JPH0870860A - Modified phosphoenolpyruvate carboxylase, its gene and production of amino acid - Google Patents

Abstract

PURPOSE: To obtain a phosphoenolpyruvate carboxylase without being substantially inhibited by aspartic acid. CONSTITUTION: This phosphoenolpyruvate carboxylate is obtained by culturing Escherichia coll holding a phosphoenolpyruvate carboxylate gene having a variation capable of replacing glutamic acid at the 625th position from the N-terminal of the phosphoenolpyruvate carboxylase with lysine. The resultant carboxylase is not substantially inhibited by aspartic acid. This method for producing an amino acid is to use a microorganism holding the resultant phosphoenolpyruvate carboxylase.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a mutant phosphoenolpyruvate carboxylase, a gene encoding the same, and a method for producing an amino acid, and more particularly, to a gene having a mutation that cancels feedback inhibition by aspartic acid and its use. .

[0002]

Phosphoenolpyruvate carboxylase is an enzyme found in most bacteria and all plants. The role of this enzyme is to supply C4 dicarboxylic acid to maintain rotation in the biosynthesis of aspartic acid and glutamic acid and the citric acid cycle. However, there are few reports showing the effect of this enzyme on the fermentation production of amino acids using microorganisms, and its importance is not clear (Atushi, Yokota and Isamu, Shiio, Agric. Bio
l. Chem., 52, 455-463 (1988), Josef, Cremer et a
l., Appl. Environ. Microbiol., 57, 1746-1752 (199
1), Petra, G. Peters-Weintisch, FEMS Microbiol. Le
tters, 112, 269-274 (1993)).

By the way, amino acids are compounds that are ubiquitously present in cells as protein components, but their production is strictly controlled for economical energy metabolism and substance metabolism. This control is mainly a feedback control, that is, a product downstream of the metabolic pathway inhibits the activity of an enzyme that catalyzes an upstream reaction, and phosphoenolpyruvate carboxylase also undergoes various regulation of activity expression. There is.

For example, Escherichia
The activity of phosphoenolpyruvate carboxylase of the genus Corynebacterium is inhibited by aspartic acid.

Conventionally, in amino acid fermentation, various techniques have been developed for efficient production, and leucine, isoleucine, tryptophan, phenylalanine and the like are fermentatively produced using mutant strains that have become insensitive to feedback control. ing. However, a phosphoenolpyruvate carboxylase mutant enzyme that has become insensitive to inhibition by aspartic acid, and an attempt to utilize it for fermentation production of amino acids of the aspartic acid group and the glutamic acid group are not known.

On the other hand, Escherichia coli (Escherichia coli)
ppc gene, a gene encoding phosphoenolpyruvate carboxylase of E. coli, has already been cloned and its nucleotide sequence has been determined (Fujita, N., Miw.
a, T., Ishijima, S., Izui, K. and Katsuki HJBiochem.
95,909-916 (1984)), but there is no report of a mutant of which the inhibition by aspartic acid was released even in the same enzyme.

[0007]

The present invention has been made from the above viewpoint, and provides a phosphoenolpyruvate carboxylase in which feedback inhibition by aspartic acid is substantially eliminated, a gene thereof, and a method of using the same. Is an issue.

[0008]

Means for Solving the Problems As a result of intensive studies to solve the above problems, the present inventors have found that by substituting an amino acid at a specific site of phosphoenolpyruvate carboxylase of Escherichia coli with another amino acid. Found that the inhibition by aspartic acid is substantially released, succeeded in obtaining a gene encoding such a mutant enzyme, and completed the present invention.

That is, the present invention provides a mutant phosphoenolpyruvate characterized by having a mutation in phosphoenolpyruvate carboxylase derived from a microorganism belonging to the genus Escherichia that cancels feedback inhibition of phosphoenolpyruvate carboxylase by aspartate. Carboxylase and D encoding this mutant phosphoenolpyruvate carboxylase
NA sequence.

The present invention further includes microorganisms belonging to the genus Escherichia or coryneform bacteria, which retain this DNA fragment, and these microorganisms, which are cultured in a suitable medium, from which L-lysine, L-threonine, L-methionine,
Provided is a method for producing an amino acid, which comprises separating an amino acid selected from L-isoleucine, L-glutamic acid, L-arginine and L-proline.

In the present specification, a DNA sequence encoding a mutant phosphoenolpyruvate carboxylase or a DNA sequence containing a promoter therein is simply referred to as "the DNA sequence of the present invention", "mutant gene" or phosphoenolpyruvate. Sometimes called a carboxylase gene.

The present invention will be described in detail below.

<1> Mutant Phosphoenolpyruvate Carboxylase The mutant phosphoenolpyruvate carboxylase of the present invention (hereinafter also simply referred to as “mutant enzyme”) is a phosphoenolpyruvate carboxylase of a microorganism belonging to the genus Escherichia. It has a mutation that cancels the feedback inhibition of phosphoenolpyruvate carboxylase by aspartic acid.

Any such mutation may be used as long as it substantially cancels the above feedback inhibition without losing the enzyme activity of phosphoenolpyruvate carboxylase. For example, it has the mutation. When mutated phosphoenolpyruvate carboxylase is present in the cells of a microorganism belonging to the genus Escherichia, there is a mutation that confers resistance to a compound having the following properties; the wild-type phosphoenolpyruvate carboxylase is produced. It exhibits a growth inhibitory action on microorganisms belonging to the genus Escherichia, and the growth inhibitory action is restored by the presence of L-glutamic acid or L-aspartic acid and inhibits the wild-type phosphoenolpyruvate carboxylase activity.

More specifically, a mutation for substituting the 625th glutamic acid from the N-terminal of phosphoenolpyruvate carboxylase with lysine, a mutation for substituting the 222nd arginine with histidine and the 223rd glutamic acid with lysine, respectively. There are mutations for substituting 288th serine with phenylalanine, 289th glutamic acid for lysine, 551th methionine for isoleucine, and 804th glutamic acid for lysine, and a mutation for substituting 867th alanine with threonine. .

As a phosphoenolpyruvate carboxylase of a microorganism belonging to the genus Escherichia, an amino acid sequence deduced from the phosphoenolpyruvate carboxylase gene of Escherichia coli (Fujita, N., Miwa, T., Ishiji
ma, S., Izui, K. and KatsukiH. J.Biochem.95,909-916 (1
984)) is shown in SEQ ID NO: 1 in the sequence listing.

The above mutant enzyme is the DNA of the present invention described below.
It is encoded by the sequence and is produced by expressing this DNA sequence in Escherichia coli or the like.

<2> DNA Sequence of the Present Invention and Microorganism Retaining the Same On the other hand, the DNA sequence of the present invention is a DNA sequence encoding the above-mentioned mutant enzyme, and is a phosphoenolpyruvate carboxylase of a microorganism belonging to the genus Escherichia. The coding DNA fragment has a mutation in the coding region that cancels the feedback inhibition of phosphoenolpyruvate carboxylase by aspartate.

Specifically, in the DNA sequence encoding phosphoenolpyruvate carboxylase having the above mutations, for example, in the nucleotide sequence of SEQ ID NO: 1 in the sequence listing, i) GAA of nucleotide numbers 2111 to 2113 is AAA.
Or a mutation that converts into AAG, ii) a mutation in which CGC with base numbers 902 to 904 converts into CAT or CAC, and a GAA from 905 to 907 converts into AAA or AAG, respectively, iii) a TCT with base numbers 1100 to 1102 changes into TTT or TTC, GAA of 1103-1105 to AAA or AAG, ATG of 1889-1891 to ATT,
ATC or ATA, and GA of 2648-2650
Mutations in which A is converted to AAA or AAG, respectively. Iv) GCGs 2837 to 2839 are ACT, ACC,
DNA sequences having any of the mutations that convert to either ACA or ACG are mentioned.

Such a mutant gene is a vector D compatible with a host and a wild-type enzyme gene or a phosphoenolpyruvate carboxylase gene having another mutation.
Mutant treatment of the recombinant DNA obtained by ligating with NA,
It can be obtained by screening a transformant with this recombinant DNA. Alternatively, after mutating a microorganism that produces a wild-type enzyme to create a mutant strain that produces a mutant enzyme, the mutant gene may be screened from the mutant strain. Hydroxylamine and the like are used for the mutation treatment of the recombinant DNA. When the microorganism itself is subjected to mutation treatment, a drug or method usually used for artificial mutation may be used.

The wild-type enzyme gene or the phosphoenolpyruvate carboxylase gene having another mutation may be any gene as long as it encodes a phosphoenolpyruvate carboxylase of a microorganism belonging to the genus Escherichia, and the nucleotide sequence is determined. It is preferred that it has been cloned. When it has not been cloned, it can be cloned using an appropriate vector after amplifying and isolating a DNA fragment containing the gene using the PCR method or the like.

As the above-mentioned gene, for example, a gene of Escherichia coli (Fujita, N., Miwa, T., Ishijima, S., Izui, K. an, which has already been cloned and whose nucleotide sequence has been determined).
d Katsuki, HJ Biochem. 95, 909-916 (1984)). The sequence of the coding region of this gene is as shown in SEQ ID NO: 1 in the sequence listing (base numbers 239-
2890).

Screening of a host having a mutant gene can be carried out using an aspartic acid analog compound. The analog compound preferably has the following properties. That is, it shows a growth inhibitory effect on a microorganism belonging to the genus Escherichia that produces wild-type phosphoenolpyruvate carboxylase, the growth inhibitory effect is restored by the presence of L-glutamic acid or L-aspartic acid, and a wild-type phosphonate. Inhibits enolpyruvate carboxylase activity.

The analog compound as described above is selected by using, as an index, the inhibition of the growth of a microorganism belonging to the genus Escherichia that produces a wild-type enzyme, for example, Escherichia coli HB101, and a mutant strain resistant to the analog compound is screened. , It is highly possible to obtain a host that produces phosphoenolpyruvate carboxylase in which feedback inhibition by aspartic acid is released.

