and Ligase (Ligase) Ligase Chain Reaction (LCR) method to determine the amount of fluorescence by enzyme immunoassay, as well as hot start PCR, nest PCR, modified oligonucleotide primer PCR, reverse transcriptase PCR, semi-quantitative reverse transcriptase PCR, Real time PCR, Rapid Amplification of cDNA Ends (SACE), Competitive PCR, Short tandem repeats (S) TR), Single Strand Conformation Polymorphism (SSCP), in situ PCR, and DDRT-PCR (Differential Display Reverse Transcriptase PCR).

As a template for the amplification of certain PCR products, relatively homogeneous samples (e.g. blood, bacterial colonies or cerebrospinal fluid) are known to be more suitable than more complex samples (e.g. urine, saliva or excreta) (Shibata in PCR: The Polymerase). Chain Reaction, Mullis et al., Eds., Birkhauser, Boston (1994), pp, 47-54). Samples containing relatively few copies of the target nucleic acid to be amplified, such as cerebrospinal fluid, can be added directly to the PCR. Blood samples should be specially handled during PCR due to the inhibitory properties of red blood cells, and red blood cells should be removed before using blood for PCR. Many methods are used for this purpose, including for example passing through a CHELEX 100 column (BioRad) and the like using the QIAAMP blood kit. Extracting nucleic acids from saliva requires a preliminary purification process that kills or inhibits growth of other bacterial species other than the desired organism. This purification process is accomplished by treating the sample with N-acetyl-L-cysteine and NaOH. This purification process is only necessary when incubating the saliva sample prior to analysis.

In a preferred embodiment of the present invention, a fragment gene is prepared by using DNA of an isolated sample as a template and performing asymmetric amplification (Asymmetric PCR). The fragment gene is obtained by one polymerase chain reaction by differentiating the ratio of forward and reverse primers at 1: 5. In this case, the primers used are part of a nucleotide sequence existing in 16S rRNA to 23S rRNA in common in bacteria (Pirkko K. et al., Clin. Micorbiol., 36 (8), 2205-2209, 1999).

Primer 1 (sense): TTGTACACACCGCCCGTC (SEQ ID NOs: 406, 1585Fw)

Primer 2 (antisense): F-TTCGCCTTTCCCTCACGGTACT (SEQ ID NOs: 407, 23BR);

Primer 3 (sense): AGTACCGTGAGGGAAAGGGGAA (SEQ ID NOs: 408, 23BFw)

Primer 4 (antisense): F-TGCTTCTAAGCCAACATCCT (SEQ ID NOs: 409, 37R); And

Primer 5 (Sense): AGGATGTTGGCTTAGAAGCA (SEQ ID NO: 410, MS37F)

Primer 6 (antisense): F-CCCGACAAGGAATTTCGCTACCTT (SEQ ID NO: 411, MS38R).

Approximate location maps for these primers are shown in FIG. 1 and F indicates the FITC fluorescent material attached to the 5 'end. In order to identify DNA bound to the probe during PCR, amplification using a 5-FITC attached primer is performed to confirm the binding through fluorescence so that the infection can be identified and the type of infection. In addition, in order to obtain a portion that cannot be amplified by these primers, primers are designed by performing multi-alignment and BLAST by a bioinformatics method.

In the case of fungi, the primers used were part of the nucleotide sequence present in the 18S rRNA of the fungus and designed by the present inventors.

Primer 1 (sense): GTAATTGGAATGAGTACAAT (SEQ ID NO: 412, fun463F)

Primer 2 (antisense): F-CTACGACGGTATCTGATCAT (SEQ ID NO: 413, fun986R).

As a preferred embodiment of the present invention, the PCR reaction was performed in 10X PCR buffer (100 mM Tris-HCl (pH8.3), 500 mM KCl, 15 mM MgCl ₂ ) 5ul, dNTP mixture (dATP, dGTP, dCTP, dTTP 2.5mM) 4ul, 10pmole before Total volume after adding 0.5ul aromatic primer, 2.5ul 10pmole reverse primer, 1ul template DNA (100ng) diluted with 1/10, 0.5ul Taq polymerase (5unit / ul, Takara Shuzo Co., Shiga, Japan) Add water to 50ul. The first denaturation is carried out at 94 ° C. for 7 minutes and the second denaturation at 94 ° C. for 1 minute. Annealing is performed at 52 ° C. for 1 minute and extension at 72 ° C. for 1 minute, and this is repeated 10 times. Thereafter, the third denaturation was performed at 94 ° C for 1 minute, hybridization at 54 ° C for 1 minute, extension at 72 ° C for 1 minute, and this was repeated 30 times. Thereafter, the last extension was performed once for 5 minutes at 72 ° C. The product produced by the PCR reaction is confirmed by agarose gel electrophoresis.

Hybridization  And washing

Hybridization techniques are not specific to the present invention. This technique is generally described in Nucleic Acid Hybridization: A Practical Approach, Ed. Hames, BD and Higgins, SJ, IRL Press, 1987; Gall and Pardue (1969), Proc. Natl. Acad. Sci., USA, 63: 378-383, and John, Burnsteil and Jones (1969) Nature, 223: 582-587).

Hybridization conditions are determined by stringency, i.e. the stringency of the operating conditions. The higher the tightening that hybridization takes place, the more specific the hybridization becomes. Constriction is a function of not only the base composition of the probe / target conjugate but also the degree of mismatch between the two nucleic acids. Constriction may also be a function of hybridization reaction variables such as the concentration and type of ions present in the hybridization solution, the nature and concentration of the denaturant and / or the hybridization temperature. The basis of the conditions under which the hybridization reaction should be carried out depends in particular on the probe used. All these data are well known and the appropriate conditions can be determined by routine experimentation in the individual case. Generally, depending on the length of the probe used, the temperature of the hybridization reaction is about 20 ° C. to 65 ° C., in particular 35 ° C. to 65 ° C., in a saline solution at a concentration of about 0.8 to 1 M.

Hybridization between the labeled oligonucleotide probe and the target nucleic acid can be increased using unlabeled helper oligonucleotides following the procedure described in US Pat. No. 5,030,557 to Hogan et al. The helper oligonucleotide binds to a region of the target nucleic acid other than the region bound by the probe. This binding takes on new secondary and tertiary structures in the target region of single-stranded nucleic acids, accelerating the binding speed of the probe.

