JPH08149981A - Method for antigenic specific immunosuppression by t-cell alpha chain - Google Patents

Abstract

PURPOSE: To design therapeutic protocols for treating allergy, auto-immunity, transplantation rejection and cancers by antigen-specifically regulating immune systems by T-cell receptor α(TCR α) chains capable of binding to the antigen.

CONSTITUTION: An immune system is modulated in an antigen-specific fashion by T-cell receptor α chains which are capable of binding to the antigen and antigen-specifically regulating the immune response generated against its antigen by suppression, enhancement or the like, in the presence of an accessory component. The accessory component is prepared from a supernatant of stimulated T cells, after eliminating soluble factors such as TCR α chains, which are capable of directly binding to the antigen used to stimulate the T cells. The accessory component itself or by itself does not act on the immune response in the absence of the TCR α chains.

COPYRIGHT: (C)1996,JPO

Description

Detailed Description of the Invention

The present invention is directed to patent application serial number No. Serial No. It is a partial continuation application of 07 / 752,820.

[0002]

[Industrial applications]

1. FIELD OF THE INVENTION The present invention relates to methods of regulating the immune system in an antigen-specific manner. The T cell receptor alpha chain capable of binding the antigen of interest is used in protocols designed to suppress or enhance the immune response to a particular antigen. The treatment protocols described herein can be used to treat allergies, autoimmunity, transplant rejection and cancer.

[0003]

[Prior art]

2. Description of Related Art Immunologists have long studied the immune system to discover mechanisms that control the immune response. As a result, various drugs or protocols have been used that non-specifically suppress or enhance the immune response as a whole. However, this type of regulation is unsatisfactory because it affects the entire immune system. It is not based on an understanding of the specific components of the immune system that result in the regulation of the immune response to specific antigens only. For example, in the treatment of allergies, it would be advantageous to selectively suppress the immune response to a particular allergen without suppressing the individual's entire immune system. The invention described and claimed in part herein, based in part on the discovery that the soluble T cell receptor alpha chain is an antigen-specific mediator of the immune response, is directed to suppressing or enhancing the immune response to a particular antigen. A method of using the T cell receptor alpha chain.

2.1. Regulation of Immune Responses When foreign antigens are introduced into an individual, they consist of two main components, a cellular immune response and a humoral immune response mediated by functionally distinct lymphocyte populations known as T cells and B cells, respectively. An immune response is elicited. Do T cells "help" various other cell types in the immune system,
Alternatively, it responds to antigenic stimulation by producing a lymphokine that activates. Moreover, certain T cells can be cytotoxic effector cells. On the other hand, the B cell response consists primarily of antibodies, which are secreted products that bind antigen directly. Helper T cells ( _TH ) can be distinguished from cytotoxic T cells and B cells by expressing a glycoprotein called CD4 on their cell surface. C
Although the mechanism by which D4 ⁺ helper T cells regulate other cell types has not been fully described, the role of certain subsets in the CD4 ⁺ T cell population has been studied (Mosmann and Coffman, 1989, Ann. . Rev. Immunol.
7: 145-173). Type 1 helper cells (T _H1 ) are activated to interleukin-2 (IL-2) and γ-
It produces interferon, while type 2 helper cells ( _TH2 ) produce IL-4 and IL-5. Based on the characteristics of lymphokine production, T _H1 appears to be involved in promoting the proliferation of other T cells, while the T _H2 factor specifically
It regulates B cell proliferation, antibody synthesis, and antibody class switching. Further, produced by T _H1 .gamma.
Since interferon inhibits the growth and function of T _H2,
These two T _H populations may be in mutual control.

Both B-cell and T-cell responses are marked by their exquisite specificity for immune antigens, but their mechanism of antigen recognition is different. Antibodies bind antigen directly on solid surfaces or in solution, whereas T cells only react with antigen present on a solid phase, such as the surface of antigen presenting cells. In addition, major histocompatibility complex (MHC)
The antigen must be presented to T cells in the presence of a Class I or Class II molecule encoded by MHC refers to a group of genes that encode proteins with different immune functions. Class I gene products are found in all cells and are the targets of major transplant rejection. Class II gene products are primarily expressed on cells of various hematopoietic systems and are involved in cell-cell interactions during the immune response. class
Both I and class II proteins have been shown to function as receptors for antigens on the surface of antigen presenting cells. Another level of complexity in the interaction between T cells and antigen is that MHC haplotypes (combinations of all alleles in the complex) are the same between antigen presenting cells and responding T cells. It only happens. Therefore, T cells specific for a particular antigen will be matched to MHC
It will respond only if the antigen is presented by cells expressing. This phenomenon is known as MHC-restriction.

In 1970, Gershon and Kondo (Gershon and Kondo, 1970, Immunology 18: 723)
We have proposed that T cells may also have a negative effect on the process of the immune response. This idea of immune regulation was initially questioned,
It has become accepted by many immunologists as it provides a conceptual construct for maintaining homeostasis of the immune system after the antigen has been cleared by a constant immune response and no longer requires a continuous response. . Since then, antigen-specific suppressor T cells (Ts) have been reported in many experimental systems (Green et al., 1983, Ann. Rev. Immuno.
l. 1: 439-463; Dorf and Benacerraf, 1984, Ann. Rev.
Immunol. 2: 127-158).

In an attempt to elucidate the mechanism of Ts action, numerous soluble mediators were discovered in T cell culture supernatants. Therefore, it was inferred that Ts functions via the release of T suppressor factor (TsF), which in turn acts on other T and B cells.
An elaborate model was proposed based on experimental data to clarify the complex interaction between different Ts subsets and their TsF (Asherson et al., 1986, Ann. Re.
v. Immunol. 4: 37-68).

Having identified cell surface markers specific for a functionally distinct subset of T cells, an attempt was made to search for markers characteristic of Ts and its TsF. Phenotypic studies of the Ts surface initially showed that they express CD8 (Lyt-2), a marker shared by T cells with potential cytotoxicity.
Only in 1976 was an antiserum reported to react with a structure specifically expressed by Ts in mice (Murphy et al., 1976, J. Exp. Med. 144: 699; Tada e.
t al., 1976, J. Exp. Med. 144: 713). According to mapping studies of the gene encoding the antigen,
It was located in the I region between I-Eα and I-Eβ in HC. This locus was called I-J.