It has been proposed that a C4 dicarboxylic acid structure is essential as a general structure of an inhibitor of phosphoenolpyruvate carboxylase. From this viewpoint, the present inventor screened various compounds. Escherichia coli HB101 was pre-cultured in LB medium, DL-2-amino-4-phosphonobutyric acid, bromosuccinic acid meso-2,3-dibromosuccinic acid, 2,2-difluorosuccinic acid, 3
-Bromopyruvic acid, α-ketobutyric acid, α-ketoadipic acid, DL-threo-β-hydroxyaspartic acid, L-aspartic acid-β-methyl ester, α-methyl-DL-aspartic acid, 2,3-diaminosuccinic acid Acid or aspartic acid-
M9 medium containing β-hydrazide (thiamin 20 μg / m
1, Leu, Pro 3 μg / ml each).
Growth was examined by measuring absorbance at 660 nm over time.

Furthermore, when these compounds are present at growth inhibitory concentrations, nucleic acids (uridine, adenosine 10 m each
(g / dl), glutamic acid, or an amino acid of the aspartic acid group (Asp 0.025%, Met, Thr, Lys 0.1% each) was examined whether inhibition was recovered.

As a result, three compounds, 3-bromopyruvic acid (3BP) (Chemical formula 1), aspartic acid-β-hydrazide (AHY) (Chemical formula 2), DL-threo-β-hydroxyaspartic acid (βHA) (Chemical formula 3) was selected.

[0028]

Embedded image

[0029]

Embedded image

[0030]

[Chemical 3]

Inhibition of growth of Escherichia coli by these analog compounds is shown in FIGS. Furthermore, FIGS. 4 to 6 show the growth recovery of Escherichia coli when the above inhibitory recovery substance was added alone or as a mixture of two or three kinds. As a control, FIG. 7 shows the growth when the inhibitor recovery substance was added in the absence of the inhibitor. In addition, in FIGS. 4 to 7, additives 1, 2, and 3 represent nucleic acids, glutamic acid, or aspartic acid group amino acids, respectively.

Furthermore, inhibition of activity of phosphoenolpyruvate carboxylase by analog compounds was examined. Yoshinaga, T., Izui, K. and Katsuki, H., J.
According to the method described in Biochem., 68, 747-750 (1970),
Enzyme activity was measured.

Escherichia coli H cultured in LB medium
B101 was crushed, the suspension was centrifuged, and the supernatant was used as a crude enzyme solution. The measurement of the enzyme activity affected the activity in a measurement system containing 2 mM potassium phosphoenolpyruvate, 0.1 mM NADH, 0.1 M tris-acetic acid (pH 8.5), 1.5 U malate dehydrogenase, and a crude enzyme. Acetyl Coenzyme A, which is known to
It was carried out by measuring the decrease in absorbance at 340 nm in the presence of M concentration. The results are shown in Fig. 8.

From the above results, it is clear that the above-mentioned three kinds of analog compounds inhibit the growth of Escherichia coli and the inhibition cannot be recovered by the nucleic acid alone, but the inhibition can be recovered by the addition of glutamic acid or aspartic acid group amino acid. is there. Therefore, these analog compounds were presumed to be selective inhibitors of phosphoenolpyruvate carboxylase. In the present invention, as shown in Examples below, these three compounds have been successfully used to select Escherichia coli that produces a mutant phosphoenolpyruvate carboxylase.

The mutant enzyme gene is obtained by screening a transformant having the mutant enzyme gene of interest using the above compound and recovering the recombinant DNA. When the microorganism itself is mutated, a mutant strain having the target mutant enzyme gene is screened using the above compound, and a DNA fragment containing the target mutant enzyme gene is isolated from the strain, When ligated to an appropriate vector, the mutant enzyme gene can be obtained.

DNA encoding phosphoenolpyruvate carboxylase thus mutated
The mutant enzyme can be produced by expressing the fragment using an appropriate host-vector system. Also, the target mutant enzyme can be produced by transforming the DNA fragment of the present invention by incorporating it into the host chromosomal DNA.

Examples of the host include microorganisms belonging to the genus Escherichia, such as Escherichia coli and coryneform bacteria. Coryneform bacteria, Corynebacterium,
Includes Brevibacterium bacteria that were previously classified as Brevibacterium but are now integrated as Corynebacterium bacteria, and Brevibacterium bacteria that are very closely related to Corynebacterium bacteria. The host suitable for amino acid production will be described later.

On the other hand, as the vector DNA, a plasmid vector is preferable, and one capable of autonomous replication in the cells of the host is preferable. When the host is E. coli, for example pUC
19, pUC18, pBR322, pHSG299, pHSG399, RSF1010 and the like. Alternatively, a phage DNA vector can be used.

The vector that can be used when the host is a coryneform bacterium and the host that retains the vector are illustrated below. The deposit number of the international depository institution is shown in parentheses.

PAJ655 Escherichia coli AJ 11882 (FERM BP-136) Corynebacterium glutamicum SR8201 (ATCC39135) pAJ1844 Escherichia coli AJ 11883 (FERM BP-137) Corynebacterium glutamicum SR8202JA611 Escherichia coli p820 11884 (FERM BP-138) pAJ3148 Corynebacterium glutamicum SR8203 (ATCC39137) pAJ440 Bacillus subtilis AJ 11901 (FERM BP-140)

These vectors can be obtained from the deposited microorganism as follows. The cells collected in the logarithmic growth phase were lysed using lysozyme and SDS, centrifuged at 30,000 xg, polyethylene glycol was added to the supernatant obtained from the lysate, and cesium chloride-ethidium bromide equilibrium density gradient centrifugation was performed. Separate and purify by separation.

To transform E. coli with the recombinant vector obtained by inserting the DNA sequence of the present invention into the above vector, for example, a method of treating cells with calcium chloride to enhance DNA permeability (Mandel, M. et al. and Higa, A., J. Mol.
Biol., 53, 159 (1977)) and the like, which are commonly used for transformation of E. coli, can be used.

Further, as a transformation method of coryneform bacteria, a method of treating the above-mentioned cells with calcium chloride, or a method of incorporating the cells at a specific growth period in which the cells can incorporate DNA (Bacillus by Duncan, CH et al.・ There is a report on subtilis). In addition, pratimid DNA
Can be incorporated into bacterial cells by molding protoplasts or spheroplasts of the DNA receptor that readily take up the protein. These are known for Bacillus subtilis, Actinomyces and yeast (Chang, S. et al. Molec. Gen. Genet., 168, 111,
(1979), Bibb et al., Nature, 274, 398, (1978), Hin
nen, A. et al., Proc. Natl. Acad. Sci. USA, 75, 19
29 (1978)). In addition, JP-A-2-207791 discloses a method for transforming coryneform bacteria.

In order to express the DNA sequence of the present invention in the above host, a promoter that works efficiently in microorganisms such as lac, trp and PL may be used, and the DNA sequence of the present invention is a phosphoenolpyruvate carboxylase gene. When it contains the promoter, it may be used as it is. Further, when the coryneform bacterium is used as the host, a known trp promoter derived from Brevibacterium (Japanese Patent Laid-Open No. 62-244382) and the like can also be used.

Further, as described above, the DNA sequence of the present invention inserted into a vector DNA capable of autonomous replication may be introduced into a host and retained in the host as a plasmid. Transposon (Berg, D.
E. and Berg, CM, Bio / Technol., 1,417 (1983)), Mu
Phage (JP-A-2-109985) or homologous recombination (Experiments in Molecular Genetics, Cold Spring)
Habor Lab. (1972)) may be used for integration into the chromosome of the microorganism. Further, in order to integrate the DNA of the present invention into the chromosome of coryneform bacteria, the temperature sensitive plasmid disclosed in Japanese Patent Laid-Open No. 5-7491 can be used.

By culturing the microorganism transformed with the DNA sequence of the present invention as described above and expressing this DNA sequence, a mutant enzyme can be obtained. Whether or not the mutant enzyme thus obtained has been desensitized to feedback inhibition by aspartic acid will be clarified by adding aspartic acid to the enzyme reaction system and measuring the activity.

Further, since the DNA sequence of the present invention encodes a mutant enzyme whose feedback inhibition by aspartic acid has been released, a microorganism having this DNA sequence can be transformed into the aspartic acid group and the glutamic acid group as shown below. It can be used for efficient fermentation production of amino acids.

Escherichia coli AJ12907 and AJ1 carrying the mutant enzyme gene obtained in the Examples below.
2908, AJ 12909, and AJ 12910 were sent to the Institute of Biotechnology, Institute of Industrial Science and Technology (Postal Code 305, 1-3 Higashi 1-chome, Tsukuba City, Ibaraki Prefecture, Japan) on August 3, 1993, respectively. 13774, FER
MP-13775, FERM P-13776, FER
Deposited as MP-13777, July 1994
Transferred from this original deposit to the international deposit under the Budapest Treaty on 11th of March, with deposit numbers FERM BP-4734 and FERM BP-4.
Deposited as 735, FERM BP-4736, FERM BP-4737.

<3> Method for producing amino acid The amino acid can be produced by culturing the microorganism having the DNA sequence of the present invention in a suitable medium and separating the produced amino acid. As such an amino acid,
L-lysine, L-threonine, L-methionine, L-isoleucine, L-glutamic acid, L-arginine, L-
Proline is mentioned.

The following are examples of suitable hosts and culture methods for introducing the DNA sequence of the present invention and using it for the production of each amino acid.

