JPH08228781A - Dna coding for protein having tpo activity - Google Patents

Abstract

PURPOSE: To obtain a new protein, having a specific amino acid sequence and thrombopoietin (TPO) activities, capable of promoting growth and differentiation of a megakaryocytic precursor cell and enhancing the production of blood platelets and useful for treating and diagnosis for thrombopathy. CONSTITUTION: This new protein has an amino acid sequence containing an amino acid sequence represented by the formula and thrombopoietin (TPO) activities, is capable of promoting the growth and differentiation of a megakarocytic precursor cell and useful for treatment and diagnosis, etc., of thrombopathy and has activities in specifically stimulating or enhancing the production of blood platelets in the living body. The protein is obtained by successively carrying out the gel filtration, anion exchange chromatography of blood plasma in a rat suffering from thrombocytopenia and further lectin chromatography, providing a TPO active fraction, successively performing the dye adsorption affinity chromatography, hydrophobic interaction chromatography and preparative inverted phase chromatography of the fraction and purifying the TPO active fraction.

Description

Detailed Description of the Invention

TECHNICAL FIELD The present invention relates to a novel protein having the activity of promoting the growth and differentiation of megakaryocyte progenitor cells, or specifically stimulating or enhancing the production of platelets in vivo, and such a protein. The present invention relates to encoding DNA and a method for producing such protein.

2. Description of the Related Art Megakaryocytes are large cells, which are multinucleated and rich in cytoplasm, which are mainly observed in bone marrow and produce platelets. The source of megakaryocytes is pluripotent stem cells in the bone marrow. Pluripotent stem cells are differentiated to some extent to become megakaryocyte progenitor cells (CFU-MK) directed only to megakaryocyte lineage, and further proliferate and differentiate into megakaryocytes. Megakaryocytes are further associated with increased polyploidy of the nucleus, maturation of cytoplasm.
n) and finally release the non-nucleated cytoplasmic fragments platelets into the blood circulation. On average 2000-4000 platelets are produced from one mature megakaryocyte. Although there are many unclear points about the mechanism of platelet production, megakaryocytes are localized in the subendothelium of the venous sinus of the bone marrow, and their cytoplasm penetrates the endothelium to form a string-like process on the inner wall of the sinus. It is thought to release and release platelets. It has been suggested that a specific production control mechanism exists for such megakaryopoiesis and platelet production. In healthy people and normal animals, effective platelet counts are maintained, but, for example, when anti-platelet antibody is administered to normal animals, only platelets rapidly decrease in a short period of time and then start to increase. It is known that the normal value is transiently exceeded, but finally returns to the normal value again. Further, clinically, it has been known that the number of platelets decreases (thrombocytopenia) or thrombocytosis despite the normal number of red blood cells and white blood cells. However, to date, the isolation and identification of specific regulatory factors responsible for such a production mechanism (for example, the presence of erythropoietin in erythropoiesis) have not been successful. The most important function of platelets is the formation of hemostatic plugs in the hemostatic mechanism. When the hemostatic mechanism fails to function normally due to thrombocytopenia, it tends to bleed. In cancer radiotherapy and chemotherapy, thrombocytopenia due to myelosuppression is a fatal complication, and such cancer patients are given platelet transfusion to prevent bleeding tendency. Platelet transfusions are also given to patients who have undergone bone marrow transplants and patients with aplastic anemia. Platelets for such platelet transfusions are prepared by plateletpheresis from the blood of healthy blood donors, but the transfusion platelets have a short shelf life and can be contaminated by bacterial infections. It also exposes the patient to dangerous viruses such as the human immunodeficiency virus (HIV) or various hepatitis viruses, induces the patient to receive antibodies to the histocompatibility antigen (HLA) on the surface of the transfused platelets, or There is a risk that contaminating lymphocytes may cause graft-versus-host disease (GVHD). Therefore, it would be extremely beneficial to be able to stimulate endogenous platelet production and at the same time reduce platelet transfusion dependency in patients with thrombocytopenia. Moreover, if thrombocytopenia can be corrected or prevented in patients who are undergoing radiation therapy or chemotherapy for cancer, it becomes possible to make those treatments safer and more intensive, and to further control them. A cancer effect can be expected. For that reason, many studies have been enthusiastically conducted for the isolation and identification of specific regulatory factors involved in the regulation of megakaryocyte and platelet production. According to in vitro studies, regulatory factors involved in the process of proliferation and differentiation of megakaryocyte cells are considered to be roughly classified into the following two (for example, Williams et al., J. C.
ell. Physiol. , 110, 101-104
Pp. (1982)). Megakaryocyte colony stimulating factor (Meg-CSF) is a regulatory factor that promotes the growth and differentiation of CFU-MK, and experimentally induces the formation of megakaryocyte aggregates (colony) in semi-solid culture medium. Have activity. Another regulator is the megakaryocyte amplification factor (Meg).
-Pot), megakaryocyte stimulating factor, platelet production stimulating factor and the like, which mainly act on megakaryocytes in the differentiation stage after CFU-MK and promote differentiation / maturation. In experiments, it is often detected as an activity that amplifies Meg-CSF activity.
In addition, when serum or plasma in the thrombocytopenic period of an experimentally thrombocytopenic animal is injected into another normal animal, platelets increase, so it is considered that there is a humoral factor having a thrombocytopenic effect in vivo. And thrombopoietin (t
hombopoietin (TPO). In recent years, several cytokines whose genes have been cloned have been investigated for their effects on megakaryocyte cells and in vitro thrombocytosis. Human IL-3 stimulates the formation of human megakaryocyte colonies (Bruno et al. Exp.
Hematol. 16: 371-377, (19
88)), resulting in an increase in platelet counts at least in monkeys (Donahue et al., Science, 241: 1,
820-p. (1988)). However, IL-3 is a factor affecting proliferation and differentiation of all hematopoietic cells,
It can be distinguished from megakaryohematopoietic and specific regulators of platelet production. Human IL-6 does not show Meg-CSF activity, but acts on immature megakaryocytes to promote differentiation into mature megakaryocytes (Williams et al., Exp. He.
matol. 18: 69- (1990)). In mice and monkeys, thrombocytopenic activity is shown, and the size of bone marrow megakaryocytes and the ploidy of nuclei are increased, but side effects such as weight loss and induction of acute phase protein have also been observed (Asano et al., Blood. , Volume 75, 1602-1
605, (1990); Stahl et al., Blood,
78, pp. 1467-1475, (1991)). Human IL-11 also showed no Meg-CSF activity, and Meg-P
OT activity is exerted, and a thrombocytopenic effect has been reported in mice (Neben et al., Blood, 81, 9).
01-908, (1993)). Human LIF also significantly increases platelet counts in monkeys (May
er et al., Blood, 81, 3226-3233,
(1993)), its action on megakaryocytes in vitro is weak (Burstein et al., J. Cell. Physi).
ol. 153, pp. 305-312, (199
2)). These cytokines are expected to have potential clinical applications as platelet-increasing factors, but they do not specifically act only on the megakaryocyte system, and side effects are also recognized. Therefore, in the clinic, a platelet-increasing factor specific to the megakaryocyte-platelet system, which has fewer side effects, is desired. Meg-CSF, Meg-Pot, or TPO has been found in serum, plasma, urine of humans or animals that have been thrombocytopenic for a long time, or in the supernatant of certain human cultured cell lines.
The existence of activity has been reported, but it remains largely unknown as to whether such a factor exerts its activity singly or in the presence of multiple factors, and the difference with known factors.
Regarding factors derived from human organisms, Hoffman et al. Compared with those of healthy individuals in the serum of patients with aplastic anemia with a decrease in bone marrow megakaryocytes and amegakaryocytic thrombocytopenic purpura in addition to a decrease in platelets. And significantly higher Meg-CSF
Found activity (Hoffman et al., N. Eng.
Med. 305, 533-538, (198
1)), Mazur et al. Further reported that this Meg-CSF activity in the serum of patients with aplastic anemia shows IL-3 or G-3.
It was shown to be different from M-CSF (Mazur et al., B
blood, 76, 290-297, (199
0)). Similar Meg-CSF activity has also been detected in the sera of intensively chemotherapy-treated cancer patients and bone marrow transplant patients (Mazur et al., Exp. Hemato).
l. Vol. 12, pp. 624-628, (1984); de.
Alarcon and Schmieder, Prog. C
lin. Bio. Res. 215, 335-340
P., (1986)). Hoffman et al. Reported that Meg-CSF having an apparent molecular weight of 46000 was purified from the plasma of a patient with thrombocytopenia of myeloid megakaryocyte hypoplasia (Hoffman et al., J. Clin. Invests.
t, 75, pp. 1174-1182, (1985)),
Subsequent studies have shown that the purity of the purified preparation is insufficient for amino acid sequence determination (Hoffma
n, Blood, 74, 1196-1212, (1
989)). ⁷⁵ Se-selenomethionine ( ⁷⁵ Se) in mice from plasma from similar thrombocytopenic patients or urine from patients with idiopathic thrombocytopenic purpura (ITP).
-The TPO-like activity that promotes uptake of selenomethionine) into new blood platelets is partially purified,
It has been shown to have an apparent molecular weight of 40,000 for plasma-derived activity (Grossi et al., Hema.
Tologica, 72, 291-295, (19
87); Vannucchi et al., Leukemia, 2
Vol. 236-240 (1988)). Meg-CSF activity and TPO-like activity have also been detected in the urine of patients with aplastic anemia and severe ITP (Kawakita).
Br. J. Haematol. , Volume 48, 609-
615, (1981); Kawakita et al., Blo.
od, 61, 556-560, (1983)). Furthermore, Kawakita et al. Reported that the Meg-CSF activity contained in the urine extract of patients with aplastic anemia had an apparent molecular weight of 45,000 by gel filtration under dissociation conditions (Kawakita et al., Br. J. . Haem
atol. 62, 715-722, (198
6)). Erikson-Miller et al. Also reported purification of Meg-CSF from similar samples, but their structure has not been elucidated (Erikson-Mil.
Ler et al., “Blood Cell Growth F”
actors: ther present and and
future use in hematology
and oncology "ed. by Murph
y, AlphaMed Press, Dayton, O
hio, p. 204-220, (1992)). Turn
er et al. from the urine of a patient who underwent bone marrow transplantation, Meg-
Megakaryocyte stimulating factor (MSF) having CSF activity was purified and the gene was cloned (Turner et al.,
Blood, 78, 1106, 279a, (199
1) (abstr., Supl.1)). This MSF
Is a protein dimer with a molecular weight of 28,000 to 35,000. It is unclear whether this factor is the same as Meg-CSF which has been detected in the serum or plasma of patients with thrombocytopenia and whether or not it has a platelet increasing action in vivo. The TPO-like activity with a molecular weight of 32000 was purified from the culture supernatant of a human embryonic kidney-derived cell line (HEK cells) and various properties have been investigated, but its structure has not yet been clarified (McD
onald et al. Lab. Clin. Med. 10,
Volume 6, pp. 162-174, (1985); McDona.
ld, Int. J. Cell Cloning, Volume 7,
139-155, (1989)). On the other hand, according to another investigator, the main activity of promoting the maturation of megakaryocytes in vitro, which is present in the conditioned medium of HEK cells, is that a known cytokine produced by the cells, namely IL
There are reports that it depends on -6 and EPO (Withy et al.,
J. Cell. Physiol. , Volume 15 3362-
372, (1992)). Regarding factors of animal origin,
Evatt et al., ⁷⁵ S in rabbits and mice in thrombocytopenic plasma of rabbits infused with antiplatelet antibody.
We have reported a TPO-like activity that promotes uptake of e-selenomethionine into neonatal platelets (Evatt et al.,
J. Lab. Clin. Med. , 83, 364-3
71, (1974)). There are many similar reports from the 1960s to the 1970s (eg, Odell et al., Proc. Soc. Bio).
l. Med. 108, 428-431, (196
1); Evatt and Levin, J. et al. Clin. Inv
est. 48, 1615-1626, (196
9); Harker, Am. J. Physiol. , 2
Volume 18, pp. 1376-1380, (1970); Shr.
einer and Levin, J .; Clin. Invests
t. 49, pp. 1709-1713, (1970);
Penington, Br. Med. J. 1 volume, 60
6, 608, (1970)). Evatt et al., And Hill and Levin partially purified TPO-like activity from plasma of rabbits in the thrombocytopenic phase induced by administration of antiplatelet antibody (Evatt et al., Blood, 54, 37.
7-388, (1979); Hill and Levin,
Exp. Hematol. , Volume 14, 752-759
P., (1986)), and further, the activity of promoting megakaryocyte differentiation and maturation in vitro, ie, Meg-P.
Purification of this factor was proceeded using ot activity as an index, and it was revealed that it has an apparent molecular weight of 40,000 to 46,000 on gel filtration, but it has not been completely purified (Ke.
ller et al., Exp. Hematol. , 16 volumes, 26
2-267, (1988); Hill et al., Exp. H
ematol. , 20, 354-360, (199
2)). No IL-6 activity was detected in the plasma of rabbits with severe acute thrombocytopenia induced by antiplatelet antibody administration, indicating that this TPO-like activity is mediated by a molecule different from IL-6. Has been (Hill
Et al., Blood, 80, 346-351, (199
2)). Tayrien and Rosenberg were also extracted from the same rabbit plasma or HEK cell culture supernatant.
A factor having an apparent molecular weight of 15,000 that stimulates the production of platelet factor 4 in a megakaryocyte rat cell line was purified, but its structure has not been clarified (Ta.
Yrien and Rosenberg, J .; Biol. Ch
em. , 262, 3262-3268, (198
7)). Nakeff has also found Meg-CSF activity in the serum of mice that have been thrombocytopenic by administration of antiplatelet antibodies (Nakeff, "Experim.
mental Hematology Today ”e
d. by Baum and Ledney, Spri
nger-Verlag, NY, pp. 111-123,
(1977)). On the other hand, in the plasma of rabbits, which had been thrombocytopenic by the same treatment, the maturation of megakaryocytes was promoted in vitro (Keller et al., Exp. Hemato).
l. 16: 262-267, (1988); Hi.
ll et al., Exp. Hematol. , Volume 17, 903-
907, (1989)), morphological changes of megakaryocytes into platelets (Leven and Ye, Blood, 69, 10).
46-1052, (1987)) stimulating activity was detected, but Meg-CSF activity was not observed. It is unclear why these differences are due. Miura et al. Detected Meg-CSF activity in thrombocytopenic plasma of rats who underwent whole-body irradiation with sublethal doses of radiation (Miura et al., Blood, 63, 10;
60-1066, (1984)), since this activity is not diminished by platelet transfusion, in vivo Meg-
Induction of CSF activity requires reduction of megakaryocytes rather than reduction of platelets (Miura et al., Ex.
p. Hematol. , 16: 139-144,
(1988)). Mazu and South were Meg-containing in the serum of dogs that had aplastic anemia after irradiation.
CSF activity was detected and the apparent molecular weight was 17 on gel filtration.
Reported to have 5000 (Mazur and S
outh, Exp. Hematol. , Volume 13, 116
4-1172, (1985)). In addition, a factor derived from serum, plasma, or urine is Straneva et al. (Straneva et al. Exp. Hematol.
5, pp. 657-663, (1987)) and the like. Thus, despite the presence of factors that promote megakaryopoiesis and thrombopoiesis in biological samples of humans and animals with thrombocytopenia, it has been confirmed to date that only such factors have been isolated. Dissociation, biochemical and biological identification, and characterization are natural sources,
It has not been successful because, for example, such factors are present in blood and urine in extremely small amounts.

Therefore, an object of the present invention is to promote the activity of promoting the proliferation and differentiation of megakaryocyte progenitor cells and / or specifically stimulating or enhancing the production of platelets in vivo ( Protein having TPO activity (TPO)
PO) from natural sources, and further by isolating the gene encoding such a protein, using recombinant DNA technology to provide a means for the homogeneous mass production of said protein. Especially. If possible, it could replace or reduce the frequency of currently adopted platelet transfusions, or could be used in the treatment and diagnosis of platelet disorders.