In the early 1980s, the field of cell-mediated immunity moved from phenomenology to molecular characterization. This shift has led to many discoveries, including characterization of the T cell receptor (TCR) (see Section 2.2 below), identification of various lymphokines, and elucidation of the three-dimensional structure of MHC proteins. However, applying molecular cloning techniques to T cell-mediated suppression studies has been fruitless. For example, attempts to biochemically purify TsF to homogeneity were largely unsuccessful. When the gene for the I region of mouse MHC was isolated and sequenced, the DNA between I-Eα and I-Eβ appeared to be insufficient to explain the IJ gene. In addition, many T cell clones and T cell hybridomas were tested for TCR β gene rearrangements, and only helper and cytotoxic T cells contained such rearrangements and all tested. Ts was negative, indicating that Ts does not express a functional receptor (Hedrick et al., 1985, Proc. Na
tl. Acad. Sci. USA 82: 531-535).

2.2. Structure and Function of T Cell Receptors The specificity of T and B cell responses to antigen is the function of the unique receptors expressed by these cells.
Research on the B cell receptor has progressed rapidly with the discovery that B cells secrete its receptor in the form of an antibody.
Plasmacytoma is a naturally occurring tumor of antibody-producing cells that are monoclonal in nature. These tumors have continually provided a homogeneous protein that was used for the initial purification of the antibody molecule as well as for its structural characterization (Potter, 19
72, Physiol. Res. 52: 631-710). Now, the cell surface form is transmembrane bound (transmembrane anchor).
ring)), except that the antibody is identical to its membrane-bound counterpart (Tonegawa, 1983, Nature 302: 575-58).
1).

On the other hand, in an early study on TCR, T
Unsuccessful in detecting the secreted form of CR and therefore
The approach using soluble antibodies has not been used successfully. Furthermore, the discovery of MHC restriction in T cell antigen recognition added another level of difficulty to the analysis of TCRs (Zinkernagel and Doherty, 1974, Natur.
e 248: 701-702). At that time, a single TCR was the antigen and MHC
It was controversial whether it could explain that it binds to both or whether two separate receptors are involved. However, it was apparent that the TCR was not identical to the B cell receptor.

With the advent of the long-term culture method for monoclonal antibodies, recombinant DNA methods and antigen-specific T cells, the identification of TCRs became much easier in the 1980s. Monoclonal antibodies raised against a clonal population of T cells were found to react specifically only with immune T cells (Allison et al., 1982, J. Immunol. 1).
29: 2293; Haskin et al., 1983, J. Exp. Med. 157: 114.
9; Samelson et al., 1983, Proc. Natl. Acad. Sci. U
SA 80: 6972). By the use of clone-specific antibodies against these immunoprecipitated T cell membranes, 4 by SDS-PAGE
A band with a molecular weight of 6,000 daltons was revealed. A band of 90,000 daltons was detected under non-reducing conditions, suggesting a dimeric structure of TCR. The following experiments established that the functional TCR is a heterodimer composed of two disulfide-bonded glycoproteins known as α and β (Marrack and Ka
ppler, 1987, Science 238: 1073-1079). At about the same time,
Complementary DNA (cDNA) clones encoding the α and β chains have been isolated in humans and mice (Hedrick et a
l., 1984, Nature 308: 149-153; Hedrick et al., 198.
4, Nature 308: 153-158; Yanagi et al., 1984, Nature
308: 145-149). Sequence analysis of the cDNA showed that the coding sequence consisted of rearranged gene segments similar to those of the antibody. Transfer of α and β genes into recipient cells was shown to be necessary and sufficient to confer antigen specificity and MHC restriction (Dembic et al., 1986, Nature 320: 23).
2-238). Therefore, the heterodimeric TCR seems to be responsible for recognition of the combination of antigen and MHC. Several studies suggest that the α and β variable regions are distorted in the orientation of antigen and MHC recognition (Kappler
et al., 1987, Cell 49: 263-271; Winoto et al., 198.
6, Nature 324: 679-682 ;. Tan et al., 1988, Cell 54: 2.
47-261), while other studies suggest that recognition is a property expressed by the entire receptor (Kuo an.
d Hood, 1987, Proc. Natl. Acad. Sci. USA 84: 7614-7
618; Danska et al., 1990, J. Exp. Med. 172: 27-3
3).

[0013] CD3 is a complex of polypeptides that bind non-covalently to TCR and are involved in a series of transmembrane transmembrane signals leading to T cell activation triggered by TCR occupancy (Clevers et al. al., 1988, Ann. Rev. Im
munol. 6: 629). Direct stimulation of CD3 by antibodies has been shown to mimic the normal pathway of T cell activation (Meuere
t al., 1983, J. Exp. Med. 158: 988). For transport of CD3 to the surface of T cells, this is the complete heterodimer TC
It is necessary to bind the R complex intracellularly. TCR
Complexes of both α and β chains with CD3 polypeptides have been shown to be assembled in the endoplasmic reticulum (Minami et a
l., 1987, Proc. Natl. Acad. Sci. USA 84: 2688-2692;
Alarcon et al., 1988, J. Biol. Chem. 236: 2953-296
1). TCR, a properly formed and complete receptor
/ CD3 is then transported to the cell surface as a functional unit. The incompletely assembled receptor complex is transported through the Golgi apparatus to lysosomes where it is degraded. Thus, the unbound α and β chains usually do not appear accessible to the outside of T cells. Even the intact TCR α and β receptors are not readily detected extracellularly in secreted form. Until now, it was thought that its function in antigen recognition was further restricted to the heterodimer form on the T cell surface.

It has now become clear that αβTCR is expressed in the majority of functional T cells. A second type of TCR consisting of γδ heterodimers was identified, but these receptors are only expressed on a part of peripheral T cells and their involvement in antigen-specific recognition has not yet been demonstrated. Structurally, T cell αβ and γδ receptors are highly homologous to antibody molecules in terms of primary sequence, gene organization and DNA rearrangement (Davis and Bjorkm).
an, 1988, Nature 334: 395-402). However, T cell antigens are distinguished from antibodies in two major ways: T
CR is found only on the cell surface and recognizes antigen only in the presence of MHC encoded molecules.