(1) Suitable host for the method for producing amino acid of the present invention (i) Suitable host for L-lysine production As a host used for L-lysine production according to the present invention, Escherichia bacterium, preferably L-lysine production Sex E. coli. Specifically, a mutant strain having resistance to a lysine analog can be exemplified. This lysine analog is such that it inhibits the growth of microorganisms of the genus Escherichia, but its inhibition is such that if L-lysine coexists in the medium, it is totally or partially released. For example, oxalysine, lysine hydroxamate, S-
(2-aminoethyl) -cysteine (hereinafter, "AEC")
Abbreviated), γ-methyllysine, α-chlorocaprolactam and the like. A mutant strain having resistance to these lysine analogs can be obtained by subjecting a microorganism of the genus Escherichia to a usual artificial mutation operation. Specific examples of strains used for L-lysine production include Escherichia coli AJ.
11442 (deposited as FERM P-5084. See JP-A-56-18596, page 471, lower left column).

On the other hand, various artificial mutants of coryneform bacteria have been used as L-lysine-producing bacteria, and these can be used in the present invention. Such artificial mutants include the following. AEC resistant mutant,
Mutant strains that require amino acids such as L-homoserine for their growth (Japanese Patent Publication Nos. 48-28078 and 56-6).
499), resistant to AEC, and further L-leucine,
Mutant strains requiring amino acids such as L-homoserine, L-proline, L-serine, L-arginine, L-alanine and L-valine (US Pat. Nos. 3,708,395 and 382).
5472), DL-α-amino-ε-caprolactam, α-amino-lauryllactam, quinoids, and L-lysine-producing mutant strains resistant to N-lauroylleucine,
An L-lysine-producing mutant strain resistant to an inhibitor of oxaloacetate decarboxylase (decarboxylase) or a respiratory enzyme (JP-A-50-53588, JP-A-50-31093).
No. 52-102498, No. 53-860.
89, JP-A-55-9783, JP-A-55-975.
9, JP-A-56-32995, JP-A-56-397.
78, Japanese Patent Publication No. 53-43591, Japanese Patent Publication No. 53-18
33), an L-lysine-producing mutant strain that requires inositol or acetic acid (JP-A-55-9784, JP-A-56-56).
8692), fluoropyruvic acid or L-lysine-producing mutants sensitive to temperatures of 34 ° C. or higher (JP-A-55-9783, JP-A-53-86090), and ethylene glycol-resistant. A mutant strain of Brevibacterium or Corynebacterium that produces L-lysine (see US Patent Application No. 333455).

Specific examples of coryneform bacteria used for producing lysine include the following. Brevibacterium lactofermentum AJ 12031 (FERM BP-277) JP 60-62994, page 525, lower left column See Brebebacterium lactofermentum ATCC 39134, JP 60-62994, page 473 lower right See column Blebibacterium lactofermentum AJ 3463 (FERM P-1987) Japanese Patent Publication No. 51-34477. In addition, wild strains of coryneform bacteria shown below can also be used in the present invention.

Corynebacterium acetoacid film ATCC 13870 Corynebacterium acetoglutamicum ATCC 15806 Corynebacterium carnae ATCC 15991 Corynebacterium glutamicum ATCC 13032 ATCC 13060 (Brevibacterium divaricatum) ATCC bacterium 14020・ Lactofermentum) ATCC 13869 (Corynebacterium lyrium) ATCC 15990 Corynebacterium meracecola ATCC 17965 Brevibacterium Saccharoricum ATCC 14066 Brevibacterium inmaliofilm ATCC 14068 Brevibacterium roseum ATCC 13825 Bacterium flava ATCC 13826 Brevibacterium Chiogenitarisu ATCC 19240 micro Corynebacterium ammonia Fi lamb ATCC 15354

(Ii) Suitable host for L-threonine production Escherichia coli B-3996 (RIA 1867) See JP-A-3-501682. Escherichia coli AJ 12349 (FERM P-9574) JP-A-2-458 Publication See page 887, upper left column Escherichia coli AJ 12351 (FERM P-9576) JP 2-458 Publication See page 887, lower right column Escherichia coli AJ 12352 (FERM P-9577) JP 2-458 Escherichia coli AJ 11332 (FERM P-4898) JP 2-458, page 889 Escherichia coli AJ 12350 (FERM P-9575) JP 2-458, JP 889 See upper left column of page Escherichia coli AJ 12353 (FERM P-9578) JP-A-2-458, page 889 See upper right column Escherichia coli AJ 12358 (FERM P-9764) JP-A-2-458, page 890 upper left See column Escherichia coli AJ 12359 (FERM P-9765) JP-A-2-458, page 890, upper left column See Escherichia coli AJ 11334 (FERM P-4900) Japanese Patent Publication No. 1-29559 Report See page 201, column 6 Escherichia coli AJ 11333 (FERM P-4899) Japanese Patent Publication No. 1-29559 See page 201, page 6 column Escherichia coli AJ 11335 (FERM P-4901) Japanese Patent Publication No. 1-29559 See page 202, column 7

Examples of coryneform bacteria include the following strains. Brebebacterium lactofermentum AJ 11188 (FERM P-4190) JP 60-87788 A, page 473, upper right column See Corynebacterium glutamicum AJ 11682 (FERM BP-118) Japanese Patent Publication No. 2-
See No. 31956, page 230, column 8, Brebebacterium flavum AJ 11683 (FERM BP-119) Japanese Patent Publication No. 2-
See 31956, page 231 column 10

(Iii) Suitable host for L-methionine production The following strains can be mentioned for L-methionine production. Escherichia coli AJ 11457 (FERM P-5175) See JP-A-56-35992, page 552, upper right column Escherichia coli AJ 11458 (FERM P-5176) JP-A-56-35992, page 552, upper right column Escherichia coli AJ 11459 (FERM P-5177) JP 56-35992 JP See page 552, upper right column Escherichia coli AJ 11539 (FERM P-5479) JP 56-144092
Japanese Patent Publication No. 435, lower left column Escherichia coli AJ 11540 (FERM P-5480) JP 56-144092
Japanese Patent Publication No. 435, lower left column Escherichia coli AJ 11541 (FERM P-5481) JP 56-144092
Japanese Patent Publication No. 435, lower left column Escherichia coli AJ 11542 (FERM P-5482) JP-A-56-144092
Issue, page 435, lower left column

(Iv) Suitable host for L-aspartic acid production The following strains can be mentioned for L-aspartic acid production. Brevibacterium Flamm AJ 3859 (FERM P-2799) JP-A-51-
See 61689, page 524, upper left column Brebebacterium lactofermentum AJ 3860 (FERM P-2800) JP, A, 51-61689, page 524, upper left column Corynebacterium acetoacetophyllum AJ 3877 (FERM P-2803) JP-A-51-61689, page 524, upper left column Corynebacterium glutamicum AJ 3876 (FERM P-2802) JP-A-51-61
See 61689, page 524, upper left column

(V) Suitable host for L-isoleucine production Escherichia coli KX141 (VKPM-
B4781) (see Japanese Patent Application Laid-Open No. 4-330275, paragraph 45), but as a coryneform bacterium, Brevibacterium lactofermentum AJ 1
2404 (FERM P-10141) (see JP-A-2-42988, page 603, lower left column), Brebebacterium flavum AJ 12405 (FERM P-10
142) (see JP-A-2-42988, page 524, lower left column).

(Vi) Hosts suitable for L-glutamic acid production Examples of Escherichia bacteria include the following strains. Escherichia coli AJ 12628 (FERM P-12380) '93 French patent publication No. 2 680 178 See Escherichia coli AJ 12624 (FERM P-12379) '93 French patent publication No. 2 680 178

Examples of coryneform bacteria include the following strains. Brebebacterium lactofermentum AJ 12745 (FERM BP-2922) JP-A-3-49690 JP See page 561 lower right column Brebebacterium lactofermentum AJ 12746 (FERM BP-2923) JP-A-3-49690 Publication, see page 562, upper left column Brebebacterium lactofermentum AJ 12747 (FERM BP-2924) JP-A-3-49690, see page 562, upper left column Brevibacterium, lactofermentum AJ 12748 (FERM BP-2925) Japanese Unexamined Patent Publication No. 3-49690, page 562, upper left column See Blebibacterium flavum ATCC 14067 Japanese Unexamined Patent Publication No. 5-3793, page 3 Table 1 Corynebacterium glutamicum ATCC 21492 Japanese Unexamined Patent Publication No. 5-3793, page 3 See Table 1

(Vii) Hosts suitable for producing L-arginine Escherichia bacteria include the following strains. Escherichia coli AJ 11593 (FERM P-5616) See JP-A-57-5693, page 468, upper left column Escherichia coli AJ 11594 (FERM P-5617) JP-A-57-5693, page 468, upper right column

Examples of the coryneform bacteria include the following strains. Brekebacterium Flavor AJ 12144 (FERM P-7642) Special Fairness 5-
No. 27388, page 174, column 4, Corynebacterium glutamicum AJ 12145 (FERM P-7643) Japanese Patent Publication 5-
No. 27388, page 174, column 4, Brevibacterium flavum ATCC 21493, Japanese Patent Laid-Open No. 5-3793, page 3, table 1 Corynebacterium glutamicum ATCC 21659, Japanese Patent Laid-Open No. 5-3793, page 3, table 1

(Viii) Suitable host for L-proline production Examples of Escherichia bacteria include the following strains. Escherichia coli AJ 11543 (FERM P-5483) See JP-A-56-144093, page 435, lower left column Escherichia coli AJ 11544 (FERM P-5484), JP-A-56-144093, page 435, lower left column

Examples of coryneform bacteria include the following strains. Brebebacterium lactofermentum AJ 11225 (FERM P-4370) JP 60-87788 A, page 473, upper left column See Brebebacterium flavum AJ 11512 (FERM P-5332) JPB 62
-36679 Gazette, page 185, column 2, see Brevibacterium Ferrum AJ 11513 (FERM P-5333) JPB 62
-36679 gazette, page 185, column 2, see Brevibacterium Flamb AJ 11514 (FERM P-5334) JP-B-62
-36679 gazette, page 185, column 2, see Corynebacterium glutamicum AJ 11522 (FERM P-5342) Japanese Patent Publication No. 62
-36679, page 185, column 2, see Corynebacterium glutamicum AJ 11523 (FERM P-5343) Japanese Patent Publication No. 62
-See 36679, page 185, column 2,

(2) Culturing method The method for culturing the above-mentioned host is not particularly different from the conventional method for culturing amino acid-producing bacteria. That is, the medium is a normal medium containing a carbon source, a nitrogen source, inorganic ions, and if necessary, organic micronutrients such as amino acids and vitamins.