According to the present invention, a TPO
New coding for amino acid sequence of active protein
A standard DNA (hereinafter referred to as "the DNA of the present invention") is provided.
Be done. The DNA of the present invention is shown in SEQ ID NO: 16.
There are DNAs encoding different amino acid sequences. Furthermore, this
The clear DNA has the amino acid sequence shown in SEQ ID NO: 16.
And, as long as it retains TPO activity, its amino
A portion of the acid sequence is modified (substitution, deletion, insertion, and / or
Are added), that is, code for TPO derivative
DNA that contains In other words, according to the invention
The amino acid sequence of DNA is substantially SEQ ID NO: 16
DNA containing the amino acid sequence shown in
It As used herein, the phrase "substantially shown in SEQ ID NO: 16
The “mino acid sequence” means the amino acid sequence shown in SEQ ID NO: 16.
In addition to "row", "as long as it retains TPO activity,
Substitution or deletion of part of the amino acid sequence shown in SEQ ID NO: 16
Amino acid sequence with deletions, insertions and / or additions "
Is included. In addition, the term "amino acid sequence
"Encoding DNA" means all degenerate nucleotide sequences
Means DNA with rows. Further, the DN of the present invention
A is the amino acid sequence of a protein having TPO activity.
DNA that encodes, and is selected from the following (a) to (c)
Includes DNA that is exposed. (A) shown in SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6
DNA or their complementary strands (b) (a) DNA or fragments thereof (under strict conditions)
Hybridizing DNA (c) D of (a), (b) if there is no degeneracy of genetic code
DNA capable of hybridizing with NA. In other words, the DNA of the present invention is
It also includes the DNA shown in either (a) or (b).
It (A) Vector pEF18S carried on Escherichia coli DH5
-A2α (contract number FERM BP-4565) embedded
Amino acid distribution of proteins with rare TPO activity
DNA encoding the sequence, or carried in E. coli DH5
Vector pHT1-231 (accession number FERM BP
-4564) having a TPO activity incorporated into
DNA encoding a protein amino acid sequence (b) the amino acid sequence of a protein having TPO activity
DNA encoding (a) or its DNA
DN hybridizing (under stringent conditions) to the fragment
A. Here is a table called "stringent" hybridization conditions.
Currently, degenerate and / or single sequence oligonucleotides
By using cleotide primer (probe)
Performing PCR amplification of DNA in the present invention
It is used in a series of examples. As an example
Sambrook et al., “Molecular C”
longing ”(Cold Spring Harbo
r Laboratory Press, 1989).
Chapter 11 and Chapter 14, or Ausubel
Et al. "Current Protocols in
Molecular Biology ”(Curren
t Protocols, U.S.A. S. A. , 1993)
See unit 2.10 of. The DNA of the present invention
Of the amino acid sequence shown in SEQ ID NO: 16
To the base sequence encoding the amino acid sequence at position 163.
And D which encodes a protein having TPO activity
NA is also included. Such DNA is due to restriction enzymes
To facilitate cleavage and / or expression.
Start, stop or middle for constructing expression vector
Additional donation of DNA to the interstitial space can be included. Well
In addition, when selecting a non-mammalian host, the
It may be possible to incorporate a currently preferred codon (preferred codon).
Yes. The DNA of the present invention includes mammals including humans.
After preparing mRNA from animal cells, etc.,
From the prepared cDNA library, according to a known method.
CDNA obtained by screening
There is. In this case, the source of mRNA is rat
Liver cell-derived cell line McA-RH8994 cells, HT
C cells, H4-II-E cells, rat liver, kidney, brain,
Examples include small intestine and human liver. In addition, the DNA of the present invention
As known from mammalian cells including human
By a known method from the genomic library created by the method
It may be screened genomic DNA. This
In the case of, the source of genomic DNA is human or rat.
And chromosomal DNA of mice and the like. Also this
Thus obtained protein having TPO activity
The well-known site-directed mutagenesis method is used for the encoding cDNA.
Some amino acid sequences are modified by
To obtain the DNA that encodes the
Can be In addition, the TPO disclosed in the present specification
Based on the amino acid sequence / base sequence of the active protein
Based on this, a protein with a partial amino acid sequence modified
The quality-encoding DNA has a chemical compound in part or in whole.
Can be easily obtained by those skilled in the art.
It The DNA of the present invention can be prepared by various gene recombination techniques.
Mass production of proteins with TPO activity
It is a useful substance. Furthermore, the DNA of the present invention is
Genes encoding related proteins, as well as other mammals
TPO cDNA and genomic DNA
A substance suitable for use as a labeled probe in some cases.
It Also, gene therapy in humans and other mammalian species
Is useful in. The DNA of the present invention can be used for a large amount of TPO.
And as a eukaryotic host for TPO production
Useful for the development of transgenic mammalian species capable of
(Palmiter et al., Science, 222,
 809-814, (1983)). Also according to the invention
If so, it encodes a protein having the above TPO activity.
A vector incorporating the DNA, transformed with the vector
Host cell, TPO produced by culturing the host cell
Characterized by separating and purifying active protein
A method for producing a protein having TPO activity is provided.
Be done. In this case, the host cell may be a prokaryote (eg
Bacteria, preferably E. coli, eukaryotes (eg yeast, kelp)
Insect or mammalian cells can be used. Baby
Examples of mammalian cells include COS cells, Chinese honey
Muster Ovary (Chinese Hamster Ov
ary) cells, X63.6.5.3 cells, C-127 cells
BHK (Baby Hamster Kidne
y) cells, human-derived cells (for example, HeLa cells), etc.
can give. Examples of yeast include baker's yeast (Sacch
aromyces cerevisiae) and methano
Le assimilating yeast (Pichia pastoris)
can give. Examples of insect cells include silkworm cultured cells (eg,
For example, Sf21 cells) and the like. These host cells
The vector used to transform
For bacteria, pKC30 (Shimatake H. an
d M. Rosenberg, Nature, 292,
128-132, 1981), pTrc99A (Ama
nn E. Et al., Gene 6, 69, 301-315, 1
988) and the like. PS for mammalian cells
V2-neo (Southern and Berg;
J. Mol. Appl. Genet. 1, 327-3
41, 1982), pCAGGS (Niwa et al .; Gen.
e, 108, 193-200, 1991), or p
cDL-SR α296 (Takebe et al .; Mol. C.
ell. Biol. , 8, 466-472, 1988).
Etc. For yeast, pG-1 (Schena
M. and Yamamoto K. R. ; Scien
CE, 241, 965-967, 1988) and the like.
For silkworm cells, transfer for recombinant virus production
Vector pAc373 (Luckow et al., Bio /
Technology, 6, 47-55, 1988) etc.
There is. These vectors may be used as a replication origin and selection
Contains selectable markers and promoters, and for eukaryotic cells
The vector may contain RNA splice sites and
A riadenylation signal or the like is added. As a replication origin
The mammalian cell vectors include SV40 and adenovirus.
Uses those derived from irs, bovine papilloma virus, etc.
be able to. As a vector for E. coli, ColE
1, those derived from R factor, F factor, etc. can be used
It 2 μm DNA for yeast, derived from ARS1
Etc. as a promoter for gene expression that can be used
The mammalian cell vector contains virus-derived
Torovirus, polyoma virus, adenovirus,
Those derived from SV40, or those derived from chromosomes (eg
For example, EF1-α) or the like can be used. For E. coli
Vectors derived from bacteriophage λ,
using trp, lpp, lac, tac promoter, etc.
Can be ADH, PHO for baker's yeast
5, GPD, PGK, MAF α promoter, methano
For the yeast utilizing yeast, the AOX1 promoter or the like is used.
Can be Nuclear polyhedrosis as a vector for silkworm cells
Those derived from viruses can be used. Select Mar
As a car, vectors for mammalian cells include
Thymidine kinase (TK), a neo resistance gene
Gene, dihydrofolate reductase (DHFR) gene, large intestine
Bacteria xanthinganine phosphoribosyl transferer
For example, the ze (Ecogpt) gene can be used. Big
Vectors for enterobacteria include kanamycin resistance gene,
Ampicillin resistance gene, tetracycline resistance gene, etc.
Can be used. Leu2, Tr for yeast
p1, Ura3 gene and the like can be used. More than
Having TPO activity using such host-vector system
To obtain a protein, the
Recombinant DNA containing the gene enables host cells
And transforming the resulting transformant,
In addition, the polypeptide is isolated from the inside of the cell or from the culture solution.
It may be purified. Means and methods used for these are publicly known
It can be done in combination with the above. With host
The N-terminal of the expressed product is more reliable when expressed by
In order to homogenize
Signal sequences of other proteins may be used. Also,
Modification (substitution, substitution) of amino acid residues at and near the N-terminus
(Or expressed in E. coli, for example)
Methionine residue and lysine residue
It is possible to make the N-terminal uniform.
It In addition, glutathione-S-transferase (G
ST: Glutathione-S-transfer
case) and TPO via thrombin recognition peptide
Express as a fusion protein in a suitable host and isolate
Then the thrombin treatment of the fusion protein
Remove the GST part and add a glycine residue at position -1.
Added Gly^-1Can get TPO protein
It The novel protein having TPO activity of the present invention (hereinafter
Below, "the protein of the present invention"), the sequence number
There is a protein consisting of the amino acid sequence shown in No. 16.
It Further, in the present invention, as long as the TPO activity is retained,
Some amino acid sequences are modified (substitutions, deletions, insertions, and
And / or added), that is, TPO derivatives are also included.
It In other words, as the protein of the present invention
Is an amino acid sequence of which is substantially the same as the amino acid sequence shown in SEQ ID NO: 16.
Included are proteins that are mino acid sequences. here
Say, "substantially the amino acid sequence shown in SEQ ID NO: 16
"A row" means "the amino acid sequence shown in SEQ ID NO: 16".
In addition, "as long as the TPO activity is retained, the sequence number
Substitution, deletion, insertion in part of the amino acid sequence shown in No. 16
Including "amino acid sequence with insertions and / or additions"
Things. SEQ ID NO: 16 as the protein of the present invention
Of the amino acid sequence shown in
Protein containing a mino acid sequence and having TPO activity
Is also included. More specifically, the array shown in SEQ ID NO: 6 is used.
Positions 1 to 231, 1 to 211 of the mino acid sequence
1st-191st, 1st-171st, 1st-163th
1st-157th, 1st-156th, 1st-155th
1st-154th, 1st-153rd, 1st-151st
And human TPO protein consisting of 7-163
It is mentioned as a protein of the invention. Furthermore, above 7th place
From inside to outside the sequence from position 151 to 151
Substitution or deletion of at least one amino acid within the range
Proteins with loss, insertion and / or addition
It is included in the protein of the present invention. TPO derivative of the present invention
Other examples include, for example, amino acid modification (substitution, deletion).
Loss, insertion and / or addition)
To improve sexuality and sustainability in the body, addition of sugar chains
Change by deleting or adding one or more potential sites
Or delete one or more cysteine residues, or
Or cysteine to other amino acid residues (eg alanine
Or the thing substituted by the serine residue) etc. are mentioned.
In general, there are methods to improve the thermodynamic stability of proteins
Then, introduction of proline residue and removal of glycine residue are effective
Is theoretically shown to be (Matthew
s et al., Proc. Natl. Acad. Sci. U.
S. A. 84,6663-6667.1987). There
To design TPO derivatives for improved stability
In some cases, a TPO derivative having a proline residue and a glycol
It is possible to think of a TPO derivative with the syn residue removed.
It For the selection of proline residue introduction site into human TPO
Is, for example, another species having a high homology to this
Derived TPO (mouse TPO: Si Lok et al., Pro
c. Natl. cad. Sci. U. S. A. 369
Vol. 565-568, (1994), Dog TPO:
T. D. Bartley et al., Cell 77, 111.
7-124, (1994)).
Can be For example, human and rat amino acids
Sequences (SEQ ID NO: 15) were compared and in human form with proline
No, but in rat type there is a site with proline, or
Is glycine in human type, but not glycine in rat type
The site having the amino acid of can be selected. For example
, The human TP shown in SEQ ID NO: 16
Leucine residue at position 9 and position 82 in the amino acid sequence of O
Glycine residue at position 146, Glycine residue at position 146,
Serine residues, etc., and those glycine residues
Derivatives substituted with amino acid residues of
A derivative substituted with a phosphorus residue may be considered. Also, one
Generally, proteins have a hydrophilic amino acid inside and a hydrophilic amino acid inside.
Since the three-dimensional structure is formed with the mino acid outside,
Amino acids present on the surface of proteins are highly hydrophilic and highly chargeable
Substitution of amino acids for protein solubility
Can be expected to improve. Even in the case of human TPO,
The derivative can be designed from such a viewpoint. An example
For example, lysine residue at the 14th position, lysine residue at the 52nd position, 59
Lysine residue, 115 glutamine residue, 119 position
Of the threonine residue and lysine residue at position 138
Examples include those substituted with a arginine residue. Further
Has been pointed out to be similar in amino acid sequence to TPO.
The smell of Erythropoietin (EPO)
The helix located at the 4th position in the primary structure (D helix
Kus) and introducing a positive charge,
Is the improvement recognized (Japanese Patent Laid-Open No. 3-72885)?
, TPO also has a D-helic
Can be predicted and TPO derivatives can be designed. one
Generally, to predict the D-helix of a protein, for example, gold
Secondary structure prediction program IDEAS (Kanehisa,
IDEAS user's manual)
Wear. Next, the region where the D helix is predicted to be located
Infers the amino acids located outside and introduces a positive charge
A candidate amino acid residue is selected. Such a candidate
The selection of, for example, the wheel model (Shiff
er and Edmundson, Biophys. J. 7,
121-135.1967)
Is. In the case of human TPO, the position of the D helix is 12
It is predicted to be the 6th to 142nd areas, but this area
As the amino acid residue selected in, for example, the 129th position
Isine residue, histidine residue at position 133, and the histidine residue at position 143.
Examples thereof include thionine residues. Therefore, these amino
Replace the acid residue with an arginine residue or a lysine residue
A derivative that introduces a positive charge is conceivable. The present invention
More specifically, the TPO derivative of
Also, the 1-position serine residue of human TPO becomes an alanine residue,
And the alanine residue at position 3 was replaced with a valine residue.
The arginine residue at the 25th position in the protein becomes an asparagine residue
The replaced protein, the histidine residue at position 33, is
Protein substituted with onine residue, argini at position 25
Residue is an asparagine residue and the glutamic acid at position 231 is
A protein in which an acid residue is replaced with a lysine residue,
ThrSerIleGly is added to the C-terminal of these proteins.
TyrProTyrAspValProAspTyrA
laGlyValHisHisHisHisHisHi
To list proteins to which the s polypeptide has been added
Can be. Furthermore, at least at the 33rd position histidine residue
Protein with deleted group, glycine residue at position 116 is missing
Lost protein, the arginine residue at position 117 was deleted
Protein, histidine residue at position 33 and pro at position 34
Protein with threonine residue inserted between phosphorus residues
Quality of the histidine residue at position 33 and the proline residue at position 34
A protein with an alanine residue inserted between
Glycine residue between stidine residue and proline residue at position 34
A protein with a group inserted, a histidine residue at position 33
A glycine residue is inserted between the proline residues at position 34,
And the proline residue at position 38 was replaced with a serine residue.
Protein, glycine residue at position 116 and algi at position 117
Protein with asparagine residue inserted between nin residues
Quality, glycine residue at position 116 and arginine residue at position 117
A protein with an alanine residue inserted between the groups, 116
Between the glycine residue at position 17 and the arginine residue at position 117
A protein with a lysine residue inserted
It In addition, at least the leucine residue at position 129 is
Protein substituted with ginine residue, hist at position 133
A protein in which a gin residue is replaced with an arginine residue, 1
The methionine residue at position 43 was replaced with an arginine residue
Protein, glycine residue at position 82 is placed at leucine residue
The glycine residue at position 146 of the replaced protein is leucine
Protein substituted with amino acid residue, serine residue at position 148
Protein in which is replaced with a proline residue, and the lysine at position 59
In which the amino acid residue was replaced with an arginine residue, 11
Tampa in which glutamine at position 5 is replaced with an arginine residue
Quality. In addition, the TPO protein of the present invention
Has the amino acid sequence shown in SEQ ID NO: 16.
Human TPO and methionine at the -2 position of the aforementioned derivatives
Residue and a protein with a lysine residue added at the -1 position
Quality, proteins with methionine residue added at position -1
included. Preferably, the protein of the invention is cDNA
A, genomic DNA, or DN obtained by chemical synthesis
Is the host cell transformed with a recombinant vector containing A?
It is characterized by being obtained by separating and purifying
It Cells using bacteria (eg E. coli) as a host
A protein having TPO activity in the case of internal expression
Protein with a start methionine residue added to the N-terminal side of
Quality is obtained, but such proteins are also included in the present invention.
Be done. Also, depending on the host used, the TPO produced
If the active protein is glycosylated
Sometimes or not glycosylated
Both are included in the protein of the present invention. Also,
The protein of the present invention includes a natural source (for example,
Conditioned medium containing TPO activity, or human urine, serum, blood
Natural with TPO activity purified and isolated from
The protein of is also included. According to the invention,
A method of purifying TPO from a natural source such as
It Such purification methods generally include protein purification.
Process used for manufacturing (ion exchange chromatography,
Chin affinity chromatography, dye adsorption chromatography
Matography, hydrophobic mutual chromatography, gel filtration
Perchromatography, reverse phase chromatography, hepa
Phosphorus affinity chromatography, sulfated gel
Chromatograph, hydroxyapatite chromatography
Chromatography, metal chelating chromatography,
Isoelectric focusing, preparative electrophoresis, etc.
A method that combines one or more of
is there. Also, the physics of TPO that can be estimated from the examples described later
Methods that can be combined using chemical properties
Also included in the present invention. Furthermore, to recognize TPO
An antibody column using an antibody capable of
It In addition, TPO was found to be a ligand for Mpl
(De Sauvage et al., Nature
369, pp. 533-538 (1994), Bartle
y et al., Cell 77: 1117-1124 (199
4), Kaushansky et al., Nature 369.
Vol. 565-568 (1994)), activating Mpl.
Affinity gel chromatography can be achieved by coupling to gel.
By preparing rum and using it, TPO
It can be purified. More specifically, Mpl cells
The outer region (Mpl-X) was used as a CHO cell host
Mpl produced and prepared by gene recombination method
-X column (see Bartley et al. (1
994)). The invention further provides a human cDNA of TPO or
Is the portion of DNA complementary to the protein-coding strand of genomic DNA
Min-encoded protein, Tra
montano et al. (Nucl. Acids Res.,
12, 5049-5059 (1984)).
Such a "complementary reverse protein" is included. The present invention includes a solid
TPO in tissues and liquid samples such as blood or urine
Or reagents useful for the detection and quantification of its receptor-bearing cells
Labeled with a detectable marker substance to provide
For example¹²⁵Radiolabeled with I or biotinylated
The present invention is also included in the above. Biotin
The modified protein of the present invention can be used in autologous bone marrow transplantation.
Immobilization strike to remove megakaryoblastic cells from the bone marrow
It is useful when binding to leptavidin. Furthermore,
Autologous or allogeneic in case of autologous or allogeneic bone marrow transplant
Immobilized streptavi to enrich for megakaryocytic cells
Useful when combined with gin. Ricin, diphtheria
Toxins such as toxins and toxin conjugates of TPO and radiation
Sex isotopes can be used for anti-cancer therapy or in bone marrow transplantation.
It is useful as a conditioning regimen. Also,
Light is a detectable marker (such as a radiolabel or
When it is labeled with a non-isotopic label such as Ochin,
Location of the human TPO gene in the chromosome map and / or
To locate any related gene family
Nucleic acid product useful for the hybridization method of
It also provides quality. They are human TPO residues at the DNA level.
It is also useful for confirming gene disorders,
And genetic markers to identify those disorders
Also used. Further, the present invention is useful and suitable
Diluents, preservatives, solubilizers, emulsifiers, adjuvants and
And / or carrier together with a therapeutically effective amount of the tamper of the invention.
Also included is a pharmaceutical composition containing a protein. For use in this specification
The term “therapeutically effective amount” refers to the specified conditions and
The amount that provides a therapeutic effect for the administration method is shown. like this
The composition may be liquid, lyophilized or
Otherwise in dried form, at various pH's, and
Buffers of ionic strength (eg Tris-HCl, acetic acid
Diluent selected from salts and phosphates, does not adsorb on the surface
Additions such as albumin or gelatin to
Agents, surfactants (eg Tween 20, Tween
 80, Pluronic F68, bile salt), soluble
Agents (eg glycerol, polyethylene glycol
), Antioxidants (eg ascorbic acid, metabisulfurous acid)
Sodium acid), preservatives (eg thimerosal, benzi)
Alcohol, paraben), excipients or tonicity agents (eg
(Eg lactose, mannitol)
Be done. In addition, polyethylene glycol for protein
Covalent bonds with such polymers, complexation with metal ions,
Of polylactic acid, polyglycolic acid, hydrogel, etc.
Into or on the surface of a granular formulation of such a polymeric compound,
Or liposome, microemulsion, micelle, simple substance
Layers or Multilamellar Vesicles, Red Blood Cell Ghosts, or Spherops
Incorporating the substance into the last. like this
The composition is based on the physical state of TPO, solubility, stability, i
n vivo release rate, in vivo clearance
The choice of composition depends on the TPO
It depends on the physical and chemical properties of the active protein.
In addition, polymers such as poloxamers or poloxamers
And tissue-specific receptors, ligands or antigens
Ligands that bind to antibodies or tissue-specific receptors
Granular compositions coated with TPO that bind to
Included. Another dosage form of the composition of the invention is
For various routes of administration including oral, pulmonary, nasal, and oral
For granular morphology, protective coatings, protease inhibitors,
Contains an absorption enhancer. Contains the protein of the present invention
The pharmaceutical composition is usually 0.05 μg / k as the active ingredient.
g body weight to 1 mg / kg body weight, medical condition, sex and administration route
It can be administered several times a day depending on the conditions. Departure
The pharmaceutical composition containing the protein of Ming is the active ingredient
And the relative activity amount in the M-07e assay described below is usually 2
5,000-500,000,000 / kg body weight
Depending on the condition, sex, administration route, etc., once to several times a day, 1
It can be administered for about 1 to 7 days per week. Further departure
Akira shows EPO, G-CS in addition to the protein of the present invention.
F, GM-CSF, M-CSF, IL-1, IL-2,
IL-3, IL-4, IL-5, IL-6, IL-7,
IL-8, IL-9, IL-10, IL-11, IL-
12, one of the factors like IL-13, LIF, SCF
Including a composition containing the above as additional hematopoietic factors
It The protein of the present invention may be used alone or in addition to other proteins.
Treatment of numerous thrombocytopenia in combination with blood factors
Useful for. Other additional hematopoietic factors include EPO,
G-CSF, GM-CSF, M-CSF, IL-1, I
L-2, IL-3, IL-4, IL-5, IL-6, I
L-7, IL-8, IL-9, IL-10, IL-1
1, IL-12, IL-13, LIF, SCF.
be able to. According to the present invention, the protein of the present invention
Chemistry as an active ingredient by the administration of anti-cancer drugs and immunosuppressants
In therapy, radiation therapy, or bone marrow transplant (BMT)
A therapeutic agent for thrombocytopenia is provided. Furthermore, platelet disorders
Harm, such as impaired platelet production or shortened platelet life (small blood
Blood loss due to increased plate destruction or increased platelet consumption)
Characterized by plate reduction, which is treatable with the proteins of the invention.
There are a number of diseases. For example, congenital Fanconi poor
Blood, aplastic anemia associated with chemotherapy or radiation, bone marrow
Dysplastic syndrome, acute myelogenous leukemia, or bone marrow transplant
Such as thrombocytopenia due to bone marrow hypoplasia,
Used to promote platelet recovery in such patients
be able to. In addition, thrombocytopenia due to abnormal TPO production
It is also useful for diseases. Blood due to shortened lifespan of platelets and megakaryocytes
Examples of platelet reduction include idiopathic thrombocytopenic purpura.
Disease, acquired immunodeficiency syndrome (AIDS), disseminated intravascular
Coagulation syndrome, thrombotic thrombocytopenia, etc.
It is also useful for promoting platelet recovery in healthy patients. Moreover, surgical hands
Administer TPO preoperatively to increase my platelets,
Use platelets as blood transfusion platelets during your surgery
It is also useful as an application for autologous platelet transfusion. Further books
Other uses of the proteins of the invention include, for example, other chemicals.
Of transient platelets due to
Treatment of disorders caused by defects or injuries
It TPO is a new "intact" blood pressure in such patients.
It can be used to facilitate the release of plates. The present invention
Furthermore, an antibody that specifically binds TPO, and
Providing antigen to obtain. The protein of the invention or
A partial fragment of the protein having an antigenic determinant serves as an antigen
Can be used. Such antibodies include monoclonal and
By both polyclonal antibodies and known methods
Includes chimeric antibodies made, ie, "recombinant" antibodies and the like.
Different antibodies against different antigenic determinants (epitopes)
Commonly used conventional antibody (polyclonal) formulations
In comparison, monoclonal antibodies are each a single antigen on an antigen
An antibody against a determinant. Specific antibody to TPO
Diagnostic and analytical assays using antigen-antibody reactions
Improving the selectivity and specificity of the method and separating TPO
Useful for purification. In addition, they are
Used to neutralize or remove TPO. Monochrome
The advantage of internal antibodies is that they are different from other immunoglobulins.
Combined with hybridoma cells in uncontaminated medium.
It can be done. Monoclonal antibody hive
Hybridized from the culture supernatant of the lymphoma cells or to the mouse
Ventilation induced by intraperitoneal inoculation of dorma cells
Prepared from water. Kohler and Milstein
First described hybridoma technology (Eur. J, Im
munol. 6, 511-519 (1976))
High levels of monoclonal antibodies against a number of specific antigens
Widely used to generate harboring hybrid cell lines
obtain. Hereinafter, the present invention will be described in more detail. (A) Purification of rat TPO-partial purification of rat TPO
Analysis of Minoic Acid Sequence-Biological Characteristics of Rat Purified TPO
Analysis The inventors of the present invention firstly promote the growth and differentiation of rat CFU-MK.
Tried to purify a protein (rat TPO) with progressive activity
saw. This purification involves the selection of various natural sources,
Is the choice of chromatographic carrier and separation means.
However, many trials and errors were repeated regarding the assembly of purification.
As a result, the inventors of the present invention used X-ray or γ-ray irradiation.
From plasma of thrombocytopenic rats induced by
Based on the rat CFU-MK assay described in
Protein having TPO activity using TPO activity as an index
The quality was purified and its partial amino acid sequence was determined. <Example
1-2>. Moreover, the biological properties of the plasma-derived rat TPO
<Example 3> tested for properties. From the purification,
Until determination of partial amino acid sequence of purified rat TPO
The outline of is as follows. (1) Thrombocytopenia caused by X-ray or γ-ray irradiation
Plasma of approximately 1100 animals was collected, and Sephadex
G-25 chromatography, anion exchange chromatography
Graphography (Q-sepharose FF)
Cutin chromatography (WGA-Agarose)
To step WGA-Agarose adsorption TP
An O active fraction was obtained. (2) Next, this WGA-Agarose adsorption TPO
Active fraction dye adsorption affinity chromatography
(TSK AF-BLUE 650MH), hydrophobic interaction
Chromatography (Phenyl Sepharo)
se 6 FF / LS), gel filtration chromatography
Processing up to (Sephacryl S-200 HR)
Was carried out. This Sephacryl S-200 H
In R, the TPO activity has four peaks (larger molecular weight).
It was divided into F1, F2, F3, F4)
Then, concentrate the TPO active fractions F2 and F3,
As molecular TPO preparation F2 and low molecular weight TPO preparation F3,
Each proceeded to the next purification step individually. (3) Preparative reverse phase chromatograph of low molecular weight TPO preparation F3
Fee (YMC-Pack PROTEIN-RP),
Reversed phase chromatography (YMC-PackCN-A
P), and reverse phase chromatography (Capcell
Separated with Pack C1). Obtained TPO active fraction
Is subjected to SDS gel electrophoresis, and TP is transferred from the electrophoresis gel.
When the O activity was extracted, the apparent molecular
There is TP0 activity in the band of about 17,000 to 19000
It was confirmed that it exists. (4) Then, all the TPO active fractions were subjected to S under non-reducing conditions.
It was subjected to DS gel electrophoresis and transferred to a PVDF membrane. Next
For systematic limited enzymatic degradation of proteins on PVDF membrane
Peptide fragmentation by
We were able to determine the partial amino acid sequence of
Based on the amino acid sequence information of the fragment, the gene clone of rat TPO
The training was carried out. ). (5) On the other hand, is Sephacryl S-200HR?
The high molecular weight TPO standard F2 is also used for low molecular weight TPO standard.
Purification is carried out in the same manner as for product F3, and the reverse phase chroma
Obtained by tography (Capcell Pack C1)
The TPO active fraction thus obtained was subjected to SDS gel electrophoresis,
Extraction of PO activity was performed. When I checked the activity, it was F3
Similar to traditional TPO, it has an apparent molecular weight of about 17 under non-reducing conditions.
000 to 22000 band has TPO activity.
I was able to confirm. (B) Specification of rat TPO-producing cells-preparation of mRNA
-Construction of rat cDNA library Since purified rat TPO is derived from plasma,
Organs that are the source of mRNA for cloning
Alternatively, it was necessary to select cells. There rat blood
Based on the biochemical and biological properties of serum-derived TPO
The activity of TPO in the culture supernatant of various organs or cells.
Sex was screened. As a result, rat liver cells
The original cell line, McA-RH8994 cells, HTC cells.
Cells, in the culture supernatant of H4-II-E cells, and in rat
Rat plasma-derived TPO was also added to the culture supernatant of primary liver cells.
An almost equivalent TPO activity was found <Example 4>. one
On the other hand, a cDNA expression vector in monkey cells (COS1 cells)
-PEF18S, two types of expression vector pME18S
And a combination of pEFBOS and <Example 5
>. The construction of this vector allows for the integration of inserts.
Expression efficiency with multiple cloning sites that can be used
It is possible to clone cDNA using
And became easier. To build a cDNA library
In addition to the expression vectors described above, plasmids of pUC system and pBR system
Mainly used vector vectors, lambda phage vectors, etc.
It We have cultured McA-RH8994 cells.
Then add guanidine thiocyanate solution and homogenize.
Then, total RNA was obtained by CsCl density gradient centrifugation <
Example 6>. RNA is prepared by the hot phenol method or acidic guar.
It can also be performed by the nidinphenol chloroform method.
come. From this total RNA, oligo dT-immobilized latex particles
Poly (A) by child⁺After purifying RNA, the restriction enzyme N
The oligo dT added with the otI cleavage sequence was used as a primer.
, Single-stranded cDNA was synthesized by reverse transcriptase, and RNas
e H and E. E. coli DNA polymerase I is used
Then, double-stranded cDNA was obtained. The obtained double-stranded cDNA
An EcoRI linker was added to A, which was used in Example 5.
The constructed cDNA expression vector pEF18S was added to NotI.
And a piece cut with EcoRI
Tentative E. coli DH5 strain was transformed with cDNA
A braly was constructed <Example 7>. (C) Acquisition of rat TPO cDNA fragment by PCR method
(Cloning) Partial amino acid sequence of rat TPO purified from rat plasma
DNA considered to encode the sequence based on the sequence
Predict the sequence and use the polymerase chain reaction (P
The degenerate primer used for CR) was synthesized. use
The primer may have a position other than the primer used in the present invention.
It may be based on the amino acid sequence. Also, Ino
It is also possible to use highly degenerate primers without using syn.
come. Furthermore, codons that are frequently used in rats are used.
Can also be used to design primers with reduced degeneracy.
Come (Wada et al. Nucleic Acids Re
s. , 18, 2367-2411, 1990). Destination
Plasmid D from the whole cDNA library prepared in
NA is extracted and PCR is performed using this DNA as a template.
A band of about 330 bp was detected, and the base sequence was
Once determined, it encodes part of the rat TPO gene
Was found to be a DNA fragment (A1 fragment) that
Example 8>. (D) Screening of rat TPO cDNA by PCR method
Sequencing of rat TPO cDNA
About 10,000 clones of the cDNA library constructed in advance
Divided into two pools, of which 100 pools
Smid DNA was extracted. Using these DNA as templates,
A newly synthesized primer based on the base sequence of one fragment
PCR was performed using 3 pools in 100 pools.
A band that was considered to be specific to the enzyme was detected. There
Then, choose one of these pools and
Divide into subpools of about 900 clones each
The same PCR was performed for 100 pools.
A band was detected in 3 subpools. Out of these
Select 1 pool and add 40 clones to each sub-pool.
Finally, each clone is finally analyzed by the same PCR.
As a result of the screening,
Fragment carrying the plasmid pEF18S-A2α
Successful isolation of loans <Examples 9 to 10>. This cd
When the nucleotide sequence of the NA fragment was determined, it was found in rat plasma.
Purified and partially determined amino acid sequence
And it is considered that it is a rat TPO carrier.
The obtained <Example 10>. Ku obtained as described above
Purify the plasmid DNA from the loan and use it for COS1 cells.
Upon transfection, T was added to the culture supernatant.
The PO activity could be detected. As a result,
pEF18S-A2α encodes rat TPO
It was confirmed that it carried cDNA <Example 11
>. (E) Detection of TPO mRNA in various rat tissues PCR was performed on tissues expressing TPO mRNA in the rat body.
In the brain, liver, small intestine, and kidney
Specific expression was detected <Example 12>. (F) Construction of human cDNA library From the results of Examples 4 and 12, human TPO cDNA library was constructed.
The liver was selected as the starting tissue for the rolling. So
Here, from commercially available normal human liver-derived mRNA, cDNA
A library was constructed. The vector of rat rye
PEF18S was used in the same manner as in the case of Braley,
CDNA was synthesized by the same procedure and the restriction enzymes NotI and Eco
As a library with directionality using RI site
Was. A library clone prepared by introducing into E. coli strain DH5
The number of loans was about 1.2 million <Example 13>. (G) Acquisition of human TPO cDNA fragment by PCR method
(Cloning) The rat TPO carried on pEF18S-A2α was coated.
For several types of PCR based on the nucleotide sequence of the cDNA
Primers were synthesized. Commercially available mR derived from normal human liver
Synthesized cDNA from NA and used these primers
When PCR was carried out, a band around 620 bp was found.
Was observed. When the nucleotide sequence was determined, rat TPO
It was revealed to be a DNA fragment having about 86% homology with
And part of the gene encoding human TPO
<Example 14>. (H) Screening of human TPO cDNA by PCR method
Sequence of human TPO cDNA-Confirmation of expression Amplification of the previously prepared human cDNA library
Divided into pools of 0,000 clones each, or 90 pools
The plasmid was extracted from Using these DNA as templates,
Based on the nucleotide sequence of the human-TPO fragment obtained in Example 14.
PCR was performed using the newly synthesized primers
However, bands were observed in the three pools. These
1 pool and select 5000 clones
90 pools among them
The plasmid DNA was purified from the plasmid. With these as molds
When the same PCR was performed with 5 sub-pools
A band was detected. Therefore, 1 pool is selected from these
And 250 clones as one pool
Divided into 90 and pooled 90
When NA was purified and detected by PCR again,
Bands were observed in the 3 pools. So out of this
Select one pool and set 30 clones as one pool.
Divide into pools and play 90 pools of them
As a result of purifying the Smid DNA and performing PCR,
Band was observed. From one of these pools
Pick 90 colonies, prepare plasmid DNA,
Finally, the clone HL34 was obtained by carrying out PCR.
<Example 15>. The plasmid DN of this clone
When the base sequence of A was determined, the base sequence of rat TPO was determined.
It carries a cDNA with about 84% homology to the sequence.
<Example 16>. This clone
Of the plasmid DNA of Escherichia coli and purified into COS1 cells
Upon Tfection, TPO activity was detected in the culture supernatant.
The cloned plasmid DNA of this clone was human T
Carrying a gene cDNA fragment encoding PO
Was confirmed <Example 17>. However, this c
The DNA fragment has no stop codon and is poly-A tail-like
I have a row at the 3'end, this is the person
It was considered an artifact. Therefore, poly-A tail-like array
Construct an expression vector that encodes the amino acids up to the last amino acid
And expressed in COS1 cells, the culture supernatant
TPO activity was detected therein <Example 18>. Full length c
Human TP using PCR to analyze the structure of DNA
A DNA fragment on the O3 'end side was obtained. Nucleotide sequence of this fragment
Was determined, the clone HL34 obtained in Example 15 was determined.
It was found that it overlaps with the cDNA of
The reading frame also extends to a total of 353 amino
It was expected to encode a protein consisting of acid. sand
Human TPO protein contains 21 signal sequences.
It was suggested that it consists of 353 amino acids.
Example 19>. The cDNA cloning of human TPO is as described above.
Other than cloning methods such as pUC and pBR
Plasmid vector, lambda phage vector, etc.
Rat TPOc using the library constructed by
Colony hybridise using DNA fragment as probe
Or plaque hybridization
Can also be done. Designed for degenerate probes
Use inosine to reduce the degree of degeneracy
You can also. Detect TPO activity specifically and sensitively
If an available assay is available, use it with the present invention.
Expression cloning using a unique expression library
Can also be done. However, in Example 15
As shown, in normal human liver, human TPO was
The content of RNA to be loaded is considered to be extremely low (see
The content calculated from the examples is 1 in 3 million
, The synthesized oligonucleotide probe or
And cDNA fragments of human TPO as a probe
By the screening method by hybridization
Results in a huge number of clones and plaques to process.
In addition, the sensitivity and specificity of hybridization are
It is expected to be extremely difficult as it does not reach the CR law.
In fact, the inventors of the present invention also prepared a normal mouse prepared in Example 13.
About 2 million clones of liver cDNA library
Colonies using a rat TPO cDNA fragment as a probe.
-Hybridization was performed, but human TPOc
It was not possible to obtain a DNA clone. (I) Reconstruction of human TPO cDNA library Clone HL34 obtained in Example 15 has incomplete cDNA
Since it was considered to be a clone containing NA, full-length
Commercially available normal human liver for the purpose of obtaining human TPO cDNA
Origin poly (A)⁺Human TPO cDNA using RNA
The library (hTPO-F1) was reconstructed. colon
Of the clone of the library prepared by introducing it into the strain DH5
The number was about 1 million. <Example 20> (J) Human TP by colony hybridization
Rescreening of OcDNA-of human TPO cDNA
Sequence-confirmation of expression Salt of human TPO cDNA of partial length obtained in Example 14
Base sequence (SEQ ID NO: 3) and predicted in Example 19
Nucleotide sequence of the full-length human TPO cDNA (SEQ ID NO:
Based on No. 6), PCR primers were synthesized. Implementation
CDNA library constructed in Example 20 (hTPO-F
1) is divided into 3 pools (# 1-3),
Plasmid DNA was prepared from the pool and these DNAs were prepared.
PCR using primers synthesized using
did. Predicted using DNA from pool # 3
As the size of DNA was amplified, pool # 3 was
Divide into 15,000 sub-pools,
When PCR was performed with Immer, 6 pools out of 90 pools
The expected size of DNA was amplified. These
1 pool and select 1000 clones
And prepare plasmid DNA
PCR was performed, but no DNA amplification was observed
Was. This is because the desired clones grow more than other clones.
Poor recovery of plasmid DNA due to slowness
Was thought to be the cause. So, I returned to the pool of # 3, L
Make 4100 colonies per B plate
Clone, 100 plates, and each
These replica plates were produced. Plate colony
PCR was performed on the DNA extracted from
However, band amplification was observed in 1 out of 100 pools
Was done. 2 replica files from this pool plate
To produce a radiolabeled probe (plasmid pEF
18S-HL34 EcoRI / BamHI fragment)
The colony hybridization used was performed. That
As a result, one positive signal was observed, so the original play
Picked a colony from the
Plasmid DNA was prepared from 50 colonies
By performing CR, finally clone pHTF
Got 1. <Example 21> Thus, in the screening of DNA clones
Is hybridization, PCR, expression clonin
It is mainly used for the
Increase cleaning efficiency, sensitivity, or
The force can be reduced. Clones obtained here
When the base sequence of pHTF1 was determined,
There is a reading frame and this open reading
Ami, a protein thought to be frame-encoded
The no acid sequence is the amino acid sequence of the human TPO deduced in Example 19.
The amino acid sequence (SEQ ID NO: 6) was completely matched. The base sequence is
Although it differs from SEQ ID NO: 6 at three positions, the amino acid changes
No substitution occurred. This results in human TPO protein
Is 353 amino acids including a 21-residue signal sequence
It was confirmed that <Example 22> The clone pHTF1 obtained as described above was used as a plasmid.
Prepare Smid DNA and transfect COS1 cells
Detected, TPO activity was detected in the culture supernatant
We were able to. <Example 23> (K) Human TP by plaque hybridization
Screening of O chromosomal DNA-human TPO chromosome D
Sequence of NA-Confirmation of expression Human beings from Professor Tokio Yamamoto, Gene Research Facility, Tohoku University
One NZYM plate from the genomic library
Sprinkle the phages so that the number becomes 30,000, and
And a replica filter for each
Was. Human TPO cDNA contained in clone pHTF1
Fragment (base sequence number 178-1025 of sequence number 7)
Amplified by PCR and purified³²P-labeled probe
Used to perform plaque hybridization
Was. As a result, 13 positive signals were detected
Therefore, pick up plaques from the original plate, NZY
Spread so that there are 1000 plaques per plate
Repair it and connect it to the replica filter made from each.
Then, plaque hybridization was performed again.
As a result, all 13 sets of filters gave positive signals.
The plaques were isolated and the phage DNA was
Prepared and human TPOcD for each of the 13 clones
PCR whether it contains the coding region of NA
Checked by. 5 out of 13 clones are c
Contains all coding regions predicted from DNA
Since it was thought to be one, 1 clone (λHGT1) was selected
And Southernblot analysis (the probe used was
Same as before). Digested with the restriction enzyme HindIII
, A single band of about 10 kbp was observed,
The DNA of clone λHGT1 is restricted to the restriction enzyme HindIII
After digestion with agarose gel, the 10 kb band
Is excised and purified to obtain the cloning vector pUC13.
And cloned pHGT1
Obtained. <Example 24> When the nucleotide sequence of this clone was determined, it was found to be carried.
The chromosomal DNA present is the human TPO tag shown in SEQ ID NO: 6.
All coding areas, and
Regarding the nucleotide sequence, the nucleotide sequences were completely the same. Also to Exxon
The corresponding region is divided by 4 introns.
Carried on clone pHTF1 obtained in Example 21
The full-length human TPO cDNA
Turned out to be different. 5 clones finally selected
Of the remaining 4 clones, the nucleotide sequence was determined.
As a result, the two sites were identical with the clone pHGT1 and the remaining
2 clones coincided with pHGT1 at one location
And it was in agreement with the other two clones pHTF1. <Implementation
Example 25> Plasmid clone pHGT obtained as described above
The EcoRI fragment of 1 was ligated into the expression vector pEF18S.
, Human TPO expression plasmid pEFHGTE was prepared.
Then, when COS1 cells were transfected,
TPO activity could be detected in the culture supernatant.
<Example 26> (L) Preparation of human TPO deletion derivative-in COS1 cell
Expression-Activity Confirmation From the results of Examples 18 and 22, the human TPO protein was confirmed.
Does not require full-length amino acids to express its activity
Was expected. Therefore, for the active expression of human TPO protein
For the purpose of analyzing the required region, the claw obtained in Example 18 was used.
Using the plasmid DNA of pHT1-231 as a template
By performing PCR with the prepared primers, human TP
An expression plasmid in which the C-terminal side of O protein has been deleted,
That is, amino acids 1-211, 1-291, 1-17
Deletion derivative coding for positions 1 and 1-163
Rasmid DNA was obtained. Each obtained plasmid
DNA transfected into COS1 cells
The TPO activity was not detected in any of the culture supernatants.
It was <Example 27> In order to examine the region responsible for TPO activity in more detail,
Induction by sequentially deleting the 151st amino acid from the C-terminal side
Neither the conductor nor the 6th, 7th and 12th amino acids on the N-terminal side are missing.
Lost derivatives were prepared and expressed in COS1 cells for activity
Was detected, the 7th amino acid was missing on the N-terminal side.
If deleted, up to the 151st amino acid on the C-terminal side
The activity became undetectable when deleted. <Example
28, 29> Based on the cDNA thus obtained, a derivative (deletion,
Replacement, insertion, addition, etc.)
It is possible to obtain modified proteins responsible for protein activity.
It The method used in this case is PCR, Sit
e directed mutagenesis method,
There are chemical synthesis methods. (M) Expression of human TPO cDNA in CHO cells-purification A cDNA animal encoding the amino acid sequence of SEQ ID NO: 6
An expression plasmid for cells, pHTP1, was constructed. <Example
30> This TPO cDNA region of pHTP1 is used to
Cell expression vector pDEF202-hTPO-P1
Built <Example 31> CHO cells were transfected with this vector and selected.
As a result of selection, the gene encoding human TPO in the chromosome
Transformed cells in which the current vector was integrated were obtained. This
When the cell clones were cultured, the TPO activity was found in the culture supernatant.
Sex was detected. <Example 32> In Example 32, human TPO expression plasmid pDE
Transfecting F202-hTPO-P1 into CHO cells
Human TPO-producing CHO cell line (C
HO28-30 cells, 25nM MTX resistant)
Cultivated <Example 55>. Human from the culture supernatant 100L
The TPO was purified. <Example 56> In addition, from the culture supernatant obtained in Example 55 by another method, T
The PO was purified. <Example 57> (N) Human TPO cDNA X63.6.5.3. cell
Expression-Activity Confirmation in Plasmid The plasmid prepared in Example 30 was cloned into pBLTEN.
Using the encoded TPO cDNA region, X63.6.
5.3 Cell Expression Vector, BMCGSneo-hTP
O-P1 was constructed. <Example 33> X63.6.5.3 cells were transfected with this vector.
When it was isolated, it encodes human TPO in the chromosome
Transformed cells containing the expression vector
Was. When this cell was cultured, TPO activity was found in the culture supernatant.
Sex was detected. <Example 34> (O) Large-scale expression of human TPO in COS1 cells-purification-
Molecular Weight Measurement, Biological Properties Expression vector prepared in Example 30, pHTP1
On culture transfected and expressed in OS1 cells
A large amount (about 40 l in total) of Qing was prepared. <Example 35> Expression vector, pHTP, prepared by the method of Example 35
Approximately 7 liters of COS1 cell serum-free culture supernatant containing 1-derived TPO
Then, TPO was purified. Hydrophobic interaction chromatography
Raffy, cation exchange column, WGA column, reverse phase column
Through each step of lamb, highly active TPO can be obtained
Was. <Example 36> Thus partially purified T from COS1 cell culture supernatant
For PO, molecular weight measurement and analysis of biological properties
Was done. <Examples 37 and 38> (P) Expression of human TPO in Escherichia coli Glutathione-S-transferase and human TPO
(Amino acid 1-174) fusion protein ("GST
-TPO (1-174) ") E. coli expression vector,
pGEX-2T / hT (1-174) was constructed. this
A part of the base sequence of human TPO cDNA (5 'side and
The other half of the region) was converted to E. coli preferred codons. <Implementation
Example 39> GST-TPO (1-174) was expressed in Escherichia coli,
After crushing the body, GST-TPO (1-
174) was solubilized. Next, rewind the TPO
(Refolding) conditions, purification conditions
(Glutathione affinity column, cation exchange column
(Rum et al.), Cutting of GST protein region by thrombin digestion
As a result of combining stages such as disconnection,
The protein containing the amino acid sequence could be partially purified. This protein
Quality has TPO activity in rat CFU-MK assay system.
I was able to confirm that. <Examples 40 and 41> Further, S at the 1st position of human TPO (amino acids 1-163).
er residue to Ala residue and Ala residue at position 3 to Va
Converted to l residue, Lys residue at -1 position, and Lys residue at -2 position
Mutant human TPO protein with addition of Met residue
(Referred to as "h6T (1-163)") for expressing E. coli
Constructed pCFM536 / h6T (1-163)
did. The human TPO cDNA carried by this vector
The base sequence of the amino acid (1-163) encoded by
All were converted to preferred codons in E. coli. <Example 42> h6T (1-163) is expressed in Escherichia coli, and the cells are disrupted.
Then, solubilization of h6T (1-163) contained in the precipitate fraction
And the refolding conditions were examined.
As a result, a protein containing the amino acid sequence of TPO as designed
Was partially purified. This protein is rat CFU-M
It can be confirmed that it has TPO activity in the K assay system.
Was. <Examples 43 and 44> Furthermore, human TPO cDNA (amino acids 1-163)
Modification with Lys residue at position -1 and Met residue at position -2
Atypical human TPO protein (“hMKT (1-16
3) ”)) E. coli expression vector pCFM536
/ HMKT (1-163) was constructed. hMKT (1-
163) was expressed in E. coli in the same manner as in Example 43, and
The expressed protein was applied to PVDF membrane after SDS-PAGE.
As a result of transcription and N-terminal amino acid sequence analysis,
It was confirmed that the amino acid sequence contained <Example 5
2> In addition, at the -1 position of human TPO (amino acid 1-332 position)
Lys residue, mutant human with Met residue added at -2 position
TPO protein (referred to as "hMKT (1-332)"
E. coli expression vector pCFM536 / hMKT
(1-332) was constructed. hMKT (1-332)
Expression was performed in E. coli in the same manner as in Example 42, and Example 4 described later was performed.
Wes using the anti-human TPO peptide antibody prepared in
Expression was confirmed by tan blotting. <Example 6
6> (Q) Preparation of anti-TPO peptide antibody-anti-TPO peptide
Preparation of antibody column Amino acid of rat TPO found in Example 10
Peptides corresponding to three partial regions in the sequence are combined.
And produce rabbit polyclonal anti-TPO peptide antibody
Made. These antibodies recognize rat and human TPO
I was sure that. Also, SEQ ID NO: 6 (or SEQ ID NO:
6) among the amino acid sequences of human TPO shown in No. 7).
The peptide corresponding to the partial region of
A clonal anti-TPO peptide antibody was prepared. these
It was confirmed that the antibody of 1. recognizes human TPO. <Implementation
Example 45> Molecules having a binding affinity for TPO, ie, anti-
TPO antibody, TPO receptor, etc. are bound to the column carrier.
And T by affinity column chromatography
A method for purifying PO can be considered. Therefore, first, Example 4
The anti-TPO peptide antibody obtained in 5 was bound to a gel carrier.
Anti-TPO antibody column was prepared. <Example 46> Anti-TPO of human TPO expressed in (R) COS1 cells
Purification using peptide antibody column-Molecular weight measurement, Biology
Transfection of expression vector pHTP1 into COS1 cells
Partially purified TPO was obtained using the collected culture supernatant as a material.
And applied it to an anti-TPO antibody column. T in the adsorption fraction
Since it was confirmed that it has PO activity,
The molecule was purified by reverse-phase column chromatography.
The quantity and biological activity were investigated. <Example 47> Partial purification of human TPO expressed in (S) COS1 cells
Confirmation of activity of authentic sample The TPO active fraction purified in Example 36,
Transfection of the current vector pHTP1 into COS1 cells
From the culture supernatant obtained by
T purified to the stage of the Pak C1 300A column
As a result of investigating the biological activity of PO, blood pressure was reduced in vivo.
It was found to have a plate increasing effect. <Example 48> Furthermore, the expression vector pHTP1 was transfected into COS1 cells.
33 L of the culture supernatant obtained by the transfection was used as the starting material.
Crude TPO fraction obtained by cation exchange column
As a result of examining the biological activity of
It was found to have an increasing effect. <Example 49> (T) Expression of human TPO chromosomal DNA in CHO cells-
Confirmation of activity Human TPO chromosome expression vector in CHO cells, pDE
F202-ghTPO was constructed. <Example 50> When this vector was introduced into CHO cells,
And an expression vector carrying human TPO chromosomal DNA
Integral transformed cells were obtained. Cultivate this cell
As a result, TPO activity was detected in the culture supernatant. <Actual
Example 51> (U) Partial purification of mutant human TPO expressed in Escherichia coli
~ Activity confirmation A clone encoding the human TPO nucleotide sequence expressed in E. coli.
Derived from loan pCFM536 / h6T (1-1163)
Guanidine Hydrochloride and Glutathione for Atypical Human TPO
Refolding operation using
h6T (1-163) increases platelets in vivo
It has been confirmed that the <Example 53> A clone encoding a human TPO nucleotide sequence expressed in E. coli.
Lone pCFM536 / h6T (1-163) -derived mutation
-Type human TPO, N-lauroyl sarcosin nato
Performs refolding operation using lithium and copper sulfate
In addition, use cation exchange chromatography to
H6T (1-163) produced is platelet in vivo
It was confirmed to have an increasing action. <Example 54> Further, by using another method, mutant human TPO, h6T
The refolding to purification of (1-163) was performed.
<Examples 60 and 61> (V) Expression of human TPO cDNA in insect cells-Activity confirmation
Recombinant virus for expression of human TPO in insect cells
<Example 58>, expressing in insect cell Sf21 and culturing
The activity in the supernatant was confirmed. <Example 59> (W) CHO cell of human TPO (amino acid 1-163)
Expression in cell-purification Among the amino acid sequences of human TPO shown in SEQ ID NO: 7,
Human TPO tamper having amino acid sequence at positions 1-163
For expression of CHO cells in the cytoplasm (referred to as "hTPO163")
The vector pDEF202-hTPO163 was constructed.
Expression vector pDEF202-hTPO163 was CHO
HTPO16 obtained by transfecting cells
3 CHO cell line was cultivated in a large amount, and h
TPO163 was purified. <Examples 62 to 65> (X) Preparation of Human TPO Substituted Derivative The Arg residue at the 25th position of human TPO was replaced with an Asn residue, and 23
The Glu residue at position 1 was replaced with a Lys residue,
A derivative having an additional peptide at the C-terminus ("N3 / T
PO)), and the His residue at position 33 remains Thr.
Group having an additional peptide at the C-terminus.
Plasma coding conductor (referred to as "09 / TPO")
In COS7 cell culture supernatant transfected with
TPO activity was detected. <Example 67> A derivative in which an amino acid is inserted into hTPO163 or hT
A derivative obtained by deleting a part of the amino acid of PO163 is used.
COS7 transfected with plasmid
TPO activity was detected in the cell culture supernatant. <Example 6
8> h6T (1-163) was used as a template and T.
A PO derivative was prepared and its TPO activity was confirmed. <Actual
Example 77> (Y) Pharmacological action of TPO The intravenous administration of the human TPO obtained in Example 56, and
Subcutaneous administration confirmed the platelet-increasing effect in normal mice
I accepted. <Examples 69 and 70> Further, the human TPO obtained in Example 56 was treated with an anti-cancer agent.
Inhibitory effect of thrombocytopenia by administration and thrombocytopenia
Platelet count recovery promotion effect, and further BMT (bone marrow transplant) performed
It has the effect of accelerating the recovery of platelet count after and after irradiation.
Confirmed to do. <Examples 71 to 74> In addition, in the normal mouse of human TPO obtained in Example 65,
Thrombocytosis and blood loss due to the administration of anti-cancer drugs
The effect of promoting platelet number recovery from plate reduction was confirmed. <Implementation
Examples 75, 76> (Z) Preparation of human TPO preparation An example of preparation of a preparation containing human TPO as an active ingredient was shown. <
Formulation Examples 1 to 9> In addition, the method for measuring TPO activity used in the present invention (i
n vitro assay system) as a <reference example>
explain. <Reference Example> A. Rat megakaryocyte progenitor cell (CFU-MK) assay
(Rat CFU-MK Assay) System (Liquid Culture System) Megakaryocytes use extracellular serotonin (s) in an energy-dependent manner.
Erotonin) is taken up and accumulated in the deep dyeing granules
(Fedorko, Lab. Invest., Vol. 36,
310-320, (1977)). This phenomenon is less
Differentiation stages between at least CFU-MK and recognizable megakaryocytes
Small, mononuclear acetylcholine-positive cells located in the
Already recognized (Bricker and Zuckerma
n, Exp. Hematol. , Volume 12, 672-67
P. 5, (1984)), and then on the increase of megakaryocyte size
Correspondingly, the amount of serotonin uptake increases (S
check and Weinstein, J. Lab. Cli
n. Med. , 98, 607-615, (198
1)). Moreover, among the bone marrow cells, only megakaryocytes
Specific (Schick and Weinstein,
J. Lab. Clin. Med, Volume 98, 607-6
Page 15, (1981)). Book Asse
The i strain is highly concentrated in rat CFU-MK (GpI
Ib / IIIa⁺CFU-MK fraction; described later) test sample
Culture in the presence of¹⁴C-cello
Tonin (¹⁴C-5-hydroxy tryptam
ine creatine sulphate;
¹⁴C-5HT)) uptake as an index
It The advantage of this assay system is that the CF contained in the cells used is
The ratio of U-MK is extremely high (see "Assay Method" below).
), On the contrary, other than the target cells of TPO contaminated
Since there are few cells, indirect effects due to contaminating cells (eg
For example, if some substance other than this factor acts on contaminated cells, M
Inducing eg-CSF activity, or contaminating cells with this factor
To produce some co-acting factor)
Can be reduced and cultured in one well
Good for a relatively long period due to low total cell count
It is to be able to maintain the culture environment. further,
Generated from CFU-MK with an active preparation during the culture period
A number of large mature megakaryocytes under a phase contrast microscope
Can be observed in a
It is also an advantage that it can be set. The result of this qualitative judgment is¹⁴
Corresponds well with the quantification result by the incorporation of C-serotonin.
ing. Therefore, by using qualitative judgment together, quantitative
The reliability of the result can be increased. "Assay Method" First, the highly concentrated assay used
Rat CFU-MK ("GpIIb / IIIa⁺ 
CFU-MK fraction ") already reported (Miy
azaki et al., Exp. Hematol. , Volume 20, 8
55-861 (1992)) slightly modified method
Was prepared according to. The outline is as follows. Wi
femur of star rat (♂, 8-12 weeks old), and
And the tibia are extracted and a bone marrow cell suspension is prepared according to the standard method.
It Levine and Fed for preparation of bone marrow cell suspension
The medium for separation of megakaryocytes (Levine and
Fedorko, Blood, Volume 50, 713-725
Page, (1977)) with slightly modified medium (13.6 mM
Trisodium citrate, 11.1 mM glucose, 1 m
M adenosine, 1 mM theophylline, 10 mM HEP
ES (pH 7.25), 0.5% bovine serum albumin
(Hereinafter, abbreviated as BSA) (Path-O-Cyte
4; Seikagaku), and Ca²⁺And Mg²⁺Not include
Solution consisting of Hanks balanced salt solution: HAT
CH solution) is used. Bone marrow cell suspension, Per
HATCH the coll stock solution (Pharmacia)
Percoll discontinuous density gradient prepared by diluting with solution
Solution (density: 1.050 g / ml / 1.063 g / ml
/1.082 g / ml) and layer at 20 ° C for 4
Centrifuge for 20 minutes at 00 × g. After centrifugation, density 1.063
The cells collected at the interface of g / ml and 1.082 g / ml
to recover. After washing the cells, 10% fetal bovine serum (hereinafter referred to as F
Iscove modified Dulbecco including CS)
Suspend in culture medium (hereinafter abbreviated as IMDM culture medium)
Enter into 100 mm tissue culture plastic dish
And incubate at 37 ° C for 1 hour in a 5% carbon dioxide incubator.
It After culturing, the non-adherent cell fraction was collected and the diameter of 10
Put it in a 0 mm plastic dish for another 37
After culturing at 0 ° C for 1 hour, the non-adherent cell fraction is collected. Times
Resuspend the collected cells in HATCH solution and
Monoclonal anti-rat platelet GpIIb / IIIa anti-
The body's P55 antibody (Miyazaki et al., Throm
b. Res. , 59, 941-953, (199
0)) adsorbed 100 mm petri for bacteria test
Dish (Falcon 1005; Becton-D
ickinson) and let stand for 1 hour at room temperature
It Then, wash the non-adsorbed cells thoroughly with HATCH solution.
After separating and removing, the cells adsorbed to the immobilized P55 antibody were picked up.
Remove by petting and collect. Usually 1 rat
From 3 to 4 x 10⁵Individual cells are obtained. Obtained cells
Rat CFU-MK is highly concentrated in the fraction
(Hereinafter, "GpIIb / IIIa⁺CFU-MK fraction "
The saturation concentration in the colony assay system described later
Usually 5-10% by assay in the presence of rat IL-3
It has been found to include some CFU-MK. What
The hybridoma producing the above P55 antibody (p55
(Cells) is the industrial technology of the Ministry of International Trade and Industry on February 14, 1994.
Contract number FERM BP at the Institute of Biotechnology, Institute of Biotechnology
Deposited as -4563. Next, the obtained Gp
IIb / IIIa⁺CFU-MK fraction with 10% FCS
96 wells for tissue culture, resuspended in IMDM culture medium containing
10 per well to flat bottom plate^FourIndividual cells enter
And then fully permeate IMDM medium.
Add the analyzed standard product (detailed later) and the test sample,
The final culture volume is 200 μl / well. Charcoal plate
Place in an acid gas incubator and incubate at 37 ° C. for 4 days. 4th day
0.1 μCi per well 3 hours before the end of culture
(3.7 KBq)¹⁴Add C-serotonin and pull
Then, the cells are cultured at 37 ° C. After culturing, plate 100
Centrifuge at 0 rpm for 3 minutes and aspirate the supernatant. Continued
Then, 1 well of PBS containing 0.05% EDTA was applied.
Add 200 μl of each well and centrifuge, remove the supernatant by suction and remove the cells.
Wash. This washing operation is repeated once again. Got
Add 1% of 2% Triton X-100 to the cell pellet.
Add 200 μl per plate and plate to plate mixer
Shake for about 5 to 10 minutes to lyse the cells sufficiently. Got
150 μl of the prepared cell lysate was placed in a commercially available cup
Solid Scintillator (Ready Cap; Beckm)
an) and left overnight in a dryer at 50 ° C.
And dry to dryness. The next day, Ready Cap was
In the liquid and at the liquid scintillation counter
¹⁴The radioactivity of C is measured. In addition, the above-mentioned cell lysate
Acetylcholinesterase activity in Ishiba
hi and Burstein's method (Ishibashi and
Burstein, Blood, Volume 67, 1512-1
514, (1986))¹⁴C
-Very similar to the quantitation results from serotonin uptake
The result is obtained."Standard goods" First, the thrombocytopenia assay used to prepare the standard product.
The plasma was prepared by the following method. 7-8 weeks old Wis
1 to the normal tar rat (♂)
Dosage is 0.5 mg and 2 at intervals of about 24 hours.
Platelets once and intravenously, about 24 hours after the second administration
During the period of decrease, laparotomy was performed under ether anesthesia and used as an anticoagulant in advance.
1 ml 3.8% (v / v) trisodium citrate solution
Abdominal aorta using a 10 ml syringe
Blood was taken from. Blood centrifuge tube made of plastic
And centrifuge at 1200 xg for 10 minutes to collect the plasma fraction.
Recovered. This plasma fraction was again stored at 1200 xg for 10 minutes.
Centrifugation for a period of time, and after centrifugation, a pellet consisting of cells and platelets
Be careful not to suck up the plasma
Collected and pooled (hereinafter, blood obtained in this way)
Serum is called "TRP"). Then, from TRP to Example 1
Ca-treated TRP prepared according to the method described in
Product C), WGA-Agarose column active fraction (standard
Item W) or Phenyl Sepharose
6 FF / LS column active fraction (standard product P)
Thoroughly dialyzing against IMDM culture solution for activity assay
The standard product. The rat TPO shown in Example 1
In the purification process, the standard product C was used in the initial stage, but
Was used as the standard product W, and thereafter, the standard product P was used. Arbitrary
The activity of the standard product C is defined as 1 and the standard product W is
And the relative activity of Standard P was determined. Relative activity of test sample
To determine the sex, draw a dose-response curve between the standard and the test sample.
The activity of the test sample was n times that of standard C
Then, the relative activity of the rest was set as n. B. Colony assay system Bone marrow cells are cultured in semi-solid culture medium in the presence of the test sample.
And CFU-MK grows and differentiates to form megakaryocytes
By calculating the number of Ronnie, Meg-CSF activity
The assay method to measure. "Assay Method" (a) When using rat non-separated bone marrow cells, etc. Rat non-separated bone marrow cells, the above A. GpIIb / III
a⁺ Obtained at each stage of CFU-MK separation / concentration operation
Cells, or GpIIb / IIIa⁺CFU-MK
Fraction 10% FCS, 2 mM glutamine, 1 mM pyrubi
Sodium phosphate, 50 μM 2-mercaptoethanone
Le, 0.3% agar (AGAR NOBLE, DIFC
IM solution containing a final volume of 1 ml containing O.
Put it in a 35 mm plastic tissue culture dish
After solidifying at room temperature, cultivate at 37 ° C in a carbon dioxide incubator.
Feed. Usually, seeded cells per dish
The number of non-separated bone marrow cells, Percoll centrifugation step
And the plastic dish adherent cell removal step
Cells and GpIIb / IIIa⁺ CFU-MK fraction
And 2 to 4 x 10 respectively⁵, 2-5 × 10^Four, 0.
5 to 2 x 10^ThreeTo be individual. Did agar gel on day 6-7
Remove from slide and slide glass (76mm × 52
mm), nylon mesh with a pore size of 50 μm, and then
Absorb the water by placing a filter paper on it and remove them, then room temperature
To dry thoroughly. 5 minutes on a hot plate at 50 ° C
After heat fixing for a while, the method of Jackson (Jackso
n, Blood, 42, 413-421, (197).
3)) Acetylcholinesterase dyeing prepared according to
Soaking in colored liquid for 2 to 4 hours, megakaryocytes are sufficiently stained
After confirming, take it out, wash it with water, dry it, and
s Hematoxylin solution for 30 seconds, after dyeing, water
Wash and air dry. Acetylcholinesterase positive giant
Meganucleus consisting of agglomerates consisting of three or more nuclear cells as one colony
Count the number of ball colonies. (B) When non-separated bone marrow cells of mouse are used. The number of seeded cells per dish is 2 to 4 × 1.
0⁵As an individual, the same method as in (a) above can be used.
it can. (C) When using human bone marrow cells or human cord blood cells Human bone marrow cells or human cord blood cells may be used as they are.
Can, but concentrated from them as follows:
The K fraction can be used. First, bone marrow fluid or navel
Layer blood on Lymphoprep (manufactured by Daiichi Kagaku)
Then, after centrifugation, the white blood cell fraction collected at the interface is collected. This
Biotinylated human cell surface antigen from cell fraction of
Bio for (CD2, CD11c, and CD19)
Cells bound by the tinted monoclonal antibody were
Remove using jin-bound magnetic beads. This porcelain
The cells that can be removed by the air beads method are mainly B cells, T cells,
Macrophages, and some granulocytes. Remaining thin
Cells with FITC-labeled anti-CD34 antibody and PE
Staining with labeled anti-HLA-DR antibody followed by celso
A computer (for example, ELITE; manufactured by COULTER)
CD34-positive and HLA-DR-positive cell fractions
Collect minutes. CFU-MK was concentrated in this fraction
(CD34⁺DR⁺(Abbreviated as CFU-MK fraction). Human
Colony assay using the rat bone marrow cells described above
Procedure is similar to the colony assay
CD34 per plastic dish⁺ DR
⁺ Set the number of CFU-MK fractions to be 3 to 5 x 10^ThreePieces
And 12.5% human AB plasma instead of 10% FCS
And 12.5% FCS. In addition,
The culturing period until the formation of Ronnie is 12 to 14 days.
It is a day. For the detection of human megakaryocytes, the surface antigen of megakaryocytes
Mouse Monoc against Human GpIIb / IIIa
Alkaline phosphatase-anti-A
Immunostaining megakaryocytes with Lucariphosphatase antibody method
(For example, Teramura et al., Exp, Hemato.
l. Volume 16, pp. 843-848, (1988)), 3
A colony consisting of the above megakaryocytes as a megakaryocyte colony
Calculate. C. Assay system using human megakaryoblastic cell line (M-0
7e assay) M-07e cells, which are a human megakaryoblastic cell line, are GM-
Increased in response to CSF, IL-3, SCF, IL-2, etc.
It is known to be a cell line that propagates (Avanz
i, J. et al. Cell. Physiol. Volume 145, 4
58-464, (1990), Kiss et al., Leuk.
Emia, Volume 7,), found to respond to TPO
And an alternative assay method for the rat CFU-MK assay system
Can be used. "Assay Method" Subcultured in the presence of GM-CSF
M-07e cells were collected, washed thoroughly, and then washed with 10% FCS.
Resuspend in IMDM culture medium containing. 96 for tissue culture
The number of cells per well is 10 per well.^Four
M-07e cells so that the number of cells becomes
And the test sample are added to bring the final volume to 200 μl / well.
To Place the plate in a 5% CO 2 incubator and
Incubate at C for 3 days. 4 hours before the end of culture on day 3 1
μCi (37KBq) / well^ThreeH-thymidi
After adding ne and culturing, cells are harvested with a cell harvester.
Collect on a glass fiber filter,^ThreeLiquid radioactivity of H
Scintillation counter (eg beta play
G; manufactured by Pharmacia). In addition, M
The definition of the relative activity amount in the −07e assay is as described above.
A. Same definition as in rat CFU-MK assay
Is. D. Assay system using mouse pro B cell line (Ba / F
3 assay) Mouse pro B cell line Ba / F3 cells are
Known to be a cell line that proliferates in response to -4 and the like
(Palacios et al., Cell, Volume 41, 72
7-734). The sub-strain, BF-TE22 cells,
Cells that respond to TPO as well as IL-3 and IL-4
It was found to grow, and rat CFU-MK assay and human
Assay using megakaryoblastic cell line (M-07e
Can be used as an alternative assay method. This
The outline of the assay system is as follows. First, 1 ng
Subcultured in the presence of 1 / ml mouse IL-3
-TE22 cells were collected and Iscove's modified DME medium (I
10% after washing 3 times with MDM; GIBCO
Resuspend in IMDM medium with FCS. Then the organization
Number of cells per well in 96-well flat bottom plate for culture
Is 1x10^FourCells are inoculated so that individual
Add O standard or test sample to bring the final volume to 200
Set the plate to be ml / well and add 5% carbon dioxide to the plate.
Incubate for 2-3 days in an incubator. 2 or 3 day culture
4m before the end of 1mCi (37KBq) / well^ThreeH
-Add thymidine and continue culturing
It After culturing, use a cell harvester to remove the cells.
Collected on a fiber filter and taken up by cells^ThreeH
Radioactivity of liquid is measured by liquid scintillation counter
I do. Test sample containing no TPO activity in this assay system
Then the cells are almost dead^ThreeH-thymidine
Tests that include TPO activity, while they are rarely incorporated
In the body, cells show active proliferation in a TPO concentration-dependent manner.^Three
Incorporation of H-thymidine is observed. Well
In addition, this assay is based on the M-07e assay and CFU-MK.
Results parallel to the assay are shown.

The present invention will be described in detail below with reference to examples. <Example 1-1> Purification of rat TPO from plasma of thrombocytopenic rat by administration of antiplatelet antibody "Preparation of plasma of rat by thrombocytopenia by administration of antiplatelet antibody" Rat megakaryocyte progenitor cells (CFU-
MK) TRP for about 1000 rats was prepared by the method described in the assay system and used as a source of purification. “Purification of rat TPO from TRP” At the beginning, based on the estimation that the TPO content in TRP would be at most 1/3 million, purification of TRP from approximately 1000 rats resulted in 1 pmole. A partially purified preparation of weak rat TPO was obtained. Next, analysis of the partial amino acid sequence of this sample was tried, and the results of three types of partial amino acid sequences were obtained. Do these match the amino acid sequence of the serine protease inhibitor (SPI) produced in the liver,
It was similar. Therefore, neither the possibility that TPO has a structure similar to that of a serine protease inhibitor or the possibility that it is a sequence derived from a contaminating protein other than TPO cannot be denied. TPO gene cloning from a rat cDNA library was carried out based on these uncertain sequences, but it was not possible to obtain a candidate gene after all. This was thought to be due to the lack of purity and quantity of the analyzed sample, and it was decided to repeat intensive research. In order to obtain the final purified preparation required for amino acid sequence analysis, the purification described in Example 1-2 below was performed. It should be noted that, from the results of this Example 1-2, the amount of TPO present in TRP or XRP (described later) is surprisingly 1/100 to 1/1 billion of the total plasma protein. It has been found that the content is so small that it is usually extremely difficult to purify it. <Example 1-2> Purification of rat TPO from plasma of rat with thrombocytopenia by X-ray or γ-ray irradiation “Preparation of plasma of rat with thrombocytopenia by X-ray or γ-ray irradiation” Sublethal dose (6 ~ 7 Gy) X-ray or γ-ray 7-8 weeks old Wistar normal rats (♂)
Whole-body irradiation was performed, and blood was collected on the 14th day of the thrombocytopenic period, and a plasma fraction was prepared by the same operation as that of the TRP described above (hereinafter, this plasma is referred to as "XRP"). Here, XRP (about 8 L) of about 1100 rats in total was used as a purification source. "Purification of rat TPO from XRP" Rat about 1100
Since the total protein amount of the blood plasma of the animals reached 493,000 mg, it was impossible to process them all at once. Therefore, in the purification steps (1) to (4) described below, about 100 animals were divided into 11 lots and carried out. Then, in (5) to (7), the batch was divided into 6 batches.
After (8), the crude purification from about 1100 animals was performed collectively. Of these, one lot (XW
9), a purification example in the batch (XB6) is given as a representative for description, and each purification step is also described. In all the steps of purification, the TPO activity was measured using the rat CFU-MK assay system described in <Reference Example> above. Purification was carried out at 4 ° C., unless stated otherwise, except that reverse phase chromatography was carried out at room temperature. In addition, protein quantification was performed using the Coomassie dye binding method (P
IERCE reagent, Catalog No. 23236X) or bicinchoninic acid method (PIERCE reagent, Catalog No. 23225). The outline of the purification is shown in Table 1.

[Table 1] (1) Calcium chloride treatment / centrifugal treatment / protease inhibitor treatment of rat plasma Approximately 100 XRP (742 m) stored at -80 ° C
1, protein concentration 54.8 mg / ml, total protein mass 4068
6 mg) was thawed and transferred to a polypropylene centrifuge tube (Nalgen). Each of these has a final concentration of 100 mM
Calcium chloride powder was added to the mixture so that the mixture was allowed to stand at 4 ° C. overnight. Then, after centrifuging at 8000 RPM for 60 minutes, the supernatant was collected. This supernatant containing TPO activity (742 ml, protein concentration 54.9 mg / ml, total protein mass 40740 mg)
And a final concentration of 1 mM of proteolytic enzyme inhibitor p-
APMSF (p-aminodiphenylmethanesulfonyl fluoride hydrochloride, Wako Pure Chemical Industries, Catalog No. 010
-10393) is added, and Sephadex described next is added.
Proceed to the step of buffer exchange with the G-25 column. In this way, about 100 animals are combined into one lot and treated with calcium chloride / p-APMSF,
11 lots in total, about 1100 XRP (total volume 81
The treatment of 84 ml and the total protein mass of 493007 mg) was repeated, and each was applied to the Sephadex G-25 column. (2) Sephadex G-25 <buffer exchange> The supernatant obtained after treatment with calcium chloride (742) (742)
ml, protein concentration 54.9 mg / ml, total protein mass 407
40 mg) was pre-equilibrated with 20 mM Tris-HCl, pH 8 (Sephadex G-25M column (Pharmacia Biotech, Catalog No. 1).
7-0033-03; diameter 11.3 cm, bed height 47
cm) at a flow rate of 40 to 70 ml / min, and 1300 ml until the protein was eluted was discarded. Next, from the time when ultraviolet absorption started to rise, the electric conductivity was 50
Collect until reaching 0 μS / cm, and add 20 mM Tris
-Protein fraction containing TPO activity replaced with HCl pH 8 solution (1377 ml, protein concentration 27.56 mg / m
l) was recovered. The total protein content of the TPO active fraction was 37.
882 mg, the protein yield at this step was 93%. The relative activity of TPO was 2.3. In this way, Sephad for each lot
As a result of carrying out the ex G-25 column, the total volume is 21117 ml, and the total protein mass is 480306 m.
g, average relative activity 1.8, relative activity amount 864600
Sephadex G-25 TPO active fractions were obtained. (3) Q-Sepharose FF <strong anion exchange chromatography> Sephadex G-25M TP obtained in (2)
O active fraction (1375 ml, protein concentration 27.5 mg / m
l, total protein mass 37841 mg, relative activity 2.3) at a flow rate of 40 ml / min and Q-Sepharose FF.
(Pharmacia Biotech, Catalog No. 17-0
510-01; diameter 5 cm, bed height 27 cm), and passed through 20 mM Tris-HCl, pH 8 Fraction F1 (3949 ml, protein concentration 0.98 mg / m2)
1, total protein mass 3870 mg, relative activity 0) were eluted. Next, 20 mM Tr containing 175 mM NaCl
Instead of is-HCl, pH8 buffer, TPO active fraction F2 (4375 ml, protein concentration 5.36 mg / ml) was eluted. Finally, 20 containing 1000 mM NaCl
mM Tris-HCl pH8 buffer, F3 (12
21 ml, protein concentration 3.9 mg / ml, total protein mass 47
83 mg, relative activity 3.8) was eluted. The total protein mass of the TPO active fraction F2 was 23440 mg, and the protein yield of F2 in this step was 61.9%. Also, T
The relative activity of PO increased to 6.8. In this way, as a result of subjecting all lots of the TPO active fraction of Sephadex G-25 to Q-Sepharose FF,
Total volume 35842 ml, total protein mass 31
4384 mg, average relative activity 8.6, relative activity 2
704000 Q-Sepharose FF TPO
Active fraction F2 was obtained. (4) Wheat germ agglutinin (WGA) -Agaros
e <lectin affinity chromatography> TP of Q-Sepharose FF obtained in (3)
The O-active fraction F2 was divided into three times, and WGA-Agaros
e (Hornen Co., Catalog No. 800273; diameter
5 cm, bed height 22.5 cm) and flow rate 5 ml / mi
n is added, and Dulbecco's phosphate isotonic buffer (DPB
Fraction F1 that passes through S) (9336 ml, protein concentration 2.3)
0 mg / ml, total protein mass 21407 mg, relative activity 6.9) were obtained. Next, 0.2M N-acetyl-D-
Glucosamine (GlcNAc, manufactured by Nakarai Co., Ltd., Catalog No. 005-20), 150 mM NaCl, 0.02
20 mM Na Phosp with% sodium azide
The pool eluted with the hate, pH 7.2 buffer was concentrated with an ultrafiltration unit (Filtron, Omega Ultraset molecular weight 8000 cut), and WGA-A
Garose adsorbed TPO active fraction F2 (2993 ml,
A protein concentration of 0.376 mg / ml) was obtained. The total protein mass of this TPO active fraction F2 was 1125 mg, and the protein yield of F2 in this step was 4.8%. Also, T
The relative activity of PO increased to 101. The F2 obtained here was stored at -80 ° C. In this way, Q-Se
All the lots of the TPO active fraction F2 of pharose FF were repeatedly subjected to WGA-Agarose, resulting in a total volume of 33094 ml and a total protein mass of 15030.
mg, average relative activity 132, relative activity amount 198700
0 WGA-Agarose TPO active fraction F2 was obtained. (5) TSK-gel AF-BLUE 650MH <
Dye adsorption affinity chromatography> (4) WGA-Agarose adsorbed TPO active fraction of lot XW8 and WGA-Agarose adsorbed T of lot XW9 starting from XRP for a total of 215 animals.
The PO active fraction F2 was collected as batch XB6 (59
74 ml, protein concentration 0.388 mg / ml, total protein mass 2319 mg, relative activity 150). This volume is 5974m
0.81 moles of NaCl (296.7
6 g) was added to give a final concentration of 0.822 M NaCl, 61
After making 32 ml of solution, 1M NaCl, 20 mM
TSK-gel AF-BLUE 650MH previously equilibrated with Na Phosphate, pH 7.2
A column (manufactured by Tosoh Corporation, Catalog No. 08705; diameter 5 cm, bed height 23 cm), flow rate 7 ml / mi.
n. After the addition was completed, at a flow rate of 10 ml / min, 20 mM Na Phosphate, 1M Na was added.
Flow-through eluted with Cl, pH 7.2 (approx. 8470 m
l) was collected and concentrated with an ultrafiltration unit (Filtron, Omega Ultraset molecular weight 8000 cut), and passed through fraction F1 (543 ml, protein concentration 2.05).
mg / ml, total protein mass 1112 mg, relative activity 31)
I got Next, the eluate was changed to 2M NaSCN, and the eluted TSK-gel AF-BLUE 650MH-adsorbed TPO active fraction F2 (1427 ml, protein concentration 0.4).
47 mg / ml) was obtained. The total protein amount of this TPO active fraction F2 was 638 mg, and the protein yield of F2 in this step was 27.5%. The relative activity of TPO is
It rose to 1500. In this way, WGA-Aga
For all batches of rose adsorbed TPO active fraction F2,
As a result of applying each to TSK AF-BLUE 650MH, total volume 10655 ml, total protein mass 4236 m
g, average relative activity 905, relative activity amount 3834000
TSK-gel AF-BLUE 650MH TP
O active fraction F2 was obtained. (6) Phenyl Sepharose 6 FF /
LS <hydrophobic interaction chromatography> (5) TSK-gel AF-BLUE 6
1.5 mol per 50 ml of TPO active fraction F2 (1424 ml, protein concentration 0.447 mg / ml, total protein mass 638 mg, relative activity 1500) volume 1424 ml
Les Ammonium Sulfate (282.
2g) powder was added to give a final concentration of 1.35M Ammon.
ium Sulfate, 1581 ml of solution.
This is 1.5M Ammonium Sulfate,
Phenyl Sepharose previously equilibrated with 50 mM Na Phosphate, pH 7.2.
A flow rate of 7 ml / m was applied to a 6 FF (Low Sub) column (Pharmacia Biotech, catalog number 17-0965-05; diameter 5 cm, bed height 10 cm).
In addition, the eluate was added to 0.8 M Am after the addition was completed.
monium Sulfate, 36 mM Na Ph
Instead of osphate, up to a fraction (about 3160 ml) eluted at a flow rate of 10 ml / min was collected and concentrated with an ultrafiltration unit (Filtron, Omega Ultraset molecular weight 8000 cut) to obtain F1 (485 m).
1, protein concentration 0.194 mg / ml, total protein mass 94.
2 mg, relative activity 0) was obtained. Next, eluate is 20 mM
The pH was changed to Na Phosphate, pH 7.2 to obtain the eluted TPO active fraction F2 (about 3500 ml).
This was concentrated in an ultrafiltration unit (Omega Ultraset molecular weight 8000 cut, manufactured by Filtron) and once sampled. TPO active fraction F2 (22
(0 ml) has a protein concentration of 1.45 mg / ml, total protein mass is 319 mg, and the protein yield of F2 in this step is 5
It was 0.0%. The relative activity of TPO is 123
It was 0. In this way, TSK-gel AF-
Repeated Phenyl Sepharose on all batches of BLUE 650 MH TPO active fraction F2.
As a result of being subjected to FF / LS, a total volume of 1966 ml, a total protein amount of 2762 mg, an average relative activity of 847, and a relative activity amount of 233,000, Phenyl Sephare
The TPO active fraction F2 of ose FF / LS was obtained. (7) Sephacryl S-200HR <gel filtration chromatography> (6) Phenyl Sepharose obtained in
6 FF / LS TPO active fraction F2 (217 ml, protein concentration 1.45 mg / ml, total protein mass 315 mg, relative activity 1230) was added to 144.8 ml 5M NaCl.
After the solution was added to make 362 ml of 2M NaCl, the solution was further concentrated to about 50 ml using an ultrafiltration unit (Amicon; YM3 membrane, diameter 76 mm). Equal volume (50 ml) of 8M urea was added to this, and the final concentration was 1M NaC.
l to about 100 ml of 4M urea solution. About 80 more
Concentrate to ml and finally make 88.78 ml sample, Sephacryl S-200HR column (Pharmacia Biotech, Catalog No. 17-058).
4-01; diameter 7.5 cm, bed height 100 cm)
Was injected. Then DPB at a flow rate of 3 ml / min
Develop with S, void volume (1200 ml) and later 45 ml
Each was collected in 60 polypropylene tubes. This elution pattern is shown in FIG. Every two sephacryl were assayed and the rest were 1100 all Sephacryl
Until the end of the S-200HR process, it was stored frozen at -85 ° C. Based on the results of the assay, XB6 collected the following fractions (FIG. 1). (F1) Tube number 1 to 15 (fraction having a molecular weight of 94000 or more near the void volume) (F2) Tube number 16 to 26 (molecular weight 94000)
~ 33000) (F3) tube number 27-44 (molecular weight 33000)
~ 3000) (F4) tube number 45-55 (molecular weight 3000 or less) In this way, Phenyl Sepharose
All batches of TPO active fraction F2 obtained with 6 FF / LS were subjected to Sephacryl S-200HR, assayed for each fraction, and stored frozen at -85 ° C. After completion of Sephacryl S-200HR for all batches, the following reverse phase chromatography (YMC-Pack PROT
Immediately before carrying out EIN-RP), it was thawed and concentrated with an ultrafiltration unit (Amicon; YM3 membrane, diameter 76 mm) to obtain the following two standards. Below, this Sepha
The concentrated preparation of the TPO active fraction F2 of cryl S-200HR was designated as "polymer TPO preparation F2", Sephacryl.
A concentrated preparation of the TPO active fraction F3 of S-200HR is referred to as "low molecular weight TPO preparation F3". For the sake of convenience, the high molecular weight TPO preparation F2 and the low molecular weight TPO preparation F3 described here refer to a collection of fractions having different elution positions by gel filtration chromatography, and do not necessarily represent the true molecular weight. is not.