Those skilled in the art will appreciate that factors affecting the thermal stability of the hybrid formed between the probe and the target may also affect probe specificity. Therefore, the melting point profile, including the melting point temperature of the probe and target hybrid, must be determined empirically for each probe and hybrid of the target. This determination can be made according to the method described in US Pat. No. 5,283,174 to Arnold et al. One method of determining the melting point temperature of the probe and target hybrids involves performing hybridization protection assays. This assay method forms a hybrid of the probe with the target under conditions of excess target in a lithium succinate buffer solution containing lithium laurylsulfate. A portion of the preformed hybrid is diluted in hybridization buffer and incubated for 5 minutes at various temperatures starting at or below the expected melting point temperature (typically 55 ° C.) and increasing 2 to 5 ° C. The solution is then diluted with weakly alkaline borate buffer and incubated at lower temperature (eg 50 ° C.) for 10 minutes. The acridinium esters linked to single chain probes are hydrolyzed under these conditions while the acridinium esters linked to hybridized probes are relatively protected. This procedure is called hybridization protection assay. The amount of chemiluminescence remaining is proportional to the amount of hybrid and is measured with a luminometer by adding hydrogen peroxide followed by alkali. This data is dipped as a percentage of the maximum signal (usually the lowest temperature) to the temperature. The melting point temperature is defined as the point at which 50% of the maximum signal remains. Alternatively, the melting point temperature for the hybrid of the probe and the target can be determined using a probe labeled with a radioisotope. In all cases, the melting point temperature for a given hybrid may vary by the concentration of salts, detergents and other solutes contained in the hybridization solution. All these factors affect the relative hybrid stability during heat denaturation (Molecular Cloning: A Laboratory Manual Sambrook et al., Eds. Cold Spring Harbor Lab Publ., 9.51 (1989)).

Hybridization conditions can be monitored taking into account several variables, for example, the hybridization temperature, the nature and concentration of the media components, the hybrids formed and the temperature upon washing. Hybridization and wash temperatures are limited to higher values depending on the base sequence, type and length of the probe and the maximum hybridization or wash temperature is about 30 ° C. to 60 ° C. At higher temperatures it competes with hybridization and dissociation or denaturation of the hybrid formed between the probe and the target. Hybridization media are for example about 3xSSC (1xSSC = 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), about 25 mM phosphate buffer PH 7.1 and 20% deion formamide, 0.02% picol, 0.02% bovine serum albumin, 0.02 % Polyvinylpyrrolidone and about 0.1 mg / ml cut and denatured salmon sperm DNA. The wash medium contains, for example, about 3 × SSC, 25 mM phosphate buffer pH 7.1 and 20% deion formamide. Depending on the modification of the probe and medium, the hybridization or washing temperature should be changed according to known associations to achieve the desired specificity (BD HAMES and SJ HIGGINS, (eds.). Nucleic acid hybridzation.A practical approach, IRL Press, Oxford , UK, 1985). In this regard, since DNA: DNA hybrids are generally less stable than RNA: DNA or RNA: RNA hybrids, hybridization conditions must be appropriately adjusted to achieve specific detection, depending on the nature of the hybrid to be detected.

In a particular preferred embodiment of the invention, hybridization buffer (6 × SSPE (0.15 M NaCl, 5 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0), 20% (v / v) formamide) is mixed with a PCR amplification gene After dispensing the probe on a fixed glass plate it is reacted for 6 hours at 30 ℃ to induce complementary binding. After the passage of time, wash for 3 minutes in the order of 3 × SPE, 2 × SSPE, 1 × SSPE.

Quantification of the hybrid can be accomplished by labeling the target with fluorescent or radioisotopes, as in the probes described above, according to conventional methods. Labeling may be on the primer itself or by using base residues labeled with fluorescent and radioisotopes for amplification and transcription.

Diagnostic purpose

The probe of the present invention can be precisely diagnosed solely and accurately by infecting diseases caused by each bacterium by detecting the bacterium with high specificity by applying one species to a kit, especially a DNA chip, or by applying two or more probes. By detecting the infectious disease-causing bacteria with a high specificity, it is possible to accurately diagnose the infectious disease caused by these bacteria at the same time. Infectious diseases caused by the bacterium according to the present invention are well known through many documents, for example:

Acinetobacter Baumani is associated with pyelonephritis and cystitis associated with urinary tract or urinary stones in all organs of the body (Glew RH. Et al., Medicine (Baltimore). 56, 79-97, (1977)). (Glew RH et al., Medicine (Baltimore), 56, 79-97, (1977)), meningitis (Berk SL et al., Arch. Neurol. 38, 95-98, (1981)), cellulitis (Gervich DH et al, Am. J. Infect. Control, 13, 210-215, (1985)), wound infection (Tong MJ. JAMA. 219, 1044-1047, (1972)), necrotizing fasciitis (Amsel MB et al. , Curr. Surg. 42, 370-372, (1985)), endophthalmitis (Peyman GA et al., Am. J. Ophthalmol. 80, 764-765, (1975)), endocarditis (Gradon JD, et al. , Clin. Infect. Dis. 14, 1145-1148, (1992)), osteomyelitis, bacterial arthritis, liver abscess, pancreatic abscess (Henricksen SD. Bacteriol. Rev. 37, 522-561, (1973)), and the like;

Unaerobiopyrirum succinicis prodersense is clinically mainly composed of bacteremia (Tee W et al., J. Clin. Microbiol. 36 (5), 1209-1213, (1998)), sepsis (Marcus L et. al., Eur. J. Clin.Microbiol.Infect.Dis. 15 (9), 741-744, (1996)), diarrhea (Malnick H et al., J. Clin. Pathol., 36 (10), 1097 , (1983) and the like;

Bacterides praxilis is known as meningitis in the central nervous system (Feder HM. Rev. Infect. Dis. 9, 783-786, (1987)), cerebral abscesses, subdural sheaths or epidural abscesses (Swartz MN. In: Finegold SM, George WL, eds.Anaerobic infections in humans.New York: Academic; 155-212, 1989), chronic sinusitis (Frederick J et al., N. Engl. J. Med. 290, 135-137, (1974)), Intraperitoneal infection (Gorbach SL. Clin. Infect. Dis. 17, 961-967, (1993)), liver abscess (Rubin RH et al., Am. J. Med. 57, 601-610, (1974)), bacteremia (Lombardi DP et al., Am. J. Med, 92, 53-60, (1992); Chow AW. Et al., Medicine (Baltimore) 53, 93-123, (1974); and Redondo MC et al. , Clin. Infect. Dis., 20, 1492-1496, (1995)), endocarditis (Felner JM et al., N. Engl. J. Med. 282, 1188-1192, (1970); Nastro LJ et al. , Am. J. Med., 54, 482-496, (1973); and (Nastro LJ et al., Am. J. Med., 54, 482-496, (1973)), wound infections, dogs and humans. Bite wound, necrotizing fasciitis, diabetic ulcer or cellulitis (Gerding D. Clin.Infe ct.Dis. 20 (Suppl 2), S283-S288, (1995)), chronic osteomyelitis, bacterial arthritis (Rosenkranz P et al., Rev. Infect. Dis. 12, 20-30, (1990);

Cardiobacterium hominis bacteria are endocarditis (Traveras J. Md. Et al., South. Med. J., 86, 1439-1440, (1993)), complications causing embolism and aneurysms and heart failure in the systemic body;

Meningitis in newborns of Chrysbacterium meningocystum (Plotkin SA et al., JAMA. 198, 194-196, (1966); Pokrywka M. et al., Am. J. Infect.Control, 21, 139-145, (1993)), respiratory infections (Brown RB et al., Am. J. Infect. Control, 17, 121-125, (1989)), sepsis, endocarditis, cellulitis, wound infection, celiac abscess, peritonitis, endophthalmitis ( Olsen H. et al., Lancet, 1, 1294-1296, (1965); Sheridan RL et al., Clin. Infect. Dis., 17, 185-187, (1993)) and the like;