As the carbon source, glucose, sucrose, lactose, etc., and a starch hydrolyzate containing these, whey, molasses, etc. are used. As the nitrogen source, ammonia gas, aqueous ammonia, ammonium salt and the like can be used. When using an auxotrophic mutant strain such as an amino acid as a host, it is necessary to appropriately add nutrients such as amino acid required by the strain to the medium. Table 1 below shows an example of a medium for producing lysine as a medium used for producing amino acids. In addition, calcium carbonate is separately sterilized and then added to other components.

[0068]

[Table 1]

Culturing is carried out under aerobic conditions while appropriately adjusting the pH and temperature of the medium until the production and accumulation of amino acids is substantially stopped. In order to collect the amino acids thus accumulated in the culture medium, a usual method can be applied.

[0070]

EXAMPLES The present invention will be described more specifically below with reference to examples.

[0071]

Example 1 Acquisition of Mutant Phosphoenolpyruvate Carboxylase Gene A plasmid pS2 obtained by inserting the phosphoenolpyruvate carboxylase gene, which has been cloned and whose nucleotide sequence has been determined, into the SalI site of the vector plasmid pBR322 is used. Then, a mutant gene was prepared. pS2 has an ampicillin resistance gene as a drug resistance marker gene (Sabe, H. et a.
L., Gene, 31, 279-283, 1984).

PS2DNA was treated with a hydroxylamine treatment solution (20 μg / ml pS2DNA, 0.05M sodium phosphate (pH 6.0), 1 mM EDTA, 0.4M hydroxylamine) at 75 ° C. for 2 hours. Since the hydroxylamine treatment is affected by pH, 80 μl of 1 M hydroxylamine · HCl, 1 mM EDTA solution adjusted to pH 6.0 with sodium hydroxide,
0.1M sodium phosphate (pH 6.0), 1 mM EDT
TE containing 100 μl of solution A and 2 μg of pS2 DNA
(10 mM Tris-HCl, 1 mM EDTA) buffer was mixed, and the final volume of water was adjusted to 200 μl.

Under the above conditions, when Escherichia coli HB101 was transformed with pS2 after the treatment, the survival rate of the transformant in the ampicillin-containing medium was 0.2% before the treatment.
It is a condition that becomes.

Escherichia coli HB101 was transformed with hydroxylamine-treated pS2 and spread on a plate medium containing ampicillin to obtain transformants of about 10,000 colonies. These are suspended in a liquid medium, and 3-bromopyruvic acid (3
BP), aspartic acid-β-hydrazide (AHY),
DL-threo-β-hydroxyaspartic acid (βH
A plating medium containing any of A) at a concentration near the minimum inhibitory concentration was applied at 10 ³ to 10 ⁵ cells per medium, and growing colonies were selected.

Analog compound resistant strain 1 thus obtained
From 00 strain, The Journal of Biochemistry, Vol.67, N
According to the method described in o.4, 1970, each phosphoenolpyruvate carboxylase produced was roughly purified, and its activity inhibition by analog compounds was examined. The enzyme activity was measured as described above.

Further, a plasmid was isolated from a strain producing a mutant enzyme whose activity was not inhibited by an analog compound, and a phosphoenolpyruvate carboxylase-deficient mutant Escherichia coli PCR1 (Sabe, H. e.
al., Gene, 31, 279-283, 1984), and confirmed that the mutant enzyme was produced.

Thus, 5 strains of transformants having the mutant enzyme gene were obtained. As a result of determining the nucleotide sequences of these genes, two strains had the same mutation and 4
A variety of mutant genes were obtained. Transformants retaining these are AJ 12907, AJ 12908, AJ
12909, named AJ 12910, August 1993
On March 3rd, at the Institute of Biotechnology, Institute of Industrial Science and Technology (zip code 305, 1-3-1 Higashi Tsukuba, Ibaraki, Japan)
FERM P-13774 and FERMP-13, respectively
775, FERM P-13776, FERM P-13
It was deposited as 777, and on July 11, 1994,
Transferred from this original deposit to an international deposit under the Budapest Treaty, deposit numbers FERM BP-4734, FERM BP-4735, FERM BP
-4736, deposited as FERM BP-4737. In addition, the plasmids held by these are pBP5 and pH respectively.
It was named A19, pBP122, pR6. Table 2 shows the mutations in the phosphoenolpyruvate carboxylase gene contained in each plasmid. The numbers in the table represent nucleotide numbers or amino acid numbers in SEQ ID NO: 1.

[0078]

[Table 2]

AJ 12907 and AJ 12909
Is a medium containing 500 μg / ml of 3BP, and AJ 1
2908 is a medium containing 1000 μg / ml βHA, and AJ12910 was selected in a medium containing 500 μg / ml AHY.

[0080]

Example 2 Mutant Phosphoenolpyruvate Carboxylase The sensitivity of phosphoenolpyruvate carboxylase produced by the transformants of the above 4 strains to aspartic acid was examined. Since these strains lack the phosphoenolpyruvate carboxylase gene derived from the host, the phosphoenolpyruvate carboxylase produced is of plasmid origin.

The sensitivity to aspartic acid was determined by a known method (Yoshinaga, T., Izui, K and Katsuki, HJ Bioche.
m., 68, 747-750 (1970)). That is, acetyl coenzyme A, which is known to affect the activity, was present in the activity measurement system at a concentration of 0.1 mM or 1 mM, and the activity of the enzyme produced by Escherichia coli holding each transformant and pS2 was increased. The sensitivity to aspartic acid was measured as shown in FIGS.

From these results, when the concentration of aspartic acid becomes high, the wild-type enzyme loses its activity, whereas the mutant phosphoenolpyruvate carboxylase of the present invention
It is clear that it remains substantially active.

[0083]

Example 3 Fermentative Production of L-Threonine by Escherichia coli Introduced with Mutant Phosphoenolpyruvate Carboxylase B-3 is a threonine producing bacterium of Escherichia coli.
The 996 strain (Japanese Patent Publication No. 3-501682) has the highest production capacity currently known. Therefore, in evaluating mutant phosphoenolpyruvate carboxylase, B-3996 was used as a host.
This B-3996 strain is a Research Institute for Genet
Deposited under the registration number RIA1867 at the ics and Industrial Microorganism Breeding. In addition, pBP5 was selected as the mutant phosphoenolpyruvate carboxylase to be evaluated and subjected to the experiment.

Plasmid pBP5 having a mutant phosphoenolpyruvate carboxylase in Escherichia coli B-3996 was ligated to Hanahan (J. Mol. Biol., Vol. 106,
p577, (1983)) and the transformant was isolated. As a control, pS which is a plasmid expressing the wild-type phosphoenolpyruvate carboxylase gene
2 was similarly transformed into Escherichia coli B-3996.

Escherichia coli B-3996 and its transformant were inoculated into a 500 ml Sakaguchi flask in which 20 ml of the medium having the composition shown in Table 3 was inoculated and the mixture was incubated at 37 ° C. for 4 hours.
When the amount of L-threonine produced was examined by culturing for 0 hour, the results shown in Table 4 were obtained. Incidentally, the medium was 2 minutes and glucose and MgSO ₄ · 7H ₂ O, and other components, after adjusting to pH7.0 with KOH, another after autoclaving 10 minutes at 115 ° C., mixing these 30 g / l of sterilized CaCO ₃ was added.

[0086]

[Table 3]

[0087]

[Table 4]

As is clear from this result, D of the present invention
Escherichia coli B-3996 carrying a mutant enzyme expression plasmid having an NA sequence is Escherichia coli B-39 carrying a plasmid expressing a wild-type enzyme.
Threonine production ability was improved over 96.

[0089]

Example 4 Fermentative Production of L-Glutamic Acid by Escherichia coli Introduced with Mutant Phosphoenolpyruvate Carboxylase Escherichia coli As a glutamic acid-producing bacterium, Escherichia coli AJ 12628 disclosed in Japanese Patent Laid-Open No. 11461/1991 is disclosed. , Has the highest production capacity currently known. Therefore, in evaluating mutant phosphoenolpyruvate carboxylase, AJ
We decided to use 12628 as a host. AJ 12
The 628 strain has been deposited under the registration number FERM BP-3853 at the Institute of Biotechnology, Institute of Biotechnology, Ministry of International Trade and Industry. In addition, pBP5 was selected as the mutant phosphoenolpyruvate carboxylase to be evaluated and subjected to the experiment.

Escherichia coli AJ 12628 plasmid pBP5 having a mutant phosphoenolpyruvate carboxylase in Hanahan (J. Mol. Biol., Vol.
106, p577, (1983)) and the transformant was isolated. Similarly, Escherichia coli by pS2
Transformants of AJ 12628 were isolated.

Plasmid pBP5 having a mutant phosphoenolpyruvate carboxylase in Escherichia coli AJ 12628 was ligated to Hanahan (J. Mol. Biol., Vol.
106, p577, (1983)) and the transformant was isolated. Similarly, Escherichia coli by pS2
Transformants of AJ 12628 were isolated.

Then, these were mixed and then sterilized separately.
CO ₃ was added at 30 g / l.

[0093]

[Table 5]

[0094]

[Table 6]

As is clear from these results, D of the present invention
Escherichia coli AJ 12628 carrying a mutant enzyme expression plasmid having an NA sequence is Escherichia coli AJ carrying a plasmid expressing a wild-type enzyme.
The glutamic acid-producing ability was improved as compared with 12628.

[0096]

Example 5 Production of Lysine by Coryneform Bacteria Introduced with Mutant Phosphoenolpyruvate Carboxylase In order to introduce and express the mutant gene in Coryneform bacteria, a promoter derived from Brevibacterium was obtained and mutated. An expression plasmid was prepared by ligating to the type gene. Further, this was introduced into a bacterium of the genus Brevibacterium to produce L-lysine.