[Table 2]After that, the low molecular weight TPO preparation F3 and the high molecular weight TPO preparation F2
Each proceeded to the next purification step. Below (8)
For each step of purification of low molecular weight TPO preparation F3 in (11)
I will talk about it. (8) YMC-Pack PROTEIN-RP <reverse phase
Chromatography> (7) Low molecular weight TPO preparation F3 (total protein mass 5
0.3 mg, protein concentration 0.184 mg / ml, relative activity
20000, relative activity 1007000, total volume 274
ml) developing solvent A (0.025% trifluoroacetic acid)
(TFA)) and developing solvent B (0.025% TFA)
Containing 1-propanol) to give a final volume of 508.6.
3ml, final propanol concentration about 20%, TFA concentration
0.012%, protein concentration 0.0989mg / ml
did. Insoluble matter was generated here, so centrifuge it.
Then, 254.3 ml (25.2 mg) of the supernatant alone is 2
YMC-that had been equilibrated with 30% B in advance
Pack PROTEIN-RP (YMC, Catalog
No. A-PRRP-33-03-15; diameter 3 cm,
Bed height 7.5 cm) at a flow rate of 2 ml / min
Was added. The precipitate was 5 mM CHAPS (3-[(3-
Colamidopropyl) dimethylammonio] -1-propa
Sulfonate; manufactured by Dojindo Laboratories, Catalog No. 7
20 mM sodium acetate containing 5621-03-3),
Add 20 ml of pH 5.5 to solubilize, combine and column
Sent to. After adding the sample, dissolve about 50 ml of the solution.
A medium (developing solvent A: developing solvent B = 3: 1) is passed through, and first,
The flow-through fraction was collected. Next, the development program (120 minutes
A linear concentration gradient from 30% B to 45% B) and then 10
Made of polypropylene with a total of 36 fractions per ml
Collected in a tube. Repeat this for the same tube
Since it was collected in a total of 36 flasks,
It became an action. The flow-through fraction is ultrafiltered as it is.
20 (made by Amicon; YM3 membrane, diameter 76 mm)
Concentrated to ml. Pass-through fraction and tube numbers 1 to 3
Take 0.1 ml from each 20 ml fraction of 6 and 2
After addition of 0 μl of 5% BSA, by centrifugal evaporation
Dry to final 0.25 ml IMDM assay culture
Dissolve in liquid and assay to identify TPO active fraction
Was. As a result, tube numbers 17-27 (propanol
The concentration of TPO in the range of 36.0-43.0%)
Yes, this is YMC-Pa derived from low molecular weight TPO preparation F3
ck PROTEIN-RP as TPO active fraction F2
Was. Just before proceeding to the next YMC-Pack CN-AP
And stored at -85 ° C. YMC-Pack PRO derived from low molecular weight TPO preparation F3
TEIN-RP TPO active fraction F2 Total volume 220 ml Protein concentration 0.0130 mg / ml Total protein mass 2.85 mg Relative activity 130000 Relative activity 371000 (9) YMC-Pack CN-AP <reverse phase chromatograph
Ruffy> YMC-derived from the low molecular weight TPO preparation F3 obtained in (8)
Pack PROTEIN-RP TPO active fraction F2
Of which 214.9 ml (total protein mass 2.79 mg, protein
Concentration 0.0130 mg / ml, relative activity 130000,
The relative activity amount of 36300) was adjusted to 50% glycerol.
6 ml was added, and the mixture was concentrated to 1.8 ml. Finally volume 5
ml, propanol concentration is less than 20%, glycerol
Was about 6%. Do this 5 times (the amount of protein injected each time)
0.555 mg, volume 1 ml). every time
0.1% TFA in developing solvent A and developing solvent B
Using 1-propanol containing 0.05% TFA, 15
YMC-Pack CN-AP (YM equilibrated with% B
C company, catalog number AP-513; diameter 6 mm,
(Head height 250 mm), flow rate of 0.6 ml / min
Injected at. After the injection is completed, the professional changes from 15% B to 25% B.
Increase the concentration of propanol, and further from 25% B to 50% B
It was developed with a linear concentration gradient of 65 minutes. Protein in the last round
Inject 1 ml of the same composition solution that does not contain, develop and
The TPO activity remaining inside was recovered. 6 times in total
Since it was collected in the same polypropylene tube, each flux
There were 44 bottles of 7.2 ml each. 30 of these
Take μl (1/240 fraction) and add 20 μl of 5
% BSA was added and dried to dryness by centrifugal evaporation.
Solution in 0.24 ml IMDM assay medium,
An assay was performed to identify the TPO active fraction. This result
Tube number 28 to 33 (3 in propanol concentration
(Ranging from 7.0 to 42.0%) has strong TPO activity.
Therefore, this is YMC-Pa derived from low molecular weight TPO preparation F3.
as the main TPO active fraction FA of ck CN-AP
Was. YMC-Pack CN- derived from low molecular weight TPO preparation F3
TPO active fraction of AP FA Total volume 43.20 ml Protein concentration 0.00863 mg / ml Total protein mass 0.373 mg Relative activity 800000 Relative activity 298400 (10) Capcell Pak C1 300A <Max
Final Reversed Phase Chromatography> TPO activity derived from low molecular weight TPO preparation F3 obtained in (9)
Of the 43.20 ml of the sex fraction FA, 43.12 ml (total protein)
White mass 0.372mg, protein concentration 0.00863mg /
ml, relative activity 800000, relative activity amount 29760
0.2 ml of 50% glycerol was added to 0.
Concentrate to 1 ml glycerol solution. to this
Developing solvent A (0.1% TFA): Developing solvent B (0.05
% TFA in 1-propanol) = 85:15 (15
% B) solution was added to a final volume of 2.1 m
1, propanol concentration about 14%, glycerol about
For a sample with 4.8% and a protein concentration of 0.177 mg / ml
Prepared. Capcell equilibrated with 15% B
 Pak C1 300A (Shiseido, Catalog No. C
1TYPE: SG300A; diameter 4.6mm, bed height
 250 mm) column, 27% B to 38% B
Up to 65 minutes with a linear concentration gradient at a flow rate of 0.4 ml / min
Unfold and 0.6 ml in 72 polypropylene tubes
Collected one by one. From each fraction 3 μl (200 min
1 fraction) and add 20 μl of 5% BSA,
Finally replaced with 225 μl IMDM assay medium
And assay 75 times diluted from the original volume
I went to From each fraction, 1μ for electrophoresis
Take 1 (1/600 fraction) and centrifuge
Gel electrophoresis and reducing agent-free SDS gel electrophoresis
Add 10 μl of pull buffer and treat at 95 ° C for 5 minutes
Was. Add this to 15-25% SDS-polyacrylamide
SDS gel using Recast gel (Daiichi Pure Chemicals)
2D-silver staining reagent / “Daiichi” silver staining kit
To ((Daiichi Pure Chemicals Co., Catalog No. 167997,
It is stained with the "Silver Staining Kit" below. Molecular weight marker
"Daiichi" III low molecular weight markers (Daiichi Chemical
Product No., Catalog No. 181061, hereinafter "DPCII
I ") was used. As a result of the above analysis, the tube number
No. 35-43 (Propanol concentration 30.0-32.5
% Range) clearly had TPO activity. this house
Tube number 36-42 (30.5 in propanol concentration
~ 32.0% range) as the main TPO active fraction FA
did. The above results are shown in FIG. Chromatography of protein mass
Estimate from grams and evaluate with assay results
And total protein mass 39.6 μg, protein concentration 9.4 μg / m
1, relative activity 4890000, relative activity 193600
Became. TPO active fraction S of tube number 36 to 42
Examination of the DS gel electrophoresis image showed that the activity was
It is clear that there is a band in which the colored intensity correlates
Became. Moreover, the molecular weight of this band is
17000-1 for standard molecular weight proteins in the reduced state
A powerful van located at 9000 and a candidate for TPO
It turned out to be (11) Extraction of TPO activity from electrophoresis gel <15%
SDS polyacrylamide gel electrophoresis>Analysis example of TPO active fraction FA TPO derived from the low molecular weight TPO preparation F3 obtained in (10)
Active fraction FA 4200 μl (total protein mass 39.6 μ
g, protein concentration 9.4 μg / ml, relative activity 489000
0, relative activity amount 193600), 5.5 μl (76
2.5 μl for active extraction
(1680 fraction) for silver staining
Take each in a sample tube and perform centrifugal evaporation.
And reducing agent-free SDS gel electrophoresis sample buffer
Add 10 μl and treat at 37 ° C for 1 hour, then at room temperature for 18:00
It was converted to SDS by leaving it for a while. For molecular weight markers
Is a prestained low range marker (Bio-R
ad company 161-0305), and DPCIII marker
Was used. These samples were prepared by a conventional method (Laemmli,
Nature, Volume 227, 680-685, (197).
0)) according to 15% S using microslab gel
DS polyacrylamide gel electrophoresis was performed at 4 ℃.
Was. Immediately after electrophoresis, cut the part to be stained with silver with a knife.
The sample was cut, placed in a fixative solution, and silver-stained using a silver staining kit.
On the other hand, the portion where the activity should be
Using a knife, use 34 knives with a width of 1.5 to 2.5 mm.
Kobayashi's method (Mikihiko Kobayashi, Biochemistry, No. 5)
No. 9, No. 9 (1987)) was used to break the gel.
It was crushed. 0.3 for each gel crushed into fine pieces
ml extraction buffer (20 mM Tris-HCl,
pH8, 500 mM NaCl, 0.05% BSA)
In addition, extraction was performed by shaking at 4 ° C. for 6 hours. Then final
500 mM potassium phosphate with a concentration of 20 mM, pH 6.8
And shake at 4 ° C for 1 hour to remove precipitated SDS
For Ultra Free C3GV 0.22μm with filter
Filtration unit (Millipore, model UFC3 OGV
0S) and 15 at 1000xg (4000RPM)
After centrifuging for a minute, the filtrate was collected. This is Ultra Free C
3-LGC molecular weight 10,000 cut ultrafiltration unit
(Millipore, model number UFC3 LGC 00)
It was centrifuged at 3000 xg (7000 RPM). Concentrate
At about 50 μl, 300 μl of 20 mM Na
 Add Phosphate, pH 7.2 buffer
Then, ultrafiltration was performed again. Repeat this 2 times and leave
SDS was removed. In addition, the same
The above operation was repeated to finally prepare 300 μl.
This was sterilized and the TPO activity was measured. Such an experiment
As a result, the protein clearly detected by silver staining was DPCI.
Apparent molecular weight of about 17,000 to II marker
There were three kinds, 19000, 14000 and 11000.
TPO active fraction of Capcell Pak C1 column
Electrophoresis, strength of activity and intensity of stained band
The apparent molecular weight correlated with is about 17,000 to 1900
Although 0 band was observed, TPO activity was also observed in this experiment.
The apparent molecular weight for which sex was detected is about 17,000-19
It was 000. The above results are shown in FIG. The above conclusion
As a result, the protein showing TPO activity was finally subjected to electrophoresis gel.
By the time it can be confirmed above, Capcell Pak C1
It can be confirmed that it was purified in the active fraction of the 300A column.
Was. This sample was applied to 15% SDS polyacrylamide gel.
Intensity of silver-stained band after electrophoresis (under non-reduction)
From the apparent molecular weight of about 170 in the total TPO active fraction.
The amount of TPO candidate protein from 00 to 19000 is about 1.7.
It was μg. Hereinafter, polymer TPO will be described in (12) to (15).
Each step of refining the standard F2 will be described. (12) YMC-Pack PROTEIN-RP <reverse
Phase chromatography> (7) Polymeric TPO preparation F2 (total protein mass 2
57 mg, protein concentration 0.894 mg / ml, relative activity 7
840, relative activity amount 2015,000, total volume 287m
1) Developing solvent A (0.025% TFA) and Sun
One third volume of pull, 95.8 ml of developing solvent B (0.0
25% TFA in 1-propanol) and add
Volume 383 ml, final propanol concentration about 25%, TF
A concentration 0.006%, protein concentration 0.671 mg / ml
And Insoluble matter was generated here, so after centrifugation
63.2 ml (42.8 mg) of pure chili divided into 6 times
YMC-Pack that had been equilibrated with 30% B in advance
 PROTEIN-RP (YMC, Catalog No. A
-PRRP-33-03-15; diameter 3 cm, bed
High 7.5 cm) column at a flow rate of 2 ml / min
Was. The precipitate was 20 mM sodium acetate containing 5 mM CHAPS.
I was able to solubilize by adding 10 ml of thorium, pH 5.5
Then, it was sent to the column together. Each sample
After injection, about 50 ml of solvent (developing solvent A: developing solvent
B = 3: 1), and collect the flow-through fraction, then
Program (linear concentration from 30% B to 120% B to 45% B)
Gradient) was started and a total of 24 fractions of 15 ml each
Was collected in a polypropylene tube. Is it the first time
Repeat from 6 to 6 times, and finally 90 ml each
Became 24 fractions. Pass-through fraction and Chu
No. 1 is the ultrafiltration unit as it is (manufactured by Amicon;
Concentrated to 90 ml with YM 3 membrane, diameter 76 mm).
Fractions from tube number 1 to 24, including flow-through
Take 0.3 ml from the solution and add 10 μl of 5% BSA
Centrifuge to dryness and finally 0.3 ml
IMDM Assay Dissolved in culture medium, assayed, T
The PO active fraction was identified. As a result, tube number 10
〜15 (Propanol concentration 34.0-39.5% range
Box) has the activity of TPO.
2 derived YMC-Pack PROTEIN-RP T
It was designated as PO active fraction F2. Next YMC-Pack CN
-Stored at -85 ° C until immediately before proceeding to AP. YMC-Pack PRO derived from polymer TPO preparation F2
TIN-RP TPO active fraction F2 Total volume 540 ml Protein concentration 0.021 mg / ml Total protein mass 11.4 mg Relative activity 227,000 Relative activity amount 2588000 (13) Superdex 75 pg <CHAPS
Gel filtration chromatography in the presence> YMC derived from polymer TPO preparation F2 obtained in (12)
-Pack PROTEIN-RP TPO active fraction F
Out of 2, 538.2 ml (total protein mass 11.3 mg,
Protein concentration 0.021mg / ml, relative activity 22700
0, relative activity amount 2565000) and 50% glycerol
After the addition of 0.6 ml, the solution was concentrated by centrifugal evaporation.
Then 6 ml of 20 mM CHAPS was added. Further
To this, 18 ml of 20 mM CHAPS was added and stirred,
C. and 41 hours later the first sample was HiLoad
26/60 Superdex 75 pg (Pharma
Ciabiotech, Catalog No. 17-1070-0
1; diameter 2.6 cm, bed height 60 cm)
Inject 5 mM CHAPS at a flow rate of 1 ml / min
Developed with DPBS containing. 4 ml at a time (protein concentration of 0.
Sample with 466 mg / ml and protein mass 1.86 mg)
Was injected into the column. Divide into columns for the 6th time,
TP of all YMC-Pack PROTEIN-RP
The O-active fraction was separated on a Superdex 75 pg column.
I took it. Fraction is 5 ml, 6 times, 3 in total
There were 45 0 ml fractions. Each
Take 0.1 ml from the ration and 10 μl of 5% BS
After adding A, dry it by centrifugal evaporation and finally
Dissolve in 0.25 ml IMDM assay medium and
The seeds were subjected to a sacrifice to identify the TPO active fraction. As a result,
Tube No. 13-31 (Molecular weight 78000-3000
Range)), there was TPO activity.
Superdex 75 pg T from PO standard F2
It was designated as PO active fraction F2. Superdex 75 derived from polymer TPO preparation F2
TPO active fraction of pg F2 Total volume 540 ml Protein concentration 0.00216 mg / ml Total protein mass 1.17 mg Relative activity 1750000 Relative activity 204204 (14) YMC-Pack CN-AP <reverse phase chromatography
Graph> Sup derived from polymer TPO preparation F2 obtained in (13)
erdex 75 pg TPO active fraction F2 (molecular weight
 78000-3000) out of 540 ml, 513.
2 ml (total protein mass 1.11 mg, protein concentration 0.002
16 mg / ml, relative activity 1750,000, relative activity
1943000) to 1/10 volume of developing solution B (0.05
% 1-propanol containing TFA), and then
15% B using medium A (0.1% TFA) and developing solution B
YMC-PackCN-AP (YMC
Made, Catalog No. AP-513; Diameter 6 mm, Bed
(High 250 mm) column at a flow rate of 0.6 ml / min
I entered. After infusion, propano was changed from 15% B to 25% B.
6% from 25% B to 50% B
It was developed with a linear concentration gradient of 5 minutes. YMC-Pack C
When proceeding to the N-AP column, all input samples
1 / 20th of all, first piloted, good activity
It was confirmed that it was possible to collect it. So 20 minutes remaining
No. 19 was divided into two portions and collected. In other words, a total of 3 deployments
Was done. Each fraction collected in a total of 3 times
Since I collected them in 44 polypropylene tubes,
The total amount was 3.6 ml. Of this, 5 μl (720 minutes
1 fraction) and finally 0.25 ml of I
The medium was replaced with the MDM assay medium. The results of the assay
Tube No. 24-30 (Propanol concentration 36.0
42.0% range) had extremely strong TPO activity
Therefore, this is YMC-Pa derived from polymer TPO preparation F2.
as the main TPO active fraction FA of ck CN-AP
Was. Superdex 75 derived from polymer TPO preparation F2
TPO active fraction of pg FA Total volume 25.20 ml Protein concentration 0.0246 mg / ml Total protein mass 0.620 mg Relative activity 700000 Relative activity 434,000 (15) Capcell Pak C1 300A <maximum
Final reverse phase chromatography> YMC derived from polymer TPO preparation F2 obtained in (14)
-Pack CN-AP TPO active fraction FA25.2
Of 0 ml, 24.66 ml (total protein mass 0.606
mg, protein concentration 0.0246 mg / ml, relative activity 70
0000, relative activity of 424,000), 0.4 ml of
Add 50% glycerol and concentrate by centrifugal evaporation.
Shrunk. Finally, the propanol concentration is a few percent, glycero
2% with 10% protein concentration of 0.303 mg / ml
It became a sample of. Developing solvent A (0.1% TF
A), developing solvent B (1-pro containing 0.05% TFA)
Capce equilibrated at 15% B using
ll Pak C1 300A (Shiseido Catalog Number
C1 TYPE: SG300A; diameter 4.6 mm, flat
(Head height 250 mm)
Flow rate 0.4 ml / m with linear concentration gradient to 8% B in 65 minutes
It is developed with in and 0.
6 ml each was collected. 0.75 μl from each fraction
Take 1/800 fraction, 20 μl of 5%
BSA was added and finally 225 μl of IMDM assay
Replaced with culture medium and diluted 300 times from the original volume
Things were assayed. From each fraction, swim
2 μl (1/300 fraction) for movement
, Centrifugal evaporation, and 10 μl of reducing agent
Not adding SDS electrophoresis sample buffer, 95 ℃
For 5 minutes. Add this to 15-25% SDS-polya
Uses Crylamide precast gel (Daiichi Pure Chemicals)
Then, SDS gel electrophoresis was performed, and the cells were stained with a silver staining kit.
A DPCIII marker was used as a molecular weight marker. Since
As a result of the above analysis, tube numbers 33 to 39 (propano
TP in the range of 29.5-31.5%)
There was O activity. Of these, tube numbers 34 to 39
(Propanol concentration is in the range of 30.0-31.5%)
The main TPO active fraction was designated as FA. Main TPO activity
Examining the SDS gel electrophoresis image of the sex fraction, (1
Starting from the low molecular weight TPO preparation F3 described in 0)
The apparent molecular weight range of 17,000 to 22,000
In addition, there is a band in which the intensity of activity correlates with the intensity of staining.
It became clear that it exists. <Example 2> Analysis of partial amino acid sequence of rat purified TPO Iwamatsu's method (Iwamatsu et al., New Basic Biochemistry Experimental Method, Volume 4, 3)
Pages 3-84 (published by Maruzen); Akihiko Iwamatsu, Biochemistry, Volume 63,
No. 2, pp. 139-143, (1991); Akihi.
ro Iwamastu, Electrophore
sis, vol. 13, pages 142-147, (1992)).
According to the above, the Capcell obtained in (10) of Example 1
 In the TPO fraction FA of the Pak C1 300A column
Analysis of amino acid sequence of rat TPO candidate protein
It was. That is, the sample is subjected to SDS gel electrophoresis
Transferred to polyvinylidene difluoride (PVDF) film
Was. Then, the protein on the PVDF membrane is reduced with S-alkyl.
After conversion, it is systematically and stepwise limited by 3 proteases
Enzymatic degradation, peptide fragmentation, and reverse phase
The resulting peptide was purified by chromatographic separation and purified.
It was analyzed by a sensitive amino acid sequencing method. Details below
Describe the details.Capcell Pak derived from low molecular weight TPO preparation F3
C1 300A TPO fraction FA of TPO candidate protein
Analysis example (1) Capcell Pak C1 300A column
Concentration of TPO fraction FA (tube Nos. 36 to 42) of the low molecular weight TPO preparation F3 obtained in (1) of Example 1
Of the conventional CapcellPak C1 300A column
TPO active fraction FA (tube number 36 to 42) 420
0 μl (total protein mass 39.6 μg, protein concentration 9.4 μg
/ Ml, relative activity 4890000, relative activity 193
Of the 600, 4151 μl (9 of the total fraction)
8.8%) was advanced for analysis for amino acid sequences. Black
The protein mass estimated from the matogram is 39.1 μg.
However, among these, it seems to have been silver stained by SDS gel electrophoresis.
TPO candidate protein having a molecular weight of about 17,000 to 19000
The amount of white matter was about 1.6 μg. In this sample
Add lycerol, concentrate by centrifugal evaporation,
5 μl glycerol solution. This includes a reducing agent
No SDS electrophoresis sample buffer, and adjust pH
1M Tris-HCl, pH 8 was added to adjust
Finally, 200 mM Tris-HCl, pH8.
0,50 mM Tris-HCl, pH 6.8,1.1
% SDS, 2 mM EDTA, 0.02% BPB, 30
About 25 μl of sample containing% glycerol was made. This
SDS samples without overheating
First at room temperature for 14 hours, then at 60 ° C for 5 minutes
Processed. (2) Electrophoresis Microslab gel (4.0% acrylic
Prepare amide concentration gel, 15% acrylamide separation gel)
SDS gel electrophoresis at room temperature at 12.5 mA, then
It is carried out for 2 hours at a constant current of 17.5 mA.
Was. For molecular weight markers, prestained low range
A marker (Bio-Rad 161-0305), and
The DPCIII marker was used. PVD immediately after migration
It was transferred to the F film (next item). In addition, the sample submitted for analysis
Part of the dithiothreitol (D
15-25% polyacrylamide gel
Recast gel (Daiichi Pure Chemicals Co., Ltd .; Multi-Gel 15 /
25, catalog number 211072). This
When this was silver stained using a silver staining kit,
The expected band has a molecular weight of about 1900 under reduction.
0 and Capcell PakC1 300A color
The purity of the TPO candidate protein in the TPO active fraction of
It was confirmed to be about several percent. In addition, non-reduction / reduction
Because of their different mobilities, at least one
It was suggested to have more than one S-S bond. (3) Transfer to PVDF membrane by electroblotting
・ Band detection Semi-dry transfer device (Marisol, wet for transfer
Using a copying apparatus model KS-8460), according to a conventional method,
160mA (11-17V) constant current for 1 hour
PVDF membrane (ProB manufactured by Applied Biosystems)
transfer to lott, catalog number 400994)
Was. 0.3M Tris, 20% methanol in anolyte
, PH 10.4, 25 mM Tris,
25% in 20% methanol, pH 10.4, catholyte
 Tris, 40 mM aminocaproic acid, 20% meta
Nol, pH 10.4 was used. Ponso the transferred film
-S staining solution (0.1g Ponceau S in 100ml and 1m
1), multiple bands were stained.
Colored and expected to have a molecular weight of about 1900 with TPO
A band of 0 could be confirmed. Cut this out,
We proceeded to the fragmentation of the peptide. (Next section) (4) Peptide fragmentation and peptide mapping
Amino acid sequence analysis TPO transferred / reduced S-alkylated on PVDF membrane
In order to systematically fragment the candidate protein, the following three
Stepwise limited enzymatic degradation by protease
Was. Primary digestion Lysyl endopeptidase (Achromo
Bacter lyticus m497-1, Jun Wako
Yakuhin Kogyo, Catalog No. 129-02541) Secondary digestion Endoproteinase Asp-N (Berlin
Made by Gar Mannheim, Catalog No. 1054558
9) Tertiary digestion Trypsin-TPCK (Worthingt
on Biochemical, Catalog No. 3
740) Peptide fragments obtained by each enzymatic digestion are collected and developed.
0.05% TFA for solvent A and 0.02% T for developing solvent B
Isopropanol containing FA: acetonitrile = 7: 3
Wakosil-II 5C18 C using a mixture of
18 reverse phase column (manufactured by Wako Pure Chemical Industries; diameter 2.0 mm,
Length 150 mm, column temperature 30 ° C., flow rate 0.25
ml / min 1% B to 50% B 30 min linear gradient
Mapping (Fig. 4) by developing at
The recovered peptide fragment was recovered. Each pepti
Gas fragment amino acid sequencer (made by Shimadzu)
Made by Seisakusho, PPSQ-2), decomposed by Edman, and then collected sequentially
The N-terminal PTH amino acid
By C18 reverse phase column chromatography by elution method
Identification was performed. The results are summarized below. Peptide cleavage by primary digestion lysyl endopeptidase
Amino acid sequence of fragment Fragment name Amino acid sequence

[Table 3]

[Table 4]

[Table 5] Of the above sequences, those shown in () are amino acid residues that can be deduced from systematic enzymatic digestion. (5) Similarity analysis of obtained amino acid sequence <homology search> Whether the obtained amino acid sequence is contained in a known protein that has already been reported, or whether there is a protein having a similar sequence , Sequence analysis software Mac Vector (Kodak Intern
national Biotechnologies, In
c. ) Was used for analysis. Information on known proteins or known genes can be found in the Entrez Release 6 database (National Center for USA).
Biotechnology Information
n, National Library of Med
icine, National Institutes
of Health, published August 15, 1993). The various databases included in this are as follows. Entrez Release 6 Database NCBI-GenBank, August 15, 19
93 (Release 78.0) EMBL, July 15, 1993 (Release)
35.0 plusdates) DDBJ, July 15, 1993 SWISS-PROT, April, 1993 (Rel)
ease 25.0) PIR, June 30, 1993 (Release)
37.0) PDB, April, 1993 PRF, May, 1993 dbEST, July 15, 1993 (Releas.
e 1.10) U. S. and European Patents
(Part) As a result, the sequence (K) DSFLADVK of AP12 is
Rat corticosteroid-bindin
g Globulin (CBG) precursor
[PIR database registration number A40066; Smi
th and Hammond; "Rat cortic
Osteroid-binding Globulin:
primary structure and mes
singer ribonucleic acid l
evels in the deliverer under
effective physiological conc
dtions. "Mol. Endocrinol.,
(1989), 3,420-426,] internal array KD
It was completely consistent with SFLADVK. Upon closer examination, the AP3 sequence (K) XYYES / ((X is A, S,
It was found that a sequence of KQYYESE, which has high similarity to G, M, or Q), (Z is E or K), is contained in the amino acid sequence of rat CBG. These A
The sequences corresponding to P12 and AP3 are continuous in rat CBG and correspond to the internal amino acid sequence KDSFLADVKQYYESE. However, AP12, A
Regarding the amino acid sequences of fragments other than P3, no known protein or gene whose similarity should be considered was found. <Example 3> Analysis of biological properties of TPO derived from thrombocytopenic rat plasma (1) Rat CFU-MK assay system (liquid culture system)
As a typical example, a partially purified preparation of TPO from thrombocytopenic rat plasma (YMC Pa described in (8) of Example 1) was used.
ck Protein-RP column TPO active fraction F
The dose-response curve when 2) was used is shown in FIG. When the culture was observed under a microscope over time, the differentiation of megakaryocytes, the progress of maturation, that is, the increase in cell size was observed over time, and it was considered that the increase in cells was also occurring. As a particularly remarkable change, protrusion formation by numerous megakaryocytes was observed on day 4 of the last day of culture (almost not observed on day 3 of culture). This protrusion formation is cyto
plastic process formation
(Leven and Ye, Blood, Volume 69, 1046
-1052, (1987)) or propl
atlet process formation
(Topp et al., Blood 7, Vol. 76, 912-924.
Page, (1990)) and the like, which is a precursor structure of platelets that have further differentiated from megakaryocytes, and is considered to be the final form of megakaryocyte differentiation that can be observed in vitro so far. Since such a morphological change was frequently observed in the TPO preparation alone, this factor was used alone as C
There is a possibility that FU-MK proliferation and differentiation are promoted, mature megakaryocytes are generated, and finally, platelet production is advanced. (2) In a colony assay system, a partially purified preparation of TPO from thrombocytopenic rat plasma, a colony of rat non-separated bone marrow cells, cells at each stage of separation / concentration, or GpIIb / IIIa ⁺ CFU-MK fraction was used. When assayed by the assay system, TPO derived from rat plasma formed megakaryocyte colonies. T
Megakaryocyte colonies formed by PO and other known cytokines, namely rat IL-3, mouse GM-CS
Comparing the megakaryocyte colonies formed by F or human EPO, the megakaryocyte colonies formed by TPO have a small number of megakaryocytes forming individual colonies, but the size of each megakaryocyte is large. It has a characteristic that it has advanced maturity. Furthermore, colonies of other cell lines were scarcely formed, and TPO showed Meg-C.
SF activity is considered to be megakaryocyte-specific activity. From these facts, TPO is
Other known cytokines exerting the activity of eg-CSF, namely rat IL-3, mouse GM-CSF, and human EPO, have different biological properties and are unique Me
It was revealed to exert g-CSF activity. CD34 ⁺ DR derived from human bone marrow cells or human cord blood cells
⁺ T from thrombocytopenia rat plasma even for cell fraction
The partially purified PO preparation showed Meg-CSF activity and formed a significant number of human megakaryocyte colonies. This indicates that this factor has no species specificity. <Example 4> Specification of rat TPO producing cells (1) Search for rat TPO producing organs First, cloning of rat TPO gene based on partial amino acid sequence of rat TPO, or purpose of securing mRNA source for expression cloning And rat T
The PO-producing organs were searched and specified. Initially, bone marrow, lung, liver, and spleen were excised with time from a rat that had been thrombocytopenic by administration of P55 antibody, and the culture supernatant of the cells (organ sections in the case of lung and liver) was collected to prepare rat CFU- M
The activity in the supernatant was evaluated by the K assay system, but no definite result was obtained. Then, the liver and T in the rat
A report suggesting a relationship with PO production (Siemensm
a. Lab. Clin. Med. , Volume 86, 81
7-833, (1975)), hepatocytes prepared by the collagenase perfusion method were cultured from the liver of a rat that had been thrombocytopenic by administration of P55 antibody, and the supernatant was applied to a WGA-Agarose column. The adsorbed fraction is V
When developed on a ydac phenyl reverse phase column,
Rat plasma-derived TP in rat CFU-MK assay system
A very similar activity was observed at the same position as the O activity.
Although weak, the activity was observed in the culture supernatant of normal rat hepatocytes. These results strongly suggested that the liver might be one of the TPO-producing organs. (2) Screening of rat TPO-producing cell line Based on the above results, screening of rat TPO-producing cell line was performed. First, 20 types of rat liver-derived cell lines were cultured in each subculture medium until they became almost confluent, and then the serum contained in the culture medium was adjusted to 5%.
The culture medium was replaced with% FCS, and the culture was continued for 3 days, and the culture supernatant was collected. The supernatant was partially purified by the method described in (1) and
When the presence or absence of PO was examined, three types of rat liver parenchymal cell-derived cell lines, namely, McA-RH8994 cells (A
TCC deposit number CRL1602, Becker et al., “O
ncodevelopmental Gene Exp
region "ed. by Fishman an
d Sell, Academic Press, NY,
259-270, (1976), purchased from Dainippon Pharmaceutical Co., Ltd., H4-II-E cells (ATCC Deposit No. CRL).
1548, Pitot et al., Nat. Cancer I
nst Monogr. , 13: 229-245,
(1964), purchased from Dainippon Pharmaceutical, and HTC cells (Thompson et al., Proc. Natl. Aca.
d. Sci. USA, 56, 296-303, (1
966), purchased from Dainippon Pharmaceutical Co., Ltd.), production of TPO activity was clearly confirmed. (3) Detailed analysis of TPO activity produced by McA-RH8994 cells, H4-II-E cells, and HTC cells Purification proceeded in parallel with TPO activity secreted from these three types of rat cell lines. Rat plasma-derived TPO
The activity was examined in more detail in terms of both biochemical and biological properties. 10 McA-RH8994 cells
The suspension was suspended in an alpha-MEM (-) culture solution containing% FCS and placed in a culture plastic flask for tissue culture having a bottom area of 175 cm ² at 1 × 10 ⁶ cells / flask to be placed in a 5% carbon dioxide incubator. After culturing at 37 ° C. for 3 days, the medium was replaced with IMDM culture medium containing 5% FCS, the cells were further cultured for 3 days, and the supernatant was collected. Dulbecco-modified Eagl containing H4-II-E cells containing 10% FCS
e culture solution (containing 4.5 g / l glucose) (hereinafter, DM
EM culture solution) and placed in a plastic flask for tissue culture having a bottom area of 175 cm ² at 5 × 10 ⁵ cells / flask at 37 ° C. in a 5% carbon dioxide incubator.
After culturing for 3 days, the medium was replaced with IMDM culture medium containing 5% FCS, and the culture was continued for 3 days, and the supernatant was collected. In addition, HTC cells were suspended in a DMEM culture solution containing 5% FCS and placed in a plastic flask for tissue culture having a bottom area of 175 cm ² at 2.5 × 10 ⁵ cells / flask to incubate a 5% carbon dioxide gas incubator. After culturing in the medium at 37 ° C for 3 days, the medium was replaced with IMDM culture medium containing 5% FCS,
The culture was further continued for 3 days, and the supernatant was collected. From 2 liters of the culture supernatant of each of the three types of cell lines thus obtained, the cell line-derived TPO was partially purified according to the method for purifying TPO from XRP described in Example 1-2. The outline will be described below. First, the culture supernatant was concentrated about 6 times with an ultrafilter, and the buffer was exchanged with 20 mM Tris-HCl (pH 8.0) using a Sephadex G-25 column. Eluate Q-Sepharose F
20 mM Tris-HCl (pH
After washing with 8.0), the adsorbed fraction was washed with 175 mM NaCl.
Elution with 20 mM Tris-HCl (pH 8.0) containing This fraction was added to a WGA-Agarose column, washed with PBS, and the adsorbed fraction was washed with 0.2 MGlc.
20 mM Na containing NAc and 0.15 M NaCl
Elution was performed with Phosphate (pH 7.2).
This eluate was used as TSK-gel AF-BLUE 650.
20 mM containing 1M NaCl, added to MH column
After washing with Na Phosphate (pH 7.2), elution was performed with 2M NaSCN. This is Phen
yl-Sepharose 6 FF / LS column and loaded with 1.5 M ammonium sulfate (Ammonium
50 mM Na Phosp containing Sulfate)
hate (pH 7.2), and then washed with 36 mM Na Phosphate containing 0.8 M ammonium sulfate, and then washed with 20 mM Na Phosphate (pH
It was eluted according to 7.2). After concentrating this adsorption fraction,
Reverse-phase Vydac Protein C4 column (The
Separations Group Catalog No. 214TP51015; diameter 1 cm, bed height 15
cm). Using 1-propanol containing 0.1% TFA as the developing solvent A and 0.05% TFA as the developing solvent B, the column was preliminarily equilibrated with 20% B, and after injecting the sample, 20% B at a flow rate of 1 ml / min. From 9 to 40% B
Elution was performed with a linear concentration gradient of 0 minutes. As a result, the TPO activity derived from any cell line was 1% at a concentration of 30% to 43%.
Eluted with propanol. As a result of measuring the activity of the preparations at each purification stage with the rat CFU-MK assay system, the TPO activities derived from the three cell lines were all TP derived from XRP.
The behavior was very similar to that of O activity (see Example 1-2) (Table 6 describes relative specific activity, activity yield, etc. at each step in the rat CFU-MK assay system). Furthermore, the elution fraction from the final reverse phase column was used as a rat CF.
As a result of measuring the activity by the U-MK assay system, the TPO activity derived from three types of cell lines and the TPO activity derived from XRP were eluted at the same peak position. Focusing on the active fraction of this reversed phase column, rat GpIIb / IIIa ⁺ CFU-M
A colony assay was performed using non-adherent cells obtained in the step of removing adherent cells in the process of separating and concentrating K. As a result, it was found that the megakaryocyte colonies were almost in agreement with the elution pattern of activity in the rat CFU-MK assay system. Formation was observed (Table 7), and like the XRP-derived TPO activity, 3
All of the cell line-derived activities exclusively formed megakaryocyte colonies and almost no colonies of other lineages. According to the method described in Example 1-2, the pooled active fractions of the reversed-phase column were subjected to SDS polyacrylamide gel electrophoresis, and the protein was extracted from the gel after the electrophoresis, and the activity was measured by a rat CFU-MK assay system. As a result, TRP derived from XRP had an apparent molecular weight of 17,000.
~ 22000, TPO derived from McA-RH8994 cells
Has an apparent molecular weight of 33,000 to 39000, H4-II
-EPO cell-derived TPO has an apparent molecular weight of 31000-3
8000, TPO derived from HTC cells has an apparent molecular weight of 1
7,000-22,000, and molecular weight 28,000-35
Had 000. As described above, McA-RH89
The TPO activity produced by 94 cells, H4-II-E cells, and HTC cells has a biological property slightly different from that of XRP-derived TPO in terms of apparent molecular weight, but has a biological property. It became clear that it was equivalent in. In the present invention, it should be noted that a molecule having a TPO activity present in blood has a specific intramolecular structure in the producing cell or after being secreted from the producing cell.
Or it suggests that it may have been cut at an unspecified position. In addition, TPO gene (mRNA and cDNA)
It also shows the possibility that various lengths exist.

[Table 6]

[Table 7] <Example 5> Expression vector for producing a cDNA library (pEF18
Construction of S) A vector was prepared which was easy to incorporate the cDNA fragment into the vector and had high expression efficiency of the cloned cDNA, and prepared for cloning and expression of TPO cDNA. That is, the promoter of the elongation factor 1α (EF1α), which is known as a promoter with high expression efficiency, is used as the SRα of the expression vector pME18S which is easy to handle.
The expression vector pEF18S was constructed by replacing the promoter (see FIG. 6). Elongation factor 1
The promoter of α is the expression vector pEF-BOS (Mi
zushima et al., Nucleic Acids Re
s. , 18 , 5322, 1990) 1 μg of restriction enzyme H
2% after partial digestion with indIII and EcoRI
About 1200 bp DNA was subjected to electrophoresis using agarose gel (FMC BioProducts).
Fragments were separated and prep-A-gene DNA purification kit (Bio-Rad; Willis et al., BioTech).
Nikes, 9 , 92-99, 1990, and was purified using a kit for selectively purifying DNA by adsorption using a porous silica-based matrix. 100 ng of this DNA fragment is similarly converted to H
50 ng of the expression vector pME18S (Liu et al., Proc Natl.
Acad. Sci. USA, 90 , 8957-896.
1, 1993). Competent high E. coli DH5 (manufactured by Toyobo Co., Ltd .; Han
ahan et al. Mol Biol, 166 , 557-
The obtained 12 colonies are randomly selected using a competent host bacterium prepared by a modification of the method of 580, 1983) to purify the plasmid DNA, and the desired plasmid ( p
One of 10 clones containing EF18S) was selected and a large amount of plasmid DNA was prepared. Plasmid D
Purification of NA is essentially Molecular Cloni
ng [Sambrook et al., Cold Spring
Harbor Laboratory Press (1
989)]. That is, the clone pME18S obtained as described above
50 ml containing 50 μg / ml of Ampicillin
LB medium (1% Bacto-tryptone, 0.
5% Bacto-east extract, 0.5
% NaCl), the cells obtained by centrifugation were added to 4 ml of TEG-lysozyme (25 mM T).
ris-Cl (pH8), 10 mM EDTA, 50 m
M Glucose, 0.5% lysozyme) solution, and 8 ml of 0.2N NaOH / 1% SDS solution is added and well suspended. Further 3M potassi
6 ml of um / 5M acetate solution was added, well suspended, and then centrifuged to obtain a supernatant. The supernatant was treated with phenol-chloroform (1: 1), added with an equal amount of isopropanol and centrifuged to obtain a pellet. The pellet was a TE solution (10 mM Tris-HCl (pH 7.5), 1 mM ED).
After dissolution in TA), RNAse treatment and phenol-chloroform (1: 1) treatment are performed, and ethanol precipitation is performed. The pellet was dissolved again in TE solution, and Nacl and polyethylene glycol 3000 were added to 0.63M,
Add to 7.5% and centrifuge. Finally, the pellet is dissolved in TE solution and then ethanol precipitated. As a result, about 300 μg of plasmid DNA was obtained. This DN
After completely digesting 100 μg of A with restriction enzymes EcoRI and NotI, 0.8% agarose gel (FMC Bi
(manufactured by O. Products), the vector fragment was recovered and purified by Prep-A-gene DNA purification kit (manufactured by Bio-Rad), and about 55 μg of plasmid DNA was obtained.
I got This DNA was used for the following cDNA library construction. <Example 6> Purification of mRNA from McA-RH8994 cells McA-RH8994 cells, which had relatively higher activity than the results of the colony assay of Example 4, were transferred to rat TPOcDN.
It was selected as a material for A cloning and used in the following experiment. All R
Isolation of NA is essentially Molecular Cloni
ng [Sambrook et al., Cold Spring
Harbor Laboratory Press (1
989)]. Mc
The A-RH8994 cells were completely and densely grown on 15 petri dishes having a diameter of 90 mm, the culture solution was removed from the petri dishes, and 0.8 ml of 5 M guanidine solution (5 M guanidine thiocyanate, 5 mM citrate was added to each petri dish. Sodium (pH 7.0), 0.1M β-mercaptoethanol, 0.5% sodium sarcosyl sulfate) was added,
After being well suspended, the mixed solution was collected in one tube, and a guanidine solution was added to make the total volume 20 ml. The mixture in which the cells were broken and became viscous was inhaled and discharged repeatedly about 20 times using a 20 ml syringe equipped with an 18G and 21G needle, until the viscosity became almost zero. Add 18 ml of 5.7M CsCl-0.1 to a polyallomer centrifuge tube that fits the Beckman SW28 rotor.
M EDTA (pH 7.5) was previously added as a cushion, and about 20 ml of the above mixed solution was gently overlaid so that the layers were not disturbed so that the tube was almost filled. The centrifuge tube prepared in this way is subjected to 250 at 20 ° C.
00r. p. m. After centrifugation for 20 hours, the obtained pellet was washed twice with a small amount of 80% ethanol.
The pellet was dissolved in TE solution, extracted with phenol-chloroform (1: 1), and then 1/10 amount of 3M sodium acetate and 2.5 times amount of ethanol were added to perform ethanol precipitation to obtain total RNA ( Total R from about 10 ⁸ cells
About 2.5 mg NA was obtained). Poly (A) from total RNA
⁺ RNA is purified by Oligotex ^™ -dT30 (S
upper) (manufactured by Nippon Synthetic Rubber / Nippon Roche); oligo dT is covalently immobilized on the surface of latex particles, and poly (A) ⁺ RNA is used in the same manner as the oligo dT column used for purifying poly (A) ⁺ RNA. Can be purified). From about 500 μg of total RNA, 20 μg of poly (A) ⁺ RNA was obtained. Example 7 Construction of Rat cDNA Library From 5 μg of poly (A) ⁺ RNA obtained in Example 5 to T
imageSave ^™ cDNA Synthesis
Kit (Pharmacia; Okayama-B)
erg method: Mol. Cell. Biol. , 2 , 161
-170, 1982, modified kit for cDNA synthesis) and DIRECTIONAL CLONING
TOOLBOX (Pharmacia; primer for synthesizing cDNA containing NotI sequence: 5'-A A double-stranded cDNA having EcoRI and a NotI recognition site at the 3 ′ end was synthesized. The synthesized cDNA was ligated with 1.2 μg of the expression vector pEF18S (see Example 5) which had been previously treated with EcoRI and NotI, and 8.4 ml
Competent High E. E. coli DH5 (manufactured by Toyobo Co., Ltd.) was transformed. As a result, 5.3 × 10 ⁵ transformants were obtained. <Example 8> Acquisition of rat TPO cDNA fragment by PCR method (cloning) 530,000 clones of the McA-RH8994 cDNA library prepared in Example 7 were treated with 50 μg / ml Ampic.
After culturing overnight in 50 ml of LB medium containing ilin,
From cells obtained by centrifugation, QIAGEN-tip10
0 (manufactured by DIAGEN; silica gel based anion exchange column for DNA purification) using McA-RH8994.
The cDNA library plasmid was purified to about 200μ.
g plasmid DNA was obtained. Two types of antisense nucleotide primers AP8-1R and AP8-, which correspond to the amino acid sequence of the peptide fragment AP8 described in Example 2.
2R, and sense nucleotide primers EF1α-1, EF1α-corresponding to the first intron of human elongation factor 1α of the plasmid vector pEF18S shown in FIG. 6 used for preparing the cDNA library.
2 was synthesized. Applied Biosystems 394 DNA / RNA synthesizer (synthesizer based on β-cyanoethylamidite method) is used for synthesis, and OPC column for synthetic DNA purification (a column packed with reverse phase silica gel and having a trityl group is manufactured by the same company) It was purified using a column for purifying DNA. The purified synthetic DNA is TE
Dissolve to 50 μM in the solution, and keep -20 until use.
Stored at ° C. All synthetic oligonucleotides used below were similarly synthesized and purified before use. Primer AP
8-1R and AP8-2R are mixed primers consisting of 17 consecutive nucleotides and used deoxyinosine as in the work of Takahashi et al. (Taka).
hash, et al. , Proc. Natl. Ac
ad. Sci. (USA) 82 , 1931-1935.
(1985)). Primer EF1 α-1, EF1 α
-2 is described in Uetski, et al. , J. et al. Bio
l. Chem. 264 , 5791-5798 (198)
9) of the genomic sequence 1491-1512, 1513
It is a primer composed of 21 and 20 nucleotides, respectively, which was synthesized based on the nucleotide sequence corresponding to -1532. Table 8 shows the sequences of the synthesized primers.