Clostridium rhammosome is an inflammatory bowel disease (Senda S, et al., Microbial Immunol 1985; 29 (11): 1019-28), brain abscess (An Med Interna. 1998 Jul; 15 (7): 392-3) Pulmonary arterial embolism (Transplant Proc. 1983 Jun; 15 (2): 1715-9), etc. in patients undergoing kidney transplantation;

Comamonas asidobarans causes endocarditis in drug abusers (Horowitz H. et al., J. Clin. Microbiol., 28, 143-145, (1990));

Corynebacterium diphtheria fungi include respiratory diphtheria (Dobie RA, et al., JAMA. 1979; 242: 2197-2201), myocarditis (Boyer NH, et al., N Engl J Med. 1948; 239: 913. ), Eye movement and cilia palsy (Kallick CA, et al., III Med J. 1970; 137: 505-512; and Naiditch MJ, et al., Am J Med. 1954; 17: 229-245), face Dysfunction of the hyperpharyngeal and larynx, peripheral neuritis, cutaneous diphtheria (Koopman JS, et. Al., J Infect Dis. 1975; 131: 239-244), endocarditis (Tiley SM, et al., Clin Infect Dis. 1993; 16: 271-275), fungal aneurysms (Gruner E, et al., Clin Infect Dis. 1994; 18: 94-96), osteomyelitis (Patey O, et al., J Clin Microbiol. 1997; 35: 441-445 ) And arthritis (Patey O, et al., J Clin Microbiol. 1997; 35: 441-445.);

Crevciella oxytoca bacteria include Pneumonia (Korvick JA et al., South. Med. J. 84 (2), 200-204, (1991); and Al-Moamary MS et al., Clin. 26 (3), 765-766, (1998)), acute pyelonephritis in children (Ghiro L et al., Nephron. 90 (1), 8-15, (2002)), outbreak in neonatal intensive care unit (Jeong SH et al., J. Hosp. Infect, 48 (4), 281-288, (2001)), enteritis (Soussi F et al., Gastroenterol. Clin. Biol. 25 (8-9), 814- 816, (2001);

Ocrobact antropy bacteria are known as bacteremia associated with vascular conduits (Kern WV et al., Infection, 21, 306-310, (1993)), endocarditis (Mahmood MS et al., J. Infect., 40, 287 -290, (2000)), endophthalmitis (Berman AJ et al., Am. J. Ophthalmol., 123, 560-562, (1997)), pancreatic abscess, necrotic fasciitis (Brivet F. et al., Clin Infect. Dis., 17, 516-518, (1993)), chondritis (Barson WJ et al., J. Clin. Microbiol., 25, 2014-2016, (1987)), and the like;

Peptostreptococcus prevoti bacteria can cause various abscesses (eg, brain abscesses), chronic otitis media, acute mastoiditis, chronic sinusitis, pneumonia, lung abscesses, empyema, female genital infections (Murdoch DA et al., J. Med). Microbiol. 41, 36-44, (1987)), Bacteremia (Brook I, J. Infect. Dis. 160, 1071-1075, (1989)), osteomyelitis, spinal osteomyelitis, mastitis, cellulitis, necrotizing fasciitis (Murdoch) DA, Clin. Michrobiol. Rev., 11, 81-120, (1998)), diabetic foot infection (Wren MWD, Br. J. Biomed. Sci., 53, 294-301, (1996)), postpartum sepsis And arthritis related to articular joints (Brook I et al., Am. J. Med. 94, 21-28, (1993)), endocarditis, pericardial abscess, bacterial pericarditis, mediastinitis (Murdoch DA, Clin. Microbiol Rev., 11, 81-120, (1998), causing oral infections (Finegold SM, New York: Academic; 1977);

Porphyromonas gingivalis is known as oral infection, periodontal abscess, periodontitis, acute necrotic ulcerative periodontitis (Darby I et al., Periodontol. 2000, 26, 33-53, (2001)), breast abscess (Edmiston CE et al., J. Infect. Dis., 162, 695-699, (1990)), chronic osteomyelitis (Brook I. et al., Am. J. Med. 94 (1), 21-28, (1993) ), Sore throat (Brook I., J. Fam. Pract., 38 (2), 175-179, (1994)), pneumonia, lung abscess, empyema, otitis media, wound infection, peritonitis, peritonitis, chronic sinusitis I., J. Med. Microbiol. 42 (5), 340-347, (1995)), vaginitis, pelvic infection (Buerden BI, FEMS Immunol. Med. Microbiol. 6 (2-3), 223-227, (1993)), bacteremia (Lee SC et al., J. Microbiol. Immunol. Infect. 32 (3), 213-216, (1999)), endocarditis (van Winkelhoff AJ et al., Periodontol. 2000, 20, 122-135, (1999)) and the like;

Peptostreptococcus free-air Aerobic bacteria are known as abscesses (Murdoch DA et al., J Med Microbiol 1994; 41: 36-44; Brook I., J Urol 1989; 141: 889-893; Brook I., Ann Otol Rhin Laryngol 1998 107: 959-960; and Civen R. et al, J Oral Pathol Med 2000; 29: 507-513), hemorrhoidal infection (Brook I. and Frazier EH, Am J Gastroenterol 1996; 91: 333-335), Soft tissue infections (Brook I. and Frazier EH, Arch Surg 1990; 125: 1445-1451), endocarditis (Montejo M. et al., Clin Infect Dis 1995; 20: 1431), gingivitis and periodontitis (Moore LVH, et al. , J Dent Res 1987; 66: 989-995; and Wade WG, et al., J Clin Periodontol 1992; 19: 127-134), and the like;

Peptostreptococcus magnus is known as purulent nasopharyngitis (Brook, I., et al., Arch. Otolaryngol.Head eck Surg. 122: 4184, 1996), empyema (Civen, R., H. et al., Clin.Infect) Dis. 20 (Suppl. 2): S224S229, 1995; Marina, M., C. et al., Clin. Infect. Dis. 16 (Suppl. 4): S256S262, 1993; and Murdoch, DA, et al. , J. Med. Microbiol. 41: 3644, 1987), necrotic pneumonia, liver abscess (Brook, I. and EH Frazier. Pediatr. Infect. Dis. J. 12: 743747, 1993), torso surface infection (Brook, I and EH Frazier.Arch.Surg. 125: 144514, 1990), infections of diabetic foot disease (Sanderson, PJ, Clin. Pathol. 30: 266268, 1977), acute nonpregnant breast abscess, cellulitis (Brook, I , and EH Frazier., Arch. Surg. 130: 786792, 1995), endocarditis (Cofsky, RD, and SJ Seligman. 1985. Peptococcus magnus endocarditis.South.Med. J. 78: 361362; and Pouedras, P., et al., Clin, Infect. Dis. 15: 185), meningitis (Brown, MA, et al., Am. J. Med. Sci. 308: 18418, 1994), osteomyelitis (Brook, I., and EH Frazi) er., Am. J. Med. 94: 22128, 1993), septic arthritis (Fitzgerald, RH, et al., Clin. Orthoped. 164: 14114, 1982), purulent pericarditis (Phelps, R., et al. , JAMA 254: 9479, 1985), Sinusitis, Otitis Media in Children (Brook, I. 1994. Peptostreptococcal infection in children. Scand. J. Infect. Dis. 26: 503510. and Clin. Microbiol. Rev. 8: 4794);