<1> Acquisition of Aspartokinase (AK) Gene Derived from Brevibacterium Bacteria A chromosomal DNA was prepared from Brevibacterium lactofermentum (Corynebacterium glutamicum) wild strain ATCC13869 according to a conventional method. PCR (p
olymerase chain reaction ； White, TJ et al.; Trend
s Genet., 5,185 (1989)). The DNA primer used for amplification was a known sequence (Mole) in Corynebacterium glutamicum.
cular Microbiology (1991) 5 (5), 1197-1204, Mol.Gen.Ge
23. Oligonucleotide (SEQ ID NO: 2) and 21mer (SEQ ID NO: 3) were synthesized to amplify a region of about 1643 bp encoding the AK gene on the basis of net. (1990) 224, 317-324). .

The DNA was synthesized according to a conventional method using a DNA synthesizer model 380B manufactured by Applied Biosystems, using the phosphoamidite method (see Tetrahedron Letters (1981), 22, 1859). PCR reaction is Takara Shuzo Co., Ltd.
Gene amplification was carried out using a DNA thermal cycler model PJ2000 manufactured by Taq DNA polymerase according to the method specified by the supplier.

After confirming the amplified 1643 kb gene fragment by agarose gel electrophoresis, the fragment excised from the gel was purified by a conventional method and the restriction enzyme NruI (Takara Shuzo Co., Ltd.) was used.
And manufactured by EcoRI (manufactured by Takara Shuzo Co., Ltd.). PHSG399 (Takeshit
a, S. et al .; Gene (1987), 61, 63-74). pH
SG399 as restriction enzyme SmaI (Takara Shuzo Co., Ltd.) and restriction enzyme E
It was cut with coRI and ligated with the amplified AK gene fragment.

The DNA was connected using a DNA ligation kit (Takara Shuzo Co., Ltd.) by the designated method. In this way, a plasmid in which pHAK399 was connected with the AK gene fragment amplified from the Brevibacterium chromosome was prepared. The plasmid having the AK gene derived from the wild strain ATCC13869 was named p399AKY.

<2> Determination of nucleotide sequence of AK gene of Brevibacterium lactofermentum AK plasmid p399AKY was prepared and the nucleotide sequence of AK gene was determined. The nucleotide sequence can be determined by the method of Sanger et al. (F. Sanger et al: Proc.Natl.Acad.Sci. USA, 74,54.
63 (1977) etc.). The results are shown in SEQ ID NO: 4 in the sequence listing. The DNA fragment has two open reading frames, each of which corresponds to the α and β subunits of AK. The amino acid sequence corresponding to each open reading frame,
It is shown in SEQ ID NO: 4 and SEQ ID NO: 5.

<3> Preparation of phosphoenolpyruvate carboxylase-expressing plasmid pS2, which is a plasmid that retains the wild-type phosphoenolpyruvate carboxylase gene, and pBP5, which is a plasmid that retains the obtained mutant phosphoenolpyruvate carboxylase gene. About 4.4 containing the phosphoenolpyruvate carboxylase gene
The SalI fragment of kb was extracted and introduced into the SalI site of the plasmid vector pHSG399 widely used in E. coli. The prepared plasmid was designated as pHS2 for the wild type and pHBP5 for the mutant type.

In order to make pHS2 and pHBP5 into plasmids expressed in Brevibacterium, a promoter functioning in Brevibacterium and an origin of replication of plasmids were introduced. The promoter is presumed to be the promoter region of the cloned AK gene,
207th ApaLI from the 1st NruI site in the nucleotide sequence
The gene fragment including the site was extracted from p399AKY and p
It was inserted into the AvaI site located approximately 60 bp before the HS2 and pHBP5 structural genes so that the transcription direction was the forward direction.

Furthermore, a gene fragment that enables autonomous growth of the plasmid in Brevibacterium, that is, an origin of replication of the plasmid was introduced into a site on the vector. The gene fragment containing the origin of replication of the plasmid is described in the vector for Brevibacterium pHC4 (see paragraph No. 10 of JP-A-5-7491, Escherichia coli AJ 12036 carrying the plasmid is Institute for Microbiological Engineering, Institute of Industrial Science and Technology). , And the restriction enzyme sites at both ends were modified to PstI sites by introducing linkers.

This fragment was designated as Ps, which is the vector part of the plasmid to which the Brevibacterium promoter had been added.
Introduced to the tI site. The constructed expression type phosphoenolpyruvate carboxylase plasmid was named as pS2 derived wild type phosphoenolpyruvate carboxylase plasmid, pHS2B, and pBP5 derived mutant form phosphoenolpyruvate carboxylase plasmid was named pHBP5B.

<4> Production of L-Lysine Using Phosphoenolpyruvate Carboxylase Expression Plasmid The pHS2B and pHBP5B thus prepared were respectively produced by Brevibacterium lactofermentum L-lysine producing AJ 3463 (Japanese Patent Publication No. No. 34477). The gene was introduced by a transformation method using electric pulse (see Japanese Patent Laid-Open No. 2-207791). The host and the transformant were subjected to shaking culture at 31.5 ° C. for 72 hours in the lysine production medium having the composition shown in Table 7. Of the components listed in the table, 1 mL of water other than CaCO ₃ was added to the medium, pH was adjusted to 8.0 with KOH, and autoclaving was performed at 115 ° C. for 15 minutes, followed by dry heat sterilized CaCO ₃ further. It was prepared by adding. Table 8 shows the amount of L-lysine accumulated in the medium after culturing.

[0107]

[Table 7]

[0108]

[Table 8]

As shown in these results, the DN of the present invention
Brevibacterium lactofermentum AJ 346 carrying a mutant enzyme expression plasmid having an A sequence
3 is Brevibacterium lactofermentum AJ 3463 carrying a plasmid expressing the wild-type enzyme.
The lysine productivity was improved.

[0110]

The DNA sequence of the present invention encodes a mutant phosphoenolpyruvate carboxylase,
Microorganisms carrying the NA sequence produce the enzyme.

Since the mutant phosphoenolpyruvate carboxylase of the present invention is not substantially inhibited by aspartate activity, it can be used for fermentation production of amino acids whose biosynthesis is regulated by aspartate.

[0112]