[Table 8] McA-RH8994 cDNA library plasmid
Using 3 μg as a template, AP8-1R (500 pmol),
EF1 α-1 (100 pmol) was used as a primer
GeneAmp ^TM PCR Reagent Ki
t with AmpliTaq ^TM DNA Poly
merase (manufactured by Takara Shuzo; heat-resistant TaqI PCR PCR
Limerase, reaction buffer, dNTP set)
And GeneAmp ^TM PCR System 96
00 (manufactured by PERKIN-ELMER; PCR reaction)
PCR reaction (2 at 95 ° C) with a volume of 100 μl
After heating for 1 minute, denaturing conditions of 1 minute at 95 ° C, 1 minute at 40 ° C
35 times under annealing condition between 72 ° C and 1 minute synthesis condition
Reaction, and incubate at 72 ° C for an additional 7 minutes)
I went. To increase the specificity of the amplified DNA fragment
Using 1 μl of the obtained PCR reaction solution as a template,
α-2 (100 pmol), AP8-2R (500 pm
ol) as a primer in the same volume of 100 μl
PCR reaction (after heating at 95 ° C for 2 minutes, then at 95 ° C for 1 minute
Denaturing conditions, annealing conditions at 45 ° C for 1 minute, 1 at 72 ° C
The reaction was repeated 35 times under the synthetic condition of 7 minutes
Incubation at 2 ° C.). Reaction obtained here
2% agarose gel (FMC Bioprodu
This PCR reaction is performed by electrophoresis using Cts).
The DNA fragment of about 330 bp, which is the main product of
Prep-A-Gene DNA Purification Kit (Bio-Rad
(Manufactured by the company). This DNA fragment is called T4DNA
PCR using ligase (Life Technology)
^TM II (manufactured by Invitrogen; PCR product TA
Cloning vector: heat-resistant poly used for PCR
Because merase has terminal transferase activity
At the 3'end of the DNA amplified by PCR,
Utilizing the property of adding one nitric acid, 5'-dT overhanging powder
Vector pCR with edges ^TM Subclaw as it is on II
The method was subcloned into a vector. Arbitrarily
QIAGEN-tip1 for 28 selected clones
00 (manufactured by DIAGEN) using plasmid DNA
Was purified, and was purified by Taq Dye Deoxy ^TM Te
rminator Cycle SequencingK
it (manufactured by Applied Biosystems; using PCR)
Dideoxy method with fluorescent dye: Sanger
Proc. Natl. Acad. Sci. USA,
74 , 5463-5467, 1977).
373A DNA sequence manufactured by Ride Biosystems
Sequencing (fluorescence sequencer)
The nucleotide sequence of the clone was determined. Of the obtained DNA fragment
Of the amino acids of AP8 at the N-terminal side (Ile / Th
r / Ser) -Val-Pro with AP8-2R ply
Select the code adjacent to the mar and seek the full length
When enced, it contained a cDNA having 261 bp
I was out. 173 to 175 nucleotide sequence of this cDNA fragment
Is the code for methionine.
The frame matches the amino acid frame of AP8. Also
Before and after this sequence, the sequence of Kozak (Kozak,
M. , Cell, 44 , 283-292, 1986).
It is presumed to be the initiation site of translation from the fact that it is compatible, and rat T
A cDNA fragment encoding the N-terminal part of the PO protein,
it was thought. This cDNA fragment was named A1. Vek
And the base sequence of the A1 fragment excluding the target sequence
The deduced amino acid sequence is shown in the sequence listing (SEQ ID NO: 1).
It was <Example 9> Screening of rat TPO cDNA by PCR method
And contain 50 μg / ml Ampicillin.
After overnight culture in 1 ml of LB medium,
Motion Separation Device PI-100 (Kurashiki Spinning Company, VER-3.
0; Alkaline SDS method: Molecular Clon
ing [Sambrook et al., ColdSpring
Harbor Laboratory Press, 1
989]: Automatic extraction of plasmid DNA based on a modified method of
Machine) was used to extract the plasmid DNA. 1/3 of that
Designed based on Fragment A1 using 0 amount as template 2
Seed Synthetic Oligonucleotide 5'CGAGGGTGTACCTGGGTCCTG 3 '
(Sense sequence 1-17 of the sequence of SEQ ID NO: 1; CGAG
Is the sequence of the adapter) and 5'CAGAGTTAGT
CTTGCGGTGAG3 '(21 of the sequence of SEQ ID NO: 1
2-232 antisense sequence) as a primer
Generate and purify, GeneAmp ^TM PCR Regen
tKit with AmpliTaq ^TM DNA P
Gene using olmerase (Takara Shuzo)
Amp ^TM PCR System 9600 (PERK
PCR reaction (3 at 94 ° C) by IN-ELMER
Denaturation conditions for 0 seconds, annealing conditions at 66 ° C for 30 seconds,
The reaction was carried out 30 times under the synthetic conditions of 72 ° C for 1 minute).
As a result, a specific van of 236 bp was found in 3 of 100 pools.
Detected. One pool out of these is about 900
The plasmid DNA is extracted by
PCR reaction of 3 pools out of 100 pools
A band was detected at. In addition, 4 of 1 pool
It was divided into pools of 0 clones each, and the same selection was performed.
Results Vans considered to be specific in 3 out of 100 pools
De was observed. Select 1 pool out of these 50 μg
LB plate containing 15 ml / ml Ampicillin (15
Each one that appeared after being plated on LB medium containing% agar)
Plasmid DNA was extracted from the colonies of
As a result of CR reaction, 2 out of 100 clones
A positive band was detected. Example 10 Sequence of rat TPO cDNA Purification of plasmid DNA is essentially Molecular
Cloning [Sambrook et al., Cold S
pring Harbor Laboratory P
[ress (1989)].
gave. The two clones finally obtained in Example 9 were
50 ml containing 50 μg / ml Ampicillin
After culturing overnight in LB medium, purification was carried out in the same manner as in Example 5,
Finally, about 300 μg of plasmid DNA was obtained. here
The plasmid DNA obtained in step 1 was used as Taq Dye Deo
xy ^TM Terminator Cycle Sequ
ening Kit (Applied Biosystems)
(Manufactured by Mitsui Chemical Co., Ltd.)
The base sequence of NA full length was determined. As a result, two blacks
The nucleotide sequences of the clones are completely identical and must be identical clones.
And became clear. Select one clone from this
A plasmid clone carrying NA was designated as pEF18S-A.
It was named 2α. The base sequence and the sequence deduced from it
The mino acid sequence is shown in the sequence listing (SEQ ID NO: 2). Sequence listing
The features of the sequence shown in (SEQ ID NO: 2) are remarkable. 172
The sequence after the 5'untranslated region of bp begins with methionine
Signal sequence for secretion consisting of 21 proteins
It encodes a highly hydrophobic amino acid that is presumed to be
You. This protein has 126 amino acid residues,
1022 bases 3'untranslated after the stop codon (TAA)
Followed by multiple adenines of sequence and poly A tail. This tongue
The partial amino acid sequence analyzed in Example 2 was found in the protein.
Only the sequence corresponding to AP8 was included (SEQ ID NO: 2
Amino acid numbers 1 to 12). Of N-glycosylation
There is no sequence site for Also, the 3'untranslated sequence end
The nucleotide sequences of 1624 to 1629 near the end are consensus
Although it is different from the sequence, it is considered as a potential polyadenylation sequence.
To be Vector pEF18 carried in E. coli DH5
S-A2α is Ministry of International Trade and Industry on February 14, 1994.
Contract number FERM B at the Institute of Biotechnology, Institute of Technology
Deposited as P-4565. <Example 11> Expression of rat TPO cDNA in COS1 cells-Activity confirmation
Of the plasmid pEF18S-A2α to COS1 cells
Transfection is DEAE including chloroquine treatment
-Dextran method (Sompayrac et al., Proc.
Natl. Acad. Sci. USA Volume 78, 757
5-7578, (1981); Luthman et al., N.
ucl. Acids Res. , Volume 11, 1295-1
308, (1983)) with some modifications.
It was carried out according to the method. DMEM culture containing 10% FCS
COS1 cells suspended in liquid (ATCC CRL165
0) is a plastic shaker for tissue culture with a diameter of 100 mm
40% at 37 ° C in a 5% CO 2 incubator.
The cells were cultured until they became% confluent. On the other hand, 500μ
g / ml DEAE-Dextran (Pharmacia
, 80 μM chloroquine (Sigma), 8% (v /
v) HBS (21 mM HEPES-145 mM Na
Cl, pH 7.1) and 9% (v / v) Nu-Ser
4 ml DMEM culture containing um (Collaborative)
Plasmid pEF1 dissolved in 30 μl HBS in the nutrient solution
8S-A2α (10 μg) was mixed and the transfection was performed.
Immediately before the test, the COS was washed twice with DMEM culture solution.
After adding to 1 cell, 37 ° C in a 5% CO 2 incubator
It was cultured for 5 hours. Then, the culture supernatant is removed by suction and DM
After washing the dish twice with EM culture solution, 10% FCS
Add 15 ml of DMEM culture medium containing 5% carbon dioxide
Incubate at 37 ° C in an incubator for 3 to 5 days, then
Collected Qing. The obtained culture supernatant is used for IMDM culture medium.
After dialysis, it was evaluated by the rat CFU-MK assay system.
I paid. As a result, the plasmid pEF18S-A2α was
Culture of COS1 cells expressed by transfection
TPO activity was observed in the nutrient supernatant in a dose-dependent manner (Fig.
7), and on the 4th day of culture as in the case of rat TPO
Many cytoplasmic process fo
Rmation formation was observed. Meanwhile, insert
Transfection of plasmid pEF18S containing no
TPO activity was detected in the cultured COS1 cell culture supernatant.
It did not (Fig. 7). In addition, in the M-07e assay system
Transfection of plasmid pEF18S-A2α
For use in the culture supernatant of COS1 cells expressed by
M-07e cell growth promoting activity was observed in a dose-dependent manner.
Transfection of plasmid pEF18S containing no insert
Activity was observed in the transfected COS1 cell culture supernatant
I couldn't do it. From these results, pEF18S-A2
A gene in which α encodes a protein having TPO activity
It was confirmed to carry the Next, this TPO activity
Partially purified product was prepared in order to investigate the proliferative thrombocytosis effect.
It was To measure TPO activity in the preparation process, rat CFU-
The MK assay system was used. First, the plasmid pEF18
COS1 cells transfected with S-A2α
For 3 days in a serum-free medium containing 0.2 mg of BSA.
Culturing was performed to obtain about 5.8 L of serum-free culture supernatant. Its serum-free
To the culture supernatant, p-APMSF was added at a final concentration of 1 mM,
Filter the filtrate through a 0.22 μm filter.
It was This volume 5793 ml (protein concentration 0.229 mg
/ Ml, total protein mass 1326 mg, relative activity 1000,
Relative activity 1326080) per 1000 ml
Add 0.85 moles of NaCl (total 288g)
The final concentration of 0.822M NaCl, 5849 ml
After making a solution, 1M NaCl, 20 mM Na Ph
T pre-equilibrated with osphate pH 7.2
SK-gel AF-BLUE 650 MH column
(Catalog No. 08705, manufactured by Tosoh Corp .; diameter 5c
m, bed height 6 cm) at a flow rate of 7 ml / min
did. After the addition is complete, 20 mM NaPhosphate,
Pass through (approx. 7%) eluted with 1M Nacl, pH 7.2.
900 ml) is collected, and this is collected in an ultrafiltration unit (fill
TRON, Omega Ultra set, molecular weight 8000
Concentrate with flow-through fraction F1 (460 ml, concentrated protein)
Degree 2.11 mg / ml, total protein mass 973 mg, relative activity
A sex of 16.3) was obtained. Next, the eluate was added to 2M NaSCN.
Instead, the eluted TSK-gel AF-BLUE 6
Limited the 50MH adsorbed TPO active fraction F2 (2840 ml)
External filtration unit (Amicon; YM3 membrane, diameter 76m
m) was used to concentrate to 6.81 ml. This TPO
The total protein content of the active fraction F2 was 12.5 mg.
The protein yield of F2 was 0.62%. Also,
The relative activity of TPO was 240. Next, HiLo
ad 26/60 Superdex 200 pg
Armacia Biotech, Catalog No. 17-10
71-01; diameter 2.6 cm, bed height 60 cm)
Inject it into the column with a flow rate of 1 ml / min and 50 mM N
20 mM Na Acetate, pH containing aCl
Deployed at 5.5. Is 194 ml eluted after the start of development?
The TPO activity can be confirmed in the fractions ranging from
It was So, this is put together, and Superdex 20
0 pg TPO active fraction F2 (66 ml, protein concentration
0.112 mg / ml, total protein mass 7.41 mg, relative
Activity 142860, relative activity 1058600)
It was Next, developing solvent A (20 mM Na Acetat
e, pH 5.5) and developing solvent B (500 mM Na
20 mM Na Phophate containing Cl, pH
7. 2) prepared and equilibrated with 100% A strong cation
Exchange column RESOURCE S
Iotec, catalog number 17-1178-01; straight
(Diameter 0.64 cm, bed height 3 cm)
Injection was performed at 1 ml / min. Then flow rate 0.3 ml
/ Min over 100 minutes from 100% A to 100% B
It was developed with a linear concentration gradient in. Assay results, wide
TPO activity elutes in the range (5% B to 32% B range)
It turned out that it was done. Wear this TPO active fraction
Ultra filtration unit (Amicon; YM3 membrane, direct
Concentrated with a diameter of 25 mm), RESOURCE S TPO
Active fraction F2 (1.65 ml, protein concentration 4.74 mg
/ Ml, total protein mass 7.82 mg, relative activity 7140
0, relative activity amount 558600) could be obtained. Profit
Although the prepared sample was not a pure TPO sample,
A sufficiently high activity was confirmed in the CFU-MK assay system.
As a result, the administration experiment to mice was carried out. That is,
ICR mouse whose platelet count was measured the day before administration
(9 weeks old; ♂) subcutaneously, TPO partial purified product (474μ
g (100 μl) / mouse / day), BSA as control
(200 μg (100 μl) / mouse / day), or
As a control, a buffer solution in which a partially purified TPO product is dissolved
Buffer of the same composition (100 μl / mouse / day) for 5 days
Administer daily, and collect blood from heart on day 6 to measure platelet count
(F800; Toa Medical Electronics). TPO partial refined product throw
On average, about 2.14 times more blood was given to the mice than before administration.
An increase in the number of small plates was observed. Also compare between treatment groups
And in mice treated with partially purified TPO, mice treated with BSA
About 1.74 times that of
1.90 times higher platelet count than normal mice
It was From these results, TPO increased platelets in vivo.
It became clear that it has an action. The TPO part
1 of mouse acute phase protein in purified product-treated mice
Seed immunosuppressive acid
Is ic protein (IAP) increased?
Therefore, TPO was associated with the induction of acute phase proteins.
Strongly suggested to be different in character from L-6 and IL-11
Was done. <Example 12> Detection of TPO mRNA in various tissues of rat
To confirm whether it is expressed, various rat tissues are used.
RNA was extracted. As described in Example 1
Similarly, on the 11th to 14th day after the X-ray irradiation,
Various tissues from 6 rats (brain, thymus, lung, liver, heart, spleen)
Promptly remove the organs (small intestine, kidney, testis and bone marrow cells)
Frozen with liquid nitrogen. RNA isolation for total RNA extraction
The reagent ISOGEN (Wako Pure Chemical Industries, Ltd.) was used. Frozen
Add the amount of ISOGEN reagent according to the weight of the tissue,
Genizer (Hiscotron; Nichine Medical Instrumentation Co., Ltd .; N)
S-60) until the tissue is completely disrupted (and
After processing at 10000 RPM for 45-60 seconds,
RNA extraction was performed (Chomczynski et al.
By Acid Guanidium Phenol Ch
Extraction method based on the loloform method: Anal. Bi
ochem. , 162 156-159, 1987
See). As a result, 1.1 mg to 5.
6 mg of total RNA was obtained. Poly (A) from total RNA
⁺ Purification of RNA is performed by Oligotex ^TM -DT30 (S
upper) (Nippon Synthetic Rubber / Nippon Roche)
20 μg of poly (A) from about 500 μg of total RNA
⁺ RNA was obtained. Poly (A) of various tissues obtained ⁺ RN
A each using 1 μg or more using random primers c
The first strand of DNA was synthesized. Poly (A) ⁺ RNA 1μ
g in 10 μl of sterilized water and heated at 70 ° C for 15 minutes
Quench, 75 pmole random primer (Takara Shuzo)
Made) 10U RNase Inhibitor (Ba
Ringer Mannheim), 50 mM Tris-HC
1 (pH 8.3), 75 mM KCl, 3 mM MgC
l ₂ , 200U SuperScript ^TM II (La
IF technology reverse transcriptase)
Add these reagents (total volume 20 μl) and incubate at 37 ℃ for 1 hour
did. Heat the reaction at 70 ° C for 10 minutes to inactivate the enzyme
And stored at −20 ° C. until use. Obtained in Example 10
From the cDNA sequence of rat TPO
The Limer was synthesized. The sequences of the synthesized primers are as follows
Street. rTPO-I: 5'-CCTGTCCCTGCTGGCCT
GCTGTG-3 ′ (347 to 367 of SEQ ID NO: 2) rTPO-N: 5′-TGAAGTTCGTCTCCCA
ACA ATC-3 '(1005-1025 of SEQ ID NO: 2)
Antisense corresponding to) Use 0.1 volume each of the synthesized cDNA reaction solutions as templates
Primers synthesized here (rTPO-I, rTPO
PCR was performed using 1 μM each of —N). G
eneAmp ^TM PCR Reagent Kit w
it AmpliTaq ^TM DNA Polymer
GeneAmp using asase (Takara Shuzo) ^TM P
CR System 9600 (PERKIN-ELM
PCR reaction (95 μm) by ER) in a volume of 100 μl.
After heating at ℃ for 2 minutes, denaturing condition at 95 ℃ for 1 minute, 57 ℃
1 minute annealing condition, 72 ° C 1 minute synthesis condition
Perform the reaction 30 times and incubate at 72 ° C for another 7 minutes.
I went). The reaction solution obtained here was mixed with 2% agaro.
Sugel (made by FMC BioProducts)
The amplified band was observed by electrophoresis.
Filter, which is considered to be specific to the brain, liver, small intestine, and kidney.
Was observed. Judgment of expression level based on this result
No, but in rats TPOmR
It was considered that NA was expressed. The same applies to people
Although it is suggested that the expression pattern is shown, the results are not consistent with those of Example 4.
Considering this, the liver is used to obtain human TPO cDNA.
Was determined to be suitable as a starting material. <Example 13> Construction of human normal liver-derived cDNA library From the results of Example 12, the liver was cloned into human TPO cDNA.
Choose from commercially available normal human liver
Poly (A) ⁺ RNA (Clontech: Chom
Acid Guanidium P by czynski et al.
Extraction based on the henol Chloroform method
5 μg was used in the same manner as in Example 7.
ver ^TM cDNA Synthesis Kit (P
(manufactured by Pharmacia) and DIRECTIONAL
CLONING TOOLBOX (Pharmaci
a), and EcoRI at the 5'end and N at the 3'end.
A double-stranded cDNA having a tI recognition site was synthesized. Synthesize
The cDNA contained 1.2 μg of EcORI and Not beforehand.
Ligated with the expression vector pEF18S treated with I,
8.4 ml competent high E. coli DH5
(Manufactured by Toyobo Co., Ltd.) was transformed. As a result, 1.2 ×
10 ⁶ Individual transformants were obtained. <Example 14> Acquisition of human TPO cDNA fragment by PCR (Kuroni
Commercially available normal human liver-derived poly (A) ⁺ RNA (Clon
(manufactured by tech) using a random primer from 1 μg
To synthesize the first strand of the cDNA. Poly (A) ⁺ RNA
Dissolve 1 μg in 10 μl sterile water and add at 70 ° C for 15 minutes.
It is cooled down after warming, and 75pmole random primer (Takarashu)
Made by) 10U RNase Inhibitor
(Manufactured by Boehringer Mannheim), 50 mM Tris
-HCl (pH 8.3), 75 mM KCl, 3 mM
MgCl ₂ , 200U SuperScript ^TM I
I (manufactured by Life Technology)
Add reagents (total volume 20 μl) and incubate at 37 ° C for 1 hour
It was The reaction solution was heated at 70 ° C for 10 minutes to inactivate the enzyme.
After that, it was stored at -20 ° C until use. Rat TPOcDN
A PCR primer was synthesized from the A sequence (SEQ ID NO: 2).
It was The primer sequences are as follows. rTPO-AIN: 5'-ATGGAGCTGAACTG
ATTTGCTC-3 ′ (173 to 19 of SEQ ID NO: 2)
3) rTPO-N: 5'-TGAAGTTCGTTCTC
CAACAATC-3 '(1005-10 of SEQ ID NO: 2
Antisense corresponding to 25) 0.1 volume of the synthesized cDNA reaction solution was used as a template.
Synthesized primers (rTPO-AIN, rTPO-
PCR was performed using 1 μM each of N). Ge
neAmp ^TM PCR Reagent Kit wi
th AmpliTaq ^TM DNA Polymer
GeneAmp using se (Takara Shuzo) ^TM PC
R System 9600 (PERKIN-ELMER
PCR reaction (at 95 ° C) in a volume of 100 μl
After heating for 2 minutes, denaturing conditions at 95 ° C for 1 minute, 1 at 40 ° C
35 minutes under the annealing conditions of 1 minute and the synthesis conditions of 1 minute at 72 ° C.
Incubate at 72 ° C for another 7 minutes.
G) The reaction solution obtained here was mixed with 2% agar
Using sgel (manufactured by FMC BioProducts)
The major product of this PCR reaction
The 620 bp DNA fragment was isolated and prep-A-di
Purification using a DNA purification kit (BioRad)
did. This purified DNA fragment was used as Taq Dye De
oxy ^TM Terminator Cycle Seq
uening Kit (Applied Biosystems)
Manufactured by Applied Biosystems Co., Ltd. 373
Sequence directly by ADNA sequencer
The sequence was determined. Base sequence excluding primer and
The deduced amino acid sequence is then the sequence listing (SEQ ID NO:
It is shown in 3). This DNA fragment excludes the primer sequence
And a rat cDNA base sequence having a length of 580 bp
As a result of comparison, it was found that they have 86% homology.
The DN that encodes a part of human TPO cDNA
It was considered to be the A fragment. <Example 15> Screening of human TPO cDNA by PCR method PC corresponding to human TPO based on Sequence Listing-SEQ ID NO: 3
The R primer was synthesized. The sequence is as follows. hTPO-I: 5'-TTGTGACCTCCGAGT
CCTCAG-3 ′ (60-80 of SEQ ID NO: 3) hTPO-J: 5′-TGACCGCAGAGGGTGG
ACCCTC-3 ′ (paired with 479-499 of SEQ ID NO: 3
Corresponding antisense) Human cDNA library constructed in Example 13
A pool of approximately 100,000 clones into one population
Divided into 50 μg / ml Ampicillin
After overnight culture in 1 ml of LB medium,
Motion Separation Device PI-100 (Kurashiki Spinning Company, VER-3.
0) was used to extract the plasmid DNA. Extracted D
NA was dissolved in the TE solution. Cast 5% of the extracted DNA
Used as a template and synthesized primers (hTPO-I,
PCR was performed using 1 μM each of hTPO-J)
It was GeneAmp ^TM PCR Reagent Ki
t with AmpliTaq ^TM DNAPolym
Using Genease (manufactured by Takara Shuzo Co., Ltd.)
^TM PCRSystem9600 (PERKIN-EL
PCR reaction in a volume of 20 μl (made by MER) (95
Denaturing condition for 1 minute at ℃, annealing for 1 minute at 59 ℃
In this case, the reaction was performed 35 times under the synthesis condition of 72 ° C. for 1 minute,
Incubation at 72 ° C for 7 minutes)
Bands considered to be specific were detected in 3 out of 90 pools.
Was issued. Choose one of these pools
Divided into loan pools and plasmid D from 90 pools
NA was purified and PCR was performed again under the same conditions. So
As a result, bands were detected in 5 pools. These
Select 1 pool and set 250 clones as 1 pool
Sub-pool and plasmid D for 90 pools
NA was extracted. PCR is performed on these in the same manner.
As a result, bands were observed in 3 pools. Than these
Select 1 pool and set 30 clones as 1 pool.
Make a pool and purify the plasmid DNA from the 90 pool.
As a result of the production and PCR, bands were observed in 3 pools
Was done. Choose one of these pools to obtain 50 μg / ml
Sprinkle on LB plate containing Ampicillin, 90
Similarly, plasmid DNA was extracted from each colony.
As a result of confirmation by PCR, clone H was finally obtained.
L34 was obtained. Example 16 Sequence of human TPO cDNA Purification of plasmid DNA is essentially Molecular
Cloning [Sambrook et al., Cold S
pring Harbor Laboratory P
[ress (1989)].
gave. Clone HL34 with 50 μg / ml Ampi
Cultured overnight in 50 ml of LB medium containing cilin
Then, the bacterial cells obtained by centrifugation were treated with 4 ml of TEG-lys.
Suspended in ozyme solution, 8 ml 0.2N NaOH
Add 1% SDS solution and suspend well. 3M more
6m potassium / 5M acetate solution
l and well suspended, then centrifuged to obtain a supernatant. The supernatant is
After treatment with ethanol-chloroform (1: 1), an equal volume of iso
Propanol was added and the mixture was centrifuged to obtain a pellet. Peret
After dissolving in TE solution, RNAse treatment, phenol-
Chloroform (1: 1) treatment and ethanol precipitation
To do. The pellet is redissolved in TE solution, NaCl,
0.63 each of polyethylene glycol 3000
Add M to 7.5% and centrifuge. Finally,
Lett dissolve in TE solution and then perform ethanol precipitation. This
This gave approximately 300 μg of plasmid DNA pEF18
S-HL34 was obtained. For the purified plasmid DNA
Taq Dye Deoxy ^TM Terminate
r Cycle Sequencing Kit
Applied Bio)
System 373A DNA sequencer
Sequenced and the full-length nucleotide sequence was determined. Base sequence
And the amino acid sequence deduced from it
No. 4). The primers required for nucleotide sequencing are
The primer synthesized based on the sequence of row No. 3 and its
Analyzed by sequencing reaction with these primers
A synthetic primer designed based on the internal sequence was used.
As a result, the obtained plasmid clone pEF18S-
HL34 contains a 861 base pair cDNA fragment,
Partial amino acid sequence AP8 of rat TPO analyzed in 2
(SEQ ID NO: 4: amino acid numbers 1 to 12) and TP2 / T
Phase with P3 (SEQ ID NO: 4: amino acid numbers 157 to 162)
A highly homologous sequence was confirmed. This DNA fragment contains 25
Code the open reading frame starting from the base
Although there is no stop codon at the 3'end
Had a poly A tail-like sequence consisting of 76 bases. Po
The 253 amino acid sequence immediately before the A tail-like sequence is
Of TPO cDNA (of 147 residues of SEQ ID NO: 2
84% homology with the amino acid sequence part)
Part of the human cDNA corresponding to rat TPO
It was considered to be a coding DNA fragment. No stop codon
Since it had a poly A tail-like sequence at the 3'end, this
The clone does not reflect the complete cDNA and is c
Suggested to be an artifact of DNA library production
Was done. <Example 17> Expression of human TPO cDNA in COS1 cells-confirmation of activity C of the obtained plasmid clone pEF18-HL34
Transfection of OS1 cells is described in Example 11.
Therefore it was done. That is, use 10 μg of plasmid DNA
The DEAE-dextran method including chloroquine treatment
3 to 5 days after transfection used
The culture supernatant was later collected. IMDM the obtained culture supernatant
After sufficient dialysis against the culture solution, rat CFU-MK
It was evaluated by a sei system. As a result, pEF18S-HL34
COS1 cell culture expressing transfection
TPO activity was observed in the nutrient supernatant in a dose-dependent manner (Fig.
8) Also, on the 4th day of culture, protrusion formation by many megakaryocytes
Was observed. On the other hand, expression plus without insert
Mido-transfected COS1 cell culture supernatant
No activity was observed in (Fig. 8). Also, M-07
In the e assay system, pEF18S-HL34 was also
COS1 cell culture supernatant expressed by transfection
Only, the M-07e cell growth promoting activity was observed. this
From these results, pEF18S-HL34 showed TPO activity.
Is responsible for the gene cDNA fragment that encodes the protein
It turned out to have. In addition, human TPO is rat
It was also revealed that it also acts on (no species-specificity)
It was <Example 18> Expression of human TPO-deficient cDNA-confirmation of activity Human TPOc of clone HL34 obtained in Example 15
DNA has a poly A tail-like continuous adenylation sequence on its 3'side.
The rat TPOcDN
Not seen in A, suggesting that it may be an experimental artificial product
It was Therefore, this poly-A tail-like continuous adenine distribution
The cDNA that was created by deleting the sequence was
It was examined whether it showed activity as TPO. For making deletions
Used PCR. Sequences of PCR primers are shown in Table 9.
Shown in Addition of restriction enzyme recognition sequence to each 5'end
Yes (EcoRI for hTPO5 and hTPO3
With NotI and two stop codons TAATGA
Added).

[Table 9] Plasmid clone pEF18S obtained in Example 16
PCR was performed using 1 μg of HL34 plasmid DNA as template and 10 μM each of the synthesized primers (hTPO5, hTPO3). GeneAmp
^TM PCR Reagent Kit with Am
GeneAmp ^™ PCR Sys using pliTaq ^™ DNA Polymerase (Takara Shuzo)
tem9600 (manufactured by PERKIN-ELMER) was used for PCR reaction in a volume of 100 μl (denaturation condition at 95 ° C. for 1 minute, annealing condition at 65 ° C. for 1 minute, synthesis condition at 72 ° C. for 1 minute, 15 times, 72 minutes for another 7 minutes
(Incubated at 0 ° C.). About 800bp obtained
Band was digested with restriction enzymes EcoRI and NotI, purified, and similarly treated with the restriction enzymes pEF1
Subcloned into 8S. From the obtained transformants, 5 clones containing a DNA fragment of about 800 bp were selected and a large amount of plasmid DNA was prepared (see Example 5 for the method). For each plasmid, the nucleotide sequence was determined for the entire region of about 800 bp amplified by PCR, and it was confirmed that the nucleotide sequences were completely identical to the nucleotide sequence analyzed in Example 16 (1-780 of SEQ ID NO: 4). did. This plasmid clone was named pHT1-231.
The vector pHT1-231 carried on Escherichia coli DH5 was assigned to the Institute of Biotechnology, National Institute of Advanced Industrial Science and Technology, Ministry of International Trade and Industry on February 14, 1994 under the contract number FERM BP-4564.
Deposited as. Expression of the obtained plasmid in COS1 cells was performed according to Example 11. That is, D containing chloroquine treatment using 10 μg of each plasmid DNA
Transfection was carried out using the EAE-dextran method, and the culture supernatant was recovered after 3 to 5 days. The obtained culture supernatant was dialyzed against IMDM culture medium and evaluated by the rat CFU-MK assay system. As a result, pH
C expressed by transfection with T1-231
TPO activity was observed in the OS1 cell culture supernatant (FIG. 9), and protrusion formation by a large number of megakaryocytes was observed on day 4 of culture. On the other hand, no activity was observed in the COS1 cell culture supernatant transfected with the expression plasmid containing no cDNA insert (FIG. 9). Also,
Also in the M-07e assay system, M-07e cell growth promoting activity was observed only in the COS1 cell culture supernatant expressed by transfection with pHT1-231. From these results, cDNA contained in pHT1-231
It was revealed that the fragment is a gene encoding a protein having TPO activity. <Example 19> Cloning of human TPOC terminal region by PCR Human TPOc of clone HL34 obtained in Example 15
The DNA has a poly A tail-like sequence at its 3'end, suggesting that the 3'portion is an incomplete clone. Therefore, an attempt was made to obtain the full-length 3'region by PCR. From the nucleotide sequence determined in Example 16, PC
Four kinds of 5'-side primers for R were synthesized.

[Table 10] As the 3'-side primer, the following primer containing 4 bases of mix nucleotides at the 3'-end was synthesized in expectation of amplification immediately after the poly A portion. In addition, an anchor primer containing no mix part was also synthesized.