2.3. Soluble T Cell Receptors Recent studies suggest that in some cases TCRs become detached or released from cells (Guy et al., 1989,
Science 244: 1477-1480; Fairchild et al., 1990, J.
Immunol. 145: 2001-2009). However, it has not been shown whether such secreted molecules are complete TCRs, partial fragments, or other molecules with epitopes that are cross-reactive with TCRs. Prior to the findings demonstrated by the examples described herein, the idea that a functionally active TCR alpha chain could be released from T cells independently of the rest of the TCR component was controversial and questioned. It was Klausner and his colleagues (Bonifacino
et al., 1990, Science 247: 79-82) showed that TCRα was retained and degraded in the endoplasmic reticulum when not complexed with CD3δ, and (Minami et al., 198).
7, Proc. Natl. Acad. Sci. USA 84: 2688-2692) CD3
-T not transported to the cell surface as part of the TCR complex
It has been shown that CRα is degraded in lysosomes. These observations negate the pathway by which TCRα is released from cells. Similarly retained and degraded by the endoplasmic reticulum
Study on CRβ (Wileman et al., 1990, Cell Regulatio
n 1: 907-919) suggest that TCR assembly and transport is more complex. For example, TCRβ foreign gene
In SCID mice expressing (transgene), TCRβ
Is expressed on the surface of immature thymocytes in the absence of TCRα or CD3 components (Kishi et al., 1991, EM.
BO J. 10: 93-100). Also, when a truncated TCR β chain gene containing only VDJ and Cβ ₁ domains was constructed, such a molecule was secreted contrary to the expectation that it would be degraded (Gascoigne, 1990, J. Biol. Chem. .265: 929
6-9301). Therefore, in some cells, TCR may be released in small amounts, presumably in the form of a complex with other unidentified molecules and / or in a post-translational truncated form.

Numerous experiments have reported the presence of unidentified soluble regulators or factors that react with antibodies to TCRα. For example, pol, which is a synthetic polypeptide antigen
In the in vitro assay of CD4 ⁺ helper T cell hybridoma A1.1 specific for y18, plus 1-A ^d , immunoregulatory activity in a cell-free system was detected; that is, the exact antigen specificity of the factor Consistent with the specificity of T cell hybridomas (Zheng et al., 1988,
J. Immunol. 140: 1351-1358). TCR Vα and V
Although antisense oligonucleotides corresponding to β were found to specifically inhibit TCR-CD3 expression on the cell surface, only antisense to Vα inhibits production of the soluble regulatory activity of A1.1, Vβ (or control oligonucleotide) did not inhibit (Zheng et al.,
1989, Proc. Natl. Acad. Sci. USA 86: 3758-3762).
In a very recent study, the antigen-specific regulatory activator of A1.1 bound to a TCRα-specific monoclonal antibody column from which was eluted a protein of 46,000 daltons molecular weight from metabolically labeled supernatant. Was determined as; anti-TCRβ, anti-TCR V
It is not bound by β or anti-CD3ε antibody (Bissonnette et al., 1991, J. Immunol. 146: 2898-2.
907). TCR α chain share an antigenic determinant, but surface TC
Non-R-derived Ts activators have been reported, but not characterized (Collins et al., 1990, J. Immunol.
145: 2809-2812). Takada (1990, J. Immunol. 1
45: 2846-2853) also shares TCR α chain antigenic determinants with T
s activator, which was MHC restricted. In contrast to these results, Fairchild (1990,
J. Immunol. 145: 2001-2009) reported a DNP-specific Ts factor that reacts with anti-TCR Cα but also with anti-Vβ and TCR-β antibodies. Prior to the discoveries described herein, the role of TCRα as a soluble immune regulatory mediator responsible for the observed antigen-specific regulatory activity was identified,
No one explained this.

TC to produce soluble TCR molecules
Three main strategies to replace or delete the R transmembrane region have been tried. The most direct approach is to add the translation stop codon to TCRα or TCRα /
It was introduced upstream of β-dimer. COS-1 cells, COS-7 cells or H transfected with cDNA
In ela cells, TCRα has been reported to be rapidly degraded in the non-lysosomal compartment before entering the Golgi apparatus (Wileman et al., Cell. Biol. 110: 973-986, 1990; Li.
ppincott-Schwartz et al., Cell, 54: 209-220, 1988;
Baniyash et al., J. Biol. Chem. 263: 9874-9878, 198.
8; Bonifacino et al., Science 247: 79-82, 1990; Bon
ifacino et al., Cell 63: 503-513, 1990; Manolios et
al., Science 249: 274-277, 1990; Shin et al., Scie.
nce 259: 1901-1904, 1993). The second strategy is TCR
The extracellular V and C domains of the α and β chains were reattached to the placental alkaline phosphatase or glycosyl-phosphatidylinositol membrane anchors of the Thy-1 molecule (Lin et al., Science 249: 677-679, 1990; Slan.
etz et al., Eur. J. Immunol. 21: 179-183, 1991).
Treatment of cells with phosphatidylinositol-specific phospholipase C results in T binding to the corresponding lipid.
The CR polypeptide was released from the membrane in soluble form, indicating that the solubilized TCRαβ heterodimer specifically reacts with anti-clonotype monoclonal antibodies. However, the yield of released TCR polypeptide was too low to allow this molecule to be used in clinical applications. The third approach is the constant region of TCR and immunoglobulin (Gregoire et al., Proc. Natl. Acad. S
ci. USA 88: 8077-8081, 1991; Weber et al., Nature 3
56: 793-796, 1992) and the zeta chain of CD3 (Engel et al.
al., Science 256: 1318-1321, 1992). These fusion proteins are secreted into the medium by transfection of myeloid or leukemic cells and these soluble TCRs retain all serologically detected epitopes of the corresponding cell surface bound TCRs. It was shown that However, these fusion proteins show low affinity recognition of the antigen and may be immunogenic. Furthermore, the functional expression of the TCR α chain alone was never successful.