[Sequence Listing] Sequence number: 1 Sequence length: 3106 Sequence type: Nucleic acid Number of strands: Double strand Topology: Circular Sequence type: Genomic DNA Origin Biological name: Escherichia coli Strain name: Sequence features: CDS existing position: 239..2890 sequence TTACTTGGGG CGATTTTTTA ACATTTCCAT AAGTTACGCT TATTTAAAGC GTCGTGAATT 60 TAATGACGTA AATTCCTGCT ATTTATTCGT TTGCTGAAGC GATTTCGCAG CATTTGACGT 120 CACCGCTTTT ACGTGGCTTT ATAAAAGACG ACGAAAAGCA AAGCCCGAGC ATATTCGCGC 180 CAATGCGACG TGAAGGATAC AGGGCTATCA AACGATAAGA TGGGGTGTCT GGGGTAAT 238 ATG AAC GAA CAA TAT TCC GCA TTG CGT AGT AAT GTC AGT ATG CTC GGC 286 Met Asn Glu Gln Tyr Ser Ala Leu Arg Ser Asn Val Ser Met Leu Gly 1 5 10 15 AAA GTG CTG GGA GAA ACC ATC AAG GAT GCG TTG GGA GAA CAC ATT CTT 334 Lys Val Leu Gly Glu Thr Ile Lys Asp Ala Leu Gly Glu His Ile Leu 20 25 30 GAA CGC GTA GAA ACT ATC CGT AAG TTG TCG AAA TCT TCA CGC GCT GGC 382 Glu Arg Val Glu Thr Ile Arg Lys Leu Ser Lys Ser Ser Arg Ala Gly 35 40 45 AAT GAT GCT AA C CGC CAG GAG TTG CTC ACC ACC TTA CAA AAT TTG TCG 430 Asn Asp Ala Asn Arg Gln Glu Leu Leu Thr Thr Leu Gln Asn Leu Ser 50 55 60 AAC GAC GAG CTG CTG CCC GTT GCG CGT GCG TTT AGT CAG TTC CTG AAC 478 Asn Asp Glu Leu Leu Pro Val Ala Arg Ala Phe Ser Gln Phe Leu Asn 65 70 75 80 CTG GCC AAC ACC GCC GAG CAA TAC CAC AGC ATT TCG CCG AAA GGC GAA 526 Leu Ala Asn Thr Ala Glu Gln Tyr His Ser Ile Ser Pro Lys Gly Glu 85 90 95 GCT GCC AGC AAC CCG GAA GTG ATC GCC CGC ACC CTG CGT AAA CTG AAA 574 Ala Ala Ser Asn Pro Glu Val Ile Ala Arg Thr Leu Arg Lys Leu Lys 100 105 110 AAC CAG CCG GAA CTG AGC GAA GAC ACC ATC AAA AAA GCA GTG GAA TCG 622 Asn Gln Pro Glu Leu Ser Glu Asp Thr Ile Lys Lys Ala Val Glu Ser 115 120 125 CTG TCG CTG GAA CTG GTC CTC ACG GCT CAC CCA ACC GAA ATT ACC CGT 670 Leu Ser Leu Glu Leu Val Leu Thr Ala His Pro Thr Glu Ile Thr Arg 130 135 140 CGT ACA CTG ATC CAC AAA ATG GTG GAA GTG AAC GCC TGT TTA AAA CAG 718 Arg Thr Leu Ile His Lys Met Val Glu Val Asn Ala Cys Leu Lys Gln 145 150 155 160 CTC GAT AAC AAA GAT ATC GCT GAC TAC GAA CAC AAC CAG CTG ATG CGT 766 Leu Asp Asn Lys Asp Ile Ala Asp Tyr Glu His Asn Gln Leu Met Arg 165 170 175 CGC CTG CGC CAG TTG ATC GCC CAG TCA TGG CAT ACC GAT GAA ATC CGT 814 Arg Leu Arg Gln Leu Ile Ala Gln Ser Trp His Thr Asp Glu Ile Arg 180 185 190 AAG CTG CGT CCA AGC CCG GTA GAT GAA GCC AAA TGG GGC TTT GCC GTA 862 Lys Leu Arg Pro Ser Pro Val Asp Glu Ala Lys Trp Gly Phe Ala Val 195 200 205 GTG GAA AAC AGC CTG TGG CAA GGC GTA CCA AAT TAC CTG CGC GAA CTG 910 Val Glu Asn Ser Leu Trp Gln Gly Val Pro Asn Tyr Leu Arg Glu Leu 210 215 220 AAC GAA CAA CTG GAA GAG AAC CTC GGC TAC AAA CTG CCC GTC GAA TTT 958 Asn Glu Gln Leu Glu Glu Asn Leu Gly Tyr Lys Leu Pro Val Glu Phe 225 230 235 240 GTT CCG GTC CGT TTT ACT TCG TGG ATG GGC GGC GAC CGC GAC GGC AAC 1006 Val Pro Val Arg Phe Thr Ser Trp Met Gly Gly Asp Arg Asp Gly Asn 245 250 255 CCG AAC GTC ACT GCC GAT ATC ACC CGC CAC GTC CTG CTA CTC AGC CGC 1054 Pro Asn Val Thr Ala Asp Ile Thr Arg His Val Leu Leu Leu Ser Arg 260 2 65 270 TGG AAA GCC ACC GAT TTG TTC CTG AAA GAT ATT CAG GTG CTG GTT TCT 1102 Trp Lys Ala Thr Asp Leu Phe Leu Lys Asp Ile Gln Val Leu Val Ser 275 280 285 GAA CTG TCG ATG GTT GAA GCG ACC CCT GAA CTG CTG GCG CTG GTT GGC 1150 Glu Leu Ser Met Val Glu Ala Thr Pro Glu Leu Leu Ala Leu Val Gly 290 295 300 GAA GAA GGT GCC GCA GAA CCG TAT CGC TAT CTG ATG AAA AAC CTG CGT 1198 Glu Glu Gly Ala Ala Glu Pro Tyr Arg Tyr Leu Met Lys Asn Leu Arg 305 310 315 320 TCT CGC CTG ATG GCG ACA CAG GCA TGG CTG GAA GCG CGC CTG AAA GGC 1246 Ser Arg Leu Met Ala Thr Gln Ala Trp Leu Glu Ala Arg Leu Lys Gly 325 330 335 GAA GAA CTG CCA AAA CCA GAA GGC CTG CTG ACA CAA AAC GAA GAA CTG 1294 Glu Glu Leu Pro Lys Pro Glu Gly Leu Leu Thr Gln Asn Glu Glu Leu 340 345 350 TGG GAA CCG CTC TAC GCT TGC TAC CAG TCA CTT CAG GCG TGT GGC ATG 1342 Trp Glu Pro Leu Tyr Ala Cys Tyr Gln Ser Leu Gln Ala Cys Gly Met 355 360 365 GGT ATT ATC GCC AAC GGC GAT CTG CTC GAC ACC CTG CGC CGC GTG AAA 1390 Gly Ile Ile Ala Asn Gly Asp Leu Leu Asp Thr Leu Ar g Arg Val Lys 370 375 380 TGT TTC GGC GTA CCG CTG GTC CGT ATT GAT ATC CGT CAG GAG AGC ACG 1438 Cys Phe Gly Val Pro Leu Val Arg Ile Asp Ile Arg Gln Glu Ser Thr 385 390 395 400 CGT CAT ACC GAA GCG CTG GGC GAG CTG ACC CGC TAC CTC GGT ATC GGC 1486 Arg His Thr Glu Ala Leu Gly Glu Leu Thr Arg Tyr Leu Gly Ile Gly 405 410 415 GAC TAC GAA AGC TGG TCA GAG GCC GAC AAA CAG GCG TTC CTG ATC CGC 1534 Asp Tyr Glu Ser Trp Ser Glu Ala Asp Lys Gln Ala Phe Leu Ile Arg 420 425 430 GAA CTG AAC TCC AAA CGT CCG CTT CTG CCG CGC AAC TGG CAA CCA AGC 1582 Glu Leu Asn Ser Lys Arg Pro Leu Leu Pro Arg Asn Trp Gln Pro Ser 435 440 445 GCC GAA ACG CGC GAA GTG CTC GAT ACC TGC CAG GTG ATT GCC GAA GCA 1630 Ala Glu Thr Arg Glu Val Leu Asp Thr Cys Gln Val Ile Ala Glu Ala 450 455 460 CCG CAA GGC TCC ATT GCC GCC TAC GTG ATC TCG ATG GCG AAA ACG CCG 1678 Pro Gln Gly Ser Ile Ala Ala Tyr Val Ile Ser Met Ala Lys Thr Pro 465 470 475 480 TCC GAC GTA CTG GCT GTC CAC CTG CTG CTG AAA GAA GCG GGT ATC GGG 1726 Ser Asp Val Leu Ala Val Hi s Leu Leu Leu Lys Glu Ala Gly Ile Gly 485 490 495 TTT GCG ATG CCG GTT GCT CCG CTG TTT GAA ACC CTC GAT GAT CTG AAC 1774 Phe Ala Met Pro Val Ala Pro Leu Phe Glu Thr Leu Asp Asp Leu Asn 500 505 510 AAC GCC AAC GAT GTC ATG ACC CAG CTG CTC AAT ATT GAC TGG TAT CGT 1822 Asn Ala Asn Asp Val Met Thr Gln Leu Leu Asn Ile Asp Trp Tyr Arg 515 520 525 GGC CTG ATT CAG GGC AAA CAG ATG GTG ATG ATT GGC TAT TCC GAC TCA 1870 Gly Leu Ile Gln Gly Lys Gln Met Val Met Ile Gly Tyr Ser Asp Ser 530 535 540 GCA AAA GAT GCG GGA GTG ATG GCA GCT TCC TGG GCG CAA TAT CAG GCA 1918 Ala Lys Asp Ala Gly Val Met Ala Ala Ser Trp Ala Gln Tyr Gln Ala 545 550 555 560 CAG GAT GCA TTA ATC AAA ACC TGC GAA AAA GCG GGT ATT GAG CTG ACG 1966 Gln Asp Ala Leu Ile Lys Thr Cys Glu Lys Ala Gly Ile Glu Leu Thr 565 570 575 TTG TTC CAC GGT CGC GGC GGT TCC ATT GGT CGC GGC GGC GCA CCT GCT 2014 Leu Phe His Gly Arg Gly Gly Ser Ile Gly Arg Gly Gly Ala Pro Ala 580 585 590 CAT GCG GCG CTG CTG TCA CAA CCG CCA GGA AGC CTG AAA GGC GGC CTG 2062 His Ala Ala Leu Leu Ser Gln Pro Pro Gly Ser Leu Lys Gly Gly Leu 595 600 605 CGC GTA ACC GAA CAG GGC GAG ATG ATC CGC TTT AAA TAT GGT CTG CCA 2110 Arg Val Thr Glu Gln Gly Glu Met Ile Arg Phe Lys Tyr Gly Leu Pro 610 615 620 GAA ATC ACC GTC AGC AGC CTG TCG CTT TAT ACC GGG GCG ATT CTG GAA 2158 Glu Ile Thr Val Ser Ser Leu Ser Leu Tyr Thr Gly Ala Ile Leu Glu 625 630 635 640 GCC AAC CTG CTG CCA CCG CCG GAG CCG AAA GAG AGC TGG CGT CGC ATT 2206 Ala Asn Leu Leu Prou Pro Pro Glu Pro Lys Glu Ser Trp Arg Arg Ile 645 650 655 ATG GAT GAA CTG TCA GTC ATC TCC TGC GAT GTC TAC CGC GGC TAC GTA 2254 Met Asp Glu Leu Ser Val Ile Ser Cys Asp Val Tyr Arg Gly Tyr Val 660 665 670 CGT GAA AAC AAA GAT TTT GTG CCT TAC TTC CGC TCC GCT ACG CCG GAA 2302 Arg Glu Asn Lys Asp Phe Val Pro Tyr Phe Arg Ser Ala Thr Pro Glu 675 680 685 CAA GAA CTG GGC AAA CTG CCG TTG GGT TCA CGT CCG GCG AAA CGT CGC 2350 Gln Glu Leu Gly Lys Leu Pro Leu Gly Ser Arg Pro Ala Lys Arg Arg 690 695 700 CCA ACC GGC GGC GTC GAG TCA CTA CGC GCC ATT CCG TGG ATC T TC GCC 2398 Pro Thr Gly Gly Val Glu Ser Leu Arg Ala Ile Pro Trp Ile Phe Ala 705 710 715 720 TGG ACG CAA AAC CGT CTG ATG CTC CCC GCC TGG CTG GGT GCA GGT ACG 2446 Trp Thr Gln Asn Arg Leu Met Leu Pro Ala Trp Leu Gly Ala Gly Thr 725 730 735 GCG CTG CAA AAA GTG GTC GAA GAC GGC AAA CAG AGC GAG CTG GAG GCT 2494 Ala Leu Gln Lys Val Val Glu Asp Gly Lys Gln Ser Glu Leu Glu Ala 740 745 750 ATG TGC CGC GAT TGG CCA TTC TTC TCG ACG CGT CTC GGC ATG CTG GAG 2542 Met Cys Arg Asp Trp Pro Phe Phe Ser Thr Arg Leu Gly Met Leu Glu 755 760 765 ATG GTC TTC GCC AAA GCA GAC CTG TGG CTG GCG GAA TAC TAT GAC CAA 2590 Met Val Phe Ala Lys Ala Asp Leu Trp Leu Ala Glu Tyr Tyr Asp Gln 770 775 780 CGC CTG GTA GAC AAA GCA CTG TGG CCG TTA GGT AAA GAG TTA CGC AAC 2638 Arg Leu Val Asp Lys Ala Leu Trp Pro Leu Gly Lys Glu Leu Arg Asn 785 790 795 800 CTG CAA GAA GAA GAC ATC AAA GTG GTG CTG GCG ATT GCC AAC GAT TCC 2686 Leu Gln Glu Glu Asp Ile Lys Val Val Leu Ala Ile Ala Asn Asp Ser 805 810 815 CAT CTG ATG GCC GAT CTG CCG TGG AT T GCA GAG TCT ATT CAG CTA CGG 2734 His Leu Met Ala Asp Leu Pro Trp Ile Ala Glu Ser Ile Gln Leu Arg 820 825 830 AAT ATT TAC ACC GAC CCG CTG AAC GTA TTG CAG GCC GAG TTG CTG CAC 2782 Asn Ile Tyr Thr Asp Pro Leu Asn Val Leu Gln Ala Glu Leu Leu His 835 840 845 CGC TCC CGC CAG GCA GAA AAA GAA GGC CAG GAA CCG GAT CCT CGC GTC 2830 Arg Ser Arg Gln Ala Glu Lys Glu Gly Gln Glu Pro Asp Pro Arg Val 850 855 860 GAA CAA GCG TTA ATG GTC ACT ATT GCC GGG ATT GCG GCA GGT ATG CGT 2878 Glu Gln Ala Leu Met Val Thr Ile Ala Gly Ile Ala Ala Gly Met Arg 865 870 875 880 AAT ACC GGC TAATCTTCCT CTTCTGCAAA CCCTCGAGAT927n CTLA TTCTAACACC CTCGTTTTCA ATATATTTCT GTCTGCATTT 2987 TATTCAAATT CTGAATATAC CTTCAGATAT CCTTAAGGAA TTGTCGTTAC ATTCGGCGAT 3047 ATTTTTTCAA GACAGGTTCT TACTATGCAT TCCACAGAAG TCCAGGCTAA ACCTCTTTT 3106