Fusobacterium necrophorum is a disease of the oral, intestinal and vaginal infections (Mandell: Principles and Practice of Infectious Diseases, 5th ed., Copyright 2000 Churchill Livingstone, Inc p.2564-2566), Lemierre's syndrome (Bilateral Lemierre's syndrome: a case report and literature review. Ear Nose Throat J. 2002 Apr; 81 (4): 234-6, 238-40, 242);

Proteus vulgaris are known for urinary tract infections (Silverblatt FJ. J Exp Med. 1974; 140: 1696; and Wray SK, Hull SI, Cook RG, et al. Proteus mirabilis. Infect Immun. 1986; 54: 43-49; and Mobley HL , Chippendale GR.J Infect Dis. 1990; 161: 525-530), meningitis, cavernous venous thrombosis (Bodur H, Colpan A, Gozukuck R et al. Scand J Infect Dis. 2002; 34 (9): 694-6) Causing it;

Enterobacter aerogenes infections include deep infections (De Gheldre Y, Maes N, Rost F, et al. J Clin Microbiol. 1997; 35: 152-160), atypical pneumonia (Holden DA, Stoller JK. Department of Pulmonary Disease, Cleveland Clinic Foundation, Ohio, West J Med 1992 Jan; 156 (1): 79-824) and the like;

Infective Endocarditis in Adults Eleftherios Mylonakis, MD, and Stephen B. Calderwood, MD In New England Journal of medicine Volume 345: 1318-1330 November 1, 2001), and bacteremia (Elting LS, Bodey GP, Keefe BH. Clin Infect Dis. 1992; 14: 1201-1207), meningitis (Hoyne AL, Herzon H. Ann Intern Med. 1950; 33: 879-902), pneumonia (Lorber B, Swenson RM. Ann Intern Med. 1974 81: 329-331), acute purulent salivary glanditis (Raad II, Sabbagh MF, Caranasos GJ. Clin Infect Dis. 1990; 12: 591-601), oral facial infection (Gill Y, Scully C. Oral Surg Oral); Med Oral Pathol. 1990; 70; 155-158), Principles and Practice of Infectious Diseases.5th edition.Handell, Churchill Livingstone p.217, Otitis Media, Sinusitis (Gaudreau C, Delage G. Rousseau D, et a Can Med Assoc J. 1981; 125: 1246-1249) and the like;

The Kinzela Kinggap fungus has been described as infectious arthritis, osteomyelitis (Amir J, Schockelford PG, J Clin Microbiol. 1991; 29: 1083-1086; and Woolfrey BF, Lally RT, Faville RJ. Am J Clin Pathol. 1986; 85: 745-749 ), Endocarditis (Wolff AH, Ullman RF, Strampfer MJ, Cunha BA.Heart Lung. 1987; 16: 579-583; Rabin RL, Wong P, Noonan JA, Plumley DD.Am J Dis Child.1983; 137: 403- 404; and Verbruggen AM, Hauglustaine D, Schildermans F, et al. J Infect. 1986; 13: 133-142), bacteremia (Yagupsky P, Dagan R. Pediatr Infect Dis J. 1994; 13: 1148-1149; Birgisson H , Steingrimsson O, Gudnason T. Scand J Infect Dis. 1997; 29: 495-498; Roiz MP, Peralta FG, Arjona R. J Clin Microbiol, 1997; 35: 1916; Yagupsky P, Dagan R. Clin Infect Dis. 1997 24: 860-866; and Redfield DC, Overturf GD, Ewing N, Powars D. Arch Dis Child. 1980; 55: 411-414), pneumonia, laryngitis, meningitis, abscess, eye infection (Yagupsky P, Dagan R, Howard CW, et al. J Clin Microbiol. 1992; 30: 1278-1281; Kennedy CA, Rosen H. Am J Med. 1988; 85: 701-702; and Mollee T, Kelly P, T ilse M. J Clin Microbiol. 1992; 30: 2516-2517) and the like;

Bacterides obatus bacteria are used for meningitis, cerebral abscess, pharyngitis, mumps, abdominal infection, diarrhea, female genital infections, osteomyelitis, and septic arthritis (Handell 5th, chapter 237 Bacteroides, Prevotella. Porphyromonas, and Fusobacterium Species and Other Medically Important Anaerobic Gram-Negative Bacilli, p, 2561- 2570), and the like;

Bacteroides tetaotaomicron bacteria have been described as enteritis associated with antibiotics (George WL, Rolfe RD, Finegold SM. J Clin Microbiol. 1982; 15: 1049-1053; and Smith JA, Cooke DL, Hyde S, et al. Med Microbiol. 1997; 46: 953-958);

Haemophilus apropylas can be used locally for head or respiratory infections, sinusitis, otitis media, pneumonia (Kiddy K, Webberley J. J Infect. 1987; 15: 161-163), empyema, bacteremia, endocarditis (Geraci JE, Wilkowske) CJ, Wilson WR, et al. Mayo Clin Proc. 1977; 52: 209-215), infectious arthritis, osteomyelitis (Petty BG, Burrow CR, Robinson RA, et al. Am J Med. 1985; 78: 159-162) , Soft tissue abscess, wound infection, necrotizing fasciitis, meningitis (Petty BG, Burrow CR, Robinson RA, et al, Am J Med. 1985; 78: 159-162), brain abscess (Kilian M., J Gen Microbiol. 1976 ; 93: 9-62; Page MI, King EO. Engl J Med. 1966; 275: 181-188; Sutter VL, Finegold SM. Ann NY Acad Sci. 1970; 174: 468-487; Kraut MS, Attebery HR, Finegold SM, et al. J Infect Dis. 1972; 126: 189-192; Elster SK, Mattes LM, Meyers BR, et al. Am J Cardiol. 1975; 35: 72-79; and Bieger RC, Brewer NS, Washington JA II, Medicine (Baltimore) 1978; 57: 345-355);

Neisseria gonohea bacteria have acute urethritis, acute epididymitis, perigenital lymphadenitis, peri-urinary abscess, acute prostatitis, infectious diseases of Tyson's gland and cow's gland (Cohen MS, Cannon JG, Jerse AE, et al. J Infect Dis. 1994; 169: 532-537), cervicitis and urethritis in women's reproductive system, plaqueitis (Platt R, Rice PA, McCormack WM. JAMA. 1983; 250: 3205-3209), anal rectum in homosexuals Gonorrhea, pharyngeal gonorrhea (Handsfield HH, Knapp JS, Diehr PK, et al. Sex Transm Dis. 1980; 7: 1-5), eye infections, acute palatitis, oral ulcers, skin infections, oral abscesses, pelvic inflammatory diseases (Quinn TC, Stamm WE, Goodell SE, et al. N Engl J Med. 1983; 309: 576-582) and the like;