Expression of TCRs in E. coli using fusion proteins of Vα and Vβ polypeptides has been previously reported (Soo Hoo et al., Proc. Natl. Acad. Sci. U.
SA 89: 4759-4763, 1992). However, only 1% of the protein could be recovered as refolded protein. In the present invention, the yield of refolded protein is comparable to typical soluble proteins such as cytokines, thus providing a uniform TCRα molecule for clinical use.

Various systems have been developed by many researchers for expressing animal proteins in E. coli.
However, many difficulties are often encountered in expressing heterologous genes in this organism. For example, there are significant differences between E. coli and animal genes in codon usage patterns and their translation initiation signals, which prevent efficient translation of animal mRNAs on bacterial ribosomes (Orormo et al., Nucl. Acids Res. 10: 2971-2996, 19
82). Alternatively, heterologous proteins synthesized in E. coli may not accumulate to significant levels due to host cell protease activity (Gottesman, Ann.
u. Rev. Genet. 23: 163-198, 1989). In addition, TCR
Since secretory or membrane-bound molecules, such as, need to be glycosylated and disulfide bridged for stability and solubility, the physical properties of therapeutically useful proteins can be problematic. Since such a stabilization step cannot be performed in the bacterial cytoplasm, the heterologous protein produced in E. coli is not included in the inclusion body (inclusion body).
ies), often forming insoluble aggregates (Schein et al., Bio / Technology 7: 1141-1149, 198).
9). The present invention provides a method for expressing truncated TCRα polypeptides in E. coli inclusion bodies to regenerate and purify biologically active TCRα.

SUMMARY OF THE INVENTION It is an object of the present invention to provide a method of using TCRα to regulate an immune response in an antigen-specific manner and a method of producing TCRα used therefor.

[0020]

SUMMARY OF THE INVENTION The present invention is directed to methods of utilizing the TCR alpha chain to regulate immune responses in an antigen-specific manner. A TCRα chain exhibiting the following two important features that can be evaluated in vitro is selected for production and use in the practice of the invention: TCRα for use in the method of the invention.
The chain must be able to bind the antigen of interest,
And, in the presence of the adjunct components described herein, the specific immune response generated against that antigen must be modulated, for example, by suppressing or enhancing the antigen-specific immune response.

TCR α chains exhibiting such properties can be advantageously used in humans or animals in vivo or in vitro in the procedures described for downregulating or upregulating an antigen-specific immune response. . For example, in patients with hyperimmune responses such as allergies, autoimmune diseases, or graft rejection, effective administration of the causative antigen-specific TCRα chain that suppresses the antigen-specific immune response in the presence of the adjunct component. In vivo
Can be administered at. Conversely, the immunosuppressed patient's body fluids can be tested for the presence of soluble TCR alpha chains that exhibit immunosuppressive effects. Enhancement of the immune response of the patient to the antigen may be accomplished by removing or neutralizing the TCRα chain using an antibody specific for the soluble TCRα chain, or by antisense oligonucleotides that inhibit the expression of the TCRα chain. It can be carried out.

Described herein are in vitro analytical methods that can be used to assess the TCR α chain used in the present invention. For example, several immunoaffinity methods can be used to assess antigen binding and are tested for T
In order to evaluate the regulatory function of CRα chain, the plaque forming cell (PFC) analysis method (hereinafter referred to as PFC analysis method) described in detail below can be used. Briefly, the TC to be tested in this PFC method
The Rα chain is added to the spleen cell culture containing the antigen of interest bound to an immunogenic lytic carrier such as xenogeneic red blood cells in the presence of auxiliary components. The immunomodulatory effect of the TCR α chain is evaluated by examining the immune response that occurs in a few days, which is indicated by the development of plaque-forming cells in the culture. That is, the immune response produces cells that produce complement-fixing antibodies to the carrier (eg, erythrocytes), which are mixed in a monolayer by mixing the cells with complement and the carrier (eg, erythrocytes). It can be detected by the analytical method formed. Cell lysis of the carrier produces one clear plaque corresponding to the presence of one plaque forming cell (PFC). Inhibition of PFC production in the culture medium indicates that the immune response was suppressed by the intervening TCRα chain specific for the bound antigen. As described in more detail below, the adjunct components used in the assay include stimulated T cell depletion of soluble factors such as TCR α chains, which directly bind to the antigen used to stimulate T cells. Prepared from the supernatant. The accessory component, by itself and by itself, has no effect on the immune response in the absence of the TCRα chain.

The present invention is based, in part, on the discovery of a soluble TCR α chain that is constitutively secreted by T cell hybridomas. As demonstrated in the examples, this secreted TCR α chain can bind directly to its antigen and, in the presence of accessory components, suppress the immune response that normally occurs against that antigen. However, the present invention applies to all TCRα
The chain gene can be cloned, expressed, and, using the techniques and methods described herein, the gene product can be tested for its suitability in practicing the present invention, so that it is naturally secreted. It is not limited to using the TCRα chain. In addition, the assay methods described herein can be used to evaluate other molecules that exhibit immunomodulatory function in an antigen-specific manner, such as antibodies, other TCR components.

In one aspect of the invention, a novel fusion gene expression system based on using rat calmodulin as a fusion partner is provided. The system can preferably be used for high expression and purification of biologically active TCRα protein. Expression of rat calmodulin in E. coli is dependent on the E. coli trp promoter and t
This has been successfully done by using an expression vector containing the rpA terminator (Matsuki et al., Biotech, A.
ppl. Biochem., 12: 284-291, 1990). In this system, rat calmodulin cDNA was modified to remove the 5'untranslated sequence and incorporate a consensus sequence for the E. coli ribosome binding site. A number of codons for the N-terminal amino acid were chosen, suitable for the E. coli consensus nucleotide sequence around the translation initiation codon. By inducing expression in E. coli, soluble rat calmodulin accounted for over 30% of total cellular protein. Using phenyl-Sepharose column chromatography, approximately 100 mg of 90% pure recombinant calmodulin was obtained from 1 liter culture. In the present invention, TC is added at the 3'end of the rat calmodulin gene.
To fuse the Rα gene, an additional sequence encoding a protease cleavage site recognized by thrombin, Lys-Val-Pro-Arg-Gly (Chan.
(Chang), Eur. J. Biochem., 151: 217-224, 1985) is inserted at the C-terminus of calmodulin. This ingenuity allows the TCRα protein to be cleaved for many reasons: 1) high expression levels, 2) the fusion protein is expressed in soluble form, 3) purification of the protein is surprising. Simple, 4) no separate refolding process for each TCRα protein is required.