[Table 11]Human normal liver-derived poly (A) as in Example 14.⁺RN
1 cDNA from 1 μg of A (Clontech)
Chains were synthesized. However, oligo d is used as a primer.
T primer (TimeSa manufactured by Pharmacia)
ver^TMAdded to the cDNA Synthesis Kit
The attached one was used at 0.5 μg). Anti-cDNA synthesis
The first PCR was performed using 0.1 volume of the reaction solution as a template.
Was. GeneAmp for PCR^TMPCR Reage
nt Kit with AmpliTaq^TMDNA
 Polymerase (Takara Shuzo) and Gen
eAmp^TMPCR System 9600 (PERK
IN-ELMER) was used. HT for the primer
PO-H (20 μM) and hTPO3mix (10 μM
M) was used to carry out the reaction in a volume of 50 μl (96 ° C.
After 2 minutes, 96 ° C 1 minute / 48 ° C 1 minute / 72 ° C 1
The reaction was performed for 10 minutes for 72 minutes and further at 72 ° C for 7 minutes). 1
The second PCR was performed using 0.1 volume of the reaction solution of the second round as a template.
I did. HTPO-K (20 μM) and primer
And hTPO3mix (10 μM) in a volume of 50 μl
The reaction was carried out in an amount (after 96 ° C for 2 minutes, 96 ° C for 1 minute
10 cycles of 1 minute / 63 ° C for 1 minute / 72 ° C for 1 minute
And 72 ° C. for 7 minutes). 0.1 volume of the second reaction solution
Was used as a template to perform the third PCR. For primer
Is hTPO-N (20 μM) and hTPO3mix (1
The reaction was performed in a volume of 50 μl (0 μM) (9
After 2 minutes at 6 ℃, 1 minute at 96 ℃ / 72 minutes at 63 ℃ / 72
React for 10 cycles of 1 minute at 72 ° C for 7 minutes at 72 ° C
while). The fourth reaction was performed using 0.1 volume of the third reaction solution as a template.
PCR was performed. HTPO-O (20
50 μM) and hTPO3mix (10 μM)
The reaction was carried out in a volume of μl (after 2 minutes at 96 ° C.,
10 cycles of 6 ° C for 1 minute / 63 ° C for 1 minute / 72 ° C for 1 minute
Reaction at 72 ° C for 7 minutes). Of the 4th reaction
A fifth PCR was performed using 0.1 volume as a template. Plastic
HTPO-O (20 μM) and hTPO3a for immers
Reaction in a volume of 50 μl using nchor (20 μM)
(96 ° C. for 2 minutes, then 96 ° C. for 1 minute / 58
React for 10 cycles of ℃ 1 minute / 72 ℃ 1 minute, and
72 ° C for 7 minutes). The reaction solution obtained here was mixed with 2% agaro.
Sugel (made by FMC BioProducts)
Subject to electrophoresis and is the major product of this PCR reaction
A DNA fragment of about 600 bp was isolated and separated by prep-A-di
DNA purification kit (manufactured by Bio-Rad)
Made. This purified DNA fragment was designated Taq Dye D
eoxy^TMTerminator Cycle Se
Quinging Kit (Applied Biosystems
Manufactured by Applied Biosystems Co., Ltd. 37
3A DNA sequencer for direct sequencing and salt
The base sequence was determined. Nucleotide sequence and then deduced
The amino acid sequence is shown in the sequence listing (SEQ ID NO: 5). This D
The NA fragment is composed of 130 nucleotides starting with the primer hTPO-O.
It has a base sequence that encodes an amino acid, and
A sequence of 180 bases or more continued on the 3'side (577 salt
It was not possible to decipher after the first). Coat this DNA fragment
The 30 amino acid sequence starting with the glycine
Amino acids Nos. 203 to 232 described in No. 4
It matched the acid sequence. At the same time bases 1 to 94
The sequence also corresponds to that of SEQ ID NO: 4, 692-785.
Was. Analysis of cDNA fragment of Example 17 and PCR of this example
As shown in SEQ ID NO: 6 from the result of analysis of the amplified fragment
In addition, the human TPO protein has a 21-residue signal sequence.
It is estimated to consist of 353 amino acids. In addition,
Mature TPO protein shown in SEQ ID NO: 6
The amino acid sequence corresponding to the protein portion is represented by SEQ ID NO: 16.
Showed. <Example 20> Reconstruction of human normal liver-derived cDNA library The clone HL34 obtained in Example 15 was an open library.
3'end without the stop codon in the reading frame
It has a poly-A tail-like sequence at the end and is useful for cDNA synthesis.
Since it was considered to be an artifact, a new commercial
Poly (A) derived from normal human liver⁺RNA (Clontech
Rebuild cDNA library using 5 μg)
did. For the synthesis of cDNA, SuperScript^TM
Lambda System for cDNA Sy
nthesis and λ Cloning Kit
Bini SuperScript^TMII RNaseH-
(Both made by LIFE TECHNOLOGIES)
used. Poly (A)⁺After denaturing RNA by heat, attach it to Kit
Includes oligo dT with NotI sequence of the genus as a primer
20 μl of reaction solution (50 mM Tris-HCl, p
H8.3 / 75 mM KCl / 3 mM MgCl₂/ 1m
M DTT / 1mM dNTP / 200U SuperS
script^TMII RNase H-), 37 ° C
And kept warm for 60 minutes. Synthesize the second strand of cDNA (25
mM Tris-HCl, pH 8.3, 100 mM K
Cl, 5 mM MgCl₂, Each 250 μM dNTP
5 mM DTT, 40 U E.S. coli DNA
polymerase I, 2U E. coli RN
aseH, 10U E. coli DNA ligas
(Incubate at 16 ° C for 2 hours in 150 μl reaction solution containing e)
Then, 10 U T4 DNA polymerase was added.
Furthermore, the temperature was kept at 16 ° C. for 5 minutes. Reaction mixture at 65 ℃ 1
After heating for 0 minutes, extract once with an equal volume of phenol-chloroform.
Out, SizeSep^TM400 spun column
n (Time Saver manufactured by Pharmacia)^TM
Small molecule attached to cDNA Synthesis Kit
Less than 400 bp due to the amount of DNA removal span column)
Said cDNA was removed. EcoRI A for this sample
daptor (TimeSa manufactured by Pharmacia)
ver^TMIncluded with cDNA Synthesis Kit
That was digested with the restriction enzyme NotI after addition,
Again SizeSep^TM400 spun column
To remove low molecular weight DNA. Get this
EcoRI at the 5'end and NotI recognition at the 3'end.
The double-stranded cDNA with rows is 1.3 μg each,
Expression vector previously treated with EcoRI and NotI
Connected with pEF18S, 9.2 ml of competent
High E. Transformation of E. coli DH5 (Toyobo Co., Ltd.)
did. As a result, the obtained human liver cDNA library
-(HTPO-F1) is 1.0 × 10⁶Transformants
Was included. Example 21 T from human liver cDNA library hTPO-F1
Screening for PO cDNA clones Human TPO cDNA based on Sequence Listing-SEQ ID NOS: 3 and 6
A PCR primer corresponding to was synthesized. The array is
Street. hTPO-I: 5'-TTGTGACCTCCGAG
TCCTCAG-3 '(60-80 of SEQ ID NO: 3) hTPO-KU: 5'-AGGATGGGTTGGGG
AAGGAGA-3 '(at 901-921 of SEQ ID NO: 6
Corresponding Antisense) Human liver cDNA library constructed in Example 20
Lee hTPO-F1 (1.0 x 10⁶3) Pooh
(# 1 to 3) and stored frozen. Each pooh
Plasmid DNA was prepared from the
And synthesized primers (hTPO-I and hTPO-
KU) PCR was performed using 1 μM each. GeneA
mp^TMPCR Reagent Kit with
AmpliTaq^TMDNA Polymerase
Using (Takara Shuzo), GeneAmp^TMPCR
 System9600 (PERKIN-ELMER company
PCR in a volume of 100 μl (made at 95 ° C for 1 minute)
Denaturing conditions, annealing conditions of 59 ° C for 1 minute, 72 ° C
The reaction was repeated 35 times under the synthesis condition of 1 minute, and then for 7 minutes.
Incubation at 72 ° C) resulted in pool # 3
Size expected when using the derived plasmid DNA
DNA was amplified. So, this pool # 3
Divided into 15,000 subpools, 50 μg / ml
Overnight in 1 ml LB medium with Ampicillin
After culturing, use the automatic plasmid separator PI-100
Then, the plasmid DNA was extracted. The extracted DNA is T
Dissolve in E solution and perform PCR using 5% of it as template
(The used primers and reaction conditions were the same as above.
). As a result, 6 pools out of 90 are expected to be large
The DNA of Kisa was amplified. Select one of these pools
Subpool with 1000 clones selected as one group
And prepare plasmid DNA as described above,
CR was performed, but no amplification of DNA was observed. one
Of electrophoretic bands of DNA amplified by a series of PCRs
The density gets thinner as the sub-pool becomes finer.
Came. Therefore, the desired clones did not grow well.
Therefore, recovery of plasmid DNA is poor, and amplification by PCR is
It is thought that it became weak
Was. So we went back to the pool # 3 and colony hybrid dye
We decided to carry out screening by zeation.
41 per 15 cm LB plate from pool # 3
Spread the clones so that there are 00 colonies, and
A number of plates were made. For each plate
Make replica plates one by one, and choose one of them
Incubate the plate at 37 ° C for a further 6 hours before
Was recovered and the plasmid DNA was extracted. These DN
When PCR similar to the above was carried out for A, 10
Amplification of band of expected size in 1 out of 0 pool
Was observed. So, from this pool plate,
A replica filter was manufactured (BIOD manufactured by PALL)
YNE^TMA TRANSFER MEMB RANE
use). Denaturation of filter is 10% SDS for 10 minutes
, 0.5N NaOH / 1.5M NaCl 10 minutes
0.5 M Tris-HCl (pH 8.0) / 1.
5M NaCl 10 minutes, air-dried for 30 minutes 80
Baking in a vacuum oven at 0 ° C. for 1 hour. Baking
6 × SSC (20 × SSC is in 1 liter)
Containing 175.3 g NaCl and 88.2 g in pH 7.0
Solution) / 1% SDS and then pre-hybridized
I went to the zation. The composition of the reaction solution is 50%
Mido, 5xSSC, 5x Denhardt's sol
ution (50 x Denhardt's solution
5g Ficoll, 5g p in 500ml
lyvinylpyrrolidone, 5g bo
vine serum bumpinfraction
 V-containing solution), 1% SDS, 20 μg / ml salmon sperm
Contains child DNA, 42 ° C 30 in 30 ml of solution
Incubate with shaking for a minute. Pre-hybridization
After hybridization, a hybridization solution of the same composition
After exchanging with 30 ml, [α-³²P] dCTP (Amacha
Probe (plasmid pEF1)
8S-HL34 EcoRI / BamHI fragment: SEQ ID NO.
No. 4 was purified from the 5'end to the 458th base and
Labeled with the Muprimer method; Anal. Bioch
em. , 132, 6-13, 1983.
Used Amersham kit Megaprime DNA
 using a labeling system),
Incubation was carried out at 42 ° C for 20 hours with shaking. The filter is
Wash in 2x SSC / 0.1% SDS solution at 42 ° C for 30 minutes
After purification, in 0.2 × SSC / 0.1% SDS solution
It was washed at 42 ° C for 30 minutes. Screen enhancing filter
And X-OMATTM AR5 film (Eastmanco
Manufactured by Duck) at -70 ° C for 16 hours
I did a fee. As a result, Cigna considered positive
One le was observed. So sig from the original plate
10cm LB play by scraping a colony around Naru
I rediscovered it. 50 colonies obtained were cultured and D
After preparing NA, primers hTPO-I and hTPO-K
PCR was performed using U (conditions and the like are the same as above).
As a result, the expected band was amplified for only one clone.
Was. This clone was named pHTF1. <Example 22> Sequence of human TPO cDNA clone pHTF1
Purification of plasmid DNA is essentially molecular
 Cloning [Sambrook et al., Cold S
pring Harbor Laboratory P
[ress (1989)].
gave. Clone pHTF1 with 50 μg / ml Amp
Incubate in 50 ml LB medium containing icillin overnight
Then, the bacterial cells obtained by centrifugation were treated with 4 ml of TEG-ly.
Suspended in sozyme solution, 8 ml 0.2N NaO
Add H / 1% SDS solution and suspend well. 3M more
 Potassium / 5M acetate solution 6
After adding ml and suspending well, centrifugation is performed to obtain a supernatant. The supernatant is
After treatment with phenol-chloroform (1: 1)
Sopropanol was added and the mixture was centrifuged to obtain a pellet. Pele
After dissolving in TE solution, RNAse treatment, phenol
-Chloroform (1: 1) treatment and ethanol precipitation
Perform Dissolve the pellet in TE solution again,
l, polyethylene glycol 3000 each 0.6
Add 3 M, 7.5% and centrifuge. Finally,
The pellet is dissolved in TE solution and then ethanol precipitated.
This gives approximately 300 μg of plasmid DNA pHTF1
Got For purified plasmid DNA Taq D
ye Deoxy^TMTerminator Cycle
e Sequencing Kit (Applied Bio
Applied Biosystems, Inc.
Sequenced by 373A DNA Sequencer
Then, the full length base sequence was determined. Nucleotide sequence and
The deduced amino acid sequence is shown in the sequence listing (SEQ ID NO: 7).
did. The primer required for nucleotide sequence determination is SEQ ID NO: 6.
Primers synthesized based on sequences and their primers
The internal sequence analyzed by the sequencer reaction by Immer
Originally designed synthetic primers were used. as a result,
The resulting clone pHTF1 has 1721 base pairs of cDNA.
Amino acid sequence A, which consists of the A fragment and was analyzed in Example 2.
P8 (SEQ ID NO: 7: amino acid numbers 1 to 12) and TP2
/ TP3 (SEQ ID NO: 7: amino acid numbers 157 to 162)
A highly homologous sequence was confirmed. This DNA fragment
Following the 5'non-coding region up to the 101st base,
Starting with the methionine encoded at the 102nd to 104th bases
Glycine encoded at bases 1158 to 1160
Open reading consisting of 353 amino acids
Frame code, and the subsequent
3'non-coding region after the stop codon (TAA)
It had 531 bases and 30 poly A tail sequences. This
Thought to be coded in the open reading frame of
The amino acid sequence of the protein is shown in SEQ ID NO: 6.
Perfectly matches the predicted amino acid sequence of human TPO
did. The nucleotide sequence is 77 salts on the 5'side of the sequence of SEQ ID NO: 6.
347 in the region just before the poly A tail sequence on the 3'side
It encoded a cDNA with a long base. Also the base sequence
Was different from SEQ ID NO: 6 at 3 positions. Different base arrangement
In the sequence, A (84th base) of SEQ ID NO: 7 is SEQ ID NO: 6
C, A (740th base) is T, G (1198th base)
It was A. Only the second base (740th base)
Although it was a mutation in the coding region of the protein,
It is the third codon of nin, and amino acid conversion has occurred.
There wasn't. What is the cause of this base sequence substitution?
It was not clear at the time point of
From the analysis of TF1, the human TPO protein has 21 residues.
Consist of 353 amino acids including the signal sequence
It could be confirmed. Estimated amount of protein excluding signal sequence
The offspring amount was 35466. Supported on Escherichia coli DH5
Vector pHTF1 is traded as of March 24, 1994
Entrusted number F to the Institute of Biotechnology, Industrial Technology Institute, Ministry of Industry
Deposited as ERM BP-4617. <Example 23> COS1 cells of human TPO cDNA clone pHTF1
Expression-Activity Confirmation of Transcription of Clone pHTF1 Obtained into COS1 Cells
Sfection was performed according to Example 11. sand
Chloroquine treatment using 10 μg of plasmid DNA
Transfection using the DEAE-dextran method with
And the culture supernatant was collected after 3 days. Got
After dialysis of the obtained culture supernatant against IMDM culture solution,
It was evaluated by the CFU-MK assay system. As a result, pHT
Dose-dependent in COS1 cell culture supernatant expressing F1
TPO activity was observed in the
CO transfected with the expression plasmid
No activity was observed in the S1 culture supernatant (FIG. 10).
a). Similar results were obtained with the M-07e assay system.
The obtained COS1 cell culture supernatant expressing pHTF1
A significant M-07e cell proliferation-promoting activity was observed in the (FIG. 1
0b). From these results, the cD contained in pHTF1
NA is a gene encoding a protein having TPO activity
It became clear that he was a child. <Example 24> Cloning of human TPO chromosome DNA Human TPO chromosome using human TPO cDNA as a probe
DNA was cloned. Used for cloning
The genomic library
Professor Norio Yamamoto (Sakai et al., J.B.
iol. Chem. 269, 2173-2182, 1
The library described in 994 was used to control human chromosomal DNA.
The one partially digested by the restriction enzyme Sau3AI is Str
atagene's phage vector Lambda E
Library constructed by connecting to BamHI site of MBL3
Lee). Human TPO cDNA was prepared from this library.
Screening was performed as a lobe, but the method used
Is essentially Molecular Cloning
[Sambrook et al., Cold Spring Har
bor Laboratory Press (198
9)]. E. coli L
15 cm NZYM plate using E392 as a host bacterium
(10g NZamine in 1 liter, 5g Nacl,
5g bacto yeast extract, 2g
 MgCl_Four7H₂O, pH containing 15% agar
7.0) Phage so that there will be 30,000 per plate
And 18 plates were prepared. Each pre
Two replica filters were prepared from each sheet (PA
BIODYNE made by LL^TMA TRANSFERME
Use MBRANE). Filter denaturation is 0.5N
NaOH / 1.5 M NaCl 10 minutes, 0.5
MTris-HCl (pH 8.0) /1.5 MNaC
l Perform 10 minutes, air dry for 30 minutes, and vacuum at 80 ° C.
Bake for 1.5 hours in a bun. Pre-hybrid
Zeation is 50% formamide, 5xSSC, 5xD
enhancet's solution, 1% SD
S, 500 μl containing 20 μg / ml salmon sperm DNA
It was carried out at 42 ° C. for 1 hour in the solution. The probe is human TPO
cDNA fragment (base sequence number 178-10 of sequence number 7)
Random was obtained by purifying 25) after amplification by PCR.
Primer DNA labeling kit
(Manufactured by Takara Shuzo; Anal. Biochem., 132,
6-13, 1983 using the random primer method.
DNA labeling kit)³²P-labeled
Was used. The sequences of the primers used for PCR are as follows.
The street. hTPO-I: 5'-TTGTGACCTCCGAGT
CCTCAG-3 '(178-198 of SEQ ID NO: 7) hTPO-N: 5'-AGGGAAGAGCGTATA
CTGTCC-3 '(1005-1025 of SEQ ID NO: 7)
Antisense corresponding to) Hybridization is pre-hybridization
Using 500 ml of a solution with the same composition as
A lobe was added and the reaction was carried out at 42 ° C for 20 hours. The filter is
5 minutes at room temperature in 2 x SSC / 0.1% SDS solution 3
After washing twice, 6 in 0.1 × SSC / 0.1% SDS solution
After washing at 8 ° C for 1 hour, the intensifying screen and
X-OMAT^TMAR5 film (Eastman Kodak
Autoradiography at -70 ° C for 16 hours
-I did it. As a result, 13 positive signals were obtained.
It was Around the 13 positive signals from the original plate
Pick up plaque, 15 cm NZY M plate 1
Re-rolling was performed so that the number of plaques was 1000 per sheet. So
Make two replica filters from each plate
Manufactured and hybridized under the same conditions as above
did. As a result, all 13 pairs of filters had positive signa.
Is detected. 1 plaque from each plate
Release, P as described in Molecular Cloning
The phage DNA was prepared by the late lysate method.
Was. 13 clones of phage DNA
Whether or not it contains the coding region is determined by PCR.
I checked. Sequence of the primer used for the check
Is as follows. hTPO-L: 5'-GGCCAGCCAGACACC
CCGGCC-3 '(1-21 of SEQ ID NO: 6) hTPO-F: 5'-ATGGGAGTCACGAAG
CAGTTT-3 '(pairs 127-147 of SEQ ID NO: 6
Corresponding antisense) hTPO-P: 5'-TGCGTTTCTCGATGGC
TTGTAG-3 '(503-523 of SEQ ID NO: 6) hTPO-V: 5'-AACCTTACCCTCTCCT
GAGACA-3 '(1070-1090 of SEQ ID NO: 6)
Antisense corresponding to) PCR was performed with a combination of these primers.
By the way, 5 out of 13 clones
Contains all predicted amino acid coding regions
Was thought to be. Chromosome D contained in these 5 clones
The length of NA is about 20 kbp, and the preliminary inspection
The restriction enzyme analysis discussed showed almost the same pattern.
So one of these clones (clone λHGT
Select 1) and perform Southern blot analysis.
It was. That is, 1 μg of each DNA of clone λHGT1
Completely with the restriction enzymes EcoRI or HindIII.
And then run on a 0.8% agarose gel, then manufactured by PALL
BIODYNE^TMA TRANSFER MEMBR
Transferred to ANE. Filter is air dried for 30 minutes at 80 ℃
Baked in a vacuum oven for 2 hours. Prehive
Redidation is 50% formamide, 5xSSC,
5x Denhardt's solution, 1% S
50 ml of DS, containing 20 μg / ml salmon sperm DNA
It was carried out at 42 ° C. for 1 hour in the solution. The probe is human TPO
cDNA fragment (base sequence number 178-10 of sequence number 7)
Random was obtained by purifying 25) after amplification by PCR.
Primer DNA labeling kit
Using (manufactured by Takara Shuzo)³²Use the one labeled with P
Was. Hybridization is pre-hybridization
Radiolabeled with 50 ml of the same composition as
A probe was added and the reaction was carried out at 42 ° C for 20 hours. filter
For 5 minutes at room temperature in 2x SSC / 0.1% SDS solution
After washing 3 times, in 0.1 x SSC / 0.1% SDS solution
After washing at 68 ° C for 1 hour, the intensifying screen and
And X-OMATTM AR5 film (Eastman Koda
Autoradiograph at -70 ° C for 16 hours
I did it. As a result, with the restriction enzyme HindIII
When digested, a single band of about 10 kbp was observed
Was. Therefore, control 10 μg of DNA of clone λHGT1.
0.8% agarose gel after digestion with HindIII restriction enzyme
Electrophoresis at 10 bp and cut out the 10 kbp band
-A-gene DNA purification kit (Bio-Rad)
Cloning purified and similarly digested with HindIII
Substituting into vector pUC13 (Pharmacia)
Cloned (host fungus is Competent manufactured by Toyobo Co., Ltd.
・ High E. E. coli DH5 was used). Obtained
Includes a 10 kbp HindIII fragment of the loan
A clone was selected and named pHGT1. Phage black
Figure 11 shows a rough restriction map of λHGT1.
You <Example 25> Sequence of human TPO chromosome clone pHGT1 The pHGT1 clone was cultured to purify the plasmid DNA.
I did. The method is essentially Molecular Clo
ning [Sambrook et al., ColdSprin
g Harbor Laboratory Press
(1989)].
50 μg / ml Ampicil of clone pHGT1
After culturing in 50 ml of LB medium containing lin overnight,
The bacterial cells obtained by heart separation were treated with 4 ml of TEG-lysozy.
suspended in me solution, 8 ml 0.2N NaOH / 1%
Add SDS solution and suspend well. Furthermore, 3M pot
Add 6 ml of assium / 5M acetate solution
Well and then centrifuge to obtain the supernatant. Supernatant is phenol
After treating with chloroform (1: 1), an equal volume of isoprop
A pellet was obtained by adding a nol and centrifuging. Pellet is T
After dissolving in E solution, RNAse treatment, phenol-chloro
Perform form (1: 1) treatment and perform ethanol precipitation.
U Re-dissolve the pellet in TE solution, add Nacl, poly
0.63M each of ethylene glycol 3000,
Add to 7.5% and centrifuge. Finally, Peret
Is dissolved in TE solution and then ethanol precipitated. to this
About 300 μg of plasmid DNA pHGT1 was obtained from
Was. About purified plasmid DNA Taq Dye
 Deoxy^TMTerminator Cycle
Sequencing Kit (Applied Biosystem
3) manufactured by Applied Biosystems, Inc.
73A DNA sequencer for sequencing, c
Protein codedies predicted from DNA nucleotide sequences
The nucleotide sequence around the coding region was determined. Nucleotide sequence and
Sequence listing of the deduced amino acid sequence (SEQ ID NO: 8)
It was shown to. The primer required for nucleotide sequence determination is Example 2
The same as that used for the nucleotide sequence analysis of the cDNA used in 2.
And the sequence reaction with those primers.
Use synthetic primers designed based on the analyzed internal sequence.
I used it. As a result, the plasmid clone pHGT1 is responsible for
The chromosomal DNA possessed is the amino acid predicted by SEQ ID NO: 6.
Including all the acid coding regions,
The nucleotide sequences were in perfect agreement. In addition,
The region corresponding to the exon to be added is four introns.
The length of the intron is in order from the 5'side.
231bp, 286bp, 1932bp, 236bp
Met. 3 is the cDNA base sequence shown in SEQ ID NO: 7
The place was different. The different nucleotide sequences are described in Example 22.
It is the same as the place (the difference between SEQ ID NOS: 6 and 7),
A (84th base) of SEQ ID NO: 7 is C, A (740 bases)
Eyes was T, and G (1198th base) was A. Sanawa
The human TPO cDNA clone obtained in Example 21
The base sequence of pHTF1 is the same as that of the human chromosome.
It became clear that they were different. Therefore, this base sequence
Analysis of whether the mutation in the sequence reflects the original sequence
5 stains finally selected for screening
Of the somatic DNA clones, the rest of which the base sequence has not been determined
The sequence was determined for the four clones. Array
Analysis is described in Molecular Cloning
Phage DNA prepared by the plate lysate method
Was carried out by the direct nucleotide sequencing method using. Up for reaction
Example 2 at the positions where the nucleotide sequence mutation points at the three positions can be analyzed
Sequence primer synthesized in 2 and Taq
Dye Deoxy^TMTerminator Cyc
le Sequencing Kit (Applied Bio
Applied Biosystems
Sequenced by 373A DNA sequencer manufactured by the company
did. As a result, 8 of SEQ ID NO: 7 was observed in all four clones.
The 4th base is C, the 740th base is T, and
Unlike the cDNA, it matched that of SEQ ID NO: 6. 1
For the 198th base, there are two G clones and one A clone.
There were two. That is, the original salt of chromosomal DNA
It became clear that there are two types of base sequences. This array difference
Or genes derived from homologous chromosomes or multiple genes
It is unknown at this point if it is derived from. Also, purchase
Entered Clontech poly (A)⁺RNA is Ca
It is derived from ucasian, but the origin of chromosomal DNA
Since Japanese are Japanese, mutations in the nucleotide sequence are different in race.
It is also suggested that it may be due to the Supported on E. coli DH5
The modified vector pHGT1 is dated March 24, 1994.
Entrusted with the Institute of Biotechnology, Institute of Technology, Ministry of International Trade and Industry
Deposited under the number FERM BP-4616. <Example 26> Expression and activity of human TPO chromosomal DNA in COS1 cells
Plasmid clone pH obtained by confirmation subcloning
GT1 has 3 inserts and 1 in the vector
There are 4 EcoRI recognition sequences in total,
The 5'-most EcoRI recognition sequence in the insert and
Approximately 4.3 kb sandwiched between EcoRI recognition sequences
The human TPO protein chordin was added to the DNA fragment of p.
It was revealed from the analysis of the nucleotide sequence that the entire region was included.
Or it becomes. Therefore, this fragment was treated with EcoRI.
Connected to the current vector pEF18S and generated 4 human TPO
The current plasmid pEFHGTE # 1-4 was obtained (see above figure)
11). We prepared these plasmid DNAs for expression experiments.
I did. Purification of plasmid DNA is essentially Mole
circular Cloning [Sambrook et al.,
Cold Spring Harbor Labora
tory Press (1989)].
And carry out about 250 μg of plasmid DNA
Obtained. CO of the obtained clone pEFHGTE # 1-4
Transfection of S1 cells is according to Example 11.
I did it. That is, use 10 μg of plasmid DNA.
The DEAE-dextran method including chloroquine treatment
The transfection used was carried out, and after 3 days in culture
Collected Qing. The obtained culture supernatant is used for IMDM culture medium.
And then dialyzed, and then evaluated by the rat CFU-MK assay system.
Was. As a result, COS1 cells expressing pEFHGTE were expressed.
TPO activity was observed in the cell culture supernatant in a dose-dependent manner.
However, the expression plasmid containing no DNA insert was
Activity in the transfected COS1 cell culture supernatant
I was not able to admit. Almost all of clones # 1 to 4
Similar results were obtained, but pEFHGTE is a typical example.
The results for # 1 are shown in Figure 12a. Also, M-07
In the e assay system, pEFHGTE was also expressed
Dose-dependent significant M-07 in COS1 cell culture supernatant
e cell growth promoting activity was observed. As a typical example, pE
The results for FHGTE # 1 are shown in Figure 12b. this
From the above results, the obtained clone pEFHGTE was carried.
The DNA to be cloned must be a functional chromosomal DNA of human TPO.
Became clear. <Example 27> Preparation of human TPO deletion derivative and expression in COS1 cells-
Activity Confirmation From the results of Example 18, human TPO was not required to be full length.
Although it was revealed that the activity could be expressed, the expression of the activity
For the purpose of analyzing the region required for
Expression was performed. The plasmid claw obtained in Example 18
Based on the pHT1-231, 20
Amino acid deleted expression plasmid and TP2 / 3
Expression including amino acids immediately after (163rd)
Mido was prepared. PCR was used for the production. For PCR
The sequences of the primers prepared in the above are as follows. hTPO-5: 5'-TTTTGAATTCGGCCAG
CCAGACACCCCGGCC-3 '(of SEQ ID NO: 4
1-21 with EcoRI sequence added; described in Table 9
Same as that of hTPO-S: 5'-TTTGCGCGCCGCTCAT
TAGCTGGGGACAGCTGTGGTGGGGT-
3 '(antisense of 555-576 of SEQ ID NO: 4; 2
Add the stop codons TAATGA and NotI sequences;
For preparing a deletion derivative encoding amino acids 1-163) hTPO-4: 5'-TTTGCGGCCGCTCAT
TACAGTGTGAGGACTAGAGAGGTTC
TG-3 '(antisense of 576-600 of SEQ ID NO: 4
S; two stop codons TAATGA and NotI sequences
Addition; preparation of deletion derivative encoding amino acids 1-171
HTPO-30: 5'-TTTGCGGCCGCTCA
TTATCTGGCTGAGGCAGTGAAGTTTT
GTC-3 '(SEQ ID NO: 4 636-660 antisense
2 stop codons TAATGA and NotI sequences
Added; deletion deletion product encoding amino acids 1-191
(For manufacturing) hTPO-2: 5'-TTTGCGCGCCGCTCAT
TACAGACCAGGAATCTTGGGCTCTGA
AT-3 '(antisense of 696-720 of SEQ ID NO: 4)
S; two stop codons TAATGA and NotI sequences
Addition; preparation of deletion derivative encoding amino acids 1-211
Plasmid) clone pHT1-231 obtained in Example 18
Primer synthesized using 1 μg of DNA as a template
-(Use hTPO-5 as 5'side, hTPO-2,
-3, -4, and -S are used as the 3'side) and 10 respectively
PCR was performed using μM. GeneAmp^TMPC
R Reagent Kit with AmpliTa
q^TMDNA Polymerase (Takara Shuzo)
Using GeneAmp^TMPCR System96
00 (made by PERKIN-ELMER) 100μ
PCR in a volume of 1 (denaturation condition of 95 ° C for 1 minute, 66 ° C
1 minute annealing condition, 72 ° C 1 minute synthesis condition
Perform the reaction 20 times and incubate at 72 ° C for another 7 minutes.
I went). Bands obtained by each PCR
After digestion with restriction enzymes EcoRI and NotI, 1% agaro
Sugel (manufactured by FMCBioProducts)
Electrophoresis and expected PCR of each PCR reaction
The major DNA fragments of size were isolated and separated by prep-A-di
DNA purification kit (manufactured by Bio-Rad),
Similarly, the restriction vector-treated expression vector pEF18S was
Cloned (as a host fungus, manufactured by Toyobo Co., Ltd.
Pitent High E. E. coli DH5). Obtained
Of the transformants that had the expected length.
Select 4 to 5 clones containing each
Then, plasmid DNA was prepared. The method is essentially Mo
regular Cloning [Sambrook
Et al, Cold Spring Harbor Labor
Atory Press (1989) J.
It carried out like this. Amino acid 1 by a series of operations
Deletion derivative encoding -163 (pHT1-163 #
1-5), a deletion derivative encoding amino acids 1-171
(PHT1-171 # 1-4), amino acids 1-191
An encoded deletion derivative (pHT1-191 # 1-4),
Deletion derivative encoding amino acids 1-211 (pHT1
-211 # 1-4) plasmid DNA was obtained. Purified
Taq Dye Deo for plasmid DNA
xy^TMTerminator Cycle Sequ
ening Kit (Applied Biosystems)
Manufactured by Applied Biosystems 373A
Sequenced by DNA sequencer and
The expected TPO cDNA without any substitution of the nucleotide sequence
I confirmed that I had an array. Each claw obtained
Transfection of COS1 cells into the Example
It was carried out according to 11. That is, 1 each for plasmid DNA
DEAE-dex with 0 μg and chloroquine treatment
3 days after transfection using the Tran method
The culture supernatant was later collected. Culture supernatant into IMDM culture medium
After dialysis, it was evaluated by the rat CFU-MK assay system.
Was. As a result, pHT1-211, pHT1-191,
express pHT1-171 and pHT1-163
TP was dose-dependent on any of the COS1 cell culture supernatants.
O activity was observed. As a typical example, pHT1-211 # 1,
For pHT1-191 # 1 and pHT1-171 # 2
Fig. 13a shows the results of the test in pHT1-163 # 2.
The results are shown in FIG. 13b. Similar results are M-07e
Also obtained in the assay system, pHT1-211, pH
T1-191, pHT1-171, and pHT1-1
For use with any COS1 cell culture supernatant expressing 63
A significant amount-dependent M-07e cell growth promoting activity was observed.
Was. As a typical example, pHT1-211 # 1, pHT1-
191 # 1, pHT1-171 # 2, and pHT1-
The results for 163 # 2 are shown in FIG. These conclusions
From the amino acid, amino acid 35 that constitutes human TPO protein
Position 164 out of 3 (including 21 signal sequences)
Even if the amino acid after arginine of is deleted,
It is clear that the activity in vitro is retained.
Of TPO activity before arginine at position 164
Therefore, it was suggested that the essential region was included. <Example 28> Preparation of human TPO C-terminal deletion and development in COS1 cells
Present-Activity Confirmation The region essential for the activity expression of human TPO protein was analyzed.
For the purpose of
A derivative having a deletion of the terminal amino acid was prepared to improve TPO activity.
It was examined whether it could be expressed. Plus obtained in Example 16
Based on the mid clone pEF18S-HL34, 163
Amino acids are sequentially deleted from the C-terminal side based on the th serine
The expressed expression plasmid was constructed. PCR is used for construction
I used it. The sequences of the primers prepared for PCR are as follows:
On the street. hTPO-5: 5'-TTTTGAATTCGGCCAG
CCAGACACCCCGGCC-3 '(of SEQ ID NO: 4
1-21 with EcoRI sequence added; described in Table 9
HTPO-150: 5'-TTTGCGCGCCGCTC
ATTAGAGGGGTGGACCCTCCTACAAG
CAT-3 '(antisense of 514-537 of SEQ ID NO: 4)
2 stop codons TAATGA and NotI sequences
Added; Construction of deletion product encoding amino acids 1-150
HTPO-151: 5'-TTTGCGCGCCGCTC
ATTAGCAGAGGGGTGGACCCTCCTAC
AA-3 '(antisense of 518-540 of SEQ ID NO: 4
S; two stop codons TAATGA and NotI sequences
Addition; for preparing a deletion product encoding amino acids 1-151) hTPO-153: 5'-TTTGCGCGCCGCTC
ATTACCTGACGCAGAGGGTGGACCC
-3 '(antisense of 526-546 of SEQ ID NO: 4;
With two stop codons TAATGA and NotI sequences
Add; for preparing a deletion product encoding amino acids 1-153) hTPO-154: 5'-TTTGCGCGCCGCTC
ATTACGCCCGACGCAGAGGGGTGGA
-3 '(529-549 antisense of SEQ ID NO: 4;
Add two stop codons TAA TGA and NotI sequences; amino acids 1-154
HTPO-155: 5'-TTTGCGCGCCGCTC
ATTAGGCCCGCCTGACGCAGAGGGT
-3 '(antisense of 532-552 of SEQ ID NO: 4;
With two stop codons TAATGA and NotI sequences
Add; for preparing a deletion product encoding amino acids 1-155) hTPO-156: 5'-TTTGCGCGCCGCTC
ATTATGGGGCCCCGCCTGACGCAGAG
-3 '(antisense of 535-555 of SEQ ID NO: 4;
With two stop codons TAATGA and NotI sequences
Add; for preparing a deletion product encoding amino acids 1-156) hTPO-157: 5'-TTTGCGCGCCGCTC
ATTAGGGTGGGGGCCCGCCTGACGCA
-3 '(the antisense of 538-558 of SEQ ID NO: 4;
With two stop codons TAATGA and NotI sequences
Add; for preparing a deletion product encoding amino acids 1-157). The clone pEF18S-HL34 clone obtained in Example 16
Using 1 μg of rasmid DNA as a template,
Limer (hTPO-5 is used as 5'side, hTPO-5
-150, -151, -153, -154, -155,
-156 and -157 are used as 3'side) 1
PCR was performed using 0 μM. GeneAmp^TMP
CR Reagent Kit with Ampli
Taq^TMDNA Polymerase (Takara Shuzo)
Manufactured by GeneAmp^TMPCR System
1 by m9600 (manufactured by PERKIN-ELMER)
PCR reaction in a volume of 00 μl (denaturing strip for 1 min at 95 ° C)
The annealing conditions of 1 minute at 66 ° C., 1 minute at 72 ° C.
The reaction was repeated 20 times under the synthetic conditions, and at 72 ° C for another 7 minutes.
Incubation) was performed. Obtained by each PCR
The digested band with restriction enzymes EcoRI and NotI,
1% agarose gel (FMC BioProducts
PCR reaction of each product
The major DNA fragment of the expected size of
Up-A-Gene DNA Purification Kit (Bio-Rad
Expression vector p purified by
Subcloned into EF18S
Yoh Spin Co. Competent High E. coli DH5
use). Among the transformants obtained,
No 3 clones each containing a specific insert
Then, the plasmid DNA was prepared by selecting 5 cells each. Method
Is essentially Molecular Cloning [Sa
mbrook et al., Cold Spring Harbo
r Laboratory Press (1989)]
Was carried out as described in. Through a series of operations
In SEQ ID NO: 4, amino acid numbers 1-150 are
Deletion mutants (pHT1-150 # 21, 22, 2, 2
5), a deletion product encoding amino acid numbers 1-151 (p
HT1-151 # 16, 17, 18), amino acid number 1
Deletion gene encoding -153 (pHT1-153 # 1-
5), a deletion product encoding amino acid numbers 1-154 (p
HT1-154 # 1-5), amino acid numbers 1-155
Deletion Encoding (pHT1-155 # 1-5), Ami
Noci acid No. 1-156-encoding deletion product (pHT1-1
56 # 1-5), encoding amino acid numbers 1-157.
Deletion product (pHT1-157 # 1-5) plasmid DN
I got A. Purified plasmid DNA pHT1-15
0 # 21, 22, 25 and pHT1-151 # 16,
Taq Dye Deoxy for 17 and 18^TM
Terminator Cycle Sequenin
For g Kit (manufactured by Applied Biosystems)
Applied Biosystems 373A DNA
Sequencer sequencer and base
Has the expected TPO cDNA sequence with no sequence substitutions
I confirmed that. CO of each clone obtained
Transfection of S 1 cells is described in Example 11.
Therefore it was done. That is, plasmid DNA 10 μg each
DEAE-Dextran with chloroquine treatment using
Transfection using the method was performed and the culture was performed 3 days later.
The nutrient supernatant was collected. Culture supernatant to IMDM culture
After thorough dialysis, evaluation was carried out using the M-07e assay system. That
As a result, it contains cysteine, which is the amino acid at position 151.
Amino acids 1-151, 1-153, 1-15, respectively
From 4th, 1-155th, 1-156th, 1-157th
A clone encoding the C-terminal deletion derivative
Dose dependent in transfected COS1 cell culture supernatant
TPO activity was detected. However, 151
Amino acids 1-150 deleted up to the cysteine of the eye
A clone encoding a C-terminal deletion derivative of
TPO activity in the cultured COS1 cell culture supernatant
Was not detected. <Example 29> Preparation of human TPO N-terminal deletion and development in COS1 cells
Present-Activity Confirmation The region essential for the activity expression of human TPO protein was analyzed.
In order to achieve the above, based on the deletion product obtained in Example 28, N-terminal
A derivative having a deletion of the amino acid on the side is prepared to generate TPO activity.
I examined whether it could appear. Plasma obtained in Example 18
Doclone pEF18S-HL34 and Example 27
Based on the plasmid clone pHT1-163 obtained in
Expression with deletion of N-terminal amino acid following signal sequence
The plasmid was constructed. PCR was used for the construction. P
The sequence of the primer prepared for CR is as follows.
It hTPO-5: 5'-TTTTGAATTCGGCCAG
CCAGACACCCCGGCC-3 '(of SEQ ID NO: 4
1-21 with EcoRI sequence added; described in Table 9
Same as that of hTPO3: 5'-TTTGCGCGCCGCTCATT
ATTCGTGTATCCTGTTCAGGTTATCC
-3 '(antisense of 757-780 of SEQ ID NO: 4;
With two stop codons TAATGA and NotI sequences
Add; to prepare a deletion product encoding amino acids 1-231.
Same as the one made) hTPO-S: 5'-TTTGCGCGCCGCTCAT
TAGCTGGGGACAGCTGTGGTGGGGT-
3 '(antisense of 555-576 of SEQ ID NO: 4; 2
Add the stop codons TAATGA and NotI sequences;
For preparing a deletion product encoding amino acids 1-163) hTPO-13: 5'-AGTAAACTGCTTCG
TGACTCCCATGTTCCTTCACAGCAGA
CTGAGCCATGG-3 '(124-of SEQ ID NO: 4
173; Preparation of derivative lacking amino acid numbers 1-12
HTPO-13R: 5'-CATGGGAGTCACG
AAGCAGTTTACTGGACAGCGGTTAGC
CTTGCAGTTAG-3 '(64-8 of SEQ ID NO: 4
7 and 124-148 antisense; amino acid number
For preparing a derivative lacking 1-12) hTPO-7: 5'-TGTGACCTCCGAGTC
CTCAGTAAACTGCTTCGTGAACTCCC
ATGTCCTTC-3 '(106-15 of SEQ ID NO: 4)
4; for preparing a derivative in which amino acid Nos. 1 to 6 are deleted) hTPO-7R: 5'-TTTACTGAGGACTC
GGAGGTCACAGAGACAGCGTTAGCCT
TGCAGTTAG-3 '(64-87 of SEQ ID NO: 4
And 106-129 antisense; amino acid number 1-
For preparing a derivative that loses 6) hTPO-8: 5'-GACCTCCGAGTCCTC
AGTAAACTGCTTCGTGAACTCCCATG
TCCTTCCACA-3 '(109-15 of SEQ ID NO: 4
7; for preparing a derivative lacking amino acid numbers 1-7) hTPO-8R: 5'-CAGTTTACTGAGGA
CTCGGAGGTCGGACAGCGTTTAGCCT
TGCAGTTAG-3 '(64-87 of SEQ ID NO: 4
And the antisense of 109-132; amino acid number 1-
For producing a derivative lacking 7. (1) A derivative lacking amino acid numbers 1-12 (pHT
13-231) Production of clone pEF18S-HL34 obtained in Example 18
Synthesized using 1.4 μg of Lasmid DNA as a template
Primers (hTPO-13 and hTPO3 used in combination
For: hTPO-5 and hTPO-13R are used in combination)
PCR was performed using 5 μM of each of the above. GeneA
mp^TM PCR Reagent Kit with
 AmpliTaq^TMDNA Polymerase
GeneAmp using (manufactured by Takara Shuzo)^TM PCR
 System 9600 (PERKIN-ELMER
PCR reaction (at 95 ° C) in a volume of 100 μl
After denaturing for 5 minutes, denaturing conditions of 95 ° C for 1 minute, 1 at 65 ° C
30 minutes under the annealing condition of 72 minutes and the synthesis condition of 1 minute at 72 ° C.
Incubate at 72 ° C for another 7 minutes.
G) 1.2% agaro of each PCR product
Sugel (made by FMC BioProducts)
Electrophoresis, each of the major D of the expected size
The NA fragment was separated and the prep-A-gene DNA purification kit was isolated.
Purified by Biot (BioRad) and 15 μl TE
Dissolved in stuffer. Use 1 μl each of this solution as a template
The second PCR was performed. Synthesized primer (h
TPO-5 and hTPO3 are used) 5 μM each
Was used to perform PCR. GeneAmp^TM PCR
 Reagent Kit With AmpliTa
q^TM DNA Polymerase (Takara Shuzo)
With GeneAmp^TM PCR System
 1 by 9600 (manufactured by PERKIN-ELMER)
PCR reaction in a volume of 00 μl (after denaturing at 95 ° C for 5 minutes,
Denaturing conditions at 95 ° C for 1 minute, annealing at 60 ° C for 1 minute
Perform the reaction 30 times under the conditions of 72 ° C and 1 minute of synthetic conditions.
And further incubated for 7 minutes at 72 ° C.).
The PCR product was analyzed by 1.2% agarose gel (FMC Bio
Electrophoresis using (Products)
The major DNA fragments of the
Purified with A-gene DNA purification kit (Bio-Rad)
It was prepared and dissolved in 15 μl of TE buffer. Restriction enzyme
Equal amount of phenol after digestion with EcoRI and NotI
/ Extract once with chloroform and perform ethanol precipitation
Was. Precipitate obtained by centrifugation in 15 μl TE buffer
After lysis, the expression vector pEF1 was similarly treated with restriction enzymes.
Subcloned into 8S (Toyobo as a host bacterium
Competent high E. E. coli DH5
for). Of the transformants obtained, the
45 clones containing insert
NA was prepared. The method is essentially Molecular
Cloning [Sambrook et al., Cold S
pring Harbor Laboratory P
[ress (1989)].
gave. In SEQ ID NO: 4, amino acid numbers 1-231
Induction of deletion of 1-12 among proteins encoding
Body (pHT13-231) plasmid DNA was obtained.
About these, ply of hTPO-5 and hTPO3
PCR was performed using
The insert was confirmed to be about the size expected on the loan
Was. About 3 clones among them, Taq Dye
Deoxy^TM Terminator Cycle
Sequencing Kit (Applied Biosystem
3) manufactured by Applied Biosystems, Inc.
Sequenced by 73A DNA sequencer, 1
The clone had the expected deletion, and
There is no substitution of the base sequence over the entire length including other parts.
Clone pH with TPO cDNA sequence as designed
T13-231 # 3 was obtained. (2) A derivative lacking amino acid numbers 1-6 (pHT7
-163) In the preparation of the deletion derivative of (1) above, the TPO protein
Was designed as the 231st amino acid of the
Even if the terminal side is further deleted, TPO activity may be expressed.
Since it was confirmed that C
The terminal was designed up to the 163rd amino acid. following
Also in (3), the 163rd amino acid is similarly added to the C-terminal.
Designed as Clone pHT1-obtained in Example 27
Using 1.4 μg of 163 plasmid DNA as a template
And synthesized primers (hTPO-7 and hTPO-
Use S in combination: hTPO-5 and hTPO-7R in combination
Used in 5 μM). G
eneAmp^TM PCR Reagent Kit w
it AmpliTaq^TM DNA Polymr
GeneAmp using asase (Takara Shuzo)^TM 
PCR System 9600 (PERKIN-EL
PCR reaction (9 by MER) in a volume of 100 μl
After denaturing at 5 ° C for 5 minutes, denaturing conditions at 95 ° C for 1 minute, 65
Annealing condition for 1 minute at ℃, Synthesis condition for 1 minute at 72 ℃
The reaction is performed 30 times at 37 ° C for 7 minutes at 72 ° C.
Beet). Each PCR product has 1.2%
Gallose gel (FMC BioProducts)
Electrophoresis using
DNA fragments were isolated and prep-A-gene DNA purified.
Purified with a kit (manufactured by Bio-Rad), 15 μl of T
It was dissolved in E buffer. 1 μl each of this solution was used as a template
A second PCR was performed. Synthesized primer
(Using hTPO-5 and hTPO-S)
PCR was performed using 5 μM. GeneAmp^TM 
PCR ReagentKit with Ampli
Taq^TM DNA Polymerase (Takara Shuzo)
Manufactured by GeneAmp^TM PCR System
According to em 9600 (manufactured by PERKIN-ELMER)
PCR reaction in a volume of 100 μl (denaturation at 95 ° C for 5 minutes
Then, denaturing conditions of 95 ° C for 1 minute and annealing at 60 ° C for 1 minute
Reaction at 72 ° C for 1 minute
And then incubate at 72 ° C for an additional 7 minutes)
Was. The PCR product was analyzed by 1.2% agarose gel (FMC B
(manufactured by ioProducts),
The major DNA fragment of the expected size is isolated and
Pur-A-gene DNA purification kit (Bio-Rad)
The product was purified with and dissolved in 15 μl of TE buffer. Limit
After digestion with the enzymes EcoRI and NotI, an equal amount of pheno
Ethanol / chloroform and then ethanol precipitation.
It was. The precipitate obtained by centrifugation is added with 15 μl of TE buffer
Expression vector pEF, which was similarly digested with restriction enzymes and treated with restriction enzymes
Subcloned into 18S (Toyobo as host fungus
Kokisha Competent High E. E. coli DH5
for). Of the transformants obtained, the
30 clones containing insert
NA was prepared. The method is essentially Molecular
Cloning [Sambrook et al., Cold Sp
ring Harbor Laboratory Pr
ess (1989)].
did. In SEQ ID NO: 4, amino acid numbers 1-163
Deletion derivative lacking 1-6 of the encoded proteins
A plasmid DNA of (pHT7-163) was obtained. this
For these clones hTPO-5 and hTPO-S
PCR was performed using
May contain inserts as large as expected
confirmed. We selected 3 clones from these clones,
q DyeDeoxy^TM Terminator C
Cycle Sequencing Kit (Applied
Io Systems Co., Ltd.)
Seque with Muse's 373A DNA sequencer
And two clones had the expected deletion
Of the nucleotide sequence over the entire length, including other parts.
2 with the TPO cDNA sequence as designed without substitutions etc.
Clones pHT7-163 # 4, # 29 were obtained
Was. (3) A derivative lacking amino acid numbers 1-7 (pHT8
-163) Preparation A derivative lacking amino acid numbers 1-7 (pHT8-16
In the production method of 3), the above-mentioned amino acid numbers 1-6 are deleted.
Essentially the same as the preparation of the derivative (pHT7-163)
By the way. Clone pHT1-obtained in Example 27
Using 1.4 μg of 163 plasmid DNA as a template
And synthesized primers (hTPO-8 and hTPO-
Use S in combination: hTPO-5 and hTPO-8R in combination
Used in 5 μM). G
eneAmp^TM PCR Reagent Kit
with AmpliTaq^TM DNA Polym
Using Genease (manufactured by Takara Shuzo Co., Ltd.)
^TM PCR System 9600 (PERKIN-
PCR reaction in a volume of 100 μl by ELMER)
(After denaturing at 95 ° C for 5 minutes, denaturing conditions at 95 ° C for 1 minute,
Annealing condition at 65 ° C for 1 minute, synthesis at 72 ° C for 1 minute
Perform the reaction 30 times under the conditions and incubate at 72 ° C for 7 minutes.
Cubate). 1.2 for each PCR product
% Agarose gel (FMC BioProducts
Electrophoresis using the
The major DNA fragment was isolated and prep-A-gene DN
Purified with A purification kit (manufactured by Bio-Rad), 15 μl
Dissolved in TE buffer. 1 μl each of this solution as template
The second PCR was carried out. Synthetic ply
Mar (using hTPO-5 and hTPO-S)
PCR was performed using 5 μM each. GeneAmp
^TM PCR ReagentKit with Am
pliTaq^TM DNA Polymerase (Treasure
GeneAmp using a brewery)^TM PCR S
system 9600 (manufactured by PERKIN-ELMER)
PCR reaction in a volume of 100 μl (at 95 ° C for 5 minutes
After denaturing, denaturing conditions of 95 ° C for 1 minute, 60 ° C for 1 minute
Annealing conditions, synthesis conditions of 72 ° C for 1 minute
And incubate at 72 ° C for an additional 7 minutes).
It was. The PCR product was analyzed by 1.2% agarose gel (FMC
Electrophoresis using BioProducts)
Isolate the major DNA fragment of the expected size and
Rep-A-Gene DNA Purification Kit (Bio-Rad
Product) and dissolved in 15 μl of TE buffer.
After digesting with the restriction enzymes EcoRI and NotI,
Ethanol precipitation after extraction once with ethanol / chloroform
I did. The precipitate obtained by centrifugation is mixed with 15 μl of TE buffer.
Expression vector p, which had been similarly digested with restriction enzymes and treated with restriction enzymes
Subcloned into EF18S
Yoh Spin Co. Competent High E. coli DH5
use). Of the transformants obtained,
Select 30 clones containing the insert and
DNA was prepared. The method is essentially Molecular
 Cloning [Sambrook et al., Cold S
pring Harbor Laboratory P
[ress (1989)].
gave. In SEQ ID NO: 4, amino acid numbers 1-163
Deletion derivative lacking 1-7 of proteins encoding
A plasmid DNA of (pHT8-163) was obtained. this
For these clones hTPO-5 and hTPO-
PCR was performed using S as a primer to
Include an insert about the size of the loan
Was confirmed. Select 3 clones from these clones,
aq DyeDeoxy^TM Terminator
Cycle Sequencing Kit (Applied
Applied Systems
Seek with Thames 373A DNA sequencer
And two clones caused the expected deletions to occur.
And salt over the entire length including other parts
TPO cDNA sequence as designed without substitution of base sequence
Two clones with pHT8-163 # 33, # 48
was gotten. (4) Expression of deletion derivative in COS1 cells and TPO activity
Confirmation of each of the obtained deletion clones to COS1 cells
Transfection is performed according to Example 11.
Was. That is, 10 μg each of plasmid DNA was used to
Using DEAE-Dextran method including Rokin treatment
Conduct the transfection and collect the culture supernatant after 3 days
did. Sufficient dialysis of culture supernatant against IMDM culture
Then, it was evaluated by the M-07e assay system. As a result,
A clone encoding a deletion derivative at position 7-163
Weak in the transfected COS1 cell culture supernatant
However, TPO activity was observed in a dose-dependent manner. On the other hand,
Minoic acid 8-163, deletion derivative of 13-231 position
COS1 transfected with the clone
No TPO activity was observed in the cell culture supernatant. <Example 30> Human TPO full-length cDNA plasmid (pHTP1)
Construction of human TPO cDNA predicted as shown in SEQ ID NO: 6
Animal cell expression vector containing all mino acid coding regions
The construction of the tar was performed. Human TPOcDN by PCR
A DNA fragment that covers the entire A coding region is shown below.
Was prepared as follows. The nucleotide sequences of the primers used are as follows.
It is Ri. hTPO-I: 5'-TTGTGACCTCCGAGT
CCTCAG-3 '(105-125 of SEQ ID NO: 6) SA: 5'-CAGGTATCCGGGGATTTTGG
TC-3 '(corresponding to 745 to 765 of SEQ ID NO: 6)
HTPO-P: 5'-TGCGTTTCCTGATGC
TTGTAG-3 '(503 to 523 of SEQ ID NO: 6) hTPO-KO: 5'-GAGAGAGCGGCCGC
TTACCCCTTCCTGAGACAGATT-3 '
(Anti-cell corresponding to 1066 to 1086 of SEQ ID NO: 6
Recognition sequence of restriction enzyme NotI and GAGA
GA sequence added). The clone pEF18S-HL34 obtained in Example 16
The first PCR was performed using 300 ng of the above as a template.
Primer hTPO-I and SA 0.5 μM each are used
I, Vent R^TM DNA polymerase
(New England BioLabs) 1 unit
Reaction using a knit (96 ° C for 1 minute, 62 ° C for 1 minute,
72 ° C for 1 minute after 30 cycles of reaction 72
C. for 7 minutes). The composition of the reaction solution is as follows.
10 mM KCl and 10 mM (NH_Four)₂ S
O_Four, 20 mM Tris-HCl (pH 8.8), 2
mM MgSO_Four, 0.1% Triton X-100,
200 μM dNTP mix. Commercially available normal human liver
1 μg of poly (A) + RNA (Clontech)
Was heated at 70 ° C for 10 minutes and then rapidly cooled on ice to give 10 mM D
TT, 500 μM dNTPmix, 25 ng ran
dom primer (Takara Shuzo), 10 units R
Nase Inhibitor (Boehringer Mann High
200 units, SuperScript^TM
II RNase H- (LIFE TECHNOLOG
IEC) was added, and the mixture was incubated at 37 ° C for 1 hour and cDNA
Synthesized. Cast 1/20 volume of synthesized cDNA reaction solution
A second PCR was performed using it as a template. Primer
-HTPO-P and hTPO-KO 2.5 μM each,
2.5 units of AmpliTaq^TM DNA po
Reaction using lymerase (Takara Shuzo) (95 ° C)
30 minutes of reaction at 1 minute, 58 ° C for 1 minute, 72 ° C for 1 minute
Kuru). PCR solution of 2 times 1% agarose
Subjected to gel electrophoresis, each of the expected major size
The different bands to the Prep-A-Gene DNA Purification Kit (Ba
It was purified using Iorad). Purified amount of each
Perform a third PCR using 1/20 of each as a template.
gave. Vent R^TM DNA polymer
se (manufactured by New England BioLabs)
Reaction using 1 unit (after heating at 96 ° C for 2 minutes, 96
Perform 2 cycles of ℃ 2 minutes, 72 ℃ 2 minutes for 3 cycles.
After that, 72 ° C. for 7 minutes). This reaction liquid
HTPO-I and hTPO-K so that the concentration becomes 1 μM
After adding O, heat at 96 ° C for 2 minutes, and then
2 reactions at 96 ° C for 1 minute, 62 ° C for 1 minute, 72 ° C for 1 minute
After 5 cycles, react at 72 ° C for another 7 minutes
Was. The reaction solution was treated with an equal volume of water-saturated phenol-chloroform.
After extraction once, it was extracted once with an equal volume of chloroform.
Then, ethanol precipitation (0.3 M sodium acetate, 0.
5 µl Boehringer Mannheim Glycogen, 2.
DNA in the presence of 5 volumes of ethanol)
Was. The recovered DNA is treated with the restriction enzymes BamHI and Not.
Digested with I and subjected to 1% agarose gel electrophoresis
Prep-A-Gene DN with major band
Purified using A purification kit (manufactured by Bio-Rad)
Then, in the same manner, it was previously deleted with the restriction enzymes BamHI and NotI.
PBluescript II SK + vector
After connecting to (Stratagene), competent
E. E. coli DH5 (Toyobo Co., Ltd.) was transformed
Was. 4 clones are selected from the obtained colonies
DNA was prepared. About purified plasmid DNA
Is TaqDye Deoxy^TM Terminate
r Cycle Sequencing Kit
Applied Bio)
System 373A DNA sequencer
Sequenced from BamHI to NotI
There is no substitution of the nucleotide sequence in the
A clone pBLTP confirmed to have a row was obtained.
PBLTP is erased with restriction enzymes EcoRI and BamHI.
After gelation, it was subjected to 1% agarose gel electrophoresis, and high molecular weight
Prep-A-Gene DNA Purification Kit (Bio
(Made by Rad). Similarly, pEF18S-
HL34 was also treated with a restriction enzyme to purify the 450 bp band.
Was. Ligate each DNA and compete
Tohai E. Transformation of E. coli DH5 (manufactured by Toyobo)
Changed. Preparation of plasmid DNA from the obtained colonies
And clone p containing the human TPO cDNA insert.
I got BLTEN. The obtained pBLTEN was used as a restriction enzyme E.
After digestion with coRI and NotI, 1% agarose gel
Approximately 1200 bp band was prepared by electrophoresis-
Use A-Gene DNA Purification Kit (Bio-Rad)
Expression vector treated with the same restriction enzymes after purification
Connected to pEF18S, competent high E. coli
DH5 (manufactured by Toyobo Co., Ltd.) was transformed. The obtained roller
Plasmid DNA was prepared from knee and human TPOcDN was prepared.
A clone pHTP1 containing all A coding regions
Obtained. Prepare a large amount of plasmid DNA for this clone
It was used in the following experiments. Preparation of plasmid DNA is essential
Molecular Cloning (Sambr
Look et al., Cold Spring Harbor L
Laboratory Press, 1989).
It was carried out as described above. <Example 31> pDEF202-hTP, recombinant vector for CHO cells
Construction of O-P1 Plasmid pMG1 containing mouse DHFR minigene,
1 μg was treated with restriction enzymes EcoRI and BamHI
After that, agarose gel electrophoresis was performed and mouse DHFR mini inheritance was performed.
A fragment containing the offspring (approximately 2.5 kbp) was recovered. Collected
Fragment 50 mM Tris-HCl (pH 7.5), 7 m
M MgCl₂1 mM mercaptoethno
l, in a 25 μl reaction solution consisting of 0.2 mM dNTP
Dissolve and add 2 units of Klenow fragment at room temperature
The reaction was carried out for 30 minutes to blunt the ends of the DNA. Next
Phenol / chloroform treatment, ethanol precipitation
After that, 10 mM Tri-HCl (pH 8.0), 1 mM
 It was dissolved in 10 μl of a solution consisting of EDTA. Then profit
Containing mouse DHFR minigene and animal cell
Expression vector pEF18S for treatment with restriction enzyme SmaI
Then, remove with alkaline phosphatase (Takara Shuzo).
The vector DNA obtained by the
Expression vector pDEF2
I got 02. Then restrict this vector pDEF202
Treated with the enzymes EcoRI and SpeI and agarose gel
The larger vector fragment was recovered by electrophoresis.
This fragment and human TPO cDNA (P1 clone
Plasmid pHTP1 containing the lone) restriction enzyme Eco
Human TPO cDNA obtained by treatment with RI and SpeI
A (P1 clone) and T4 DNA ligase (Takara Shuzo
Expression vector pDEF202-hTP
O-P1 was obtained. This plasmid is the replication initiation region of SV40
Region, human elongation factor-1-alpha pro
Motor, SV40 early polyadenylation site, mouse DH
FR minigene, pUC18 origin of replication, β-lac
Tamase gene (Amp^r), Human Elongation
Human factor T downstream of the factor 1-alpha promoter
PO cDNA is connected. <Example 32> Expression of human TPO in CHO cells CHO cells (dhfr- strain, Urlaub and Chasi).
n; Proc. Natl. Acad. Sci. USA;
Vol. 77, p. 4216, 1980) 6 cm diameter plate
(Falcon) α minimum containing 10% fetal calf serum
Essential medium (α-MEM (-), thymidine, hypoxanthine
Cultivated and proliferated by adding calcium phosphate)
Shaped by (cellPhect, Pharmacia)
The quality has changed. That is, pDEF prepared in Example 31
Buffer 10 μg of 202-hTPO-P1 plasmid
-A: 120 μl and H₂O: Add 120 μl and mix
After that, it was left at room temperature for 10 minutes. Next, this solution
Buffer B: 120 μl was added to and mixed again
Then, it was left at room temperature for 30 minutes. Play this DNA solution
CO after dripping₂6 hours in the incubator
Cultured. Remove the medium from the plate and α-MEM
After washing twice with (-), 10% dimethyl sulfoxy
Add α-MEM (-) containing gut and treat at room temperature for 2 minutes
Was. Then, non-selective medium containing 10% dialyzed fetal bovine serum (previously
Α-MEM (-), hypoxanthine, thymidine added)
10% dialyzed fetal bovine serum after culturing for 2 days
Containing selection medium (α-MEM (−), hypoxanthine, chi
Selection was performed with no added midine. Select cells
After lipsin treatment, per 6 cm diameter plate,
5 10cm diameter plates or 24 well plates 2
After dividing into 0 sheets, change medium every 2 days with selective medium
It was carried out by continuing the culture while carrying out. Cells
For plates or wells that have grown,
Human TPO activity in nutrient supernatant was analyzed by M-07e assay and B
When measured using the a / F3 assay,
Activity was also observed in the essay system. In the culture supernatant,
New play for those with recognized TPO activity
Or well containing 25 nM methotrexate
Divide the cells 1:15 in selective medium and continue culturing.
To grow cells resistant to methotrexate and
I made a row. The transformation of CHO cells is C
Co-transformation of pHTP1 and pMG1 into HO cells
(Co-transfection)
Can also be done. Plasmid pDEF202-hT
CHO cell line transformed with PO-P1 (CH
O-DUKXB11) traded on January 31, 1995.
Entrusted number F to the Institute of Biotechnology, Industrial Technology Institute, Ministry of Industry
Deposited as ERM BP-4988. <Example 33> X63.6.5.3. Recombinant vector for cells, BMCG
Construction of Sneo-hTPO-P1 Restriction of 1 μg of BMCGSneo expression vector for animal cells
After treatment with the enzymes XhoI and NotI, agarose gel
Electrogel electrophoresis was performed to recover the vector DNA portion.
Then, the obtained DNA fragment and human TPO cDNA were included.
The plasmid pBLTEN with restriction enzymes XhoI and Not
Human TPO cDNA (P1 clone
And T4 DNA ligase,
De BMCGSneo-hTPO-P1 was obtained. This manifestation
The plasmid is the cytomegalovirus early promoter,
Intron and polya derived from rabbit β-globin gene
Denyl site A part of human β-globin gene, bovine papillo
69% of mavirus 1 gene, thymidine kinase promoter
And polyadenylation sites, phosphotransferrs
Case I (neomycin resistance gene), pBR322
Production start region and β-lactamase gene (Amp^r)
Containing human T at the downstream of the cytomegalovirus promoter
PO cDNA is connected. <Example 34> X63.6.5.3. Expression in cells X63.6.5.3. Cells contain 10% fetal bovine serum D
ulbecco's minimallessential
(DME) medium is grown in culture and electroporated.
The transformation method was used. That is, the example
BMCGSneo-hTPO-P1 plastic prepared in 33
20 μg of sumid 10⁷DME medium containing individual cells 75
In addition to 0 μl, 4 mm gap for electroporation
Place in a cuvette with a cup and leave at 4 ° C for 10 minutes
Was. This cuvette is an electroporation device (B
TX 600, manufactured by BTX), set to 380V, 2
Gene transfer under the conditions of 5 mF and 24 Å
Was. After gene transfer, release the cuvette again at 4 ° C for 15 minutes.
After plating, the cells were incubated with DME containing 10% fetal bovine serum.
Washed twice. The cells are then treated with 50 ml of 10% fetal bovine serum
Suspend in DME containing and divide into 5 96-well plates
After that, CO₂Cultured for 2 days in an incubator.
Then, the culture solution was added with 1 mg / ml of G418 (GIBCO).
Co., Ltd.) Replaced with DME containing 10% fetal bovine serum, and then 3
The medium was changed every day. The well where the cells grew
Furthermore, the human TPO activity in the culture supernatant was measured by CFU-MK.
Assay, M-O7e Assay and Ba / F3 Assay
Was measured using
Was also found to be active. Confirmation of human TPO activity in the culture supernatant
For resistant cells, grow resistant cells twice.
Cloning to establish human TPO producing cell line
Was. <Example 35> Large-scale expression of human TPO in COS1 cells Transfection of COS1 cells into Example 11 was performed.
DEAE-dextran containing chloroquine treatment according to claim 1.
Carried out by law. COS1 cells (ATCC CRL165
175cm which treated 0) with collagen coating²The culture
IMDM with 10% (v / v) FCS in Rasco
In a 5% CO2 incubator at 37 ° C
The cells were cultured until they became about 100% confluent. Culture
Rasco's collagen coating treatment is 1 mM HCl
Collagen solution adjusted to 0.3 mg / ml (Iwaki
Cellmatrix type I-C) manufactured by 175c
m²Add 25 ml per culture flask for 1 hour at room temperature
After standing, the collagen solution is collected and 20-50 ml of PB
It was performed by washing once with S. Transfection
175 cm²250μ per culture flask
g / ml DEAE-Dextran (Pharmacia
, 60 μM chloroquine (Sigma), and 10
% (V / v) Nu-Serum (Collaborative
500 ml of HB in 20 ml of IMDM solution containing
Mix plasmid pHTP1 (40 μg) dissolved in S
And wash once with IMDM immediately before transfection
After addition to the above COS1 cells, 5% carbonic acid at 37 ° C was added.
The cells were cultured in a gas incubator for 3 hours. Then cultivate
50m after removing the nutrient supernatant by suction and washing once with IMDM
1% serum-free medium was added, and 5% carbon dioxide ink at 37 ° C was added.
The cells were cultured in an incubator and the culture supernatant was recovered after 5 days.
175 cm for one operation²From the culture flask 100
Using 260 sheets, 5 to 131 culture supernatants were collected.
The composition of serum-free medium is 5 μg / ml Insulin
(Manufactured by Sigma) 5 μg / ml Transferferri
n (manufactured by Sigma), 10 μM monoethanol
mine (Wako Pure Chemical Industries), 25 nM Sodium s
elenite (manufactured by Sigma), 200 μg / ml B
SA (Nichirei's fatty acid-free high-purity beef album
IMDM including Example 36 Human full-length TPO expressed in COS1 cells (expression plus
Purification of Mido pHTP1 and P1 clones and confirmation of activity Human full-length TPO expressed in COS1 cells (expression plus)
Examples of the activity and purification of amide pHTP1) are described below.
Bell. Partial purification in order to investigate the platelet increasing effect of TPO
To prepare high purity TPO sample
Purified. For measuring TPO activity in the following preparation process
Mainly used the M-O7e assay system, but rat CF
Similar TPO activity was shown in U-MK assay system
It was The final concentration of 0.02
~ 0.05% human serum albumin (HSA) as standard
Was added. First, plasmid pHTP1 from Ohashi and Sudo
Method (Hideya Ohashi and Tada
shi Sudo, Biosci. Biotech. B
iochem. , 58 (4), 758-759, 199.
COS1 cells transfected with 4)
0.2g BSA, 5mg cow per 1000ml
Does insulin contain 5 mg of human transferrin?
0.02 mM monoethanolamine, 25 nM
Serum-free IMDM containing Sodium Selenite
Culture for 5 days at 37 ℃ in a 5% carbon dioxide incubator.
Then, about 7 L of serum-free culture supernatant was obtained. Its serum-free culture
The supernatant was treated with p-APMSF and a protease inhibitor.
And Pefabloc SC (4- (2-Aminoet
hyl) -benzenesulfonyl fluo
Ride hydrochloride, Merk
Manufactured by Catalog No. 24839) with a final concentration of about 1 mM.
Then, the filtrate of a 0.22 μm filter was taken. This
This is an ultrafiltration unit (Omegaul manufactured by Filtron)
TRASET molecular weight cut 8000 or Millipore
・ PLGC Pellicon cassette with a molecular weight of 10,000
10 times concentrated with a volume of 723 ml (protein concentration
3.38 mg / ml, total protein mass 2445 mg, relative activity
Sex 43000, relative activity 105100000)
1.6 moles of Ammonium per 1000 ml
 Add Sulfate (288g total) to final concentration
8 including 1.5M Ammonium Sulfate
After making 04 ml of solution, 1.25M Ammoniu
20 mM sodium citrate containing mSulfate
Macr previously equilibrated with a buffer solution (pH 5.2)
o-Prep Methyl HIC column (Bio-
Rad, Catalog No. 156-0080; Diameter 5c
m, bed height 9 cm) at a flow rate of 10 ml / min.
Added After the addition is complete, 1.25M Ammonium
20 mM sodium citrate buffer containing Sulfate
Flow-through fraction F1 (238) eluted with liquid (pH 5.2)
4 ml, protein concentration 0.864 mg / ml, total protein mass
2061 mg, relative activity 6000) was obtained. Then elute
Put the solution in 20 mM Na Citrate, pH 5.8
Eluted fraction F2 (1092 ml, protein concentration
0.776mg / ml, total protein mass 847mg, relative activity
Sex 150,000). Furthermore, Macro-Pr
ep Methyl HIC column F2 (1081m
1) in 20 mM sodium citrate buffer (pH 5.
8) Pre-equilibrated SP Sepharose Fa
st Flow (Pharmacia Biotech, Kata
Log number 17-0729-01; diameter 3 cm, bed
High 10 cm) column and flow rate 10 ml / min
Was added. After the addition is complete, add 110 mM NaCl
20 mM sodium citrate buffer (pH 5.6) containing
Fractions F1 (2262 ml,
Protein concentration 0.270mg / ml, total protein mass 610m
g, relative activity 30000) was obtained. Next, eluate 40
20 mM sodium citrate buffer containing 0 mM NaCl
The eluted fraction F2 (85
6 ml, protein concentration 0.189 mg / ml, total protein mass
162 mg, relative activity 300000) was collected. next,
The eluate was 20 mM with 1000 mM NaCl.
Elution was performed by changing to sodium acid buffer (pH 5.2)
Fraction F3 (370 ml, protein concentration 0.034 mg / m
1, total protein mass 12.6 mg, relative activity 150000)
Collected. In addition, SP Sepharose Fas
The main TPO active fraction F2 in the t Flow column
(845 ml), and a final concentration of about 10% 1-propano
20 mM citrate containing 400 mM Nacl.
L pre-equilibrated with sodium phosphate buffer (pH 5.4)
A-WGA column (Honen Co., Catalog No. WG-
007; diameter 2 cm, bed height 14 cm)
It was injected and added at a flow rate of 3 ml / min. After the addition is complete
20 mM sodium citrate containing 400 mM Nacl
Buffer solution (pH 5.4) and 1-propanol
Fraction F1 (6:
4.4 ml, protein concentration 0.0178 mg / ml, total protein
White mass 1.15 mg, relative activity 17220) was obtained. Next
The eluate was added to 0.4 M GlcNac, 10% 1-pro
20 mM sodium citrate buffer containing propanol (p
H6.1) and eluted fraction F2 (45 ml, protein
White matter concentration 0.0104 mg / ml, total protein mass 0.47
0 mg, relative activity 675,000) was collected. So L
Main TPO active fraction F2 on A-WGA column
(340 ml) with TFA at a final concentration of about 0.005%
After adding, YMC-Pack CN-AP (YMC
Made, Catalog No. AP-513; Diameter 6 mm, Bed
High 250 mm) column was developed. That is, developing solvent
0.1% TFA in A and 0.05% TFA in developing solvent B
Y equilibrated with 15% B using 1-propanol containing
Flow rate of 0.6 ml on the MC-Pack CN-AP column
/ Min. 15% B to 25% after infusion
The propanol concentration is increased to B, and 25% B to 50
Develop in a linear concentration gradient of 65 minutes up to% B, 1.5 ml
(2.5 min) each collected in polypropylene tube
Was. 0.5 μl each (1/3000 fraction
, HSA is added, concentrated by ultrafiltration, and finally
0.25 ml IMDM assay containing 0.05% HSA
B. As a culture solution, apply this to assay and
Fractions were identified. As a result, tube numbers 24 to 30
(Propanol concentration is in the range of 35.0-42.0%)
Strong TPO activity (relative activity about 630000-4800
000), the TPO active fraction FA (13.5
ml). So, in addition, YMC-Pack CN
-The FA obtained by AP was added to developing solvent A with 0.1% TF.
A, 1-propano containing 0.05% TFA in developing solvent B
-Based Capcell Pak C1 300A
(Made by Shiseido, Catalog No. C1TYPE: SG300
A; diameter 4.6 mm, bed height 150 mm, straight
Connect a pre-column with a diameter of 4.6 mm and a bed height of 35 mm
Developed) column. That is, YMC-Pac
k Part of FA (8.9 ml) obtained by CN-AP was
After adding 0.3 ml of glycerol, centrifuge evaporation
After concentrating by filtration, add about 2.5 ml of 10% solution B.
E, CapcellPak C1 equilibrated with 20% B
 Injection into a 300A column at a flow rate of 0.4 ml / min
Was. After completion of injection, elute with 20% B for 5 minutes, then 20%
Expand from B to 40% B with a linear concentration gradient of 50 minutes, and
ml (2.5 min) each into polypropylene tube
collected. 1 μl each (1/1000 fraction
, HSA is added, concentrated by ultrafiltration, and finally
0.25 ml IMDM assay containing 0.05% HSA
B. As a culture solution, apply this to assay and
Fractions were identified. As a result, tube numbers 20-23
(Propanol concentration range of 28.5-32.5%)
Strong TPO activity (relative activity about 3000000-225
It was possible to obtain a highly active preparation showing 000000). <Example 37> Molecular weight measurement of human TPO expressed in COS1 cells Human full-length TPO expressed in COS1 cells (expression plus
The molecular weight of amide pHTF1 and F1 clone) is sugar chain.
Can be inferred from the size of the peptide chain as a result of the addition of
It was considered to be larger than the molecular weight. So first, C
Human full-length TPO expressed in OS1 cells (expression plasmid
From the culture supernatant containing pHTF1 and F1 clones)
The partially purified TPO fraction was prepared as follows. That is, the exhibition
Opening solvent A (0.1% trifluoroacetic acid (TFA)) and
And developing solvent B (1-propano containing 0.05% TFA
YMC-P pre-equilibrated with 25% B
ack PROTEIN-RP (YMC, Catalog No.
No. A-PRRP-33-46-25; diameter 0.46c
m, bed height 15 cm) column, culture supernatant 0.3 m
1%, and 25% B for 5 minutes at a flow rate of 0.4 ml / min.
After passing through the solution, directly apply the solution from 25% B to 50% B for 50 minutes.
Fractionation was performed with a linear concentration gradient. TPO activity is 34.5% -4
It was eluted in the range of 3.5% 1-propanol and
It was evaporated to dryness by heart evaporation to obtain a partially purified sample. Next
The non-reducing SDS-PAGE gel described in Example 1
After protein extraction from TP, TP was performed using M-07e assay system.
Wester for O activity or as described in Example 45
Analysis revealed that the reduced DPCIII marker
The corresponding molecular weight was measured. As a result, the apparent molecular weight
TPO activity exists in a wide range of about 69000 to 94000
It was possible to confirm the non-uniformity of the molecular weight. And the same as this
In this way, N-Glycanase (Genzyme Inc.
Manufactured by Catalog No. 1472-00).
For the TPO after cutting, DPCIII reduced by treatment
Examining the apparent molecular weight for the marker, 3
6000 to 40,000, which depends on the size of the peptide chain
Still higher than the estimated molecular weight of about 35,000
Was strongly suggested to include O-linked sugar chains.
Was. Similar to these, human full-length expressed in COS1 cells
TPO (expression plasmid pHTP1, P1 clone origin
I also examined the apparent molecular weight of
It was 000-83000. <Example 38> Biological characteristics of human TPO Primarily, the expression plasmid pHTF1 was transfected into COS1 cells.
Culture containing TPO activity obtained by transfection
Human and rat blood system of human TPO using supernatant
The effect on cells was examined. C prepared from human cord blood
D34⁺, DR⁺Colony assay system using cell fraction
When tested with, a significant number of megakaryocytes by human TPO
Colonies formed. For example, the expression plasmid pHT
COS transfected and expressed 1-231
6000 cells under the condition of adding 10% of 1 cell culture supernatant
CD34⁺, DR⁺An average of 11.5 megakaryocytes from cells
Colonies formed. Human peripheral blood from Ficoll-
White blood cell fraction obtained by specific gravity centrifugation using Paque
Remove practicable adherent cells from SBA
AIS cells that have an affinity for (soybean agglutinin)
Using Micro Selector CD34 (Asahi Medical Co., Ltd.)
Removed by the panning method and finally
Panning method using Kuta CD34 (Asahi Medical Co., Ltd.)
At CD34⁺A cell fraction was obtained. Human T
PO (transfection of the expression plasmid pHTF1
The expressed COS1 cell culture supernatant),
After liquid culture for a day, large size GpIIb /
IIIa⁺Selective growth of cells was observed, and this G
pIIb / IIIa⁺In cells, ploidy of the nucleus (ploid
y) was increasing. From this, human TPO
Acts specifically on megakaryocyte progenitor cells to promote their proliferation and differentiation
It was strongly suggested to promote. Minutes from rat bone marrow cells
Separated and purified GpIIb / IIIa⁺Cell fraction, and G
pIIb / IIIa⁺The plaster of the previous stage to obtain the cell fraction
Colony assay system using non-adherent cell fraction
As a result of the assay, human TPO showed a significant number of megakaryocytes.
Ronnie was formed. For example, the expression plasmid pHTF
COS1 cell culture in which 1 was transfected and expressed
100% on the 5th day of culture under the condition of adding 20% of nutrient supernatant.
0 GpIIb / IIIa⁺Average of 34.5 cells
Megakaryocyte colonies and 20,000 plastics
An average of 28.5 megakaryocyte colonies formed from non-adherent cells
Was made. In addition, the plastic non-adherent cell fraction
There are various types of progenitor cells other than karyocytes, but human
Only megakaryocyte colonies were formed by addition of TPO
TPO strongly acts on megakaryocyte progenitor cells specifically
Was suggested. In addition, GpIIb / I derived from rat bone marrow
IIa⁺The cell fraction was converted to human TPO (expression plasmid pHT
COS1 cells transfected and expressed with F1
Liquid culture in the presence of 20% culture supernatant) for 3-5 days
And examined the ploidy of the nucleus,
The ploidy was clearly increased on the 5th day. <Example 39> Glutathione-S-transferase (GST) and histone
To TPO (amino acids 1-174) fusion protein (hereinafter
Below, this fusion protein was labeled as "GST-TPO (1-17
4) ")) E. coli expression vector construction In order to facilitate expression of human TPO in E. coli,
Artificial encoding TPO and containing E. coli preferred codons
The gene was created. This DNA base sequence is E. coli
Amino terminal methionine codon (ATG) for translation initiation
-1 position. 1-12 shown in Table 12
Producing Rigonucleotides and Synthetic Oligonucleotides of 2-11
Reotide 1 with T4 kinase (Pharmacia)
mM ATP, 10 mM Tris-acetate,
10 mM Mg-acetate, 50 mM K-ac
Phosphorylated in a solution of etate. These synthetic orientations
In order to convert the gonucleotide into 6 double-stranded DNAs, 1
And 2; 3 and 4; 5 and 6; 7 and 8; 9 and 10; 1
10 single-stranded DNA combinations of 1 and 12 respectively
mM Tris / HCl (pH 7.5), 10 mM M
gCl₂Annealed in a solution of 50 mM NaCl.
Then three sets of double-stranded DNs 1 and 2; 3 and 4; 5 and 6
A and three sets of 7 and 8; 9 and 10; 11 and 12
T4 ligase (life technology
Manufactured by the company
In this way, T4 ligase was used for the reaction. This ligature
BamHI (boehringer)
-Mannheim) and after digestion with 2% agarose gel
Electrophoresed and fragment about 390-400 bp in size
Collected and purified with a Prep-A-Gene DNA Purification Kit.
It was prepared and digested with XbaI and BamHI to support pUC18.
Cloned (using E. coli DH5α as the host
Used). Among the clones obtained, the clones shown in Table 13 were
Those who code for TPO and contain E. coli preferred codons
Select clones with engineered genes by base sequence analysis
This was designated as pUC18 (XB) (1-123).
The DNA sequence of the coding strand of Table 13 is shown in the sequence listing (SEQ ID NO:
No. 9).