E.ella corodens is a human bite (Goldstein EJC. Clin Infect Dis. 1992; 14: 633-640), head and neck infections (Tveteras K, Kristensten S, Bach V, et al. J Laryngol Otol. 1987; 101; : 592-594), respiratory infections (Suwanagool S, Rothkopf MM, Smith SM, et al. Arch Intern Med. 1983; 143: 2265-2268), gynecological infections (Jeppson KG, Reimer LG. Obstet Gynecol. 1991; 78 503-505; Drouet E, De Montclos H, Boude M, et al. Lancet. 1987; 2: 1089), lung infection (Joshi N, O'Bryan T, Appelbaum PC. Rev Infect Dis. 1991; 13: 1207- 1212), causing endocarditis (Decker MD, Graham BS, Hunter EB, et al. Am J Med Sci. 1986; 292: 209-212), and the like;

Bacterides vulgaris is common in meningitis, brain abscess, pharyngitis, mumps, abdominal infection, diarrhea, female genital infection, osteomyelitis, septic arthritis (Mandell 5th, chapter 237 Bacteroides, Prevotella, Porphyromonas, and Fusobacterium Species and Other Medically Important Anaerobic) Gram-Negative Bacilli, p. 2561- 2570);

Branhamela catarrhalis fungus is known as otitis media (Stenfors LE, Raisanen S. J Laryngol Otol. 1990; 104: 749-757), lower respiratory tract infections, and acute exacerbations of chronic obstructive respiratory disease (Verghese A, Roberson D, Kalbfleisch JH, Sarubbi F. Antimicrob Agents Chemother. 1990; 34: 1041-1044), pneumonia (Collazos J, de Miguel J, Ayarza R. Eur J Clin Microbiol Infect Dis. 1992; 11: 237-240), respiratory infections (McKenzie H, Morgan MG, Jordens JZ, et al.J Med Microbiol, 1992; 37: 70-76), Sinusitis (Pentilla M, Savolainen S, Kuikaanniemi H, et al. Acta Otolaryngol (Stockh). 1997; (Suppl) 529: S165- S168), causing bacteremia (Ioannidis JPA, Worthington M, Griffiths JK, Snydman DR. Clin Infect Dis. 1995; 21: 390-397),

Suterella wazworthissis causes appendicitis, peritonitis, intraperitoneal abscess (Clin Infect Dis. 1997; 25 (Suppl 2): S88-S93);

Candida albicans bacteria include thrush (Schultz, FW 1925. Am. J. Dis. Child, 29; 283-285), Sulsy (Bassiouny, A et al. 1984. J. Laryngol. Otol., 98; 609-611) Stomatitis (Olsen, et al. 1978. Scand. J. Dent. Res, 86; 392-398), vaginitis (Ryley, JF, J. Med. Vet. Mycol., 24; 5-22, 1986), bronchial Pneumonia (Plummers, NS 1966 Symposium on Candida Infection.London, Churchill Livingstone, pp214-220), esophagitis, gastritis, enteritis (Trier, JS 1984. Am. J. Med., 77; 39-43), chronic mucosal candidiasis Jorizzo, JL 1982. Arch. Dermatol., 118; 963-965), Acute mycosis (Ray, TL et al. 1978. Int. J. Dermatol., 17; 603-690), Diaper-related diseases (Leyden, JJ 1978) Arch.Dermatol., 114; 56-59), Candida granulomas (Imperator, PJ 1968. Arch. Dermatol., 97; 139-146), endocarditis (Ben Joseph, 1985. Harefuah, 108; 72-73), urinary Mechanical infection (Goldberg, PK 1979. J. Am. Med. Assoc., 241; 582-584), meningitis (Roessman. 1967. Arch. Pathol., 84; 495-498), sepsis (Ashcraft, K 1970. J Am. Med. Assoc., 217; 454-456, eczema (Drouet, M. 1985. Allergie Immunol., 17; 13). -18), causing asthma (Wengrower, D et al. 1985. Respiration, 47; 209-213) and the like;

Candida glabrata is a fungal disease (Block, CS, Young, CN and Myers, RAM 1977. S. Afr. Med. J 51, 632-636), ulcerative purulent inflammation, granulomatous response (Francis W. Chandler, Williams Kaplan et al. A Color Atlas and Textbook of the Histopathology of Mycotic Disease.Wolf Medical Publications Ltd.pp45), sepsis (Minkowitz, S., D. Koffler, et al. 1963. Am. J. Med., 34: 252 255), pyelonephritis (Newman, DM, and JM Hogg, et al. 1969. J. Urol., 102: 547-548), respiratory infections (Oldfiekld, FSJ, L. Kapica, et al. 1968. Can. Med.Assoc. J., 98: 165-168), endocarditis (Carmody, TJ, KK Kane. 1986. Heart Lung, 15: 40-42; Heffner, DK, and WA Franklin. 1978. Am. J. Clin. Pathol., 70: 420-423; Lees, AW, SS Rau, et al. 1971. Lancet, 1: 943-944), meningitis (Wickerham, LJ 1957. J. Am. Med. Assoc., 165: 47- 48), causing ophthalmitis (Larson, PA, RL Lindhstrum, et al. 1978. Arch. Ophthalmol., 96: 1019-1022).

Hereinafter, the present invention will be described in more detail with reference to the following examples. However, these examples are merely illustrative and should not be understood as limiting the scope of the invention.

Example  One

23S of bacteria rDNA  And ITS  Sequencing

The following strains were purchased directly as described in Table 1 to determine the total base sequence of 23S rDNA and ITS of each standard strain.

Strains were cultured and chromosomal DNA was extracted using a GIAmp DNA mini kit (QIAGEN, USA). Using the extracted DNA as a template to determine the nucleotide sequence, multiple alignment and BLAST of 16S, ITS, and 23S rDNA sites of each known bacterium were carried out to carry out common common to all known bacteria among the above-mentioned examples. Primer was prepared. Among the prepared common primers, a common primer (1585Fw; 5-TTGTACACACCGCCCGTC) (SEQ ID NO: 406) capable of amplifying the ITS site and 520R, 23S 750F (T), 23S 750F, 970F, and 930R among the common primers of the 23S site , 2960R (T) and 2960RC were prepared by the inventors themselves and the remaining primers were known as the common primers of 23S rDNA (Anthony. RM, et al., J. Clin. Microbiol. 38 (2), 781-788, 2000) Was used to produce. Sequences of the prepared common primers used in sequencing and their approximate positions are shown in Table 2 below.