5. DETAILED DESCRIPTION OF THE INVENTION The present invention includes the use of the antigen-binding alpha chain of the T cell antigen receptor in the regulation of antigen-specific immune responses.
According to one aspect of the invention, the ability of the TCR alpha chain to bind to an antigen and modulate the immune response specific for that antigen is evaluated. Described herein are in vitro assays used for this purpose. TCRα showing appropriate activity
The chains can be produced in large quantities, for example by recombinant DNA and / or chemical synthesis methods, and used to upregulate or downregulate the immune response to a particular antigen. For example, hypersensitivity reactions, autoimmune responses and graft rejection responses can be suppressed with TCRα chains that are specific for their corresponding antigens and induce antigen-specific suppression. Alternatively, immunity to an antigen can be increased by specifically removing the α chain or inhibiting the production of such α chain in an individual in order to specifically enhance the immune response to the specific antigen. Conversely, the TCRα chain that enhances the immune response to the antigen can be identified and utilized.

The present invention is, in part, a TCRα that binds directly to an antigen and suppresses the immune response generated against the antigen.
Based on the discovery of the secreted form of the chain. In particular, it binds to the antigen and is suitable as an accessory com.
Synthetic polypeptide antigens that continuously released in the presence of secreted form of TCRα chain to inhibit the immune response to the antigen of ponent), poly 18, plus are specific CD4 ⁺ helper T cell hybridoma to 1-A ^d A1.1 is described. A1.1 described herein
Isolation of the TCR α chain gene and its transfer into a poly 18 non-reactive T cell line (see section 6 below), and that the A1.1 TCR α chain gene transcription and translation products in vitro mediate this regulatory activity. (See Section 7 below) indicates that the TCR α chain gene, but not the TCR β chain gene, has a role of directly encoding an antigen and encoding a regulatory factor that mediates a regulatory function. The production of the TCR α chain and its use as an antigen-specific immunoregulator is detailed in the sections below and described by way of example.

5.1. Production of TCR α Chains The present invention relates to TCR α chains that are both antigen-binding and immunoregulatory activities, but are not the complete T cell surface antigen receptors for α and β. Antigen-binding TCRα protein having antigen-specific regulatory activity is produced by various methods. For example, expression of the TCR α chain protein is achieved by recombinant DNA methods and / or chemical synthetic methods based on known amino acid sequences. Alternatively, the TCR α chain can be directly purified from the culture supernatant of a T cell line that continuously releases this active substance.

5.1.1. Evaluation of TCR α Chain Regardless of the method used to produce such TCR α chain, the antigen binding capacity and immunoregulatory activity of the molecule must be evaluated. For example, the ability of the TCRα chain to bind directly to the antigen of interest uses the TCRα chain in place of the antibody normally used in assay systems including ELISA (enzyme linked immunosorbent assay), immunoprecipitation, Western blot, or radioimmunoassay. It can be evaluated by a modified immunoassay method, but is not limited thereto.

The immunoregulatory ability of the antigen-binding TCR α chain is
It may be evaluated using any assay system capable of detecting an immune response in an antigen-specific manner. For example, the PFC assay described and performed herein can be used to identify TCR alpha chains that suppress immune responses directed against specific antigens.
Culturing spleen cells in the presence of highly immunogenic carriers such as sheep red blood cells (SRBC) produces an immune response resulting in plaque forming cells. SRBC cultured spleen cells
(Or a suitable hemolytic carrier) and complement,
The number of PFCs per culture can be assayed by culturing the mixture as a monolayer. Cells surrounded by transparent plaque (eg, hemolyzed red blood cells) are counted as PFC. Inhibition of PFC production in spleen cell cultures, ie reduction in the number of PFCs / culture, indicates suppression of the immune response. T
The following PFC assay may be performed to test the suppressive activity of the CRα chain and to confirm that the suppression is antigen-specific: The antigen of interest is bound to SRBC (Ag-
SRBC), added to splenocytes from non-immunized mice. The immunoregulatory effect of the TCRα chain specific for said antigen is obtained by adding to the culture the TCRα chain to be tested in the presence of the auxiliary components described below (ie the auxiliary component is added before adding the TCRα chain to be tested). , Or should be added at the same time). Control cultures can have the TCRα chain added in the absence of accessory components, or vice versa, or an irrelevant antigen can be used. After culturing, the number of PFC / culture is evaluated from each condition. PF in test culture
Inhibition of C production indicates that the tested TCR α chain antigen-specifically suppresses the immune response that normally occurs in culture, as compared to the inhibition observed in controls.

The auxiliary components used in the test system include the supernatant of stimulated T cells without any soluble factors, including the TCR α chain which directly binds the antigen used to stimulate T cells. As a result, the auxiliary component itself does not suppress the immune response. Carrier used in antigen-specific PFC assay /
Ancillary components are produced from T cells stimulated in vivo with the indicator. For example, the following method can be used for the preparation of the auxiliary component used in the above PFC assay system in which Ag-SRBC is the target. Depleting B cells from spleen cells from SRBC-immunized mice and culturing abundant T cells or producing T cell hybridomas that are reproducible and can be used as a continuous source of culture supernatant To use. Using the PFC assay,
The ability of T cell culture supernatants to inhibit the anti-SRBC immune response is tested. In the PFC assay, SRBC are added to cultured splenocytes in the presence or absence of T cell supernatant. T found to inhibit anti-SRBC response
The cell culture supernatant is then adsorbed with SRBC to remove all soluble factors such as the soluble TCRα chain that directly binds SRBC. The PFC assay is then used to test the ability of the adsorbed supernatant to inhibit the anti-SRBC immune response.
These adsorbed supernatants, which do not inhibit the anti-SRBC response, were found to have a PFC assay (ie A
PFC assay with g-SRBC target). Alternatively, a T cell hybridoma that produces an auxiliary component that does not require an adsorption step;
For example, the hybridoma 3 described below in Section 8 (see Figure 1), which constitutively produces auxiliary components in the culture supernatant.
-1-V may be created. Therefore, the auxiliary component is
Although not inhibitory on its own, it includes one or more factors such that antigen-specific factors such as the TCR α chain can suppress the immune response in an antigen-specific manner. Examples of such assay systems are given below in Section 6.1.5. Described in.