SEQ ID NO: 2 Sequence Length: 23 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA TCGCGAAGTA GCACCTGTCA CTT 23

SEQ ID NO: 3 Sequence Length: 21 Sequence Type: Nucleic Acid Number of Strands: Single Strand Topology: Linear Sequence Type: Other Nucleic Acid Synthetic DNA Sequence ACGGAATTCA ATCTTACGGC C 21

SEQ ID NO: 4 Sequence length: 1643 Sequence type: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: Genomic DNA Origin organism name: Corynebacterium glutami
cum) Strain name: ATCC13869 Sequence characteristics: mat peptide Location: 217..1482 Method by which the characteristics were determined: S sequence TCGCGAAGTA GCACCTGTCA CTTTTGTCTC AAATATTAAA TCGAATATCA ATATACGGTC 60 TGTTTATTCACACAGAAACGCATCCC AGTGGCTGAG ACGCATCCGC TAAAGCCCCA GGAACCCT 120 CGAAAGGTGC ACAAAG GTG GCC CTG GTC GTA CAG 234 Met Ala Leu Val Val Gln 1 5 5 AAA TAT GGC GGT TCC TCG CTT GAG AGT GCG GAA CGC ATT AGA AAC GTC 282 Lys Tyr Gly Gly Ser Ser Leu Glu Ser Ala Glu Arg Ile Arg Asn Val 10 15 20 GCT GAA CGG ATC GTT GCC ACC AAG AAG GCT GGA AAT GAT GTC GTG GTT 330 Ala Glu Arg Ile Val Ala Thr Lys Lys Ala Gly Asn Asp Val Val Val 30 30 GTC TGC TCC GCA ATG GGA GAC ACC ACG GAT GAA CTT CTA GAA CTT GCA 378 Val Cys Ser Ala Met Gly Asp Thr Thr Asp Glu Leu Leu Glu Leu Ala 40 45 50 GCG GCA GTG AAT CCC GTT CCG CCA GCT CGT GAA ATG GAT ATG CTC CTG 426 Ala Ala Val Asn Pro Val Pro Pro Ala Arg Glu Met Asp Met Leu Leu 55 60 65 70 ACT GCT GG T GAG CGT ATT TCT AAC GCT CTC GTC GCC ATG GCT ATT GAG 474 Thr Ala Gly Glu Arg Ile Ser Asn Ala Leu Val Ala Met Ala Ile Glu 75 80 85 TCC CTT GGC GCA GAA GCT CAA TCT TTC ACT GGC TCT CAG GCT GGT GTG 522 Ser Leu Gly Ala Glu Ala Gln Ser Phe Thr Gly Ser Gln Ala Gly Val 90 95 100 CTC ACC ACC GAG CGC CAC GGA AAC GCA CGC ATT GTT GAC GTC ACA CCG 570 Leu Thr Thr Glu Arg His Gly Asn Ala Arg Ile Val Asp Val Thr Pro 105 110 115 GGT CGT GTG CGT GAA GCA CTC GAT GAG GGC AAG ATC TGC ATT GTT GCT 618 Gly Arg Val Arg Glu Ala Leu Asp Glu Gly Lys Ile Cys Ile Val Ala 120 125 130 GGT TTT CAG GGT GTT AAT AAA GAA ACC CGC GAT GTC ACC ACG TTG GGT 666 Gly Phe Gln Gly Val Asn Lys Glu Thr Arg Asp Val Thr Thr Leu Gly 135 140 145 150 CGT GGT GGT TCT GAC ACC ACT GCA GTT GCG TTG GCA GCT GCT TTG AAC 714 Arg Gly Gly Ser Asp Thr Thr Ala Val Ala Leu Ala Ala Ala Leu Asn 155 160 165 GCT GAT GTG TGT GAG ATT TAC TCG GAC GTT GAC GGT GTG TAT ACC GCT 762 Ala Asp Val Cys Glu Ile Tyr Ser Asp Val Asp Gly Val Tyr Thr Ala 170 175 180 GAC CCG CGC ATC GTT CCT AAT GCA CAG AAG CTG GAA AAG CTC AGC TTC 810 Asp Pro Arg Ile Val Pro Asn Ala Gln Lys Leu Glu Lys Leu Ser Phe 185 190 195 GAA GAA ATG CTG GAA CTT GCT GCT GTT GGC TCC AAG ATT TTG GTG CTG 858 Glu Glu Met Leu Glu Leu Ala Ala Val Gly Ser Lys Ile Leu Val Leu 200 205 210 CGC AGT GTT GAA TAC GCT CGT GCA TTC AAT GTG CCA CTT CGC GTA CGC 906 Arg Ser Val Glu Tyr Ala Arg Ala Phe Asn Val Pro Leu Arg Val Arg 215 220 225 230 TCG TCT TAT AGT AAT GAT CCC GGC ACT TTG ATT GCC GGC TCT ATG GAG 954 Ser Ser Tyr Ser Asn Asp Pro Gly Thr Leu Ile Ala Gly Ser Met Glu 235 240 245 GAT ATT CCT GTG GAA GAA GCA GTC CTT ACC GGT GTC GCA ACC GAC AAG 1002 Asp Ile Pro Val Glu Glu Ala Val Leu Thr Gly Val Ala Thr Asp Lys 250 255 260 TCC GAA GCC AAA GTA ACC GTT CTG GGT ATT TCC GAT AAG CCA GGC GAG 1050 Ser Glu Ala Lys Val Thr Val Leu Gly Ile Ser Asp Lys Pro Gly Glu 265 270 275 GCT GCC AAG GTT TTC CGT GCG TTG GCT GAT GCA GAA ATC AAC ATT GAC 1098 Ala Ala Lys Val Phe Arg Ala Leu Ala Asp Ala Glu Ile Asn Ile Asp 280 285 290 ATG GTT CTG CAG AAC GTC TCC TCT GTG GAA GAC GGC ACC ACC GAC ATC 1146 Met Val Leu Gln Asn Val Ser Ser Val Glu Asp Gly Thr Thr Asp Ile 295 300 305 310 ACG TTC ACC TGC CCT CGC GCT GAC GGA CGC CGT GCG ATG GAG ATC TTG 1194 Thr Phe Thr Cys Pro Arg Ala Asp Gly Arg Arg Ala Met Glu Ile Leu 315 320 325 AAG AAG CTT CAG GTT CAG GGC AAC TGG ACC AAT GTG CTT TAC GAC GAC 1242 Lys Lys Leu Gln Val Gln Gly Asn Trp Thr Asn Val Leu Tyr Asp Asp 330 335 340 CAG GTC GGC AAA GTC TCC CTC GTG GGT GCT GGC ATG AAG TCT CAC CCA 1290 Gln Val Gly Lys Val Ser Leu Val Gly Ala Gly Met Lys Ser His Pro 345 350 355 GGT GTT ACC GCA GAG TTC ATG GAA GCT CTG CGC GAT GTC AAC GTG AAC 1338 Gly Val Thr Ala Glu Phe Met Glu Ala Leu Arg Asp Val Asn Val Asn 360 365 370 ATC GAA TTG ATT TCC ACC TCT GAG ATC CGC ATT TCC GTG CTG ATC CGT 1386 Ile Glu Leu Ile Ser Thr Ser Glu Ile Arg Ile Ser Val Leu Ile Arg 375 380 385 390 GAA GAT GAT CTG GAT GCT GCT GCA CGT GCA TTG CAT GAG CAG TTC CAG 1434 Glu Asp Asp Leu Asp Ala Ala Ala Arg Ala L eu His Glu Gln Phe Gln 395 400 405 CTG GGC GGC GAA GAC GAA GCC GTC GTT TAT GCA GGC ACC GGA CGC TAA 1482 Leu Gly Gly Glu Asp Glu Ala Val Val Tyr Ala Gly Thr Gly Arg 410 415 420 421 AGTTTTAAAG GAGTAGTTTT ACAATGA CTT ACCGGCCAGG 1542 TCGGCCAGGT TATGCGCACC CTTTTGGAAG AGCGCAATTT CCCAGCTGAC ACTGTTCGTT 1602 TCTTTGCTTC CCCGCGTTCC GCAGGCCGTA AGATTGAATT C 1643