In order to determine the nucleotide sequence, these common primers were used as a template for chromosomal DNA of the strain, and PCR was performed to purify the product. In order to determine the base sequence of the ITS region and the 23S portion, the 16S rDNA sequence portion which is common to all the known strains by performing multiple alignment and BLAST with 16S rDNA of known bacteria 1585Fw primer was prepared by PCR, and PCR was performed with the primer of 23BR. PCR reaction was performed under the following conditions. The first denaturation was performed at 94 ° C. for 7 minutes and the second denaturation at 94 ° C. for 1 minute. Hybridization was performed at 52 ° C. for 1 minute and extension at 72 ° C. for 1 minute, which was repeated 10 times. Thereafter, the third denaturation was performed at 94 ° C. for 1 minute, hybridization at 54 ° C. for 1 minute, and extension at 72 ° C. for 1 minute, which was repeated 20 times. Thereafter, the last extension was performed once at 72 ° C. for 5 minutes. The resulting product was confirmed by agarose gel electrophoresis. The amplified PCR product was purified and sequenced using appropriate primers according to the site of nucleotide sequence to be analyzed by DNA automatic sequencer (Perkin Elmer, ABI prism 3700 sequencer). The primer used in the analysis of the nucleotide sequence was applied to the first prepared common primer, and then the base sequence was analyzed by preparing the 520R, 23S 750F, 23S 750F (T) primer based on the obtained base sequence. PCR was performed with 23BFw and MS38R to determine the next portion of the 23S rDNA sequence.

PCR conditions were performed in the same manner as above, and based on the base sequence obtained therefrom, primers of 970F and 930R were analyzed, and the base sequence was analyzed. In order to determine the nucleotide sequence of the rest of the 23S rDNA, multiple alignment and BLAST with 23S rDNA nucleotide sequence of known bacteria were performed to carry out 2960R which is common to all known bacteria among those exemplified above. (T), 2960RC primers were prepared. PCR with the same conditions as above was carried out with this primer and MS37F, and the base sequence was determined using this primer. The entire nucleotide sequence of 23S rDNA and ITS of each bacterium thus determined is set forth in SEQ ID NOs: 1 to 28.

Example  2

To identify bacteria DNA  Screening for Probe Candidates

In order to confirm the presence and identification of each bacterium, a probe specific to each bacterium was produced. For the production of specific probes, specificity must be unique to each bacterium. For this purpose, a specific probe candidate group for the bacterium was selected first. Specific probe candidate group is present only in each microorganism by aligning and comparing the sequences of all possible bacteria identified in Example 1 or known in GenBank with the 23S rRNA and ITS nucleotide sequences so far through multiple alignments. Specific base sequences were separately classified to prepare probe candidate groups present therein. Probe candidates were determined within the 23S rRNA gene and / or ITS site for bacteria and 18S rRNA gene site for fungi. The specificity of the probe candidate group was confirmed by comparing the similarity between the fungus by BLAST search. As a result, selected probe candidate groups are listed in Tables 4 to 49 below.

Example  3

Synthesis of Nucleic Acid Probes

Each probe candidate group selected in Example 2 was synthesized for application to a DNA chip. Mononucleotide (Proligo Biochemie GmbH Hamburg Co.) was put into an automated synthesizer (Expedite ^™ 8900, PE Biosystems Co.) and input the sequence and scale of the desired probe to obtain a pure nucleic acid probe of 0.05 umole, respectively. The obtained probe was subjected to electrophoresis to confirm the synthesis.

Example  4

DNA  Chip making

In order to immobilize the DNA probe, a bond between the aldehyde group and the amine group was used. When synthesizing all DNA fragment probes to immobilize the DNA probe, a base having an amino residue was inserted using an aminolinker column (Aminolinker column, Cruachem, Glasgrow, Scotland) in the 3-first position, and a glass plate. Slide glass was coated with an aldehyde residue (CEL Associates, Inc. Huston, Texas, USA).

To fix the probe, use a microarrayer made according to a known technique in a state in which the probe was dissolved in 3X SSC (0.45 M NaCl, 15 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0) buffer solution. Yoon, SH, et al, J. Microbiol.Biotechnol. 10 (1), 21-26, 2000—the entire contents of this document are incorporated herein by reference), followed by a humidity of about 55%. The DNA probe was immobilized by inducing a chemical reaction for at least 1 hour and leaving it for at least 6 hours under the above conditions. In the bacteria detection probe, the total probe was integrated at a concentration of 100 pmole at intervals of 280 μm in order to prepare a DNA chip fixed with the probe.

In order to confirm that the reaction between the amine group of the probe and the aldehyde on the glass plate was smooth and well immobilized, it was confirmed by staining with SYBRO green II (Molecular Probe, Inc., Leiden, Netherlands).

Example  5

Isolation and Amplification of Target Samples

Genomic DNA was separately extracted from the 31 standard strains listed in Table 3, including the 28 standard strains described in Example 1:

The bacteria grown in the titration medium were suspended in 200 µl sterile distilled water, centrifuged at 14,000 rpm for 10 minutes, and the supernatant was discarded, leaving only pellets.

In case of Gram-negative bacteria, ATL solution (Tissue Lysis solution, DNeasy Tissue Kit, QIAGEN) was suspended in 180 µl, 20 µl of Proteinase K was lysed, and then incubated at 55 ° C for 1 hour. After vortexing for 15 seconds, 200 μl of AL solution (Lysis solution, DNeasy Tissue Kit, QIAGEN) was mixed and incubated at 70 ° C. for 10 minutes. After 200 μl of ethanol (100%) was added and mixed, the solution was transferred to a 2-ml tube containing a DNeasy mini column and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, DNeasy Tissue Kit, Qiagen), centrifuge at 8,000 rpm or more for 1 minute, discard the effluent, and add 500 µl of AW2 solution (Wash solution 2, DNeasy Tissue Kit, QIAGEN). The DNeasy membranes were dried by centrifugation at full speed for 3 minutes and the effluent was discarded. After inserting the DNeasy mini-column for 15 minutes at room temperature, the genomic DNA was eluted by centrifugation for 1 minute at 8,000 rpm or more.

In case of Gram-positive bacteria (standard strain), it was suspended in 180 µl of lysozyme lysate solution (20mm Tris-Cl, pH8.0, 2mM EDTA, 1.2% TritonX-100, 20mg / ml lysozyme) and incubated for 30 minutes at 37 ℃. 25 μl of Proteinase K and 200 μl of AL solution (solution solution, DNeasy Tissue Kit, QIAGEN) were mixed well and incubated at 70 ° C. for 30 minutes. After adding 200 μl of ethanol (100%) and mixing, transfer the exclusive solution to a 2-ml tube containing a DNeasy mini column, and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, DNeasy Tissue Kit, Qiagen), centrifuge at 8,000 rpm or more for 1 minute, discard the effluent, and add 500 µl of AW2 solution (Wash solution 2, DNeasy Tissue Kit, QIAGEN). The DNeasy membranes were dried by centrifugation at full speed for 3 minutes and the effluent was discarded. After inserting the DNeasy mini column for 15 minutes at room temperature, the genomic DNA was eluted by centrifugation for 1 minute at 8,000rpm or more.