Conversely, TCRα chains that enhance the immune response are identified in a similar manner. In such a case, before adsorption, P
An auxiliary component prepared from T cell hybridomas or T cell culture supernatants showing increased FC production and no activity after adsorption was identified to identify TCRα chains that antigen-specifically enhance the immune response to Ag-SRBC. Designed P
It can be used for FC assay. Since the above assay system uses non-sensitized spleen cell cultures to assess the immune response, and carrier-sensitized spleen cell cultures to prepare the adjunct components, the culture spleen cells will contain animals. It may be limited to using sources of origin (eg, mouse, rat, rabbit and non-human primates). However,
It can be used to test the immunoregulatory activity of human TCR α chain. In fact, many human immune functions have been tested in animal-based assay systems. For example, human antibody effector functions such as complement-mediated hemolysis and cytotoxicity of antibody-dependent cells can be performed using animal serum and animal effector cells, respectively. However, using human cell culture instead of animal spleen cell culture, the above PFC
It is preferred to modify the assay. For example, the effect of the TCR α chain on the immune response to a specific antigen is
mas et al. (1980, J. Immunol. 125: 2402) (Thomas, 19
82, J. Immunol. 128: 1386) also can be evaluated using the reverse hemolytic PFC assay. In this assay system, porkweed mitogen-stimulated T cell supernatants can be used as a source of auxiliary components.

5.1.2. Selection of T Cells Antigen-specific T cells that can be used as a source of the TCRα chain used in the method of the present invention and / or a source of genetic material used to produce the TCRα chain are known in the art in many i.
It can be prepared and selected by the n-vitro method. Sources of T cells can be peripheral blood, lymph nodes, spleen, and other lymphocyte organs, as well as tissue sites infiltrated by T cells such as tumor nodules. Density gradient centrifugation or CD2, C
The T cell fraction may be separated from other types of cells by cell sorting methods using antibodies to T cell surface markers such as D3, CD4, CD8. These methods include, but are not limited to, panning, affinity chromatography, flow cytometry, magnetic bead separation and the like. Negative selection method using antibodies against markers that are not expressed on T cells to remove non-T cell populations or to utilize the properties of non-T cell membranes such as attachment to various substrates to increase the proportion of T cells Can also be used. To select more interesting T cell subsets, more specific markers such as anti-CD4 and anti-CD8 for selection of helper and cytotoxic / suppressor T cells respectively, or T cells such as memory cells. The above method can be applied using antibodies against the markers expressed on the subset.

Antigen-specific T cell lines can be prepared in vitro by repeated stimulation with optimal concentrations of the specific antigen in the presence of appropriate irradiated antigen presenting cells and cytokines.
Can be created with o. Antigen-presenting cells are autologous or MH
It should be obtained from a C-compatible source, which may be macrophages, dendritic cells, Langerhans cells, EBV-transformed B cells or unseparated peripheral blood mononuclear cells. Cytokines may include various natural or recombinant interleukins such as interleukins 1, 2, 4 and 6. For one example of such a method, for example,
See Tanaka et al., 1990, J. Immunol. 145: 2846-2853.

Irradiated feeder cells
l), T cell cloning using limiting dilution cloning in the presence of antigen and cytokines can yield a clonal population of antigen-specific T cells. Alternatively, antigen-specific T cells and BW5147 or BW110
Fusion partner tumor line such as 0, then HAT
A T cell hybridoma can be prepared by performing selection and recloning. Antigen-specific T cells are also CD
It can be cloned and expanded by using a monoclonal antibody against 3. Cells obtained directly from in vivo sources can be used to generate T cell clones and T cell hybridomas, which can then be tested for antigen specificity and selected, or alternatively, antigen specific T cell lines can be cloned and Can be confirmed before fusion. T cell clones can be maintained in long term culture by repeated stimulation with antigen or anti-CD3 every 7-14 days and then expanded with cytokines, whereas T cell hybridomas perform regular antigen stimulation. Can be grown in a suitable medium without.

Antigen specificity of monoclonal T cell populations measures the lymphokine production produced by these cells in response to proliferation and / or antigen in vitro.
It can be evaluated by an assay. The phenotype of T cells can be confirmed by staining with antibodies against various T cell markers. Such antigen-specific T cells are constitutively TCRα
An activation signal may be required for secreting the chain or for release of its alpha chain. Preferably recombinant DNA
Antigen-specific T cells may be used as a source of genetic material required to produce TCRα chains by chemical synthesis and / or. Using this approach, certain antigen-specific T cells that may not secrete the naturally-occurring TCRα chain can be used in accordance with the present invention.
It can be used as a source of chain genetic material.

5.1.3. Isolation of TCR α chain coding sequence Messenger RNA (mRN for preparation of cDNA
A) can be obtained from a cell source that produces the desired α chain, while the genomic sequence for TCRα can be obtained from any cell source. Section 5. above.
1.2. Any of the T cells generated as described in 1. can be used as a source of coding sequences for the TCR α chain and / or to prepare a cDNA or genomic library. In addition, some of the lymphocyte organs (eg, spleen, lymph nodes, thymus and peripheral blood lymphocytes) can be ground and used as a source for DNA or RNA extraction. Alternatively, the T cell line may be DNA
It can be used as a convenient source of NA. Genetically engineered microorganisms or cell lines containing the TCRα coding sequence can be used as a convenient source of DNA for this purpose.