[Table 12]

[Table 13] CDNA from ¹ μg of human normal liver-derived poly (A) ⁺ RNA
The first strand of A was synthesized using an oligo dT primer as a primer, and PCR was performed using 0.1 volume of the cDNA synthesis reaction solution as a template. HTPO-C and h are used as primers.
Using TPO-ko (EcoRI), the reaction was performed in a volume of 100 μl (after 96 ° C. for 2 minutes, 95 ° C. for 1 minute /
30 cycles of 58 ° C. 1 minute / 72 ° C. 1 minute, and 72 ° C. 7 minutes). Human TP obtained by this
2% after digestion of OcDNA fragment with BamHI and EcoRI
Run on an agarose gel, and a fragment of about 600 bp was recovered, purified with a Prep-A-gene DNA purification kit, and digested with EcoRI and BamHI.
Subcloned into UC18 (host is E. coli
DH5α was used). A clone encoding the correct human TPO base sequence is selected by base sequence analysis,
It was designated as pUC18 (BE) (124-332). The sequences of the PCR primers used here are as follows. hTPO-C: 5'-GGAGGAGACCAAGGC
ACAGGA-3 '(pHTF1 clone 329-3
49) hTPO-ko (EcoRI): 5'-CCGGAATT
CTTACCCTTCCTGAGACAGATT-3 '
(An EcoRI sequence was added to the antisense corresponding to 1143-1163 of the pHTF1 clone). pUC18 (BE) (124-332) was digested with BamHI and EcoRI, and then electrophoresed on a 2% agarose gel to recover a C-terminal fragment of human TPO cDNA having a size of about 600 bp to prepare a prep-A-gene DNA purification kit. Purified with E. coli and digested with EcoRI and BamHI
It was subcloned into UC18 (XB) (1-123) (the host used E. coli DH5α). The clone obtained here was cloned into pUC18 (XE) (1-33
2). From Examples in which various deletion constructs on the C-terminal side of human TPO cDNA were prepared and expressed to measure human TPO activity in vitro,
Since it was revealed that human TPO amino acids 1-163 retain human TPO activity, it was decided to construct an expression vector containing this peptide fragment. Here, G
Expression of ST-TPO (1-174) was performed. pHTF
One clone of 681-686 (amino acids 173-17
Since the nucleotide sequence corresponding to 4) is recognized by the restriction enzyme SacI, a stop codon was introduced by two synthetic oligonucleotides utilizing this restriction enzyme recognition site.
Specifically, two synthetic oligonucleotides SSE1,
SSE2 was added to 10 mM Tris / HCl (pH 7.
5), annealed in a solution of 10 mM MgCl ₂ , 50 mM Nacl, and the double-stranded DNA obtained here is treated with S
Human TPO cDNA C digested with acI and EcoRI
PUC18 (XE) (1- except for about 480 bp on the terminal side)
332) using the DNA Ligation Kit (manufactured by Takara Shuzo Co., Ltd.) to prepare clone pUC18 (XS).
(1-174) was obtained (the host was E. col.
i DH5α was used). The sequences of the synthetic oligonucleotides used here are shown in Table 14.

[Table 14] pUC18 (XS) (1-174) was added to XbaI, Eco
After digestion with RI, electrophoresis on 2% agarose gel
A fragment of about 600 bp in size encoding PO amino acids 1-174 was recovered to prepare prep-A-gene D.
Purified with NA purification kit and subcloned into pBluescript IISK ⁺ (manufactured by Stratagene) digested with XbaI and EcoRI (host is E.col).
i DH5α was used). The clone obtained here was designated as pBL (XS) (1-174). Further, in the same manner as above, pBL (XS) (1-174) is replaced with XbaI,
After digestion with HindIII, human TPO amino acids 1-17
A fragment of about 550 bp in size encoding 4 was recovered, purified with Prep-A-Gene DNA Purification Kit, and digested with XbaI, HindIII to pCFM53.
6 (specification Sho 60-501988) (E. coli DH5α was used as the host). The clone obtained here was cloned into pCFM536 / hT (1-17).
4). PGE, a fusion protein expression vector with glutathione-S-transferase (GST)
GST-TP by X-2T (Pharmacia)
To express O (1-174), the following was performed. PCR was performed using pCFM536 / hT (1-174) as a template and two PCR primers GEX1 and CEX3 (after 96 ° C. for 2 minutes, 95 ° C. for 1 minute / 41 ° C. for 1 minute / 72 ° C. for 1 minute). For 22 cycles and 72 ° C. for 7 minutes). The thus obtained fragment encoding human TPO was digested with NaeI and EcoRI and then electrophoresed on a 2% agarose gel to recover a fragment having a size of about 550 bp to prepare prep-A-gene D.
Purified with NA purification kit and cloned into pGEX-2T digested with EcoRI and SmaI (the host was E.co.
Clone pGEX-2T / hT (1-17), which encodes the correct human TPO nucleotide sequence.
4) was selected by analysis of the nucleotide sequence, and this was selected as GST-
It was used as a transformant for expressing TPO (1-174). The sequences of the PCR primers used here are as follows. GEX1: 5'-ATCGCCGGCTCCGCCAG
CTTGTGAC-3 '(added NaeI sequence to 21-39 of SEQ ID NO: 10) GEX3: 5'-GCCGAATTCTCATTAGA
GCTCGTTCAGGT-3 '(5 of SEQ ID NO: 10
23-549 antisense). This expression plasmid also contains a GST protein followed by a thrombin recognition sequence, and human TPO (amino acids 1-17).
4) which contains the sequence encoding. The thrombin recognition sequence and the sequence encoding human TPO (amino acids 1-174) are shown in the sequence listing (SEQ ID NO: 10). <Example 40> Expression of GST-TPO (1-174) in Escherichia coli The transformant obtained in Example 39 was treated with ampicillin 50.
60 ml of LB medium containing μg / ml was cultured by shaking at 37 ° C. overnight, and 25 ml of this culture solution was added to 50 μg / ampicillin.
In addition to 1000 ml of LB medium containing 100 ml, OD is A
Shaking culture was carried out at 37 ° C. until ₆₀₀ reached 0.7-0.8. Then IPT to a final concentration of 0.1 mM
G was added, and the mixture was further cultivated with shaking for 3 hours to give GST-TP.
The expression of O (1-174) was induced. <Example 41> GST derived from clone pGEX-2T / hT (1-174) encoding a human TPO nucleotide sequence expressed in Escherichia coli.
-TPO (1-174) purification and activity confirmation Clone pGEX-2 encoding human TPO nucleotide sequence
GST-TPO (1-17) derived from T / hT (1-174)
4) 10 ml of water was added to 5.9 g of the production recombinant frozen cells to suspend the cells, and the cells were crushed with a high-pressure crusher. GST-TPO (1-174) was recovered in the precipitated fraction by centrifugation, and most of the mixed proteins, bacterial components, etc. were removed. Next, 5 ml of water was added to the recovered precipitation fraction containing GST-TPO (1-174) to suspend it, and then 6 ml of 1M Tris buffer solution pH 8.5 was added with stirring to 10M urea 1
20 ml and 16 ml of water were added. After stirring and solubilizing at room temperature for 5 minutes, the solution was divided into four equal portions, and each of the following (1) to
Four operations of (4) were performed. (1) It was diluted 10-fold with 20 mM Tris buffer pH 8.5. To this, reduced glutathione and oxidized glutathione were added to give final concentrations of 5 mM and 0.5 mM, respectively.
Let stand overnight at 4 ° C. GST in the supernatant by centrifugation
-TPO (1-174) was recovered, diluted 20-fold with 20 mM sodium citrate buffer (pH 5.5), and adjusted to pH 5.5 with acetic acid. SP Seph equilibrated with 20 mM sodium citrate buffer pH 5.5
GST-TPO (1-174) was adsorbed onto a cation exchange column of arose Fast Flow (Pharmacia Biotech, Catalog No. 17-0729-01). 20 mM sodium citrate buffer p
After washing with H5.5, GST-TPO (1-174) was eluted with 20 mM sodium citrate buffer pH 5.5 containing 500 mM sodium chloride. 2.6 ml of 1 M Tris buffer pH 8.
After adding 5 to adjust the pH to 8.1, glutathione sepharose 4B (Pharmacia Biotech, Catalog No. 17-0756-01) was added to the column and GST- was added.
TPO (1-174) was adsorbed. After washing with PBS, 20 mM Tri containing 10 mM reduced glutathione
GST-TPO (1-174) was eluted with s buffer pH 8.5. Thrombin 37 NIH Unit in the eluate
Was added and allowed to stand at room temperature for 4 hours, then diluted 10-fold with PBS, added to a glutathione sepharose 4B column to adsorb the cleaved GST, and TPO (1-1
74) was recovered. The collected non-adsorbed fraction was diluted 3-fold with 20 mM sodium citrate buffer pH 5.5 and equilibrated with the same buffer SP Sepharose Fast F
It was added to a low cation exchange column, and elution was performed in the same buffer solution by a linear concentration gradient method with a sodium chloride concentration of 0 M to 500 mM. (2) All the operations of (1) are 0.1% polysorbate 80.
Done in the presence. (3) Diluted 10 times with 20 mM Tris buffer pH 8.5. To this, reduced glutathione and oxidized glutathione were added to give final concentrations of 5 mM and 0.5 mM, respectively.
Let stand overnight at 4 ° C. GST in the supernatant by centrifugation
-TPO (1-174) was recovered, diluted 20-fold with 20 mM sodium citrate buffer (pH 5.5), and adjusted to pH 5.5 with acetic acid. SP Seph equilibrated with 20 mM sodium citrate buffer pH 5.5
arose Fast Flow G for cation exchange resin
ST-TPO (1-174) was adsorbed. Same resin 2
After washing with 0 mM sodium citrate buffer pH 5.5, GST-TPO using 20 mM sodium citrate buffer pH 5.5 containing 500 mM sodium chloride.
(1-174) was eluted. 1 MTris for eluate
The pH was adjusted to about 8 by adding a buffer solution pH 8.5, and thrombin 320 NIH Unit was added and allowed to stand at room temperature for 4 hours, and then 5 mM with a 20 mM sodium citrate buffer solution pH 5.5.
SP Sepharo that has been diluted twice and equilibrated with the same buffer
se Fast Flow cation exchange column, and sodium chloride concentration 0M to 500m in the same buffer.
Elution was performed by the linear concentration gradient method up to M. (4) All the operations of (3) are 0.1% polysorbate 80.
Done in the presence. SP Sepharo obtained by the operations of (1) to (4)
SE Fast Flow cation exchange chromatography sodium chloride concentration of about 200 mM to 400 mM
Each of the fractions eluted in 1. was sufficiently dialyzed against an IMDM culture solution and evaluated by a rat CFU-MK system. As a result, TPO activity was observed in a volume-dependent manner. As a result of analyzing the same fraction by SDS-PAGE in the presence of a reducing agent, a band having a molecular weight of 19 KDa was detected as one of the main protein bands of this fraction (purity 1-20%). For this band, the SDS-PAG was prepared by the method described in Example 1.
After E, it was transferred to a PVDF membrane and subjected to N-terminal sequence analysis. As a result, this pGEX-2T / hT (1-174)
It was confirmed that it contained the sequence of TPO to be expressed as the derived fusion protein. <Example 42> Amino acid 1 (Ser → Ala), amino acid 3 (Ala →
Human TPO (amino acids 1-163) converted to Val)
Construction of E. coli expression vector pUC18 (XE) (1-33) prepared in Example 39
2) was digested with XbaI and EcoRI and then electrophoresed on a 2% agarose gel to recover a fragment of about 1000 bp encoding human TPO amino acids 1-332 and purified with Prep-A-gene DNA purification kit. , X
pBluescript digested with baI and EcoRI
It was subcloned into IISK + (manufactured by Stratagene) (host used E. coli DH5α).
The clone obtained here was cloned into pBL (XE) (1-33
2). Next, this clone pBL (XE) (1-3
32) from the BamHI recognition sequence of amino acid 163 (36
6-489) was changed to Escherichia coli preferential codon. 13-20 synthetic oligonucleotides shown in the table were made, 13 and 14; 15 and 16; 17 and 18
In the same tube, T4 kinase (Pharmacia) was used to prepare 0.1 mM ATP,
10 mM Tris-acetate, 10 mM Mg
-Acetate, phosphorylated in a solution of 50 mM K-acetate. 1/10 amount of 100 mM
Tris / HCl (pH 7.5), 100 mM MgC
l ₂ , 500 mM NaCl solution was added and 3 in a water bath.
After boiling for 1 minute, it was left to stand to give double-stranded DNA. Next, three sets of double-stranded DNAs of 13 and 14; 15 and 16; PC
The R reaction was performed. PCR product obtained by this
After digestion with amHI and HidIII, electrophoresis was performed on a 2% agarose gel, and a fragment of about 130 bp was recovered using a prep-A-gene DNA purification kit. This is BamHI
And HidIII digested pBL (XE) (1-33
2) was subcloned into E. coli D
H5 was used). Among the obtained clones, one having the nucleotide sequence shown in Table 15 was selected by sequencing, and this was designated as pBL (XH) (1-163).

[Table 15] Furthermore, for the purpose of increasing the expression level of human TPO (amino acids 1-163) and preventing degradation by N-terminal protease, human TPO (amino acids 1-163)
The amino acid at position 1 of Ser is converted to Ser → Ala, and the amino acid at position 3 is converted to Ala → Val.
Mutant human TPO (amino acids 1-163) that encodes Met at the position (hereinafter, such protein is referred to as "h
6T (1-163) ”was constructed to construct an expression vector. Four kinds of synthetic oligonucleotides shown in the table were prepared, and 2-9, 3-3 synthetic oligonucleotides were added to 1 mM ATP, 10 mM Tris-acetate, using T4 kinase (Pharmacia).
10 mM Mg-acetate, 50 mM K-ac
Phosphorylated in a solution of etate. To convert these synthetic oligonucleotides into two double-stranded DNAs, 1-
9 and 2-9; single-stranded DNA in the combination of 3-3 and 4-3, respectively, was added to 10 mM Tris / HCl (pH
7.5), 10 mM MgCl ₂ , 50 mM NaCl
Annealed in the above solution. Then 1-9 and 2-9; 3-
Two sets of double-stranded DNAs, 3 and 4-3, were treated with DNA Liga.
Reaction was performed using a Tion Kit (manufactured by Takara Shuzo). The DNA obtained by this ligation reaction was treated with XbaI,
Subcloning into pBL (XH) (1-163) digested with NruI, and selecting a clone which was correctly replaced by the synthetic oligonucleotide shown in Table 16 by analysis of the nucleotide sequence (E. coli DH5α was used as the host) This was designated as pBL (XH) h6T (1-163).

[Table 16] pBL (XH) h6T (1-163) was added to XbaI, Hi
After digestion with ndIII, mutant human TPO amino acids 1-
A fragment of about 500 bp encoding 163 was recovered, purified with Prep-A-gene DNA purification kit, and digested with XbaI, HindIII to pCFM.
The clone was cloned into E. coli JM109 previously transformed with pMW1 (ATCC No. 39933). The clone obtained here was designated as pCFM536 / h6.
T (1-163), the E. coli strain containing this expression vector was mutated human TPO, that is, h6T (1-16).
3) Used as a transformant for expression. This expression plasmid contains the DNA sequence shown in the sequence listing (SEQ ID NO: 11). <Example 43> Expression of h6T (1-163) in Escherichia coli The expression plasmid pCFM536 is controlled by the λPL promoter, which itself is under the control of the cI857 repressor gene. The transformant obtained in <Example 42> was shake-cultured in 60 ml of LB medium containing 50 μg / ml of ampicillin and 12.5 μg / ml of tetracycline at 30 ° C. overnight, and 25 ml of this culture solution was added with 50 μg / ml of ampicillin. In addition to 1000 ml of LB medium containing OD, OD was 30 until A ₆₀₀ reached 1.0-1.2.
The cells were cultured with shaking at ℃. Then, about 330 ml LB medium at 65 ° C. was added so that the final temperature was 42 ° C., and further 3
The culture was shaken at 42 ° C. for an hour to induce the expression of h6T (1-163). <Example 44> h6 derived from clone pCFM536 / h6T (1-163), which encodes a human TPO nucleotide sequence and was expressed in E. coli.
Purification of T (1-163) and Confirmation of Activity 10 ml of water was added to 3.6 g of the frozen h6T (1-163) producing recombinant frozen cells to suspend the cells, and the cells were crushed with a high-pressure crusher. The precipitate fraction is collected by centrifugation to remove most of the mixed proteins, bacterial components and the like. Recovered h6T (1-
After adding 7 ml of water to the precipitate fraction containing 163) to suspend it, 1M Tris buffer pH 8.5 was added to 3 while stirring.
After adding ml, urea (final concentration 8M), guanidine hydrochloride (final concentration 6M), and N-lauroylsarcosine sodium (final concentration 2%) were added, respectively, and solubilized by stirring at room temperature for 5 to 20 minutes. This is 20 mM Tris buffer pH
After 10-fold dilution with 8.5, the protein was rewound (refolding) overnight at 4 ° C. At this time, in addition to air oxidation, glutathione and copper sulfate were added as additives. H6T was added to the supernatant by centrifugation.
(1-163) was recovered. As a result of analyzing each collected fraction by SDS-PAGE in the presence of a reducing agent, a band having a molecular weight of about 18 K Dalton was detected as a main protein band of this fraction (purity: 30
-40%). According to the method described in Example 1, this band was transferred to a PVDF membrane after SDS-PAGE and subjected to N-terminal sequence analysis. As a result, this pCFM was detected.
It was confirmed that it contained a TPO sequence to be expressed as a mutant TPO derived from 536 / h6T (1-163). Each fraction was thoroughly dialyzed against IMDM culture medium and evaluated by the rat CFU-MK system. As a result, TPO activity was observed in all fractions in a volume-dependent manner. <Example 45> Preparation of anti-TPO peptide antibody and detection of TPO by SDS-PAGE-> Western analysis If an anti-TPO antibody can be prepared, TP can be obtained by an immunological technique.
O protein can be detected. Therefore, among the first amino acid sequence of rat TPO, three regions (shown in Table 17) that were considered to be relatively suitable as antigens were selected, and Tam (Proc. Natl. Aca.
d. Sci. USA, 85, 5409-5413, 19
88), a four-stranded Multiple Ant
As a result of synthesizing igenPeptide (MAP) type peptide and immunizing 2 rabbits each with 100 μg each 8 times, these antisera could be obtained. Amino acid sequence contained in synthetic peptide antigen

[Table 17] Next, of these antisera, first, the anti-RT1 peptide and anti-RT2 peptide antibodies were subjected to a protein A column (PROSEP-A; Bioprocessing).
IgG, manufactured by Ltd., catalog number 8427)
Fractions (2344 mg and 1920 mg, respectively) were obtained, and 54 mg and 32 mg of these fractions were taken, and activated biotin (NHS-LC-Biotin, II, PIER) was obtained.
Biotinylated by coupling with CE, Catalog No. 21336). . Similar to the method described in Example 1, the preparation containing recombinant TPO was treated with SDS-P.
It was subjected to AGE, and then electroblotted onto a PVDF or nitrocellulose membrane, and Western analysis was carried out by using these biotinylated antibodies as primary antibodies according to a standard method. That is, the membrane after blotting is 20 mM
Tris-HCl, 0.5M NaCl (pH 7.5)
After washing with (TBS) for 5 minutes and twice with TBS containing 0.1% Tween 20 (TTBS) for 5 minutes, each was treated with a blocking agent (BlockAce, manufactured by Dainippon Pharmaceutical Co., Ltd., catalog number uk-B25) for 60 minutes. . Then 10 μg / ml
Concentration of biotinylated anti-TPO peptide antibody, 0.05%
The sample was post-treated for 60 minutes with a TTBS solution containing BSA and 10% BlockAce, and then washed twice with TTBS for 5 minutes. Next, alkaline phosphatase labeled avidin (Leinco
Made by Technologies, Catalog No. A10
8) 500 with 10% BlockAce, TTBS solution
After treating with a solution containing a 0-fold diluted solution for 30 minutes, washing with TTBS twice for 5 minutes and washing with TBS for 5 minutes, color development with an alkaline phosphatase substrate (Bio-Rad, Catalog No. 170-6432) Let The above Western analysis was carried out at room temperature. As a result, COS
Not only various recombinant rat TPOs expressed in 1 cell but also various recombinant human TPOs expressed in COS1 cells and E. coli (specifically, the CO 2 described in the above Examples).
The plasmid pHTP1 or human TPO derived from the plasmid pHTF1 expressed in S1 cells and TPO after cleavage of the N-linked sugar chain, GST-TPO (1-
174) and its TPO after thrombin digestion, and h6T (1-163), which is a mutant TPO expressed in E. coli, could also be recognized. Then, it became possible to use for analysis of these various recombinant human TPOs. It was shown that it is possible to prepare an anti-human TPO peptide antibody in the same manner as the above method. With the antibodies obtained by these methods, not only Western analysis but also T using antibody columns
It can be applied to all immunological techniques using antibodies that are usually considered, including purification of PO. In addition, among the amino acid sequences of human TPO shown in SEQ ID NO: 7, six regions (shown in Table 19) that were considered to be relatively suitable as an antigen were selected, and Tam (Proc. Natl. A) was selected.
cad. Sci. USA, 85, 5409-5413,
1988) and a four-stranded Multiple A
Nepten Peptide (MAP) type peptides were synthesized, and 100 μg of each peptide was immunized into 2 rabbits 8 times each. A single-chain peptide in which a cysteine residue was bound to the C-terminal of each peptide region shown in Table 19 was separately synthesized, and the antibody titer was examined using this as a test antigen using an enzyme immunoassay. Since an increase in antibody titer was confirmed also in serum, these were used as antisera.
Since two rabbit antisera were immunized for each antigen peptide, the antibody was prepared separately for each rabbit. Specifically, by distinguishing from each of these derived rabbit individuals, the anti-HT1 peptide antibody
It is called like an anti-HT1-1 peptide antibody or an anti-HT1-2 peptide antibody. The purification of anti-HT1-1 peptide antibody is shown below as an example. First, 30 mg of the single chain peptide of HT1 having a cysteine residue bound thereto was added to 12 ml of Su.
lfoLink coupling gel (Pierce,
Catalog No. 44895). That is, 6 times the gel volume of coupling buffer (50 mM Tr
The peptide solution containing the antigen is coupled to the gel equilibrated with is, 5 mM EDTA-Na pH 8.5) for 15 minutes. Then, after allowing to stand for 30 minutes, the gel is washed with a coupling buffer having a volume three times the volume of the gel.
Next, a coupling buffer containing 0.05 M L-Cystein-HCl is added at a rate of 1 ml / ml gel to block unreacted groups for 15 minutes. Next, after allowing to stand for 30 minutes, the gel is washed with 8 times the gel volume of the coupling buffer. The above coupling was performed at room temperature. In this way, the peptide containing the antigenic region was covalently bound to the gel with a coupling efficiency of 28.3% to give 1 ml.
An antigen peptide antigen column was prepared with 0.8 mg of bound peptide per gel. Next, anti-H after whole blood sampling
Of the 78.4 ml of antiserum containing the T1-1 peptide antibody, 76.7 ml (protein amount of 3620 mg) was preliminarily set to 150 m.
50% M NaCl, 0.05% sodium azide
After adding to the antigen column equilibrated with mM phosphate buffer (pH 8) and further washing with the same buffer, 105.9 ml of the flow-through fraction (protein mass 3680 mg) was obtained. Then 0.1M
The adsorbed fraction was eluted with citrate buffer (pH 3.0) and immediately 21.1 ml of 0.1 M carbonate buffer (pH 9.
9) was added and neutralized, followed by ultrafiltration (YM30 manufactured by Amicon).
Concentrate with a membrane and 11.2 ml (protein mass 77.7 m)
It was possible to obtain a purified anti-HT1-1 peptide antibody in a solution of g) in 50 mM phosphate buffer (pH 8) containing 150 mM NaCl, 0.05% sodium azide. Similarly, an anti-HT1-2 peptide antibody (60.0
mg), an anti-HT2-1 peptide antibody (18.8 mg),
An anti-HT2-2 peptide antibody (8.2 mg) could be obtained. Anti-HT3-6 peptide antibody can be obtained in the same manner. Affinity-purified anti-HT1-1 peptide antibody, anti-HT1-2 peptide antibody, anti-HT2-1
Peptide antibody, anti-HT2-2 peptide antibody 3 each
Take mg to obtain active biotin (NHS-LC-Bioti
n II, PIERCE, Catalog No. 2133
6) Biotinylated by coupling with 6).

[Table 19] Recombinant human T partially purified from the culture supernatant of CHO cells into which the gene encoding the amino acid sequence of
The PO sample was subjected to SDS-PAGE according to a standard method, then electroblotted onto PVDF or a nitrocellulose membrane, and Western analysis was carried out in the same manner as in the case of the above-mentioned anti-RT peptide antibody. It was confirmed that human TPO was recognized and detected. <Example 46> Preparation of anti-TPO peptide antibody column The anti-rat TPO peptide antibody obtained in Example 45 was
Since it was able to recognize rat and human TPO, the immunoglobulin (IgG) fractions of the anti-RT1 peptide antibody and the anti-RT2 peptide antibody were bound to the chromatography carrier as follows, and the anti-TPO peptide antibody column was loaded. It was made. The antibody used as the material was derived from 2 rabbit antisera for each antigen peptide, and the antibody was prepared separately for each rabbit. In brief, anti-RT1 peptide antibody is referred to as anti-RT1-1 peptide antibody and anti-RT1-2 peptide antibody, respectively,
For peptide antibodies, anti-RT2-1 peptide antibody and anti-RT
It is called a 2-2 peptide antibody. Since these were separately prepared as antibody columns, the number of anti-RT1 peptide antibody columns was 2
Species (respectively referred to as anti-RT1-1 antibody column and anti-RT1-2 antibody column), anti-RT2 peptide antibody column includes two species (respectively referred to as anti-RT2-1 antibody column and anti-RT2-2 antibody column), and further anti-RT1 -2 peptide antibody and anti-RT2-1 peptide antibody were mixed and coupled to a gel to prepare 5 kinds of antibody columns (anti-RT1-2 + 2-1 mixed antibody column). 5 mg / ml of each antibody
50 mM Na Ph at a concentration of (2.5 mg / ml in which anti-RT1-2 peptide antibody and anti-RT2-1 peptide antibody were mixed in equal amounts in the anti-RT1 + 2mix antibody column)
osphate, 0.15M NaCl (pH 8.0)
2.31 ml of the swollen formyl-activated gel (Formyl-Cel).
lulofine, manufactured by Chisso Corporation), 4 ° C
And the coupling reaction was carried out for 2 hours. Then 10 mg /
ml reducing agent solution (Trimethylamin
1.1 ml of e borane (TMAB), manufactured by Seikagaku Corporation, catalog number 680246) was added, and after coupling reaction for 6 hours, only the gel portion was recovered by centrifugation. To this, 10 ml of purified water was added, and the operation of collecting only the gel portion by centrifugation was repeated 4 times,
Unreacted antibody was removed. Then 4.6 ml of blocking buffer (0.2 M Na Phosphate, 1
Methanol amine (pH 7.0)) and 1.1 ml of a reducing agent solution were added, and the mixture was treated at 4 ° C. for 2 hours or more to block the active groups of the unreacted gel. Finally, the gel was washed with purified water and DPBS using centrifugation, packed into a small column tube, 3M potassium thiocyanate solution, 0.1M glycine-HCl (pH 2.
5) After washing with the solution, it was re-equilibrated again with DPBS and stored. The anti-RT1-1 antibody column, the anti-RT1-2 antibody column, the anti-RT2-1 antibody column, the anti-RT2-2 antibody column, and the anti-RT1-2 + 2-1 mixed antibody column each have five types of anti-TPO peptide antibody gels. The coupling efficiencies of IgG fractions are 97.4%, 95.4%, 9 in order.
It reached 8.4%, 98.3% and 99.4%. The amount of IgG fraction coupled per gel volume was 5.6 mg / ml gel, 5.8 mg / ml gel,
5.7 mg / ml gel, 5.7 mg / ml gel, 2.9
It was a mg / ml gel. Therefore, it was confirmed that there was no great difference in the coupling efficiency and the coupling amount depending on the origin of the antibody and the difference in the antigen. Therefore, the experiment shown in Example 47 was performed using these antibody columns. <Example 47> Purification of culture supernatant-derived TPO obtained by transfecting expression vector pHTP1 into COS1 cells by anti-TPO antibody column → reverse phase column chromatography-confirmation of biological activity As an in vitro assay method for evaluation, the M-07e assay system was used. A partially purified preparation of TPO derived from the culture supernatant of Example 35 obtained by transfecting COS1 cells with the expression vector pHTP1 (a fraction that is not the main fraction in which TPO was recovered, that is, Macro-Prep Methyl HI).
C column flow-through fraction F1 and F2 followed by 20 mM N
a Citrate, column washed with pH 5.8 and eluted, F3, SP Sepharose Fast Flo
F1 and F3 of the w column were collected together and the TPO subpool fraction (546.379 ml, protein concentration 0.490 mg / m
1, total protein mass 2676 mg, relative activity 12100, relative activity 32380000), ultrafiltration unit (Filtron Omega Ultraset molecular weight 8)
(000 cut), the solvent was first replaced with DPBS, and when the volume became small, an ultrafiltration unit with a YM-10 membrane (manufactured by Amicon) was used to finally obtain 120.
The solution was 2 ml of DPBS containing 0.05% sodium azide. Next, 5 kinds of anti-TPO prepared in Example 46
All the peptide antibody gels were mixed, put together in one antibody column (diameter 1.6 cm, bed height 4.8 cm, referred to as anti-RT1 + 2 mixed antibody column), and flow rate 0.033 at room temperature.
The TPO subpool fraction was added at ml / min. After the addition was completed, the eluate was collected until the UV absorption of the eluate was sufficiently reduced, and further concentrated by an ultrafiltration unit with a YM-10 membrane (manufactured by Amicon) to pass-through fraction F1 (82.6).
2 ml, protein concentration 14.3 mg / ml, total protein mass 1
184 mg, relative activity 67500, relative activity amount 7990
0000) was collected. Next, a column adsorption fraction F2 (92.97 ml, protein concentration 0.12 mg / m) eluted with an acidic eluent (0.1 M glycine-HCl (pH 2.5)) was used.
1, total protein mass 11.1 mg, relative activity 257100,
The relative activity amount 2860000) was eluted. Pass-through fraction F
1 had a considerable amount of TPO activity, but TPO adsorbed on the antibody column showed an increase in relative activity of about 20-fold, and therefore was further purified. That is, developing solvent A
1-propanol containing 0.1% TFA as the developing solvent and 0.05% TFA as the developing solvent B was used for Capcell Pak.
C1 300A (manufactured by Shiseido, catalog number C1 TYP
E: SG300A; diameter 4.6 mm, bed height 15
In addition to 0 mm, a pre-column with a diameter of 4.6 mm and a bed height of 35 mm was connected.) In a column, 1/10 volume of developing solvent B was added to F2 obtained in the antibody column.
Capcell Pak C13 equilibrated with 0% B
It was injected into the 00A column at a flow rate of 0.4 ml / min. After the injection was completed, elution was performed with 20% B for 5 minutes, and then a linear concentration gradient from 20% B to 40% B was developed for 50 minutes to obtain 1 ml.
(2.5 min) each was collected in a polypropylene tube. Take 2 μl (1/500 fraction) of each, add HSA, concentrate by ultrafiltration, and finally 0.02%
A 0.25 ml IMDM assay culture solution containing HSA was prepared and assayed to identify the TPO active fraction. As a result, it was possible to obtain a preparation having a strong TPO activity in tube numbers 20 to 23 (in the range of 28.5 to 32.5% in propanol concentration). Further, when these samples were subjected to Western analysis by the method described in <Example 45>, the apparent molecular weight under reduction was 60000 to 7000 with respect to the DPCIII molecular weight marker.
There is certainly a TPO of 0, apart from this, 32000
It was found that there are also molecules having a molecular weight of ˜43,000 and 20,000 to 30,000. <Example 48> Capsell derived from the culture supernatant obtained by transfecting the expression vector pHTP1 into COS1 cells.
Confirmation of biological activity of TPO purified to the stage of Pak C1 300A column The TPO active fraction purified in Example 36, namely Capc
Tube number 2 for the ell Pak C1300A column
Up to 0-23 (in the range of 28.5-32.5% in propanol concentration) was collected, 0.21 ml of glycerol was added, and then concentrated by centrifugal evaporation. Add 0.21 ml of 6M guanidine hydrochloride solution to this and add 1 with DPBS.
After diluting to ml, Sephadex G25 column (NA
P-10, Pharmacia Biotech, Catalog No. 17-0854-01) was replaced with a DPBS solution containing 0.01% HSA, and 1.1 ml of 0.01% was added.
DPBS containing HSA was added to finally prepare a TPO active fraction FA (2.6 ml). An in vivo assay was performed to examine the biological TPO activity of this preparation. That is, 100 μl of the active fraction (including the relative activity amount of 87400 in the M-07e assay system) was added to 4 male ICR mice (8 weeks old) per group once a day for 5 days.
It was subcutaneously administered every day. As a control, 0.01% HS
100 μl of DPBS containing A was subcutaneously administered on the same schedule. Blood was collected from the fundus immediately before the start of administration and on the day after the end of administration, and a blood cell measuring device (F80 manufactured by Toa Medical Electronics Co., Ltd.
0) was used to measure the platelet count. In the TPO administration group,
After the end of administration, the average increase in platelets was 1.42 times compared to that before administration, and it was 1.23 times higher than the number of platelets in the control group, showing a significant difference (p <0.
05, Student-test). From this result, it became clear that the above human TPO produced in animal cells has a platelet increasing action in vivo. <Example 49> Confirmation of biological activity of crudely purified TPO fraction obtained by cation exchange column using 33 L of culture supernatant obtained by transfecting COS1 cells with expression vector pHTP1 as a starting material (1 ) In- vitro for evaluation of the following purified samples
The ro assay method used was the M-07e assay system.
Serum-free culture supernatant obtained by transfecting COS1 cells with 33 L of the expression vector pHTP1 was obtained in the same manner as in the method described in Example 36 to obtain 0.22 μm.
The filtrate of the m filter was taken. This was concentrated about 10 times with an ultrafiltration unit (PLGC Pellicon cassette, molecular weight cut 10,000, manufactured by Millipore), and p-APMSF, which is a protease inhibitor, was added to a final concentration of about 1 mM, and the volume was 2018 ml (protein concentration 3.22 mg. / M
1, total protein mass 6502 mg, relative activity 66000, relative activity 429100000) were obtained. Next, the concentration process was repeated using an ultrafiltration unit (Filtron, Omega Ultraset, molecular weight cut: 30,000), and a fraction having a molecular weight of 30,000 or more (volume: 1190 ml, protein concentration: 2.54 mg / ml, total protein mass: 3020 mg, relative) Activity 82,500, relative activity amount 249000000), and a fraction having a molecular weight of 30,000 or less (volume 2975 ml, protein concentration 0.471 mg / ml, total protein mass 1402 mg,
A relative activity of 4500 and a relative activity of 6310000) could be obtained. The presence of TPO activity in the fraction having a molecular weight of 30,000 or less indicates that the culture supernatant may contain low-molecular-weight TPO in the process of expression and secretion of TPO in animal cells. Show. On the other hand, molecular weight 30
More than 000 fractions were further replaced with 20 mM sodium citrate buffer (pH 6.1) and pre-equilibrated with 20 mM sodium citrate buffer (pH 6.1) SP S.
epharoseFast Flow (Pharmacia
Biotech, Catalog No. 17-0729-01;
(Diameter: 2.6 cm, bed height: 29 cm), and the mixture was added at a flow rate of 5 ml / min. After the addition was completed, the product was washed and eluted with a 20 mM sodium citrate buffer (pH 6.1). Next, 20 mM sodium citrate buffer solution (pH 6.1) was used as the developing solvent A, and 1M N was added to the developing solvent A.
Using a solution containing aCl as developing solvent B, flow rate 3 ml
A linear concentration gradient of 0% B to 50% B for 215 minutes / min, and 50% B to 100% B for 20 minutes was developed and collected in polypropylene tubes at 30 ml (10 min). Taking a part of these and examining the distribution of activity in the M-07e assay system, T
It was found that the PO activity was eluted. Therefore, the fraction eluted with 50 mM or less of NaCl including the flow-through was
1, 50-1000 mM NaC as the main fraction of TPO
Fractions eluted with 1 were pooled as F2. F1 has a volume of 1951 ml (protein concentration 2.05 mg / ml, total protein mass 3994 mg, relative activity 13500, relative activity 5
39,000,000) and F2 had a volume of 649.8 ml (protein concentration 1.11 mg / ml, total protein mass 721 mg, relative activity 268,000, relative activity amount 193,000,000). (2) SP Sepharose Fast Flow
Confirmation of biological activity of F2 SP Sepharose Fast collected in (1)
Take 2.5 ml of F2 from Flow and use Sephadex
G25 column (NAP-25, manufactured by Pharmacia Biotech, Catalog No. 17-0852-01) was replaced with 3.5 ml of DPBS solution containing 0.01% HSA, and this sample (protein concentration 1.46 mg / ml) in order to investigate the biological TPO activity, in vi
The vo assay was performed. That is, 100 μl of active fraction (M-07e) was added to 4 male ICR mice (8 weeks old) per group.
1 day per day (including 3150 relative activity in assay system)
Subcutaneous administration was performed once every day for 5 days. As a control, 0.01%
100 μl of DPBS containing HSA was subcutaneously administered on the same schedule. Blood collection was performed from the fundus immediately before the start of administration and on the day after the end of administration, and a blood cell measuring device (Famous product manufactured by Toa Medical Electronics, F
800) was used to measure the platelet count. In the TPO-administered group, the average was 1.2 after the administration as compared with before administration.
A 9-fold increase in platelets was observed, which was 1.12-fold higher than that of the control group, indicating a significant difference (p <
0.05, Student t-test).
From this result, the above human TPO produced in animal cells
However, it was revealed that they have a platelet increasing action in vivo. <Example 50> Construction of recombinant expression vector of human TPO chromosomal DNA for CHO cells, pDEF202-ghTPO The vector pDEF202 was digested with restriction enzymes KpnI and SpeI.
The fragment containing the smaller mouse DHFR minigene and SV40 polyadenylation signal was recovered by agarose gel electrophoresis, and the plasmid pEFHG containing this fragment and human TPO chromosomal DNA was recovered.
Vector D in which TE was treated with restriction enzymes KpnI and SpeI to remove the region containing the SV40 polyadenylation signal
NA was ligated with T 4 DNA ligase (Takara Shuzo) to obtain the expression vector pDEF202-ghTPO.
This plasmid contains the replication origin region of SV40, human elongation factor-1-alpha promoter, SV
40 early polyadenyl site, mouse DHFR minigene, replication initiation region of pUC18, β-lactamase gene (Amp ^r ), and human TPO chromosome D downstream of human elongation factor-1-alpha promoter.
NA is connected. <Example 51> Expression of human TPO chromosomal DNA by CHO cells CHO cells (dhfr-strain, Urlaub and Chasi)
n; Proc. Natl. Acad. Sci. USA;
77 vol. 4216, 1980) in a 6 cm diameter plate (manufactured by Falcon) in α minimum essential medium (α-MEM (-), thymidine, hypoxanthine added) containing 10% fetal calf serum, and this is grown. Transformation was performed by the calcium phosphate method (CellPhect, manufactured by Pharmacia). That is, pDEF prepared in Example 50
After adding 120 μl of buffer A and 120 μl of H 2 O to 10 μg of 202-ghTPO plasmid and mixing, the mixture was left at room temperature for 10 minutes. Next, 120 μl of buffer B was added to this solution and mixed again,
It was left for 30 minutes at room temperature. After this DNA solution was dropped on the plate, it was cultured in a CO ₂ incubator for 6 hours. After removing the medium from the plate and washing twice with α-MEM (-), α containing 10% dimethyl sulfoxide was used.
-MEM (-) was added, and the mixture was treated at room temperature for 2 minutes. Then, a non-selective medium containing 10% dialyzed fetal bovine serum (the above α-M
EM (-), hypoxanthine, thymidine added) was added and cultured for 2 days, followed by selection with a selective medium containing 10% dialyzed fetal bovine serum (no α-MEM (-), hypoxanthine, thymidine added). It was For selection, trypsinize the cells and then add 10 cm to each 6 cm-diameter plate.
It was carried out by dividing the medium into 5 plates of diameter or 20 plates of 24 wells and then continuing the culture while exchanging the medium with the selective medium every 2 days. As a result of measuring the human TPO activity in the culture supernatant of the plate or well in which the cells had grown using the Ba / F3 assay, human TPO activity was recognized. In addition, the transformation of CHO cells was performed using pEFHGTE and pMG for CHO cells.
1 for co-transfection
It can also be done by doing. <Example 52> Human TP having Lys at position -1 and Met at position -2
Construction of an E. coli expression vector of O (amino acids 1-163) (hereinafter, this protein is referred to as "hMKT (1-163)"-confirmation of expression / expression) The amino acid sequence of SEQ ID NO: 6 (position 1-163) In order to express a protein in which Lys was added to the -1 position and Met was added to the -2 position, 1-13, 2-13, 3-3 and 4-shown in Table 18 below were prepared in the same manner as in Example 42. HMKT (1-163) expression vector pCFM536 / hMKT (1-16) for E. coli using the synthetic oligonucleotide of 3
3) was constructed.