In the case of fungi (standard strains), the cells were suspended in 200 µl of sterile distilled water, centrifuged at 14,000 rpm for 10 minutes, and the supernatant was discarded and pellets were collected. The pellet is mixed with 200 μl SDS TE buffer (10% SDS, 100 mM Tris-Cl, 20 mM EDTA, pH 8.0) and 20 μl proteinase K (included in the DNeasy Tissue kit) solution at 55 ° C. Incubated for 2 h at and 10 min at 95 ° C. 200 μl of ethanol (100%) was added to the culture, and the mixed solution was transferred to a 2-ml tube containing a DNesay mini column, and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, DNesay Tissue Kit, Cat.No.69504 QIAGEN), centrifuge at 8,000 rpm or more for 1 minute, discard the distillate, and re-use AW2 solution (Wash solution 2, DNesay Tissue Kit, QIAGEN) 500 Add μl and centrifuge for 3 minutes at full speed to dry the DNeasy membrane and discard the effluent. The DNesay mini column was transferred to a 1.5 ml tube, and 100 µl of AE solution (eluate, DNesay Tissue Kit, QIAGEN) was added thereto, and allowed to stand at room temperature for 15 minutes, followed by centrifugation at 8,000 rpm or more for 1 minute to elute genomic DNA. Once again, 100 μl of an AE solution (eluate, DNesay Tissue Kit, QIAGEN) was added to the DNesay mini column and allowed to stand at room temperature for 15 minutes, followed by centrifugation at 8,000 rpm or more for 1 minute to elute genomic DNA.

A fragment gene was prepared by using the DNA of the isolated strain as a template and performing asymmetric amplification (Asymmetric PCR). Fragment gene was obtained by one polymerase chain reaction by differentiating the ratio of forward and reverse primers at 1: 5. In order to identify DNA bound to the probe during PCR, binding was confirmed by fluorescence by amplification using a primer attached with 5-FITC (fluorescein isothiocyanate). The primers used in the PCR reaction were used simultaneously with three pairs of primers when DNA was isolated from bacteria:

Primer 1 (sense): TTGTACACACCGCCCGTC (SEQ ID NOs: 406, 1585Fw)

Primer 2 (antisense): F-TTTCGCCTTTCCCTCACGGTACT (SEQ ID NOs: 407, 23BR);

Primer 3 (sense): AGTACCGTGAGGGAAAGGCGAA (SEQ ID NOs: 408, 23BFw)

Primer 4 (antisense): F-TGCTTCTAAGCCAACATCCT (SEQ ID NOs: 409, 37R); And

Primer 5 (Sense): with AGGATGTTGGCTTAGAAGCA (SEQ ID NO: 410, MS37F)

Primer 6 (antisense): F-CCCGACAAGGAATTTCGCTACCTT (SEQ ID NO: 411, MS38R).

F attached to the 5 'end of the sequence indicates the FITC fluorescent material.

When DNA was isolated from fungi the following primer pairs were used:

Primer 1 (sense): GTAATTGGAATGAGTACAAT (SEQ ID NO: 412, fun463F)

Primer 2 (antisense): F-CTACGACGGTATCTGATCAT (SEQ ID NO: 413, fun986R).

PCR reaction was performed under the following conditions. 5 ul 10X PCR buffer (100 mM Tris-HCl (pH 8.3), 500 mM KCl, 15 mM MgCl ₂ ), dNTP mixture (2.5 mM each for dATP, dGTP, dCTP, dTTP) 4 ul, 10 pmole forward primer 0.5 ul, 10 pmole reverse primer 2.5 ul , 1 ul of template DNA (100 ng) diluted to 1/10, 0.5 ul of Taq polymyrase (5 unit / ul, Takara Shuzo Co., Shiga, Japan) were added and water was added so that the total volume was 50 ul. The first denaturation was performed at 94 ° C. for 7 minutes and the second denaturation at 94 ° C. for 1 minute. Annealing was performed at 52 ° C. for 1 minute and extension at 72 ° C. for 1 minute, which was repeated 10 times. Thereafter, the third denaturation was performed at 94 ° C for 1 minute, hybridization at 54 ° C for 1 minute, and extension at 72 ° C for 1 minute, which was repeated 30 times. Thereafter, the last extension was performed once at 72 ° C. for 5 minutes. The product produced as a result of the PCR reaction was confirmed by agarose gel electrophoresis. As a result, it was confirmed that DNA double strands and fragment strands were simultaneously synthesized for each strain.

Example  6

Hybridization  And washing

In order to confirm the specificity and sensitivity of the probe candidate group, the hybridization reaction was performed by applying the PCR product (Example 5) amplified from the cells to a DNA chip (Example 4) to which a nucleic acid probe was immobilized. The nucleic acid probe was tested for cross-reaction (specificity) for the remaining species when a signal appeared after hybridization with a genomic gene isolated from its standard strain.

The DNA plate having the nucleic acid probe immobilized on the glass plate was hydrolyzed by steaming, and then immersed in 70% ethanol to remove the probe that was not immobilized on the glass plate. Subsequently, during the hybridization process, the fluorescent material was attached to an aldehyde residue remaining on the surface of the glass plate, thereby increasing the overall signal and preventing the glass plate from blocking the effect of the specific probe signal (1.3 g NaBH _4). , 375ml PBS, 125ml 100% ethanol) and then reacted for 5 minutes in a shaker (shaker). After washing for 5 minutes with 0.2% SDS, washed 2-3 times with sterile water for 1 minute, and then the water in the glass plate was removed using a centrifuge (1,000rpm, 2 minutes).

To hybridization solution hybridization buffer solution (hybridization buffer: 6 × SSPE; 20XSSPE; 3M NaCl, 0.2M NaH 2 PO 4 · H 2 O, 0.02M EDTA, pH 7.4, 20% (v / v) formamide; Sigma Co , St. Louis) was added to the 30 amplified gene amplified by asymmetric amplification method (Asymmetric PCR) was prepared so that the total volume is 200 μl. The prepared solution was dispensed onto the glass plate on which the probe was immobilized and then covered with a probe-clip press-seal incubation chamber (Sigma Co., St. Louis, Mo.).

To prevent drying around the glass plate during hybridization, a wet tissue was placed in the hybridization chamber and then reacted for 6 hours in a 30 ° C shaking incubator to induce complementary binding. After elapse of time 3 × SSPE (0.45M NaCl, 15 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0), 2 × SSPE (0.3M NaCl, 10 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0), 1 After washing for 5 minutes in each of SSPE (0.15 M NaCl, 5 mM C ₆ H ₅ Na ₃ O ₇ , pH 7.0), the water in the glass plate was removed using a centrifuge (1,000 rpm, 2 minutes).

Example  7

Hybrid  detection

The results of the hybridization reaction were searched using Scanarray 5000 (GSI Lumonics Inc., Bedford, MA.), And the results are shown in Tables 4 to 49 below.