The cDNA or genomic library can be prepared from the DNA fragment prepared by a method well known in the art. Fragments encoding TCRα can be identified by screening such libraries with nucleotide probes homologous to a portion of the TCRα sequence. In this regard, it should be noted that there is a single constant region gene (Cα) for TCRα in humans and mice. Since the nucleotide sequence encoding Cα is known in both species, the D region homologous to the constant region is used.
NA probes were synthesized by standard methods in the art and described in Section 5.1.2. From T cells as described in
MRNA transcripts that can be used to synthesize the Rα gene or TCRα cDNA can be isolated and used to identify the appropriate TCRα sequence or genomic clone in a cDNA library prepared from such T cells. Alternatively, an oligonucleotide specific to the desired variable region of the TCR α chain can be constructed, in which case the variable region sequence must be designed on a case-by-case basis. Oligonucleotide probes designed on the basis of the constant region are advantageous in this respect, since they can be used to "fish up" any TCR alpha chain gene or coding sequence. Although part of the coding sequence can be used for cloning and expression, full length clones, ie those that contain the entire coding region for TCRα, are preferred for expression. For this purpose, DNA
Techniques well known to those of skill in the art for isolation of the above, construction of appropriate restriction fragments, construction of clones and libraries, and screening of recombinants can be used. Methods known to those skilled in the art can be used for this purpose. For example, Maniatis et al. (1989, Molecular Cloning, A Laboratory Manual, Co
ld Spring Harbor Laboratory, NY). In a particular embodiment according to the example in Section 6 below, the complete nucleotide coding sequence for the TCR α chain gene was isolated from the T cell hybridoma, A1.1, shown in FIG.

Alternatively, TCRα that can be directly cloned
To make a cDNA or genomic copy of the sequence, an oligonucleotide probe derived from the specific TCRα sequence can be used as a primer in the PCR (polymerase chain reaction) method. For a review of such PCR methods, see, eg, Gelfand, D. et al. H. , 19
89, "PCR method, principle and application of DNA amplification" (Ed.,
HAErlich, Stockton Press, NY); and “Recent Protocols in Molecular Biology” (Vol.2, Ch.15, Eds.
See Ausubel et al., John Willey & Sons, 1988).

Regardless of the method of identifying and cloning the TCRα coding sequence, expression cloning methods can be used to substantially reduce the screening effort. Recently, a one-step method for cloning and expressing an antibody gene has been reported (McCafferty e
t al., 1990, Nature 348: 552-554; Winter and Milste
in, 1991, Nature 349: 293-299). Based on this technique, the TCR α chain gene can be cloned directly into the vector at a site adjacent to the bacteriophage coat protein gene, such as λ and fd. Phages carrying the TCRα gene express the fusion protein on their surface so that columns containing antigen or TCRα-specific antibodies can be used to select and isolate phage particles with binding activity. Transient gene expression systems can also be used to identify the correct TCRα gene. For example, COS cell lines (eg Gerard & Gluzman, 1986, Mol. Cell. Biol.
6 (12) 4570-4577) can be used, but TCR α chain expression should be detected in extracts of COS cells that have been co-transfected with the CD3 δ chain gene (Bonifa
cino et al., 1990, Cell 63: 503-513).

In the practice of the present invention for cloning and expression of TCRα, due to the degeneracy of the nucleotide coding sequence, any known antigen-specific TCRα
Other DNA encoding similar amino acid sequence of chain gene
Arrays may be used. Such alterations include deletions, additions or substitutions with different nucleotide residues, which result in a sequence encoding the same or a functionally equivalent gene product. A gene product may contain deletions, additions or substitutions of amino acid residues within the sequence, which are silent changes and produce a biologically active product. Such amino acid substitutions include the polarity of the residues involved,
It can be carried out on the basis of the similarities of charge, solubility, hydrophobicity, hydrophilicity and / or amphipathicity. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar side chains of similar hydrophilicity include: leucine. , Isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, tyrosine.

The TCR α chain sequence can be modified to obtain a gene product with improved properties such as improved stability and half-life, which can be used in vivo.
For example, the TCR α chain gene or its variable region can be labeled with Ig
Hybrid genes can be constructed by ligating to the constant regions of human immunoglobulin genes such as G. For technologies applicable to this, see Capon et al., 1989, Na.
See ture 337: 525-531.

5.1.4. Expression of α-Chain Coding Sequences In order to express a biologically active TCRα chain, the nucleotide sequence encoding TCRα or the functional equivalents described in Section 5.1.3, above, is expressed in a suitable expression vector, That is, it is inserted into a vector containing elements required for transcription and translation of the inserted coding sequence. Modified forms of the TCRα coding sequence can be engineered to enhance stability, productivity, purification or yield of expression product. For example, it can be engineered to express a fusion protein comprising TCRα and a heterologous protein or a cleavable fusion protein. Such fusion proteins are readily isolated by affinity chromatography, eg, immobilization on a column specific for the heterologous protein. If the cleavage site is engineered between the TCRα moiety and a heterologous protein, treatment of the cleavage site with an appropriate enzyme or agent will release the TCRα chain from the chromatographic column (eg, Booth
et al., 1988, Immunol. Lett. 19: 65-70; and Garde.
lla et al., 1990, J. Biol. Chem. 265: 15854-15859.
).

Methods known to those skilled in the art can be used to construct expression vectors containing the TCRα coding sequence and appropriate transcription / translation control signals. These methods are in
In vitro recombinant DNA techniques, synthetic methods and in v
Includes ivo recombination / genetic recombination. For example, Maniatis
et al., 1989, Molecular Cloning A Laboratory Manu
See al, Cold Spring Harbor Laboratory, NY.

A variety of host-expression vector systems may be used to express the TCRα coding sequence. These are recombinant bacteriophage DNA, plasmid DNA or cosmid DNA containing the TCRα coding sequence.
Microorganisms such as bacteria transformed with expression vectors; TC
A yeast transformed with a recombinant yeast expression vector containing a Rα coding sequence; a recombinant viral expression vector containing a TCRα coding sequence (eg cauliflower mosaic virus, CaMV; tobacco mosaic virus,
Plant cell line infected with TMV) or transformed with a recombinant plasmid expression vector (eg Ti plasmid); insect cell line infected with a recombinant viral expression vector (eg baculovirus) containing a TCRα coding sequence. Or an animal cell line infected with a recombinant viral expression vector containing a TCRα coding sequence (eg, retrovirus, adenovirus, vaccinia virus), or a transformed animal cell line engineered for stable expression. Including but not limited to. Glycosylation of the expression product does not appear to be required for TCRα immunoregulatory activity, as shown in the Example described in Section 7 below. Therefore, it may be advantageous to utilize bacterial expression systems for high yield TCRα production. However, glycosylation may be important for in vivo applications, although glycosylation is not required for immunoregulatory activity;
It may be shown that the half-life is increased in vivo. In such cases, expression systems that allow for translational and post-translational modification, such as mammalian, insect, yeast or plant expression systems, can be used.