SEQ ID NO: 5 Sequence length: 1643 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: genomic DNA Origin organism name: Corynebacterium glutami
cum) Strain name: ATCC13869 Sequence characteristics: mat peptide Location: 964..1482 Method by which the characteristics were determined: S sequence TCGCGAAGTA GCACCTGTCA CTTTTGTCTC AAATATTAAA TCGAATATCA ATATACGGTC 60 TGTTTATTCACAGAGAACACCATCCC AGTGGCTGAG ACGCATCCGC TAAAGCCCCA GGAACCCT 120 ACT. CGAAAGGTGC ACAAAGGTGG CCCTGGTCGT ACAGAAATAT 240 GGCGGTTCCT CGCTTGAGAG TGCGGAACGC ATTAGAAACG TCGCTGAACG GATCGTTGCC 300 ACCAAGAAGG CTGGAAATGA TGTCGTGGTT GTCTGCTCCG CAATGGGAGA CACCACGGAT 360 GAACTTCTAG AACTTGCAGC GGCAGTGAAT CCCGTTCCGC CAGCTCGTGA AATGGATATG 420 CTCCTGACTG CTGGTGAGCG TATTTCTAAC GCTCTCGTCG CCATGGCTAT TGAGTCCCTT 480 GGCGCAGAAG CTCAATCTTT CACTGGCTCT CAGGCTGGTG TGCTCACCAC CGAGCGCCAC 540 GGAAACGCAC GCATTGTTGA CGTCACACCG GGTCGTGTGC GTGAAGCACT CGATGAGGGC 600 AAGATCTGCA TTGTTGCTGG TTTTCAGGGT GTTAATAAAG AAACCCGCGA TGTCACCACG 660 TTGGGTCGTG GTGGTTCTGA CACCACTGCA GTTGCGTTGG CAGCTGCTTT GAACGCTGAT 720 GTGTGTGAGA TTTACTCGGA CGTTGACGGT GTGTATACCG CTGACCCGCG CATCGTTCCT 780 AATGCACAGA AGCTGGAAAA GCTCAGCTTC GAAGAAATGC TGGAACTTGC TGCTGTTGGC 840 TCCAAGATTT TGGTGCTGCG CAGTGTTGAA TACGCTCGTG CATTCAATGT GCCACTTCGC 900 GTACGCTCGT CTTATAGTAA TGATCCCGGC ACTTTGATTG CCGGCTCTAT GGAGGATATT 960 CCT GTG GAA GAA GCA GTC CTT ACC GGT GTC GCA ACC GAC AAG TCC GAA 1008 Met Glu Glu Ala Val Leu Thr Gly Val Ala Thr Asp Lys Ser Glu 1 5 10 15 GCC AAA GTA ACC GTT CTG GGT ATT TCC GAT AAG CCA GGC GAG GCT GCC 1056 Ala Lys Val Thr Val Leu Gly Ile Ser Asp Lys Pro Gly Glu Ala Ala 20 25 30 AAG GTT TTC CGT GCG TTG GCT GAT GCA GAA ATC AAC ATT GAC ATG GTT 1104 Lys Val Phe Arg Ala Leu Ala Asp Ala Glu Ile Asn Ile Asp Met Val 35 40 45 CTG CAG AAC GTC TCC TCT GTG GAA GAC GGC ACC ACC GAC ATC ACG TTC 1152 Leu Gln Asn Val Ser Ser Val Glu Asp Gly Thr Thr Asp Ile Thr Phe 50 55 60 ACC TGC CCT CGC GCT GAC GGA CGC CGT GCG ATG GAG ATC TTG AAG AAG 1200 Thr Cys Pro Arg Ala Asp Gly Arg Arg Ala Met Glu Ile Leu Lys Lys 65 70 75 CTT CAG GTT CAG GGC AAC TGG ACC AAT GTG CTT TAC GAC GAC CAG GTC 1248 Leu Gln Val Gln Gly Asn Trp Thr Asn Val Leu Tyr Asp Asp Gln Val 80 85 90 95 GGC AAA GTC TCC CTC GTG GGT GCT GGC ATG AAG TCT CAC CCA GGT GTT 1296 Gly Lys Val Ser Leu Val Gly Ala Gly Met Lys Ser His Pro Gly Val 100 105 110 ACC GCA GAG TTC ATG GAA GCT CTG CGC GAT GTC AAC GTG AAC ATC GAA 1344 Thr Ala Glu Phe Met Glu Ala Leu Arg Asp Val Asn Val Asn Ile Glu 115 120 125 TTG ATT TCC ACC TCT GAG ATC CGC ATT TCC GTG CTG ATC CGT GAA GAT 1392 Leu Ile Ser Thr Ser Glu Ile Arg Ile Ser Val Leu Ile Arg Glu Asp 130 135 140 GAT CTG GAT GCT GCT GCA CGT GCA TTG CAT GAG CAG TTC CAG CTG GGC 1440 Asp Leu Asp Ala Ala Ala Arg Ala Leu His Glu Gln Phe Gln Leu Gly 145 150 155 GGC GAA GAC GAA GCC GTC GTT TAT GCA GGC ACC GGA CGC TAAAGTTTTAA 1490 Gly Glu Asp Glu Ala Val Val Tyr Ala Gly Thr Gly Arg 160 165 170 TT 172 AGG TTACAATGAC CACCATCGCA GTTGTTGGTG CAACCGGCCA GGTCGGCCAG 1550 GTTATGCGCA CCCTTTTGGA AGAGCGCAAT TTCCCAGCTG ACACTGTTCG TTTCTTTGCT 1610 TCCCCGCGTT CCGCAGGCCG TAAGATTGAA TTC 1643

[0117]

[Brief description of drawings]

FIG. 1 is a view showing growth inhibition by 3-bromopyruvic acid.

FIG. 2 is a view showing growth inhibition by aspartic acid-β-hydrazide.

FIG. 3 is a view showing growth inhibition by DL-threo-β-hydroxyaspartic acid.

FIG. 4 is a graph showing the effect of an inhibitory recovery substance on 3-bromopyruvic acid.

FIG. 5 is a graph showing the effect of an inhibitory recovery substance on aspartic acid-β-hydrazide.

FIG. 6 is a graph showing the effect of an inhibitor / restorative substance on DL-threo-β-hydroxyaspartic acid.

FIG. 7: Effect of growth recovery factors on growth.

FIG. 8 is a graph showing inhibition of growth inhibitory substances on phosphoenolpyruvate carboxylase activity.

FIG. 9 shows the inhibition of phosphoenolpyruvate carboxylase of the present invention by aspartic acid.

FIG. 10 shows the inhibition of phosphoenolpyruvate carboxylase of the present invention by aspartic acid.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C12R 1: 185) (C12N 9/00 C12R 1:01) (C12N 15/09 ZNA C12R 1: 185) ) C12R 1: 185)

Claims (12)

[Claims] 1. A phosphoenolpyruvate carboxylase derived from a microorganism belonging to the genus Escherichia, which has a mutation that cancels the feedback inhibition of phosphoenolpyruvate carboxylase by aspartic acid. 2. The mutant phosphoenolpyruvate carboxylase according to claim 1, which, when present in the cells of a microorganism belonging to the genus Escherichia, imparts resistance to a compound having the following properties. It exhibits a growth inhibitory action against a wild strain of the microorganism, and the growth inhibitory action is restored by the presence of L-glutamic acid or L-aspartic acid, and inhibits the wild-type phosphoenolpyruvate carboxylase activity. 3. The compound is 3-bromopyruvic acid,
Aspartic acid-β-hydrazide, DL-threo-β-
3. The mutant phosphoenolpyruvate carboxylase according to claim 2, which is selected from hydroxyaspartic acid. 4. The mutant phosphoenolpyruvate carboxylase according to claim 1, wherein the mutation is a mutation that substitutes lysine for glutamic acid at the 625th position from the N-terminal of phosphoenolpyruvate carboxylase. 5. The mutation, wherein the arginine at the 222nd position from the N-terminal of phosphoenolpyruvate carboxylase is replaced with histidine and the glutamic acid at the 223nd position is replaced with lysine, respectively.
The mutant phosphoenolpyruvate carboxylase described. 6. The mutation comprises phenylalanine at the 288th serine, 289th glutamic acid at lysine, 551th methionine at isoleucine, and 80th from the N-terminal of phosphoenolpyruvate carboxylase.
The mutant phosphoenolpyruvate carboxylase according to claim 1, which is a mutation that substitutes lysine for the fourth glutamic acid. 7. The mutant phosphoenolpyruvate carboxylase according to claim 1, wherein the mutation is a mutation in which alanine at position 867 from the N-terminal of phosphoenolpyruvate carboxylase is replaced with threonine. 8. A DNA fragment encoding the mutant phosphoenolpyruvate carboxylase according to any one of claims 1 to 7. 9. The DNA fragment according to claim 8 is a chromosome DN.
A microorganism belonging to the genus Escherichia or the coryneform bacterium, which has been integrated and transformed into A. 10. A recombinant DNA obtained by ligating the DNA fragment according to claim 8 with a vector DNA capable of autonomously replicating in cells of Escherichia bacterium or coryneform bacterium. 11. A microorganism belonging to the genus Escherichia or coryneform bacterium transformed with the recombinant DNA according to claim 10. 12. The microorganism according to claim 9 or 11 is cultured in a suitable medium, and L-lysine, L-threonine, L-methionine, L-isoleucine, L-glutamic acid, L-arginine and L are cultured from this medium. -A method for producing an amino acid, which comprises separating an amino acid selected from proline.