[Table 18]This expression plasmid is shown in the sequence listing (SEQ ID NO: 12).
Containing the DNA sequence that was created. Furthermore, the same as Example 43
In this way, the expression of hMKT (1-163) was induced.
The expressed protein obtained here was used for PV after SDS-PAGE.
After transferring to a DF membrane, N-terminal amino acid sequence analysis was performed.
As a result, the amino acid of hMKT (1-163) to be expressed
It was confirmed that the sequence was included. <Example 53> A clone encoding a human TPO nucleotide sequence expressed in E. coli.
Lone pCFM536 / h6T (1-163) -derived mutation
Type human TPO, h6T (1-163) guanidine hydrochloride
Refolding with Glutathione and Purification
Confirmation of Physical Activity Recombinant h6T (1-163) Production Prepared in Example 43
Suspended by adding 3 ml of water to 1.2 g of frozen body, high pressure
The cells were crushed with a crusher. Centrifuge to collect the precipitated fraction.
Collect and remove most of the mixed proteins, bacterial components, etc. Times
Water was added to the collected precipitation fraction containing h6T (1-163).
Suspended for a final 4 ml. 1 ml with stirring
20 ml after adding 1M Tris buffer pH 8.5
8M guanidine hydrochloride was added and stirred at room temperature for 5 minutes.
Solubilized. This is 20 mM Tris buffer pH 8.5.
Diluted 10 times with 5mM reduced glutathione and 0.5m
After adding oxidized glutathione of M and stirring to dissolve,
It was allowed to stand overnight at 0 ° C. H6 was added to the supernatant by centrifugation
T (1-163) was recovered. 16 of the obtained supernatant
0 ml of YM10 ultrafiltration membrane (Amicon)
Concentrate and replace the buffer with DPBS to a final volume of 3.4.
ml (protein concentration 2.18 mg / ml). This fraction
Was sufficiently dialyzed against IMDM culture solution, and then rat CFU
-As a result of evaluation by the MK assay system, strong TPO activity
(Relative activity 58000) was shown. Adjust by the above method
Made TPO active fractionin vivoAssay
Was done. 1 group 4 male ICR mice (7 weeks old)
170 μl of the active fraction (rat CFU-MK assay
(Including the relative activity of 22000 in the system) once a day for 5 days
Subcutaneous administration was performed for consecutive days. As a control, a group of 6 animals
170 μl of DPBS subcutaneously on the same schedule
Was administered. Blood collection should be performed immediately before the start of the administration
3 days after completion, it was performed from the fundus and a blood cell measurement device (TOA Medical Electronics
Manufactured by F800). TPO throw
In the given group, on the day after the end of administration, the average compared to before administration
2.15-fold increase in platelets was observed at 3 days after administration
The effect continued even afterwards and was 2.13 times higher.
Maintained. On the day after the end of administration or any day after 3 days
Even so, the platelet count was comparable to that of the control group on each day.
Compared with 1.73 times, 1.80 times high value, between both
Significant difference (p <0.001, Student t-te
st) was recognized. From this result, produced from E. coli,
Human TPO prepared by the above method is
It was revealed that it has a platelet increasing effect. <Example 54> A clone encoding a human TPO nucleotide sequence expressed in E. coli.
Lone pCFM536 / h6T (1-163) -derived mutation
-Type human TPO, h6T (1-163) N-lauroyl
Refolding with sarcosine sodium and copper sulfate
-Purification-Confirmation of biological activity Recombinant production of h6T (1-163) prepared in Example 43
Suspended by adding 3 ml of water to 0.6 g of frozen body, high pressure
After crushing the cells with a crusher, centrifuge to separate the precipitate fraction.
Recovered. The precipitate fraction was suspended by adding 3.1 ml of water.
Then 0.19 ml of 1M Tris buffer pH 9.2, 1
1.25 μl of 1 M DTT, 38 μl of 0.5 MED
TA, 0.38 ml of 10% sodium deoxycholate
Was added with stirring, and the mixture was stirred at room temperature for 40 minutes. Distant
Precipitated fractions were collected by heart separation, and most of the mixed proteins,
The cell components and the like were removed. Suspended by adding 4 ml of water to the precipitate
And then containing h6T (1-163) by centrifugation
The precipitated fraction was collected. 3.8 ml of water was added to the obtained precipitate fraction.
After adding and suspending, while stirring, 0.2 ml of 1 MTr
is buffer pH 8 and 1 ml of 10% N-lauroyl monkey
Add cosin sodium and stir for 20 minutes at room temperature.
Solubilized. To this, add 5 μl of 1% copper sulfate,
Stir overnight (about 20 hours). H6T by centrifugation
After collecting the supernatant fraction containing (1-163), the supernatant 5 m
1 ml of 5 ml water, 10 ml of 20 mM Tris buffer p
After adding H7.7, 2.6 g of Dowex 1-x4
20-50 mesh, chloride form io
Resin was added and stirred for 90 minutes. Glass filter
After collecting the non-adsorption fraction of the ion-exchange resin using
The supernatant was collected by cardiac separation. 20m of the obtained supernatant
SP Sep equilibrated with MTris buffer pH 7.7
harose Fast Flow cation exchange column
NaCl concentration 0M to 500m in the same buffer solution
Elution was performed by the linear concentration gradient method up to M. Elution
Fractions were thoroughly dialyzed against IMDM culture medium, then rat C
As a result of evaluation by the FU-MK assay system, SP Seph
aroseFast Flow cation exchange chromatography
Ruffy was eluted at about 100 mM NaCl concentration
Fractional TPO activity (relative activity about 1900000
0) was shown. This fraction is an ultra free CL fractionated molecule
Volume 5000 ultrafiltration unit (Millipore, model number UF
Concentrated 1.6 times using C4LCC25) (2.5m
1, protein concentration 25 μg / ml). Same fraction in the presence of reducing agent
As a result of SDS-PAGE analysis at
It was detected as the main band (purity 70-80%). the above
TPO active fraction prepared by the methodin v
ivoThe assay was performed. ICR male mau with 4 mice per group
Of the active fraction (rat CFU-
1 including the relative activity amount of 47500 in the MK assay system)
Subcutaneous administration was performed once a day for 5 consecutive days. 100 as a control
20 mM Tris buffer pH 7.7 containing mM NaCl
100 μl was administered subcutaneously on the same schedule. Blood sampling
Should be performed from the fundus immediately before the start of administration and the day after the end of administration.
Blood reduction using a sphere measuring device (F800 made by Toa Medical Electronics)
The number of plates was measured. In the TPO administration group, the
Average 1.73 times more platelets than before administration
1.59 times higher than the number of platelets in the control group
And a significant difference (p <0.01, Stude
nt t-test). From this result, E. coli
The human TPO produced by
It is clear that it has a platelet increasing effect in the body
It was. <Example 55> Large-scale culture of CHO cells In Example 32, human TPO expression plasmid pDEF was used.
Transfection of 202-hTPO-P1 into CHO cells
CHO cell line producing human TPO (CH
O28-30 cells, 25nM MTX resistant) large-scale culture
Was carried out as follows. Cells with 25 nM MTX
And DMEM / F-12 medium containing 10% FCS (G
IBCO) was used to culture and proliferate. This cell
200 μl of the same medium after peeling off using a psin solution
Falcon roller bottle containing (Falcon
1 x 10 to 3000)⁷1 cell at 37 ℃
The culture was carried out for 3 days at a rotation speed of rpm. After 3 days,
Remove by suction and rinse the cell culture surface with 100 ml PBS.
And then containing 25 nM MTX and 10% FCS.
20 DMEM / F-12 medium (GIBCO)
Add 0 ml and incubate at 37 ℃ for 1 day at 1 rpm
7 days later, the culture supernatant was collected and the next purification operation was started.
Made into the material. Perform the above operation for 500 roller bottles
Then, 100 L of culture supernatant was obtained. <Example 56> Purification of human TPO from human TPO producing CHO cell line (1) About 100 L of serum-free culture supernatant was obtained from Example 55.
Then, the filtrate of a 0.22 μm filter was taken. This
This is an ultrafiltration unit (PLTK Pellico manufactured by Millipore)
Cassette and molecular weight of 30,000)
Was replaced with purified water, and a proteolytic enzyme inhibitor p-A
PMSF (manufactured by Wako Pure Chemical Industries, Ltd.) with a final concentration of 1 mM and Pef
Abloc SC (Merck) final concentration 0.35
Addition of mM, volume 3628 ml (protein concentration 1.60 mg
/ Ml, total protein mass 5805 mg, relative activity 12300
00, relative activity amount 7149000000) molecular weight 30
Over 000 fractions were obtained. This fraction is described in Example 45
When analyzed by Western analysis, the molecular weight was 66,000.
The presence of TPO protein in the range of ~ 100,000
It became clear. A closer examination reveals that
Was found to contain lower molecular weight TPO as well.
Was. Separately, ultrafiltrate with a molecular weight of 30,000 or less
Outside filtration unit (Millipore PLGC Pellicon cassette
When concentrated with a molecular weight cut of 10,000)
Product 1901 ml (protein concentration 0.36 mg / ml, total protein
White mass 684mg, relative activity 245500, relative activity amount
169,000,000), the TP has a reduced molecular weight.
It was confirmed that O molecules were generated in the culture process. Next
764 in 3614 ml of a fraction with a molecular weight of 30,000 or more
g ammonium sulphate, and 144.5 ml 0.5M
Add sodium citrate buffer (pH 5.5) and final
1.41M ammonium sulphate, 17.7 mM querce
Make 4089 ml of solution containing sodium phosphate buffer,
The resulting insoluble matter was centrifuged to obtain a soluble matter. This is 1.2
20 mM sodium citrate containing M ammonium sulfate
Macr previously equilibrated with a buffer solution (pH 5.5)
o-Prep Methyl HIC column (Bio-
Rad, Catalog No. 156-0080; Diameter 5c
m, bed height 24.5 cm), flow rate approx. 25 ml / m
added in. 1.2M ammonium sulfate after addition
20 mM sodium citrate buffer (pH 5.
What was eluted in 5) is the ultrafiltration unit (filtro
Omega Ultra set molecular weight 8000
Concentrate with F) and pass through F1 (4455 ml, protein)
Concentration 0.400 mg / ml, total protein mass 1780 mg,
Relative activity 1831000) was obtained. Then, eluate 20
Elution after changing to Na Na Citrate, pH 6.0
Ultrafiltration unit (made by Filtron Co., Ltd.
Concentrate with Mega Ultra Set (molecular weight cut to 8000)
Fraction F2 (1457 ml, protein concentration 0.969 m
g / ml, total protein mass 1411 mg, relative activity 171
5000) was collected. This S by SDS-PAGE
2 has a protein with a molecular weight of 66,000 to 100,000
It was confirmed to do. Furthermore, according to Western analysis
It was revealed that this protein is TPO.
Next, Macro-Prep Methyl HIC
Rum F2 (1443 ml) was added to 20 mM sodium citrate
SP S pre-equilibrated with Lithium buffer (pH 6.0)
epharose Fast Flow (Pharmacia
 Biotech, catalog number 17-0729-0
1; diameter 5 cm, bed height 12 cm)
And added at a flow rate of 15 ml / min. After the addition is complete
20 mM sodium citrate containing 50 mM NaCl
Combine up to that eluted with Um buffer (pH 6.0)
Fraction F1 (3007 ml, protein concentration 0.226)
mg / ml, total protein mass 679 mg, relative activity 888
30) was obtained. Next, the eluate was added with 750 mM NaCl.
20 mM sodium citrate buffer (pH 5.4) containing
The eluted fraction F2 (931 ml, protein concentration)
0.763mg / ml, total protein mass 710mg, relative activity
Sex 5558000). This is an ultrafiltration unit
(Filtron's Omega Ultraset molecular weight 8
000 cut, 202m with Amicon YM3 film)
It was concentrated to 1. Next, SP Sepharose F
Concentrated liquid of TPO active fraction F2 on ast Flow column
(197 ml) with Sephacryl S-200HR
Column (Pharmacia Biotech, catalog number
17-0584-05; diameter 7.5 cm, bed height
100 cm) and gel filtration at a flow rate of 3 ml / min
Was done. Eluent volume 1200-1785 ml, 178
5 to 2010 ml, 2010 to 2280 ml, 2280
Collect up to 3000 ml of each range and collect fractions F1
(585 ml, protein concentration 1.00 mg / ml, total protein
Mass 589 mg, relative activity 411800), fraction F2
(225 ml, protein concentration 0.263 / ml, total protein
Amount 59.2 mg, relative activity 2509000), fraction F3
(270 ml, protein concentration 0.119 / ml, total protein
Mass 32.1 mg, relative activity 2535000), fraction
F4 (720 ml, protein concentration 0.0467 / ml,
 Total protein mass 33.6 mg, relative activity 1155000)
Got In this way, the fractionated TPO activity was determined by gel filtration.
Since it was found that the molecular weight range by the method is wide, SDS-
After PAGE, Western analysis was performed,
Most of the TP has a molecular weight of 66,000 to 100,000
While it was O, the molecular weight was 3 for F2 and F3, respectively.
2,000-60,000, molecular weight 32,000-42,000
Were present. TP of any molecular weight
All O molecules also had TPO activity. The molecular weight is 6
N-terminal end for 6000 to 100,000 TPO molecules
When the mino acid sequence analysis was performed,
Confirmed to contain the amino acid sequence of the encoded protein
I was able to recognize it. In addition, T having a molecular weight of 66,000 to 100,000
Regarding PO molecules, N-glycanase (N-glyca)
nase: Genzyme, catalog number 147
2-00), neuraminidase (Neuraminid
ase: manufactured by Nacalai Tesque, catalog number 242-
29 SP), endo-α-N-acetylgalactosami.
Nidase (Endo-α-N-acetylgalac
tosaminidase: manufactured by Seikagaku Corporation, catalog number
No. 100453), and O-glycosidase (OG)
lycosidase: Boehringer Ma
Manufactured by nnheimBiochemica, catalog number
1347101) glycan cleaving enzyme alone or in combination
Enzyme digestion experiment was conducted together with SDS-PAGE
Around the time, the polypeptide part of TPO was estimated from theoretical values.
It has a molecular weight of about 36,000 and is N-linked and O-linked.
It was found to be a glycoprotein having both sugar chains. <Example 57> Purification of human TPO from human TPO-producing CHO cell line (1) CHO cell blood-free obtained in the same manner as in Example 55
Add 211.4 g of ammonium sulfate to 1 L of the clear culture supernatant.
Yes, 0.2 μm filter (Gelman Science
CE company, catalog number 12992)
1.2M ammonium sulfate, 20 mM sodium acetate
Macro- equilibrated with buffer (pH 5.6)
Prep Methyl HIC column (Bio-Ra
D company, catalog number 156-00811, diameter 50m
m, bed height 90 mm) at a flow rate of 15 ml / min.
did. After the addition was completed, 20 mM sodium acetate buffer (p
H5.6) was eluted with 450 ml. This eluate is Vyd
ac Reversed-phase C4 column (The Separations
 Group, Catalog No. 214BTP54, straight
(Diameter 4.6 mm, bed height 250 mm), flow velocity 0.75 m
It was added at 1 / min. 15% after addition is complete, 5%
10 mM Tris buffer (pH 6.4) containing nol
After washing with the open solvent A), relax 10 mM Tris from the developing solvent A.
94% ethanol containing buffer (pH 6.4) (developing solvent
B) was eluted with a linear gradient of 66 minutes. this
The chromatogram is shown in FIG. It seems to be TPO
Molecules with a molecular mass of approximately 65,000-100,000 are SDS-P
As a result of analysis by AGE, retention time after sample addition 6
A single band can be obtained in the fraction around 8-72 minutes.
Was confirmed (see FIG. 16). More waste
Turn analysis reveals that this protein is TPO
It was confirmed. Take a portion of this sample and
As a result of acid analysis, it is encoded by the human TPO gene
It was confirmed that the amino acid sequence of the protein was included. <Example 58> Preparation of recombinant virus for expression of human TPO in insect cells pHTP1 prepared in Example 30 was a restriction enzyme EcoRI.
In addition, after digestion with NotI, 1% agarose gel electrophoresis
And band about 1200 bp prep-A-gene
After purification using a DNA purification kit, the same restriction enzymes were used.
The treated transfer vector pVL1393 (in
Competent high E. co
li DH5 (manufactured by Toyobo Co., Ltd.) was transformed. Obtained
Plasmid DNA from the colonies
A clone pVL containing the entire coding region of cDNA
1393 / hTPO was obtained. The plasmid of this clone
Molecular Cloning (Sam)
Brook et al., Cold Spring Harbor
Laboratory Press, 1989).
Prepare BaculoGold as described
^TM Transfection Kit (Farmin
Insect cell Sf21 (Invitroge)
Sf-900 medium after transfection
Cultivated in (Life Technology) at 27 ℃ for 4 days
Then, the supernatant containing the virus was recovered. This supernatant
10⁹-10⁵Dilute twice and use 1 ml of the
About 7 × 10 in mm Petri dish⁵To individual Sf21 cells
Infection was carried out at 27 ° C for 1 hour. Remove the supernatant Sf-90
Pour in 1% agarose containing 0 medium and let the agarose solidify.
After cooling, it was cultured at 27 ° C. for 6 days under humidification. Shape here
Picked up the formed single plaque, 200μ
The virus was eluted in 1 of Sf-900 medium. this
Virus clones were cloned into Sf21 cells in 24-well plates.
The cells were infected and the virus was amplified. Obtained thing
Phenol / black
After loform treatment, ethanol precipitation was performed to obtain viral DNA.
Recovered. Human TPO using this viral DNA as a template
PCR is carried out using primers specific to the cDNA,
Human T depends on whether or not a specific DNA fragment is amplified.
Recombinant virus containing POcDNA was selected. here
Recombinant virus containing human TPO cDNA obtained in
Sf21 cells were infected with the supernatant containing
Ailus was amplified. <Example 59> Expression and activity confirmation of human TPO in Sf21 insect cells 175 cm²Approximately 8 Sf21 cells in the culture flask of
Cultivate to 0% confluence and produce in Example 58.
2 recombinant virus containing human TPO cDNA
After infecting at 7 ° C for 1 hour, 27 in Sf-900 medium
After culturing at 4 ° C for 4 days, the supernatant was recovered. The resulting culture
Supernatant to NAP^TMFor -5 columns (Pharmacia)
And replaced with IMDM culture solution, which was used for rat CFU-M
K assay system and M-07e assay system
, TPO activity and M-07e cells which were significant in a dose-dependent manner
Growth-promoting activity was observed. Also described in Example 45
The same Western analysis as described above was performed on Sf21 cells.
The revealed recombinant human TPO was confirmed. <Example 60> A clone encoding a human TPO nucleotide sequence expressed in Escherichia coli.
Lone pCFM536 / h6T (1-163) -derived mutation
-Type human TPO, h6T (1-163) N-lauroyl
Refolding with sarcosine sodium and copper sulfate
Method and refolding-purification h6T (1-163) production recombinant prepared in Example 43
Suspended by adding 300 ml of water to 30 g of frozen body,
Crusher (10000 psi, Rannie High
Destroy the cells with the Pressure Laboratory)
After crushing, the precipitate fraction was collected by centrifugation. Precipitation
90 ml of water was added to the suspension to suspend, and while stirring,
After adding water to make the volume 150 ml, 9 ml 1 MT
ris buffer pH 9.2, 540 μl of 1 MDTT,
1.8 ml 0.5 M EDTA, 18 ml 10% deo
Add sodium xycholate with stirring and at room temperature
Stir for 30 minutes. Collect the precipitate fraction by centrifugation,
Most of the mixed proteins and bacterial components were removed. 1 for precipitation
After suspending by adding 80 ml of 5 mM DTT, centrifuge
The precipitate fraction containing h6T (1-163) was collected by separation.
did. 300 ml of water was added to the obtained precipitate fraction to suspend it,
Water was further added with stirring to adjust the liquid volume to 570 ml.
Then, with stirring, 30 ml of 1M Tris buffer pH 8
And 150 ml of 10% N-lauroyl sarcosine natri
Um was added and solubilized by stirring for 20 minutes at room temperature. This
Add 750 μl of 1% copper sulfate to it and stir at room temperature overnight (approx.
Stir for 20 hours. Centrifuge to h6T (1-16
After collecting the supernatant fraction containing 3),
50 ml water, 1500 ml 20 mM Tris buffer
After adding pH 7.7, stir 3 ml of polysorbate while stirring.
Tooth 80 (Nikko Chemicals) was added. 600 in the same solution
g Dowex 1-x4, 20-50 mesh, ch
Add the loride form ion exchange resin to room temperature.
And stirred for 90 minutes. Ions using a glass filter
After collecting the fraction not adsorbed on the exchange resin, 750 ml of 20 m
Wash the ion exchange resin with MTris buffer pH 7.7
Was. Ion exchange resin non-adsorbed fraction and washing solution
2N sodium hydroxide was added to adjust the pH to 9.2,
20 mM Tris buffer containing 0.1% polysorbate 80
Q Sepharose equilibrated at pH 9.2
Fast Flow anion exchange column (inner diameter 5 cm
x 10 cm) and the non-adsorbed fraction was collected. hydrochloric acid
Was used to adjust the pH of the non-adsorbed fraction obtained to 7.2
20 mM Tris buffer containing 0.1% polysorbate 80
SP Sepharose equilibrated with buffer pH 7.2
 Fast Flow cation exchange column (inner diameter 5 cm
 x 10 cm) and add sodium chloride in the same buffer.
The linear concentration gradient method from 0M to 500 mM
Elution was performed. About eluate SDS-PAGE
Therefore, analysis was performed and the TPO elution fractions were collected. TPO melt
Trifluoroacetic acid was added to the fractions to a concentration of 0.1%,
Capsule pack 5 μm 300A C1 column (inner diameter 2.
1 cm x 5 cm x 2 pieces, added to Shiseido)
Then, 1-propanol concentrated in 0.1% trifluoroacetic acid.
Reversed phase HPL by linear gradient elution
C was performed. SD in the absence of reducing agent
Results by S-PAGE and by reverse phase HPLC
Fractionation into 3 fractions was performed according to the elution position, and 0.
After 3-fold dilution with 1% trifluoroacetic acid,
Add to a reversed-phase HPLC column and re-chromatography in the same way.
A graph was taken. The obtained TPO3 fraction was subjected to reverse phase H
Fr. Sa, Fr. Sb, Fr.
SDS in the absence of reducing agent as S-c (see FIG. 17)
-As a result of PAGE analysis, the molecular weight was 18K darts, respectively.
(Fr.S-a), 19K Dalton (Fr.S-a)
b), a single bar near 18K Dalton (Fr.S-c).
Band was detected (see FIG. 18). About each
As a result of amino acid composition analysis, the amino acid composition obtained was
It almost agrees with the theoretical value from the sequence information, and it is N-terminal.
The end amino acid sequence analysis yielded only the expected sequence.
It was In addition, the protein of each fraction obtained from the results of amino acid analysis
White mass is 0.64 mg (Fr.S-a) 1.8, respectively.
1 mg (Fr.S-b), 3.49 mg (Fr.S-
It was c). Add each fraction to IMDM culture
After dialysis, M-07e assay was performed and the relative activity was about
1620000 (Fr.S-a), relative activity about 2350
0000 (Fr.S-b), relative activity about 7460000
00 (Fr.S-c) showed TPO activity. <Example 61> A clone encoding a human TPO nucleotide sequence expressed in Escherichia coli.
Lone pCFM536 / h6T (1-163) -derived mutation
Type human TPO, h6T (1-163) guanidine hydrochloride
And refolding with cysteine-cystine ~
Purification h6T (1-163) production recombinant prepared in Example 43
Suspended by adding 500 ml of water to 50 g of frozen body,
Crusher (10000 psi, Rannie High
Destroy the cells with the Pressure Laboratory)
After crushing, the precipitate fraction was collected by centrifugation. Precipitation
Add water to the suspension to suspend, and add water with stirring.
After adjusting the volume to 250 ml, add 15 ml of 1M Tris buffer.
Buffer pH 9.2, 900 μl 1MDTT, 3 ml
0.5 MEDTA, 30 ml of 10% deoxycholic acid
Add sodium with stirring and stir at room temperature for 30 minutes
did. The precipitate fraction was collected by centrifugation, and most of the mixture was mixed.
Proteins, cell components, etc. were removed. 300 ml of 5 for precipitation
After adding mMDTT and suspending, centrifuge
The precipitated fraction containing 6T (1-163) was collected. Recovered
Water was added to the precipitated fraction containing h6T (1-163)
Suspended to a final volume of 104 ml. 20m while stirring
376 after adding 1 1M Tris buffer pH 8.5
Add 8 ml guanidine hydrochloride and stir at room temperature for 10 minutes.
It was solubilized by stirring. 2500 ml with stirring
20 mM Tris buffer containing 0.1% polysorbate 80
Add a pH of 8.5 and add 1M guanidine hydrochloride.
Add 2000 ml of 20 mM Tris buffer pH 8.5.
Then, add 5 mM cysteine and 0.5 mM cystine
And stirred to dissolve. After standing overnight at 4 ° C, centrifuge
H6T (1-163) was recovered in the supernatant by separation.
Prep scale UF cartridge PL
Concentrated using a DC ultrafiltration membrane (Millipore), 0.1%
20 mM Tris buffer pH containing polysorbate 80
Replaced the buffer at 9.2 with a final volume of approximately 1000 mL.
did. 20m containing 0.1% polysorbate 80
Q Seph equilibrated with MTris buffer pH 9.2
arose Fast Flow anion exchange column
(Inner diameter 5 cm x 10 cm) and added in the same buffer
Linear concentration of sodium chloride from 0M to 500mM
Elution was carried out by the gradient method, and the sodium chloride concentration was 20
Fractions eluted at salt concentrations from mM to around 150 mM
240 mL was collected. The obtained fraction was added to 20 mM Tri
s-buffer pH 7.2 to 4-fold dilution to 960 mL,
The pH was adjusted to 7.2 with acetic acid. 0.1%
20 mM Tris buffer pH containing polysorbate 80
SP Sepharose Fas equilibrated with 7.2
t Flow cation exchange column (inner diameter 5 cm x 1
0 cm) and sodium chloride concentration 0 in the same buffer.
Elution by linear gradient method from M to 500 mM
I did. The eluate was separated by SDS-PAGE.
Analysis was performed and TPO elution fractions were collected. In the TPO elution fraction
Add trifluoroacetic acid to 0.1% and add capsules.
Pack 5μm 300A C1 column (inner diameter 2.1cm
x 5 cm x 2 bottles, Shiseido)
Increase the 1-propanol concentration in% trifluoroacetic acid.
Reversed-phase HPLC is performed by linear gradient elution method
Was. Eluent SDS-PAGE in the absence of reducing agent
According to the results of analysis by
It fractionated into 2 fractions. Reverse the obtained two fractions eluted with TPO
Fr. G-a, Fr. G-d (Figure
SD) in the absence of a reducing agent for each
As a result of S-PAGE analysis, the molecular weight was 18 Kdal, respectively.
Tons (Fr.G-a), 32K Daltons (Fr.G-a)
It was detected as a single band around d) (see Fig. 18).
See). In addition, SDS-PAGE analysis in the presence of a reducing agent
As a result, both fractions had a molecular weight of around 20K Dalton.
Was detected as a single band. Amino about each
As a result of acid composition analysis, the amino acid composition obtained was
It almost agrees with the theoretical value from the sequence information, and the N-terminal
Mino acid sequence analysis yielded only the expected sequence.
Was. In addition, the protein of each fraction obtained from the results of amino acid analysis
The mass is 2.56 mg (Fr.G-a) and 1.1, respectively.
It was 6 mg (Fr.G-d). IMDM culture of each fraction
After sufficient dialysis against the nutrient solution, perform M-07e assay
As a result, the relative activity was about 3960000 (Fr.G-a),
Relative activity about 760,000 (Fr. Gd) TPO activity
Showed sex. <Example 62> Partial length human TPO (amino acids 1-163) (hereinafter
The protein is called "hTPO163") CHO cell
For recombinant vector pDEF202-hTPO163
Construction Restriction of the vector pDEF202 obtained in Example 31
Treated with elementary EcoRI and SpeI, and agarose gel electro
The larger vector fragment was recovered by electrophoresis
Then, this fragment and the amino acids at positions -21 to 163
HTPO163 cDNAs encoding
Plasmid pEF18S-h containing SEQ ID NO: 13)
Treatment of TPO 163 with restriction enzymes EcoRI and speI
The obtained hTPO163 cDNA and T4D
Expression vector p is ligated with NA ligase (Takara Shuzo)
DEF202-hTPO 163 was obtained. This plasm
Is the replication origin region of SV40, human elongation
Actor 1-alpha promoter, SV40 early poly
Adenylation site, mouse DHFR minigene, pUC18
Replication origin region of β-lactamase gene (Amp^r)
Including human elongation factor 1-alpha
HTPO163 cDNA was connected downstream of the promoter.
Have been. <Example 63> Expression of hTPO163 by CHO cells CHO cells (dhfr- strain, Urlaub and Chasi).
n; Proc. Natl. Acad. Sci. USA;
Vol. 77, p. 4216, 1980) 6 cm diameter plate
(Falcon) α minimum containing 10% fetal calf serum
Essential medium (α-MEM (-), thymidine, hypoxanthine
Cultivated and proliferated by the transfectam method.
(Manufactured by Seikagaku Corporation). That is,
PDEF202-hTPO 16 prepared in Example 62
240 μl of 0.3M NaCl in 10 μg of 3 plasmids
After adding and mixing, 20 μl of transfectam and H
₂A mixed solution with 220 μl of O was added and mixed again. this
After dropping the DNA solution onto the plate, CO₂Incu
Cultured in beta for 6 hours. Remove medium from plate
And washed twice with α-MEM (-), 10% dimethyl
Sulfoxide-containing α-MEM (-) was added, and room temperature was added.
For 2 minutes. Next, containing 10% dialyzed fetal bovine serum
Non-selective medium (alpha-MEM (-), hypoxanthine,
After culturing for 2 days after adding thymidine), 10%
Selective medium containing dialyzed fetal bovine serum (α-MEM (-), hypo
Xanthine and thymidine were not added).
For selection, trypsinize the cells and then plate 6 cm in diameter.
5 pieces of 10 cm diameter plate or 24 pieces per piece
After splitting into 20 L-plates, select every 2 days
By continuing the culture while exchanging the medium at the site,
gave. On the plate or well where the cells have grown
Therefore, the TPO activity in the culture supernatant was measured by Ba / F3 assay.
TPO activity was observed when measured using the Sei method.
Was. About TPO activity in the culture supernatant
Add 25 nM Methotre to new plate or well
Divide the cells 1:15 in selective medium containing xetate and culture.
Cells resistant to methotrexate by continued feeding
Were grown and cloned. In addition, CHO cells
Of pEF18S-hTPO to CHO cells
163 and pMG1 were co-transformed (co-transf
section).
Shaped by the plasmid pDEF202-hTPO163
Transformed CHO cell line (CHO-DUKXB11)
Is Ministry of International Trade and Industry, Agency of Industrial Science and Technology, as of January 31, 1995
Contract No. FERM BP-498 to Institute of Engineering and Technology
Deposited as 9. <Example 64> Large-scale culture of CHO cells In Example 63, hTPO163 expression plasmid pD was used.
Transfer EF202-hTPO163 to CHO cells
HTPO163-producing CHO cells obtained by
Mass cultivation of strains (CHO109 cells, OnM MTX resistance)
The feeding was carried out as follows. Cells with 10% FCS
Use DMEM / F-12 medium containing (GIBCO)
The cells were grown in culture. Use these cells with trypsin solution
After peeling off, Falco containing 200 ml of the same medium
n roller bottles (Falcon 3000)
Inoculate million cells and rotate at 1 rpm at 37 ℃
The cells were cultured for 3 days. After 3 days, the culture solution was removed by suction, and 10
After rinsing the cell culture surface with 0 ml of PBS, 10
DMEM / F-12 medium containing no FCS (GIB
CO Co., Ltd.) (200 ml) and added at 37 ° C, 1 rpm
Incubate for 7 days at inversion speed, and after 7 days, collect the culture supernatant,
It was used as the starting material for the next purification operation. Roll the above operation
Perform 300 bottles to obtain 60 L of serum-free culture supernatant
Was. <Example 65> hTPO163 was produced from an hTPO163 producing CHO cell line.
Purification (1) 60 L of serum-free culture supernatant obtained from Example 64
Then, the filtrate of a 0.22 μm filter was taken.
Furthermore, ultrafiltration unit (Molecular weight 1 manufactured by Filtron)
Concentrated fraction (600 ml, protein
Quality concentration 11.2 mg / ml, total protein mass 6430 mg)
Got This fraction was diluted with anti-HT1 peptide antibody.
Apparent molecular weight of 2000 when examined by stern analysis
HTPO163 protein expressed in the range of 0 to 26000
It became clear that quality exists. This concentrated culture supernatant
573 ml at a flow rate of about 20 ml / min and 10 mM solution
Pre-equilibrate with sodium phosphate buffer (pH 6.8)
Sephadex G-25 Fine column
(Pharmacia Biotech, Catalog No. 17-
0032-02; diameter 10 cm, bed height 30 cm)
Treated with 10 mM sodium phosphate buffer
Solution (pH 6.8) solution of protein fraction F1 (938
ml, protein concentration 4.9 mg / ml, total protein mass 45
94 mg) was obtained. This Sephadex G-25
Fine column protein fraction 929 ml in advance to 10 mM
SP equilibrated with sodium phosphate buffer (pH 6.8)
 Sepharose Fast Flow
Cia Biotech, Catalog No. 17-0729-
01; diameter 5 cm, bed height 12 cm)
It was added at 15 ml / min. 10 more after the addition is complete
mM sodium phosphate buffer (pH 6.8), then 1
10 mM sodium phosphate buffer containing 0% ethanol
Collect up to that eluted at (pH 6.8) and collect in fraction F
1 (1608 ml, protein concentration 2.13 mg / ml, total
A protein mass of 3426 mg) was obtained. Next, eluate 10m
750 mM N in M sodium phosphate (pH 6.8)
Change to a buffer containing aCl and 25% ethanol and elute.
The main elution fraction of hTPO163 F2 (651 m
1, protein concentration 1.67 mg / ml. Total protein mass 108
7 mg) was collected. SP Sepharose Fas
200 out of TPO active fraction F2 of t Flow column
Take ml and add ethanol and purified water to the final ethanol.
A 300 ml solution having a concentration of 45% was prepared. Here
The insoluble matter resulting from the addition of tanol was removed by centrifugation.
After removal, developing solvent A (10 mM sodium acetate buffer
(PH 6.7)), developing solvent B (containing 90% ethanol)
10 mM sodium acetate buffer (pH 6.7))
By the way, SOURCE15 pre-equilibrated with 50% solution B
RPC column (Pharmacia Biotech, Catalo
No. 17-0727-02; diameter 2 cm, bed height 2
0 cm) at a flow rate of 2 ml / min. After injection,
Wash with 45% solution B until rum non-adsorbed substance is almost eluted
After that, set the flow rate to 1.5 ml / min, and first 5 minutes for 5 minutes.
0% B, then 50% B to 100% B in 140 minutes
After a linear concentration gradient, develop with 100% solution B for 35 minutes
Was. Elution fractions collected every 5 minutes (7.5 ml) during this time
Minutes were subjected to SDS-PAGE and Western analysis, h
When the elution range of TPO163 was examined, ethanol concentration
Apparent molecular weight in the range of 66% to 87% of about 20,000
To 26000 highly purified hTPO163
It turned out to have been issued. These hTPO163
The higher the molecular weight of the
As a result, hTPO16 with more sugar chains attached
It was suggested that the hydrophilicity was increased by about 3 molecules. SO
HTPO163 elution fraction of RUCE 15RPC column
(Elution in the ethanol concentration range of 68% to 86.5%
out of 90 ml of hTPO163 fraction) to 88.8 ml
After adding CHAPS, ultrafiltration (YM, manufactured by Amicon)
-3 Concentrate and wash with ultrafiltration unit with membrane)
Finally, it contains about 5% ethanol and 4 mM CHAPS.
A 2.5 ml concentrated preparation was prepared. This standard is 10% in advance
10 mM sodium phosphate buffer containing ethanol (p
H6.8) equilibrated with Superdex 75 pg
Column (Pharmacia Biotech, catalog number
17-1070-01; diameter 2.6 cm, bed height 60
cm) at a flow rate of 1.5 ml / min. 6 after injection
After 0 minutes, the elution fraction was collected every 6 ml (4 minutes).
About SDS-PAGE
The fraction started to elute hTPO163, and at least 31
HTPO163 is eluting in a wide range up to
And confirmed. This is a standard molecular weight marker for gel filtration
(Gel Filtration manufactured by Bio-Rad)
Standard; Catalog No. 151-1901 and
Calbiochem Insulin; Catalog No.
A mixture of 407696) and a molecular weight of about 44,000.
To 6000. Moreover, these hTPs
O163 has a large molecular weight with more sugar added
It was considered that the compounds were eluted in this order. Test tube number 16-
In the elution range of 31 (elution volume 180-276 ml)
As a summary of all hTPO163 molecular species
Fraction FA was prepared. Separate from fraction FA, test tube number 1
6-18 (elution volume 180-198 ml), test tube number
19-24 (elution volume 198-234 ml), test tube number
No. 25-31 (elution volume 234-276 ml)
A portion was taken and made into fractions FH, FM, and FL, respectively. One
Mari Fraction FA is essentially a combination of Fractions FH, FM and FL.
It will be set. The above is shown in FIG. (2) Next, Superdex 75 pg described in (1)
 Column hTPO163 elution fractions FH, FM, FL and
And FA will be described in detail. Obtained in this way
The amino acid sequence on the N-terminal side of hTPO163 is shown in Example 1.
When examined in the same manner as described above, N-terminal serine
Most of the
It was strongly suggested that the O-linked sugar chain was added to
Was. Also, the sequence following the N-terminal serine is derived from the gene sequence.
It was confirmed that the amino acid sequence was expected. Ami
Acid composition analysis (AccQ.Tag method, Waters)
Results, hHPO163 protein of FH, FM, FL and FA
The quality (the peptide part that does not contain sugar chains) has a concentration of 1 each
0.2 ng / ml, 6.2 ng / ml, 0.84 ng /
ml was 3.2 ng / ml. These fractions 100
ng is multi gel 15/25 (Daiichi Pure Chemicals Co. 15-
25% precast polyacrylamide gel)
After reduction under non-reducing conditions or DTT, SDS-PAG
After carrying out E and dyeing with silver (manufactured by Daiichi Pure Chemicals Co., Ltd.),
Each is an extremely high purity hTPO163 standard product.
It could be confirmed. DPCIII molecular weight under reducing conditions
Calculated with a marker (Daiichi Pure Chemicals) as standard
The apparent appearance of hTPO163 in FH, FM, FL and FA
The molecular weight is 24000 to 21500 and 23000, respectively.
~ 21000, 23000-20500, 23500-
It was 20500 (see FIG. 20). See also Wester
Biotin-labeled SDS under reducing conditions
-PAGE standard (Bio-Rad, Bi
onylated SDS-PAGE Stand
ards, Broad Range; Catalog No. 16
1-0319) as a standard for FH, FM, F
The apparent molecular weights of hTPO163 of L and FA are respectively
26000-22000, 25500-22000,
26000-21000, 26000-21000
It was. Heterogeneity of molecular weight of FH, FM, FL and FA
Is probably due to the heterogeneity of the added O-linked sugar chain.
Can be set. Therefore, the FH, FM, FL and FA fractions
Neuraminidase (Naka)
Made by Litesque, catalog number 242-29 SP)
Enzymatically digested, reduced by DTT and analyzed by SDS-PAGE
Apparently, the apparent molecular weight of each fraction was 19000.
Since it was in the vicinity, it was added to the hTPO163 protein.
The same heterogeneity in the amount of sialic acid in the sugar chains was confirmed.
Sometimes, hTPO163 obtained here is used as a glycoprotein
It was revealed that it was expressed in CHO cells
Was. (3) Each of FH, FM, FL and FA obtained in (2)
Fractions were assayed for in vitro activity in the M-07e assay system.
When examined, the relative specific activity was 1 mg hTPO163 protein.
Per quality (weight of peptide part not including sugar chain weight),
511,000,000, 775,000,000, 1 respectively
It was 150,000,000 and 715,000,000. <Example 66> Human TP having Lys at position -1 and Met at position -2
O (amino acids 1-332) (hereinafter “hMKT (1-33
2) ")) construction and expression of expression vector for Escherichia coli.
The codons used from amino acid 164 to amino acid 332 are
It was changed to the E. coli preferred codon as described below. Table 20
21-40 synthetic oligonucleotides shown in
Was.

[Table 20] 21 and 22; 23 and 24; 25 and 26; 27 and 28; 29 and 30; 31 and 32; 33 and 34; 3
5 and 36; 37 and 38; 39 and 40 synthetic oligonucleotides in the same tube using T4 kinase (Pharmacia) 0.1 mM ATP, 10 mM
Tris-acetate, 10 mM Mg-ac
It was phosphorylated in a solution of etate, 50 mM K-acetate. Further 1/10 amount of 100 mM T
ris / HCl (pH 7.5), 100 mM Mgc
l ₂ , 500 mM NaCl solution was added and 3 in a water bath.
After boiling for 1 minute, it was left to form a double-stranded DNA. Then 21 and 22; 23 and 24 (combination A),
25 and 26; 27 and 28; 29 and 30 (combination B), 31 and 32; 33 and 34 (combination C), 3
5 and 36; 37 and 38; 39 and 40 (combination D) four sets of double-stranded DNA were ligated using a DNA ligation kit (Takara Shuzo), and then (combination A) and (combination B) ), (Combination C) and (Combination D) were respectively linked in the same manner, and the resulting reaction solutions were designated as Connection 1 and Connection 2. Using these reaction solutions as templates, 41 and 42 for ligation 1 and 43 for ligation 2
PCR was carried out using the synthetic oligonucleotides of Nos. 44 and 44 as primers. P obtained in the PCR reaction of ligation 1
For CR products, SacI, EcoRV, P of ligation 2
For the PCR product obtained by the CR reaction, EcoRV,
After digestion with HindIII, electrophoresis was performed on a 2% agarose gel, and fragments of about 240 bp and 250 bP were recovered by the Prep-A-gene DNA purification kit. These two fragments were subcloned into pBluescript II KS + (Stratagene) digested with SacI and HindIII (the host was E.col).
i DH5 was used). Table 2 among the obtained clones
Those having the nucleotide sequence shown in 1 were selected by sequencing, and the clones obtained here were cloned into pBL ((S
H) (174-332).

[Table 21] Next, pBL (XH) h6T (1-
163) as a template, the following 45 and 46 synthetic oligonucleotides were used as primers for PCR reaction, and the PCR products obtained here were BamHI and Sac.
After digestion with I, electrophoresis was performed on a 6% polyacrylamide gel, and a fragment of about 160 bP was recovered from the gel. Also, pBL (S
H) (174-332) was digested with SacI and HindIII to obtain a fragment of about 480 bp, which was Prepoo A-
These two fragments were recovered with the Gene DNA Purification Kit and pBlue was digested with BamHI and HindIII.
script II KS + (manufactured by Stratagene)
Subcloned into E. coli DH5
It was used). Among the obtained clones, those having the nucleotide sequences shown in Table 22 were selected by sequencing, and the clone obtained here was designated as pBL (BH) (123-332).