Tables 4 through 49

Example  8

Blind test

A DNA chip was prepared as in Example 4, and 12 kinds of bacteria were used, namely Staphylococcus aureus, Pseudomonas aeruginosa, Proteus mirabilis, Crevciella pneumoniae, and acinetobacter bau. Blind tests on Mani, Escherichia coli, Enterococcus pesium, Staphylococcus epidermidis, Salmonella group E, Salmonella group B, Crevciella oxytoca and Vulcoderia sefacia were conducted. 1, 9, 11 and 14 show the design of DNA chips for blind testing. The names described in these figures indicate that the probes listed in Tables 4 to 49 are fixed to the glass plates. Amine 3'-AAAAAAAAAAAAAAA-5'-FITC (SEQ ID NO: 428) was used as a position marker and is labeled C. As a negative control, a probe-melted buffer (3X SSC) was used and is labeled N. A common bacterial probe was used as a positive control on the chip, which is listed in Table 50 below.

The samples used in this study were taken from specific sites of about 300 pathogenic infections, and the presence of bacteria was confirmed by the culture method.

Genomic DNA was extracted from the cultured samples as follows. If the sample was a bodily fluid, 10 ml of the bodily fluid was collected in an EDTA tube or a plain tube. If the amount of the sample is more than 10ml centrifuged at 5,000 xg for 15 minutes, if less than 10ml was centrifuged for 15 minutes at 14,000rpm and the precipitate was collected in 1-2 1.5ml tube. Suspend in 180µl of lysozyme buffer (20mM Tris-Cl, pH 8.0, 2mM EDTA, 1.2% Triton X-100, 20mg / ml lysozyme) and incubate for 30 minutes at 37 ° C. Lysis solution, QIAamp DNA Blood Mini Kit, QIAGEN) 200μl and gently mixed, incubated for 2 hours at 55 ℃ and then incubated for 10 minutes at 95 ℃. After adding 200 μl of ethanol (100%) and mixing, the whole solution was transferred to a 2-ml tube containing a QIAamp spin column, and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, QIAamp DNA Blood Mini Kit, QIAGEN), centrifuge at 8,000 rpm for 1 minute, discard the effluent, and then again 500 µl of AW2 solution (Wash solution 2, QIAamp DNA Blood Mini Kit, QIAGEN). The mixture was centrifuged at 14,000 rpm for 1 minute to discard the effluent. The QIAamp spin column was transferred to a 1.5 ml tube, 300 µl of AE solution (Elution Solution, DNA Blood Mini Kit, QIAGEN) was added thereto, and allowed to stand at room temperature for 15 minutes, followed by centrifugation at 8,000 rpm for 3 minutes to elute genomic DNA. After adding 750 μl of ethanol (100%) for 1 hour at −20 ° C., centrifuging at 14,000 rpm for 20 minutes, discarding the ethanol, which was the supernatant, drying, and pellets were dissolved in 20 μl sterile distilled water and concentrated.

If the sample was blood, 10 ml blood was sampled into an EDTA tube. The plasma layer was divided into 1.5 ml tubes by centrifugation at 1,800 rpm for 10 minutes, centrifuged at 14,000 rpm for 10 minutes, and the precipitate was divided into 1.5 ml tubes. Suspend in 180µl of lysozyme buffer (20mM Tris-Cl, pH 8.0, 2mM EDTA, 1.2% Triton X-100, 20mg / ml lysozyme) and incubate for 30 minutes at 37 ° C. Lysis solution, QIAamp DNA Blood Mini Kit, QIAGEN) 200μl and gently mixed, incubated for 30 minutes at 55 ℃ and again incubated for 10 minutes at 95 ℃. After adding 200 μl of ethanol (100%) and mixing, the whole solution was transferred to a 2-ml tube containing a QIAamp spin column and centrifuged at 8,000 rpm for 1 minute to discard the liquid collected in the tube. Add 500 µl of AW1 solution (Wash solution 1, QIAamp DNA Blood Mini Kit, QIAGEN), centrifuge at 8,000 rpm for 1 minute, discard the effluent, and then again 500 µl of AW2 solution (Wash solution 2, QIAamp DNA Blood Mini Kit, QIAGEN). The mixture was centrifuged at 14,000 rpm for 1 minute to discard the effluent. The QIAamp spin column was transferred to a 1.5 ml tube, 300 µl of AE solution (Elution Solution, DNA Blood Mini Kit, QIAGEN) was added thereto, and allowed to stand at room temperature for 15 minutes, followed by centrifugation at 8,000 rpm for 3 minutes to elute genomic DNA. After adding 750 μl of ethanol (100%) for 1 hour at −20 ° C., centrifuging at 14,000 rpm for 20 minutes, discarding the ethanol, which was the supernatant, drying, and pellets were dissolved in 20 μl sterile distilled water and concentrated.

Amplification, hybridization reaction, washing and detection of hybrids were carried out in the same manner as in Examples 5 to 7 above. The results are shown in Table 51 below. In the data in this table, the denominator is the number of application of the sample and the molecule is the number of times the signal from hybridization appears.

For reference, FIGS. 2, 3, 4, 5, 6, 7 and 8 are Staphylococcus aureus, Pseudomonas aeruginosa, Proteus mirabilis, Creveciella pneumoniae, Acinetobacter Baumani, Lee . In the blind test on the specimens containing E. coli and Enterococcus fungus, respectively, the results of hybridization on the DNA chip of FIG. 1 searched using Scanarray 5000 are shown. FIG. 10 shows the results of hybridization reactions in the DNA chip of FIG. 9 retrieved using Scanarray 5000 in a blind test on a sample containing Staphylococcus epidermidis bacteria. FIG. 12 and 13 show the results of hybridization reactions in the DNA chip of FIG. 11 retrieved using ScanAray 5000 in a blind test on specimens containing Salmonella group E and Salmonella group B bacteria, respectively. Figures 15 and 16 show the results of hybridization reactions in the DNA chip of Figure 14 retrieved using ScanAray 5000 in a blind test on specimens containing the Crevciella oxytoca and Vulcoderia Sephacia bacteria, respectively.

According to the present invention, a probe having a nucleotide sequence that specifically hybridizes with the rRNA gene of each pathogen and does not cross-react with nucleic acids of other organisms has been developed. By identifying the specificity of each of these probes, new diagnostic methods for diagnosing infectious diseases for chemotherapy will be available.

Attach sequence list electronic file  

Claims (6)

15-25 bp nucleic acid molecule essentially containing the following nucleotide sequence: AAGGATTGACAGATT (C.alic 007, SEQ ID NO: 399); or CATTAATCAAGAACG (C.alic 008, SEQ ID NO: 400). A nucleic acid probe for detecting Candida albicans bacteria that essentially contains the nucleic acid molecule of claim 1. A composition comprising a nucleic acid probe for detecting Candida albicans bacteria which essentially contains the nucleic acid molecule of claim 1. delete A DNA chip in which a nucleic acid probe for detecting Candida albicans bacteria containing essentially the nucleic acid molecule of claim 1 is immobilized on a solid support. Method for detecting and identifying Candida albicans bacteria, characterized by using the nucleic acid probe of claim 2.

Images