[Table 22] PBL (XH) h6T (1-16 prepared in Example 42
3) was digested with BamHI and HindIII to give pBL
Digest (BH) (123-332) with the same restriction enzymes
The resulting fragment of about 640 bp was ligated to clone pBL
(XH) h6T (1-334) was prepared. Further implementation
PCFM536 / hMKT (1-16 created in Example 52
About 270 obtained by digesting 3) with XbaI and SfiI
pBL (XH) obtained by digesting the bp fragment with the same restriction enzymes
The clone pBL (X was ligated to h6T (1-334).
H) hMKT (1-334) was created. pBL (X
H) hMKT (1 to 334) was added to XbaI, HindII
After digestion with I, mutated human TPO amino acids 1-332
The fragment of about 1040 bp in size is encoded.
After collecting and purifying, p digested with XbaI and HindIII
Cloni on CFM536 (Sho 60-501988)
(The host was pMW1 (ATCC No. 3993).
3), which was previously transformed in E. coli JM109
used). The clone obtained here was designated as pCFM536.
/ HMKT (1-332) and the expression vector
Mutated hMKT (1-332) tamper strain
It was used as a transformant for expression. This expression plasmid
Including the DNA sequence shown in the sequence listing (SEQ ID NO: 14)
I have. The transformant obtained here was treated with ampicillin 50
μg / ml, tetracycline 12.5 μg / ml
Culture in 60 ml of LB medium with shaking at 30 ° C overnight.
LB containing 25 ml of nutrient solution containing 50 μg / ml of ampicillin
In addition to 1000 ml of medium, OD is A ₆₀₀ Is 1.0-
Shaking culture was performed at 30 ° C. until reaching 1.2. Then the final temperature
Approximately 330 ml LB culture at 65 ° C so that the temperature is 42 ° C
Add the soil and cultivate with shaking at 42 ° C for 3 hours
Of human TPO and hMKT (1-332) protein
Was induced. Using these cultured cells directly as a sample
SDS-PAGE was performed. First for SDS-PAGE
Using a multi gel 15/25 manufactured by Kagaku Co.
When sea blue staining was performed, hMKT (1-332)
For those that induce protein expression, the molecular weight is about
A protein specific for induction of expression was detected at 35 kD.
Was issued. On the other hand, after SDS-PAGE, the tamper on the gel
Electro-blotting of protein to nitrocellulose membrane
And reacted with the anti-HT1 peptide antibody prepared in Example 45.
When it was made to develop color, it was found to have a molecular weight of about 35 kD.
Of the hMKT (1–332) was detected.
Expression was confirmed. <Example 67> Preparation of human TPO-substituted derivative and expression in COS7 cells-
Confirmation of activity A derivative of human TPO with some amino acids replaced
Whether or not it has was examined as follows. For this example
The animal cell expression vector pSMT201 was as follows.
It was made. First, the mouse erythropoietin receptor
Expression plasmid pXM-mEPORn containing cDNA
(Dana Farr Cancer Institute D'Andrea Expo
Obtained from Shishi, Cell: Volume 57, pages 277-285 (1
989)) treated with restriction enzymes KpnI and EcoRI
After that, agarose gel electrophoresis was performed and mouse erythropoie
PXM vector fragment excluding the tin receptor cDNA portion
Was recovered. Next, various types of pXM expression vectors were recovered.
Two pairs for introducing restriction enzyme sites for cloning
The synthetic oligonucleotide was used with a DNA synthesizer manufactured by ABI.
It was made. The nucleotide sequence of the synthesized oligonucleotide
It is shown below. The two oligonucleotides are mixed and annealed.
After making into a double-stranded oligonucleotide,
PXM vector fragment and T4 DNA ligase (Takara Shuzo
(Manufactured by K.K.) to obtain expression vector pDMT201.
Next, the mouse contained in this expression vector pDMT201
PDMT201 vector was used to remove the DHFR cDNA.
Vector and pEF18S vector with restriction enzymes NotI and
And HpaI, agarose gel electrophoresis was performed, and pD
Larger fragment derived from MT201 vector DNA and pE
Recover smaller fragment from F18S vector DNA
And bind with T4 DNA ligase (Takara Shuzo)
To obtain an expression vector pSMT201. This vector
Indicates the replication start area of SV40 as shown in FIG.
And enhancer sequences, adenovirus major late promoter
Sequencer, adenovirus tripartite leader
Sequence, splice signal sequence, SV40 early polyadenylation
Sequence, adenovirus VA RNA gene sequence, pU
Replication initiation region of C18, β-lactamase gene (Am
p ^r ), And restrictions for linking the target gene
As the enzyme sequence, Bgl II, Pst I, I, Kp
n I, Xho I, EcoRI, Sma I, Spe
I, and Not I sites. Shown in Example 30
To control PHTP1 containing full-length human TPO cDNA
Enzymatically digested with the restriction enzymes EcoRI and Spe I
The resulting full-length human TPO cDNA fragment was similarly restricted
Subclonin in the vector pSMT201 digested with enzyme
Plasmid pSMT201-hTPO
I got The plasmid pSMT20 obtained as described above
First, using 1-hTPO as a template,
The plasmid βGL-TPO / pBlue is
It was made like this. In βGL-TPO / pBlue, human T
On the 5'untranslated side of PO, the method of Annweiler et al.
Therefore, we tried to add a rabbit β-globin leader sequence.
(Annweiler et al., Nucleic Acid
S Research, vol. 19, p. 3750). First of all
Two chemically synthesized DNA chains shown below, and a vector
Controls Bluescript IISK + (manufactured by Toyobo Co., Ltd.)
The fragment was digested with the restriction enzymes EcoRI and SmaI.
The leader sequence was inserted by
Vector βGL / pBlue was prepared. (Add the SmaI sequence to 102-122 of SEQ ID NO: 7
Stuff) (Antisense of 1140-1160 of SEQ ID NO: 7, S
peI and HindIII sequences were added.) PCR was performed using plasmid pSMT201-hTPO DNA.
1 ng was used as a template and the synthesized primers were
It carried out using 10 micromol each. TaKaRa PCR A
Using mplficaion Kit (manufactured by Takara Shuzo)
, Programmable Thermal Co
nroller (MJ Research)
PCR in a volume of 100 μl (94 ° C for 1 minute, 55
℃ 2 minutes, 72 ℃ 2 minutes 3 cycles, followed by 94 ℃ 4
5 seconds, 55 ℃ 1 minute, 72 ℃ 1 minute 20 cycles)
I went. Chloroform extraction of PCR product, ethanol
Solution twice and then dissolve in 100 μl TE buffer.
I understand. This is erased with the restriction enzymes SmaI and HindIII.
After extraction, phenol / chloroform extraction, ethanol precipitation
I went. The precipitate obtained was added to 10 μl of TE buffer.
After lysis, the vector βGL / pB was similarly digested with restriction enzymes.
subcloned into lue (host fungus made by Toyobo Co., Ltd.
Competitive High E. Using coIi JM109
for). 20 clones were selected from the obtained transformants,
Plasmid DNA was prepared. The method is essentially Mole
color Cloning [Sambook et al., C
old Spring Harbor Laborat
ory Press (1989)]
It was carried out in this way. About purified plasmid DNA
Is Taq Dye Deoxy ^TM Termina
ter Cycle Sequencing Kit
(Applied Biosystems) is used to apply
373A DNA sequencer manufactured by Debio Systems
Was used to confirm the nucleotide sequence. βGL-TPO / p
The plasmid encoding Blue has a base sequence
Make sure you have the expected TPO cDNA sequence with no column substitutions.
And confirmed. Controls βGL-TPO / pBlue
After digestion with restriction enzymes BgIII and SpeI,
Loroform extraction and ethanol precipitation were performed. Obtained sink
Dissolve the cells in 10 μl of TE buffer,
Subcloning into digested vector pSMT201
(The host bacterium was Competent High E.c manufactured by Toyobo Co., Ltd.
oli JM109 is used). Essentially Molecul
ar Cloning [Sambook et al., Cold
Spring Harbor Laboratory
Press (1989)].
A plasmid DNA was prepared from the transformant. Got
The expressed expression vector pSMT / βGL-TPO is shown in FIG.
The splice signal sequence of the pSMT201 vector shown in
Restriction enzyme sequence Bgl II / spe I part downstream of
Position β-globin leader sequence and human TPO cDNA
Are connected to each other. This pSMT / βGL
-Transfection of TPO vector into COS7 cells
It was used for the experiment. For the preparation of human TPO substituted derivative, P
Utilized CR and followed the method of Ito et al. (Ito et al., G
ene, 102, 67-70, 1991). here
Then, the Arg residue at position 25 of human TPO is changed to an Asn residue.
Substituted derivative and His residue at position 33 remain in Thr
An attempt was made to produce a derivative in which the group was substituted. The PCR used for PCR
The sequence of Limer is as follows. The first-stage PCR was performed using the plasmid βGL-TPO / pBl.
Using 1 ng of ue DNA as a template,
Immersion was performed using 10 μM each (primer
The combination of [1] ΔBgIII and end, [2] T
7 and N3, [3] T7 and 09). TaKaRa PCR
Amplification Kit (Takara Shuzo)
Using the Programmable Thermal
Controller (MJ Research
PCR (1 minute at 94 ° C) with a volume of 100 μl
, 55 ° C for 2 minutes, 72 ° C for 3 minutes]
94 ° C 45 seconds, 55 ° C 1 minute, 72 ° C 1 minute 17 times
Ukule). Each PCR product is chloroform
Extraction with ethanol and precipitation with ethanol twice
It was dissolved in TE buffer. 2 types of this PCR product
The second-stage PCR was carried out using each μl. Mold assembly
The combination of PCR products [1] and [2] of [1] and [3]
PCR product. All primers used were T7 and e
nd combination. Incubate at 94 ° C for 10 minutes
After adding TaKaRa Taq, 94 ℃ 1 minute
3 cycles of 55 ℃ for 2 minutes and 72 ℃ for 2 minutes
94 ° C 45 seconds, 55 ° C 1 minute, 72 ° C 1 minute 9 cycles
Kuru went. 5 mg / ml p for each PCR product
Roteinase K 1 μl, 0.5M EDT
Add 2 μl of A and 2 μl of 20% SDS at 30 ° C for 30 minutes
After incubating for a while to inactivate Taq, phenol / chloropho
Rum extraction, ethanol precipitation and dissolution in 20 μl sterile water
It was After digesting this with the restriction enzymes BgIII and SpeI,
Enol / chloroform extraction, ethanol precipitation
It was Dissolve the obtained precipitate in 10 μl of TE buffer
Then, similarly digest with restriction enzyme and alkaline phosphatase (child
Bovine intestine, Boehringer Mannheim) treated expression
Subcloned into vector pSMT201 (host
Bacteria are Competent High E. coli J
Use M109). Each of the obtained transformants
Select 2 clones each and prepare plasmid DNA
It was The method is essentially Molecular Clonin
g [Sambook et al., Cold Spring H
Arbor Laboratory Press (1
989)]. Refining
For the plasmid DNA prepared, Taq Dye De
oxy ^TM Terminator Cycle S
equalizing Kit (Applied Biosystem
3) manufactured by Applied Biosystems, Inc.
73A DNA sequencer confirms the nucleotide sequence
Was. Plasmids derived from the PCR products of [1] and [3]
The intended amino acid substitution [His33 (CAC) →
Thr (ACC)] and C-terminal (Gly33
A peptide consisting of the following amino acid sequence was added to 2)
CD encoding a TP0-substituted derivative (09 / TPO)
It was confirmed that NA was included. On the other hand, [1]
The plasmid derived from the PCR product of [2] was designed as
Minoic acid substitution [Arg25 (AGA) → Asn (AA
C)] and an additional amino acid substitution [Glu231
(GAA) → Lys (AAA)] and has a C-terminal (G
a peptide consisting of the following amino acid sequence in ly332)
Code added TPO-substituted derivative (N3 / TPO)
Was found to contain a cDNA that Peptide: TSIGYPYDVPDYAGVHHHHHH Trans of each obtained clone into COS7 cells
Sfection was chloroquine treated according to Example 35.
The DEAE-Dextran method was used. Ie plastic
Transfection 5 using 40μ of Sumid DNA
After a day, the culture supernatant was collected. Centrifuge the collected culture supernatant
Concentrated 20 times with Recon-30 (manufactured by Amicon) and M-0
It was evaluated by the 7e assay system. As a result, human TPO substitution
Plus encoding N3 / TPO, 09 / TPO derivatives
In COS7 cell culture supernatants transfected with Mido
In each case, TPO activity was detected in a dose-dependent manner (Fig.
22). <Example 68> Preparation of human TPO insertion / deletion derivative and its use in COS7 cells
Expression-Activity Confirmation Derivative or hT in which amino acid is inserted into hTPO163
Derivatives lacking amino acids from PO163 are active
I examined whether or not. The prepared derivative is H of SEQ ID NO: 7.
is33 deletion (dH33), Gly116 deletion (d
G116), Arg117 deletion (dR117), Hi
33] and Pro34 between Thr insert (T3
3 '), Ala insert (A33'), Gly insert (G
33 ') and A between Gly116 and Arg117
sn insert (N116 ′), Ala insert (A11
6 '), a Gly insert (G116'). these
Of these, T33 'and N116' are mucin-type sugar chains, A
It is a derivative intended to introduce a sn-linked sugar chain. Derivative
PCR was used for the preparation of
(Ito et al., Gene, 102, 67-70, 19
91). The sequences of the primers used for PCR are as follows.
Ri. The first-stage PCR is the plasmid β prepared in Example 67.
Using 1 ng of GL-TPO / pBlue DNA as a template
10 μM each of the synthesized and used primers
It was carried out. The combination of primers is [1] dRI
endNotI, [2] T7 and mutagenesis primer (d
H33, A33 ', G33', T33 ', dG116'
dR117, A116 ', G116', N116 ')
is there. TaKaRa PCR Amplificati
Using On Kit (Takara Shuzo Co., Ltd.)
Mable Thermal Controller
(MJ Research Co., Ltd.) 100 μl volume
PCR was performed at. The reaction of [1] is 94 ° C for 1 minute, 4
5 ℃ 2 minutes, 72 ℃ 2 minutes 3 cycles, then 94 ℃
45 cycles, 45 ° C for 1 minute, 72 ° C for 1 minute 17 cycles
Le. The reaction of [2] is 94 ° C for 1 minute, 55 ° C for 2 minutes, 7
2 ℃ 2 minutes 3 cycles, followed by 94 ℃ 45 seconds, 55
17 cycles of 1 minute at 72 ° C and 1 minute at 72 ° C. Each P
Chloroform extraction of CR product and ethanol precipitation twice
After that, it was dissolved in 100 μl of TE buffer. Next
1 μl each of the PCR products of [1] and [2]
A second stage PCR was performed using The primers used are
All are combinations of T7 and endNotI. 94
TaKaRa Ta after incubation at 0 ° C for 10 minutes
q is added, 94 ° C for 1 minute, 55 ° C for 2 minutes, 72 ° C for 2 minutes
3 cycles, followed by 94 ° C for 45 seconds, 55 ° C for 1 minute,
Nine cycles of 72 ° C. for 1 minute were performed. Each PCR product
1mg of 5mg / ml Proteinase K
1, 0.5 M EDTA 2 μl, 20% SDS 2 μl
After incubating at 37 ° C for 30 minutes to inactivate Taq, add
Enol / chloroform extraction, ethanol precipitation, 20μ
Dissolved in 1 liter of sterile water. This is a restriction enzyme EcoRI, N
After digestion with otI, phenol / chloroform extraction, etha
Noll precipitation was performed. The precipitate obtained was mixed with 10 μl of TE solution.
After dissolving in a buffer, digest with restriction enzyme and
Phatase (calf intestine, Boehringer Mannheim)
Subcloned into the treated expression vector pEF18S.
(The host fungus was Competent High manufactured by Toyobo Co., Ltd.
E. FIG. E. coli JM109). Obtained transformation
Plasmid DNA was prepared from the body. The method is essentially M
olecular Cloning [Sambook
Et al, Cold Spring Harbor Labo
ratory Press (1989)].
It was carried out as follows. Purified plasmid DNA
About Taq DyeDeoxy ^TM Termin
ater Cycle Sequencing Kit
(Applied Biosystems) is used to apply
373A DNA sequencer manufactured by Debio Systems
The base sequence was confirmed by. As a result, dH33,
A33 ', T33', dG116, dR117, A11
Plasmids encoding 6 ', G116', N116 '
Has no nucleotide sequence substitutions other than the intended site over the entire length.
Make sure you have the expected TPO cDNA sequence
It was Also, in G33 ', one position other than the intended part is
Base substitution leading to mino acid substitution [Pro38 (CCT)
→ Ser (TCT)] was recognized. Each obtained
Of clones of COS7 into COS7 cells
Was performed according to Example 11. Ie plasmid D
DEAE containing 10 μg NA and chloroquine treatment
-Perform the transfection using the dextran method.
After 4 to 5 days, the culture supernatant was collected. On the collected culture
Clearance was assessed with the M-07e assay system. As a result,
A plasmid encoding a noic acid insertion / deletion derivative
Use in any of the COS7 cell culture supernatants
TPO activity was detected in a dose-dependent manner (see FIG. 23). T
Expression plus without cDNA encoding PO derivative
COS7 transfected with mid pEF18S
No activity was observed in the cell culture supernatant. <Example 69> Platelet-increasing action of TPO Blood was collected in advance from the orbital vein and the microcell counter was used.
-(Toa Medical Electronics, F-800)
Randomized 20 normal 8-week-old ICR male mice
It was divided into 4 groups. One group (control-iv
Group) 100 μl PBS once a day for 5 consecutive days
It was administered intravascularly, and the other 1 group (TPO-iv group) was used as an example.
SP Sepharose Fast obtained in 56
The concentrated solution of human TPO active fraction F2 of Flow was NAP-
25 columns (Pharmacia Biotech, catalog
No. 17-0852-02) and replaced with PBS, and
100 μl of diluted with PBS (M-07e
(Including relative activity of 211,900 in essay system) for 1 day
It was intravenously administered once for 5 consecutive days. Also, another group
(Control-sc group) 1 μl of 100 μl PBS
Administered subcutaneously once a day for 5 consecutive days, then administered to another group (TPO-
sc group) 100 μl for 1 day as in TPO-iv group
It was subcutaneously administered once for 5 consecutive days. 6, 8 after the start of administration
Orbital vein of each mouse on days 10, 13 and 15
Blood is collected daily, and a microcell counter (Toa Medical
The number of platelets was measured by F-800 manufactured by Denshi. platelet
The transition of the numbers is shown in FIG. That is, control-
In the iv group, the number of platelets increased even on the 6th day when the number increased.
44% increase compared to before, control-s
47% increase was observed on day 8 with the highest increase in group c
It was only done. On the other hand, in the TPO-iv group
Shows an increase of 177% on day 6 compared to before administration.
And continued to increase thereafter, and reached the highest level of 469% on the 10th day.
A large increase was observed. Also, 6 days for TPO-sc group
Already a 347% increase in the eyes and the biggest increase after 8 days
A 493% increase was observed. From the above results, human T
PO increases platelets regardless of species and administration route
It was confirmed to have. <Example 70> Platelet-increasing action of TPO Blood was collected in advance from the orbital vein, and the microcell counter was used.
-(Toa Medical Electronics, F-800)
Normal 11-week-old C3H / HeJ male mice 16
The animals were randomly divided into 4 groups. One group (contro
100 μl PBS once a day for 5 consecutive days
Was subcutaneously administered. Conducted to the other 1 group (TPO-1 group)
Sephacryl S-200HR obtained in Example 56
The human TPO active fraction F1 of the above was placed in PBS with NAP-25.
100 μl of the solution that had been replaced and diluted with PBS
(Relative activity of 83,000 in M-07e assay system
(Including) was subcutaneously administered once a day for 5 consecutive days. Another one
Group (TPO-2 group) was administered with TPO-1 group
One of the two-fold diluted active fractions with PBS
00 μl (relative activity in the M-07e assay system 41,
(Including 500) subcutaneously once a day for 5 consecutive days
It was The last one group (TPO-3 group) is the TPO-2 group.
The TPO active fraction administered in 1. was further diluted 2-fold with PBS.
100 μl of the sample (in the M-07e assay system)
Relative activity of 20,750 is included) once a day for 5 consecutive days
Was subcutaneously administered. 6, 8, 10 and 12 days after the start of administration
Blood was collected daily from the orbital vein of each mouse and
Icrocel Counter (Toa Medical Electronics, F-800)
The number of platelets was measured at. Fig. 25 shows the change in platelet count
did. That is, in the control group, the platelet count was almost
No fluctuation was seen. In the TPO administration group, whichever
Platelets that maximize in group 8 days after the start of administration
An increase in number was observed. Also, the dose-dependent
The existence was confirmed. That is, in the TP0-1 group, 6 days
Already an increase of about 200% on the eyes and about 27 on the 8th day
It increased to 0%. It decreased after that, but on the 12th day
Even if it is, there is an increase of about 65.
Intention (p <0.01: Dunnett's multiple comparison test: Dun
net multiple comparison t
est) was recognized. Similarly in the TPO-2 group
Although the increase was seen, the increase effect did not reach the TPO-1 group.
Approximately 140% and 160 on the 6th and 8th days, respectively
% Increase was recognized. Also, control group on day 12
And reduced to almost the same level. To TPO-3 group
The increasing effect on swelling was even weaker than that of the TPO-2 group,
On the 8th day when it reached the maximum value, an increase of about 110% was seen
And significant difference from control group (p <0.01)
Was also recognized. From the above results, human TPO is
To increase the number of platelets regardless of
It was confirmed that the effect was dose-dependent. <Example 71> Thrombocytopenia inhibitory effect of administration of an anticancer agent by TPO 5-FU to 200 m for 30 8-week-old ICR male mice
After intravenous administration at a rate of g / kg body weight, randomly
Divided into 2 groups of 15 animals, one from the next day (Day 1)
Group (control group) with 100 μl PBS for 1 day
It was subcutaneously administered once for 5 consecutive days. The other group
(TPO group) includes the human TPO activity used in Example 69.
Fraction F2 100 μl (relative in M-07e assay system
(Including active amount 211,900) once a day for 5 consecutive days
It was administered subcutaneously. After the start of administration
Randomly extract 5 mice from each group,
Blood is collected from the vein and a microcell counter (Toa Medical
The number of platelets was measured by E-2500, manufactured by Child. platelet
The transition of the numbers is shown in FIG. That is, the control group
In 5-FU administration, the platelet count decreased day by day.
6 reached the lowest value (about 28% of the value before 5-FU administration)
However, in reaction to the decrease in Day 8, it increased to about 1.3 times.
It was Even in the TPO group, the platelet count after 5-FU administration
And decreased to the lowest value for Day 6 (of the value before 5-FU administration).
(About 52%), but most of the platelet counts of Day 4 and 6
There is no difference, and in Day 6 the control group
(P <0.05: Dunnett's multiple comparison test)
High). In Day 8, 5-FU
It increased to about 200% of the pre-dose value. The above results
Prevents thrombocytopenia due to anti-cancer drugs in human TPO
It was confirmed that there is an effect. <Example 72> The therapeutic effect of thrombocytopenia by TPO To 36 7-week-old ICR male mice, nimustine hydrochloride (A
CNU) was intravenously administered at a rate of 50 mg / kg body weight.
After that, they were randomly divided into two groups of 18 animals each, and the next day (Da
200 μl from y1) to one group (control group)
Subcutaneous administration of PBS twice daily for the other group
(TPO group) includes the TPO active fraction used in Example 70.
Tween at a ratio of 0.04% without diluting F1 with PBS
200 μl to which n-80 was added (M-07e
(Including relative activity of 360,000 in a system) twice a day
It was subcutaneously administered every day. Randomized mice in each group after administration started
Divided into 3 groups for blood collection on Day 5 and 12 respectively
Group, blood collection on Day8, 14 and collection on Day10
There was a blood group. Blood is collected from the orbital vein and
Small blood at the counter (F-800 manufactured by Toa Medical Electronics)
The number of plates was measured. The change in platelet count is shown in FIG. You
That is, in the control group, the platelet count after ACNU administration
Decreased daily, and was the lowest at Days 8-10 (each ACN
It is about 29% of the value before U administration) and about 49 on Day 12.
%, Day 14 only recovered to about 74%.
On the other hand, in the TPO group, the value before ACNU administration was about 5% for Day 5.
It decreased to 38%. After that, it started to increase and ACNU
Compared to the value before administration, Day 8 recovered to about 63%,
From Day 10 onwards, the number of platelets above the ACNU pre-administration value was shown.
However, about 12% on Day 12 and about 40 on Day 14.
It increased to 0%. As mentioned above, in the control group
Is already in the process of decreasing Day 8-10
The group has begun to increase, and ACNU has already been thrown at Day 10.
Since the number of platelets has increased to above the pre-specified value,
TPO is an anti-cancer drug-induced thrombocytopenic recovery
It was confirmed to have the effect of promoting recovery. The actual
Including the results of Example 71, human TPO has an anticancer drug seed
Inhibitory effect on blood platelet count and blood loss regardless of type
Expected to have the effect of promoting recovery from plate loss
Be done. <Example 73> The therapeutic effect of thrombocytopenia after BMT by TPO 10G was applied to 48 7-week-old C3H / HeN male mice.
Bone marrow cells of syngeneic mice after whole body irradiation with y radiation
1 x 10 ⁶ Individuals were immediately administered intravenously. There randomly
Divided into 2 groups, one group (control) from the next day (Day 1)
PBS for the control group) and the other group (TPO group)
The TPO active fraction F1 (M-07e assay used in Example 70)
(Including the relative activity of 44,000 in b))
100 μl was subcutaneously administered once a day for 20 consecutive days. Throw
After the start of feeding, each group will be on Days 5, 10, 14, and 21.
6 mice each were randomly extracted and collected from the orbital vein.
Blood, micro cell counter (Toa Medical Electronics, E-
2500) to measure the platelet count. Change in platelet count
It is shown in FIG. That is, in any group, BM
Platelet count decreased daily after T,
It became low (about 3% before BMT enforcement). Then gradually
Recovery, about 11% in the control group on Day 14, T
It was about 13% in the PO group. Control on Day 21
In the Le group, the recovery was only 37%, but in the TPO group
Then, it was recovered to about 65%, and a significant recovery promotion effect was recognized.
It was From the above results, human T purified in Example 56
PO has an effect of promoting recovery of the platelet count after BMT is performed.
It was confirmed that there were fruits. <Example 74> Effect of TPO on thrombocytopenia after irradiation Irradiation of 36 male 8-week-old ICR mice with 5 Gy X-rays
After total body irradiation, it was randomly divided into 2 groups and the next day (Day
From 1) PBS to one group (control group), the other
One group (TPO group) had the TPO activity used in Example 70.
Fraction F1 (relative activity in M-07e assay system 1,4
(Including 40,000) once a day for 3 consecutive days
Subcutaneous administration, and from the next day, relative activity in the M-07e assay system
A sex dose of 360,000 was administered subcutaneously once a day for 7 consecutive days.
It was After the start of administration, the mice were randomly divided into 3 groups in each group.
K, and the group that draws blood on Day 4, 11, and 21 respectively, D
Group collecting blood on ay7 and 13 and blood collecting on Day9 and 15
It was set as a group. Blood is collected from the orbital vein and microcell
Platelets at a counter (F-800 manufactured by Toa Medical Electronics)
The number was measured. FIG. 29 shows the change in platelet count. sand
That is, in the control group, the number of platelets was measured daily after X-ray irradiation.
Decreased to the lowest level on Day 9 (about 24% of the value before X-ray irradiation).
%), About 38% for Day 11 and about 6 for Day 13.
Recovered to 7% and recovered to the value before X-ray irradiation on Day15
It was On the other hand, in the TPO group, the value before X-ray irradiation is about 7
It decreased to 24%. After that, it started to increase and X-ray irradiation
Compared to the previous value, Day 9 recovered to about 82%,
After y11, the number of platelets is equal to or more than the value before X-ray irradiation, and Da
The tendency was maintained until y21. As described above,
Already in Day 9 which is in the process of decreasing in the troll group
The TPO group has started to increase, and X-rays have already been taken on Day 11.
Platelet count increased beyond the pre-irradiation value and remained high thereafter.
I had On the other hand, in the control group,
It takes 15 days to recover to the platelet count. this
From the results, the human TPO purified in Example 56 was not exposed to radiation.
Shortened recovery time from thrombocytopenia after irradiation
And the therapeutic effect on thrombocytopenia after irradiation was confirmed.
It was <Example 75> Platelet-increasing action of hTPO163 Blood was collected in advance from an orbital vein, and a microcell counter was used.
-(Toa Medical Electronics, F-800)
Randomized 15 normal C3H / HeN male mice
Were divided into 4 groups (control group, A, B, C group). 1
Group (control group) contains 0.1% mouse serum
PBS was subcutaneously administered once a day for 5 consecutive days. To group A
Is the SP Sepharose obtained in Example 65.
FastFlow TPO active fraction F2 was added to 0.1%
HTPO163 was diluted with PBS containing mouse serum for 1 day.
Or about 4 as the relative activity amount in the M-07e assay system.
0,000,000 / kg body weight, M-0 for group B
Approximately 8,000,0 as relative activity in 7e assay system
00 / kg body weight, and similarly for group C, M-07e
Approximately 1,600,000 as relative activity as a sei system
/ Kg body weight was subcutaneously administered for 5 consecutive days. Administration
Eyes of each mouse 6, 8, 10, 12 days after the start
Blood is collected daily from the fossa vein and microcell counter is used.
(Toa Medical Electronics, F-800)
It was The change in platelet count is shown in FIG. That is,
Little change in platelet count in the troll group
It was Start administration in any of the TPO administration groups
A maximal increase in platelet count was observed on the 8th day
It was In addition, a dose dependence was observed between the administration groups.
That is, in Group A, about 88% on the 6th day and about 1% on the 8th day.
00% increase was seen, and even on the 10th day, about 97%
The increase was maintained and both were significantly different from the control group
(P <0.01: Dunnett's multiple comparison test)
It was An increase was also seen in group B, but there was an increasing effect.
Are less than group A, but about 6 and 8 days each
5%, about 84% increase between the control group
Significant difference (p <0.01 or p <0.05: Dunnett
Multiple comparison test) was accepted. Increasing effect in group C
Was even weaker than group B, but reached the maximum on day 8
The increase was about 31%. Based on the above results
The hTPO163 purified in Example 65 had an increased platelet count.
Addition, and its effect is dose-dependent
Was confirmed. <Example 76> The therapeutic effect of thrombocytopenia by hTPO163 Nim hydrochloride was added to 100 8-week-old C3H / HeN male mice.
Sutin (ACNU) intravenously at a rate of 50 mg / kg body weight
After oral administration, 4 groups of 25 animals each (control
Le, A, B, C group) and from the next day (Day 1)
PBS was added to the control group at a rate of 5 ml / kg body weight.
Subcutaneous administration was carried out once a day for every day,
SP of Sepharose Fast Flow T
The PO active fraction F2 was diluted with PBS, and hTPO163 was added.
About 1 as relative activity in M-07e assay system
6,000,000 / kg body weight once a day for consecutive days
It was administered below. Similarly, for group B, the M-07e assay system was used.
As a relative activity of about 48,000,000 / kg body
In the M-07e assay system for group C
As a relative activity amount of about 160,000,000 / kg
Subcutaneous administration was carried out once a day at a weight ratio. After the start of administration
Mice were randomly divided into 5 groups and each
Blood was collected at 5, 8, 10, 12, and 14. Blood sampling
Perform from the vein, micro cell counter (Toa Medical Electronics
Manufactured by E-2500). Platelet count
The transition of is shown in FIG. That is, in the control group
Showed that platelet count decreased daily after ACNU administration.
8-10 lowest (about 15-16% of ACNU pre-treatment value)
It becomes about 28% on Day12 and about 51% on Day14.
I just recovered. On the other hand, in Group A, on Day 8
Was reduced to about 25% of the pre-ACNU value,
After that, it started to increase, and it was about 34% for Day10 and Day1.
2 to about 89% and Day 14 to ACNU
Recovered above the previous level. In Group B, Day8 has AC
It decreased to about 23% of the value before NU administration, but increased after that.
In addition, it has already recovered to about 64% on Day 10.
However, on Day 14, it recovered to more than the value before ACNU administration.
It was Also in group C, the number of cells increased after Day 10 as well.
And after Day 12, more than before ACNU administration
Recovered. As described above, platelets in any group
The lowest number was observed on Day8, but human TPO administration
The decrease was slower in the group than in the control group,
The low price rose. In the control group, D
Almost no recovery of platelet count was observed in ay10
However, in the human TPO administration group
Recovery of platelet count was observed in all groups, although there were differences.
In the μg / kg administration group, Day12 had already been
He recovered to a level higher than that of Yoho. Day in control group
14 also recovered to about 51% of the ACNU administration pre-position
Compared to what was only produced in Reference Example 2
HTPO163 promotes recovery from thrombocytopenia
It became clear that it had an effect. As described above, Example 65
HTPO163 purified by
The therapeutic effect on thrombocytopenia was observed. Example 77 Preparation of human TPO derivative in E. coli Biological activity, stability, and stability of TPO expressed in E. coli, and
Designed and produced TPO derivatives in an attempt to improve solubility
It was The prepared derivative is the Leu129 of SEQ ID NO: 11.
Arg substitution (L129R), Arg position of His133
Substitute (H133R), Arg substitution of Met143 (M
143R), a Leu substitution product of Gly82 (G82L),
Leu substitution product of Gly146 (G146L), Ser1
Pro substitution of 48 (S148P), Ar of Lys59
g-substitution (K59R) and Arg substitution of Gln115
It is the body (Q115R). Casting for making TPO derivative
As a mold, h6T (1-163) described in Example 42 is used.
To synthesize the following oligo DNA for mutation introduction
did. The mutant plasmids shown below are all Sculptor
Nvitro Mutagenesis Kit (Amersham
Manufactured by the company). The plasmid described in Example 42.
Obtained from pCFM536 / h6T (1-163)
The Xba I-Hind III fragment was bluescript.
pt II SK- (Toyobo Co., Ltd.) Xba I-H
The plasmid pS was inserted between the ind III cleavage sites.
KTPO was prepared. The plasmid pSKTPO is E. coli
It was held on JM109. Helper phage M13KO
Single-stranded DN from pSKTPO using 7 (Takara Shuzo)
A was prepared, and using the above synthetic oligo DNA for mutation,
According to the protocol attached to the kit,
It was made. About the obtained candidate plasmid
Determine the nucleotide sequence and confirm that the target site has been mutated.
And confirmed. Of all pSKTPO made above
Extraction of Xba I-Hind III fragment from derivative
Xba I-Hind of plasmid pCFM536
E. coli 261 after insertion between the III cleavage sites
Transformation to express the desired TPO derivative
Completed the body. Encode the desired TPO derivative
Cultivation of the transformant containing the gene was carried out according to Example 43.
Carried out. Of the obtained h6T (1-163) producing recombinant
Frozen cells (about 3 g), 10 mM EDTA, 10 mM
20 mM Tris buffer containing DTT, 1 mM PMSF
About 30 mL of liquid (pH 8.5) was added and suspended, and then ice-cooled
1 minute sonication with an interval of 1 minute below
Wave crusher was used) 5 times. Centrifuge the crushed cells
Transfer to a tube and spin at 15,000 rpm for 10 minutes at 4 ° C.
Keep in mind and collect the pellets. Add 8M Guani to this pellet.
Zinc hydrochloride, 5 mM EDTA, 1 mM PMSF
Add about 30 mL of 10 mM Tris buffer (pH 8.7).
And add about 50 mg of DTT to room temperature.
And stirred for 1-2 hours to reduce the protein sample. After the reduction,
Adjust the pH of the sample to 5 using a 2M hydrochloric acid solution and adjust to 4 ° C.
I left it. Reduced protein sample is treated with 30% glycero
3M urea, 3mM cystamine, 1mM L-system
In containing 10 mM CAPS buffer (pH 10.5,
Diluted to about 1.5 L). Dilution at room temperature overnight
It carried out. Stir the diluted sample solution at room temperature for 2 days
At 8000 rpm after fully oxidizing the sample protein
Insoluble matter was removed by centrifugation for 45 minutes. The supernatant after centrifugation
The pH was adjusted to 6.8 with 6M phosphoric acid and deionized water was added.
After doubling the dilution with the
Filter using 2 sheets of Western filter paper, # 2, diameter 90mm)
It was The filtrate is used as an ion exchange resin (CM-Sepharose
Fast flow, from Pharmacia)
After adsorbing it on a glass (2.6 x 10 cm), 15% green
10 mM phosphate buffer containing cerol and 1 M urea (pH
6.8) After washing with about 400 mL, 15% glycerol
Containing 10 mM phosphate buffer (pH 7.2) about 300 m
The column was equilibrated with L. 15% for elution of target sample
0.5M from 10 mM phosphate buffer containing glycerol
Using a linear concentration gradient up to the same buffer containing salt, flow rate 1
It was performed at mL / min. Elute proteins from the column
Followed by UV absorption at 280 nm, containing the target protein
The collected fractions (about 30-40 mL) were collected. This
Centriprep 1
0, manufactured by Amicon) was concentrated to about 2 mL.
After that, it was purified using reverse phase HPLc (manufactured by Waters).
It was At this time, the column has Waters μBonda.
Using sphere C4 (3.9 x 150 mm),
Eluent A, which is a 0.05% TFA solution, for quality elution
70% 2-Propanol, 30% CH3CN
And eluent B containing 0.02% TFA, B eluent
Change the concentration of from 1% to 100% in 40 minutes,
The target protein was eluted. TPO derivative is
Were eluted at the position of about 30 minutes. Purified
To measure the activity of the TPO derivative, the eluted derivative
Collect body for 2 days against 2 L of 10 mM phosphate buffer
After dialysis, centrifuge concentrator (Centriprep 1
0, manufactured by Amicon) and concentrated with M-07e
I used it for essay. Each of the prepared TPO derivatives is
Organism similar to h6T (1-163) used as a control
The activity was shown (see FIGS. 32 and 33). The following are formulation examples
Show. Formulation Example 1 Human TPO fraction obtained in Example 56
Frozen product frozen at -20 ° C after concentrated and aseptic treatment
Was used as an injection. Formulation Example 2 Human TPO fraction obtained in Example 56
Was concentrated in a 10 ml vial bottle by aseptic operation.
1 liter, freeze-dried at -20 ° C, and frozen with a rubber stopper.
The dried product was used as an injection. <Formulation Example 3> Human TPO fraction obtained in Example 56
Was concentrated and sterile filtered, then placed in a 10 ml vial.
It was filled into an injection. <Formulation Example 4> hTPO163 obtained in Example 65
The fractions were concentrated, sterilized, and frozen at -20 ° C.
The frozen product obtained was used as an injection. <Formulation Example 5> hTPO163 obtained in Example 56
Concentrate the fractions and sterilize them into 10 ml vials.
Fill 5 ml, freeze-dry at -20 ° C, and plug into a rubber stopper.
The lyophilized product was used as an injection. Formulation Example 6 hTPO163 obtained in Example 65
After concentrating the fractions and aseptically filtering this, 10ml vials
It was filled in a bottle to give an injection. <Formulation Example 7> Reference Example Human TP obtained in Example 57
The O fraction was concentrated, aseptically processed, and frozen at -20 ° C.
The frozen product thus obtained was used as an injection. <Formulation Example 8> Human TPO fraction obtained in Example 57
Was concentrated in a 10 ml vial bottle by aseptic operation.
1 liter, freeze-dried at -20 ° C, and frozen with a rubber stopper.
The dried product was used as an injection. <Formulation Example 9> Human TPO fraction obtained in Example 57
Was concentrated and sterile filtered, then placed in a 10 ml vial.
It was filled into an injection.

[Sequence list]

[Brief description of drawings]

FIG. 1: Gel filtration chromatography (Sephacryl S-2) in rat TPO purification from XRP.
00 HR column) and rat CFU
-Graph showing TPO activity in MK assay.

FIG. 2: Reversed phase chromatography (Capcell Pak) for purification of rat small molecule TPO preparation derived from XRP.
Cl 300A column) chromatogram and TPO activity in rat CFU-MK assay.

FIG. 3: Reversed phase chromatography (Capcell Pak) for purification of rat small molecule TPO preparation derived from XRP.
Cl 300A column) TPO active fraction FA (tube number 36 to 42), a photograph showing separation by SDS-polyacrylamide gel electrophoresis, and rat CFU-
The graph which shows TPO activity in a MK assay.

FIG. 4: Reversed phase chromatography (Capcell Pak) for purification of rat small molecule TPO preparation derived from XRP.
Cl 300A column) TPO active fraction FA 3
The graph which shows the peptide map by step digestion.

FIG. 5 is a graph showing rat plasma-derived TPO activity in the rat CFU-MK assay.

FIG. 6 is a conceptual diagram showing the construction of the expression vector pEF18S.

FIG. 7. pEF1 in rat CFU-MK assay.
8 is a graph showing TPO activity in the culture supernatant of COS1 cells into which 8S-A2α has been introduced and expressed.

FIG. 8. pEF1 in rat CFU-MK assay.
8 is a graph showing TPO activity in the culture supernatant of COS1 cells into which 8S-HL34 has been introduced and expressed.

FIG. 9: pHT1 in rat CFU-MK assay
6 is a graph showing TPO activity in the culture supernatant of COS1 cells in which -231 was introduced and expressed.

Figure 10a: pH in the rat CFU-MK assay.
3 is a graph showing TPO activity in the culture supernatant of COS1 cells into which TF1 has been introduced and expressed.

FIG. 10b is a graph showing TPO activity in the culture supernatant of COS1 cells into which pHTF1 was introduced and expressed in the M-07e assay.

FIG. 11: Outline of restriction enzyme map of phage clone λHGT1. (In the figure, E: EcoRI, H: HindII
I, S: shows Sal I. )

Figure 12a: pE in rat CFU-MK assay.
The graph which shows TPO activity in the COS1 cell culture supernatant which introduced and expressed FHGTE.

Figure 12b: pEFHGT in M-07e assay.
TPO in COS1 cell culture supernatant in which E was introduced and expressed
A graph showing activity.

FIG. 13a: pHT1-211 # 1, and pHT1-291 # in rat CFU-MK assay.
1 and C into which pHT1-171 # 2 was introduced and expressed
The graph which shows the TPO activity in the OS1 cell culture supernatant.

Figure 13b: pH in the rat CFU-MK assay.
The graph which shows the TPO activity in the COS1 cell culture supernatant which introduce | transduced / expressed T1-163 # 2.

Figure 14: pHT1-21 in M-07e assay.
1 # 1, pHT1-191 # 1, pHT1-171 #
2 and C introduced with pHT1-163 # 2
The graph which shows the TPO activity in the OS1 cell culture supernatant.

FIG. 15 is a chromatogram of reverse phase chromatography (Vydac C4 column) in the purification of human TPO from the culture supernatant of CHO cells into which pDEF202-hTPO-P1 was introduced and expressed.

FIG. 16: Human TP purified from the culture supernatant of CHO cells into which pDEF202-hTPO-P1 was introduced and expressed.
A photograph showing separation of O by SDS-polyacrylamide gel electrophoresis.

FIG. 17 is a chromatogram of reverse phase chromatography in the purification of human TPO from Escherichia coli into which pCFM536 / h6T (1-163) has been introduced and expressed.

FIG. 18 is a photograph showing separation by SOS-polyacrylamide gel electrophoresis of h6T (1-163), a mutant human TPO separated and purified from Escherichia coli into which pCFM536 / h6T (1-163) had been introduced and expressed.

FIG. 19: Human TPO expression plasmid pDEF202-
hTPO163 using the culture supernatant obtained by transfecting hTPO 163 into CHO cells as a starting material
Of hTPO163 on Superdex 75 pg column for purification of. Protein was measured by UV absorption at 220 nm.

FIG. 20: Human TPO expression plasmid pDEF202-
hTPO163 using the culture supernatant obtained by transfecting hTPO 163 into CHO cells as a starting material
In the purification of 1., an SDS-polyacrylamide gel electrophoresis photograph of the hTPO163 standard product obtained with a Superdex 75 pg column. Each hTPO163 was silver stained.

FIG. 21 shows the structure of the expression vector pSMT201.

FIG. 22: βGL-TP in the M-07e assay.
C introduced and expressed O, N3 / TPO, O9 / TPO
The graph which shows TPO activity in OS7 cell culture supernatant.

FIG. 23 is a graph showing TPO activity in COS7 cell culture supernatants into which the human TPO insertion / deletion derivative was introduced / expressed in the M-07e assay.

FIG. 24 is a graph showing changes in the platelet count when human TPO was intravenously or subcutaneously administered to normal mice.

FIG. 25 is a graph showing changes in platelet count when human TPO was subcutaneously administered to normal mice at different doses.

FIG. 26 is a graph showing changes in the number of platelets when human TPO is administered after the anticancer drug (5-FU) has been administered to mice.

FIG. 27 is a graph showing changes in the number of platelets when human TPO was administered after the anticancer drug (ACNU) was administered to mice.

FIG. 28 is a graph showing changes in the platelet count when human TPO was administered after BMT (bone marrow transplantation) was performed on mice.

FIG. 29 is a graph showing changes in platelet count when human TPO was administered to mice after irradiation.

FIG. 30 is a graph showing the change in platelet count when hTPO163 was subcutaneously administered to normal mice.

FIG. 31 is a graph showing changes in platelet count when hTPO163 was administered to mice after the administration of an anticancer drug (ACNU).

FIG. 32: Human TPO derivative expressed in E. coli (H1
33R, S148P, Q115R) is a graph showing the TPO activity in the M-07e assay.

FIG. 33. Human TPO derivative expressed in E. coli (M1
43R, L129R, G82L, G146L, K59
R) is a graph showing TPO activity in the M-07e assay.

─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] April 27, 1995

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be amended] Title of invention

[Correction method] Change

[Correction content]

Title: DNA encoding a protein having TPO activity

[Procedure Amendment 2]

[Document name to be amended] Statement

[Name of item to be amended] Claims

[Correction method] Change

[Correction content]

[Claims]

25. The method according to claim 21, wherein the eukaryotic cell is a mammalian cell. ─────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] November 17, 1995

[Procedure Amendment 1]

[Document name to be amended] Statement

[Name of item to be amended] Claims

[Correction method] Change

[Correction content]

[Claims]

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical indication C12P 21/02 9281-4B C12N 5/00 B // (C12N 1/21 C12R 1:19) ( (C12N 5/10 C12R 1:91) (C12P 21/02 C12R 1:19) (C12P 21/02 C12R 1:91) (31) Priority claim number Japanese Patent Application No. 6-167328 (32) Priority Date 6 ( 1994) June 15 (33) Priority claiming country Japan (JP) (31) Priority claim number Japanese Patent Application No. 6-227159 (32) Priority date 6 (1994) August 17 (33) Priority claim Country Japan (JP) (31) Priority claim number Japanese Patent Application No. 6-193169 (32) Priority date Hei 6 (1994) August 17 (33) Priority claim country Japan (JP) (31) Priority claim number Japanese Patent Application No. 6-304167 (32) Priority Day No. 6 (1994) November 1, (33) Country claiming priority Japan (JP) (31) Priority holder Number Japanese Patent Application No. 6-298669 (32) Priority Date December 6 (1994) December 1 (33) Priority Claim Country Japan (JP) (31) Priority Claim Number Japanese Patent Application No. 6-341200 (32) Priority Date Hei 6 (1994) December 28 (33) Priority claiming country Japan (JP) (72) Inventor Akihiko Iwamatsu 1-13-5 Fukuura, Kanazawa-ku, Yokohama, Kanagawa Kirin Brewery Co., Ltd. Basic Technology Research Institute (72 Inventor Hironori Akahori 3 Miyahara-cho, Takasaki-shi, Gunma Kirin Brewery Co., Ltd. Pharmaceutical Research Laboratory (72) Inventor Ryota Kuroki 1-13-5 Fukuura, Kanazawa-ku, Yokohama, Kanagawa Kirin Kiryu Brewery Co., Ltd. ) Inventor Toshiyuki Shimizu 1-13-5 Fukuura, Kanazawa-ku, Yokohama-shi, Kanagawa Kirin Brewery Co., Ltd., Fundamental Technology Research Institute (72) Takanori Muto 1-13-5, Fukuura, Kanazawa-ku, Yokohama, Kanagawa Prefecture Kirin Brewery Co., Ltd. Basic Technology Research Institute

Claims (31)

[Claims] 1. Having TPO activity, substantially SEQ ID NO: 1.
A protein having the amino acid sequence shown in 6. 2. The protein according to claim 1, which has TPO activity and has the amino acid sequence shown in SEQ ID NO: 16. 3. The amino acid sequence shown in SEQ ID NO: 16,
Alternatively, the amino acid sequence has a substitution, deletion, insertion, and / or addition in a part of the amino acid sequence, and TPO
A protein having activity. 4. The protein according to claim 3, which comprises the amino acid sequence of positions 7 to 151 in the amino acid sequence shown in SEQ ID NO: 16. 5. The protein according to claim 4, which comprises the amino acid sequence of positions 1 to 151 of the amino acid sequence shown in SEQ ID NO: 16. 6. The protein according to claim 4, which comprises the amino acid sequence of positions 7 to 163 of the amino acid sequence shown in SEQ ID NO: 16. 7. The amino acid sequence shown in SEQ ID NO: 16 including the amino acid sequence from 1st position to 163rd position.
The protein according to. 8. The protein according to claim 3, which has at least one of the amino acid mutations shown in (a) to (v) below in the amino acid sequence shown in SEQ ID NO: 16; A serine residue is replaced with an alanine residue, and an alanine residue at position 3 is replaced with a valine residue. (B) An arginine residue at position 25 is replaced with an asparagine residue. (C) Histidine at position 33. The residue is substituted with a threonine residue. (D) The arginine residue at the 25th position becomes an asparagine residue,
And the glutamic acid residue at position 231 is replaced with a lysine residue (e) the histidine residue at position 33 is deleted (f) The glycine residue at position 116 is deleted (g) 117 The arginine residue at position 33 is deleted (h) The threonine residue is inserted between the histidine residue at position 33 and the proline residue at position 34 (i) The histidine residue at position 33 and position 34 An alanine residue is inserted between the proline residues of (j) a histidine residue at position 33 and a glycine residue between the proline residues at position 34 (k) a histidine residue at position 33 A glycine residue is inserted between the group and the proline residue at the 34th position, and the proline residue at the 38th position is replaced with a serine residue. (L) Glycine residue at the 116th position and arginine residue at the 117th position An asparagine residue is inserted between (M) an alanine residue is inserted between the glycine residue at position 116 and the arginine residue at position 117 (n) a glycine residue between the glycine residue at position 116 and the arginine residue at position 117 (O) the leucine residue at position 129 is replaced with an arginine residue (p) the histidine residue at position 133 is replaced with an arginine residue (q) a methionine residue at position 143 Is substituted with an arginine residue (r) The glycine residue at position 82 is replaced with a leucine residue (s) The glycine residue at position 146 is replaced with a leucine residue (t) 148 (U) The lysine residue at position 59 is replaced with an arginine residue (v) The glutamine residue at position 115 is replaced with an arginine residue. 9. ThrSerIleGly is further added to the C terminus.
TyrProTyrAspValProAspTyrA
laGlyValHisHisHisHisHisHi
9. The protein according to claim 3, wherein the polypeptide of s is added. 10. A methionine residue at the -2 position and a lysine residue at the -1 position are further added.
The protein according to claims 3 to 8. 11. The protein according to claim 3, wherein a methionine residue is further added at the -1 position. 12. The protein according to claim 3, wherein a glycine residue is further added at the -1 position. 13. A DNA containing a nucleotide sequence encoding the amino acid sequence of the protein according to claim 1. 14. A vector p carried on Escherichia coli DH5.
A DNA containing a nucleotide sequence encoding an amino acid sequence of a protein having TPO activity, which is incorporated into EF18S-A2α. 15. A vector p carried on Escherichia coli DH5.
A DNA containing a nucleotide sequence encoding an amino acid sequence of a protein having TPO activity, which is incorporated in HT1-231. 16. A recombinant vector containing the DNA according to claim 13. 17. A prokaryotic or eukaryotic cell transformed with the DNA according to claim 13. 18. A bacterium transformed with the DNA according to claim 13. 19. Escherichia coli transformed with the DNA according to claim 13. 20. An insect cell transformed with the DNA according to claim 13. 21. A mammalian cell transformed with the DNA of claim 13. 22. A method for producing a protein having TPO activity, which comprises culturing the prokaryotic or eukaryotic cell according to claim 17, and isolating and purifying the produced protein having TPO activity. 23. The method according to claim 22, wherein the prokaryotic cell is a bacterium. 24. The production method according to claim 23, wherein the bacterium is Escherichia coli. 25. The eukaryotic cell is an insect cell.
The manufacturing method described. 26. The method according to claim 22, wherein the eukaryotic cell is a mammalian cell. 27. A pharmaceutical composition comprising the protein according to claim 1 and a pharmaceutically acceptable carrier. 28. A platelet increasing agent comprising the protein according to claim 1 as an active ingredient. 29. A therapeutic agent for platelet disorders containing the protein according to any one of claims 1 to 12 as an active ingredient. 30. A therapeutic agent for thrombocytopenia containing the protein according to any one of claims 1 to 12 as an active ingredient. 31. The therapeutic agent for thrombocytopenia according to claim 30, wherein the thrombocytopenia is chemotherapy, radiation therapy or bone marrow transplantation.