Depending on the host / vector system used, a number of suitable transcription and translation elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc., can be used in the expression vector (eg, Bitter et a
l., 1987, Methods in Enzymolozy 153: 516-544). For example, to clone in a bacterial system,
Bacteriophage lambda pL, plac, ptrp, p
tac (ptrp-lac hybrid promoter)
Inducible promoters such as For cloning in mammalian cell lines, promoters from the mammalian cell genome (eg, metallothionein promoter) or promoters from mammalian viruses (eg, retroviral long terminal repeats; adenovirus late promoter; vaccinia virus).
5K promoter) can be used. TCR in which a recombinant DNA or a promoter prepared by a synthetic method is also inserted
It can be used to drive transcription of the α coding sequence.

In bacterial systems, a large number of expression vectors may be advantageously selected depending on the intended use of the TCRα to be expressed.
For example, when trying to produce large amounts of TCRα, vectors that direct high levels of expression of the fusion protein product that can be easily purified are preferred. Those engineered to contain a cleavage site that aids in the recovery of TCRα are preferred. Such a vector is an E. coli expression vector pUR278 (Ruther
et al., 1983, EMBOJ. 2: 1791), but is not limited thereto. In the vector, the TCRα coding sequence is ligated into the vector in frame with the lac Z coding region, resulting in a hybrid TCRα-lac
Z protein is produced; pIN vector (Inouye & Inouye, 1985, Nucleic acids Res. 13: 310
1-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
264: 5503-5509) etc.

In yeast, a number of vectors containing constitutive or inducible promoters can be used. As a review, Curr
ent Protocols in Molecular Biology, Vol. 2, 1988,
Ed.Ausubel et al., Greene Publish. Assoc. & Wiley
Interscience, Ch. 13; Grant et al., 1987, Expressi
on and Secretion Vectors for Yeast, in Methodsin E
nzymology, Eds. Wu & Grossman, 31987, Acad. Press,
NY, Vol. 153, pp.516-544; Glover, 1986, DNA Clo
ning, Vol.II, IRL Press, Wash., DC, Ch.3; and
Bitter, 1987, Heterologous Gene Expression in Yeas
t, Methods in Enzymology, Eds. Berger & Kimmel, Ac
ad.Press, NY, Vol.152, pp.673-684; and The M
olecular Biology of the Yeast Saccaromyces, 1982,
Eds. Strathern et al., Cold Spring Harbor Press, V
See ols. I and II. ADH or LEU2
A constitutive yeast promoter such as or an inducible promoter such as GAL can be used (Cloning in Yeast, Ch.3, R.
Rothstein In: DNA Cloning Vol.11, A Practical Appr
oach, Ed. DM Glover, 1986, IRL Press, Wash., D.
C.). Alternatively, a vector that promotes the integration of the foreign DNA sequence into the yeast chromosome may be used.

When using a plant expression vector, the TCR
Expression of the α coding sequence may be performed by any of a number of promoters. For example, CaMV 35S RN
Viral promoters such as the A and 19S RNA promoters (Brisson et al., 1984, Nature 310: 511-5.
14); or the coat protein promoter to TMV (Takamatsu et al., 1987, EMBO J. 6: 307-311) can be used; or plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO
J. 3: 1671-1680; Broglie et al., 1984, Science 22.
4: 838-843); or a heat shock promoter such as soybean hsp17.5-E or hsp17.3-B (Gurley et al., 1986, Mol. Cell. Biol. 6: 559-56.
5) can be used. These constructs were labeled with Ti plasmid,
It can be introduced into plants using Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation and the like. For a review of such techniques, see, for example, Weissbach & Weissbach, 1
988, Methods for Plant Molecular Biology, Academic
Press, NY, Section VIII, pp.421-463; and Griers
on & Corey, 1988, Plant Molecular Biology, 2d Ed.,
See Blackie, London, Ch.7-9. TCRα
Another expression system that can be used for expression of is the insect system. One such system is Autographa californica.
ca ) Nuclear polyhedrosis virus (AcNPV) is used for expression of foreign genes. The virus Spodoptera frugiperda (Spodopterafrugiperd
a ) Proliferate in cells. The TCRα coding sequence can be cloned into a nonessential region of the virus (eg, polyhedrin gene) and placed under control of an AcNPV promoter (eg, polyhedron promoter). TCR
Successful insertion of the α coding sequence results in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (ie, virus lacking the proteinaceous coat encoded by the polyhedrin gene). These recombinant viruses are then used to infect Stodotera frugiperda cells to express the inserted gene in the cells (e.g., Smith et al., 1983, J.
Viol. 46: 584; Smith, U.S. Pat. No. 4,215,051.
No.).

Eukaryotic systems, and preferably mammalian expression systems, are capable of suitable post-translational modifications of the expressed mammalian protein. TC eukaryotic cells with the cellular machinery for proper processing of primary transcription, glycosylation, phosphorylation, and favorable secretion of gene products
It should be used as a host cell for Rα expression. Mammalian cell lines are preferred. Such host cell lines are CH
O, VERO, BHK, HeLa, COS, MDCK,
-293 and W138, but is not limited thereto.

Production of TCRα in a T cell host may enhance its activity, eg, due to preferred processing and / or binding to other T cell molecules. If such expression is preferred, a T cell tumor cell line,
T cell hosts can be used including, but not limited to, T cell hybridomas, T cells that produce accessory components, or T cells that produce immune regulators.

Mammalian cell lines can be engineered with recombinant viruses or viral elements to direct expression.
For example, when using an adenovirus expression vector, the TCRα coding sequence is
It can be linked to translation control complexes, such as the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Nonessential regions of the viral genome (eg region E1 or E3)
Insertion into the host results in a recombinant virus that is viable and capable of expressing the TCR α chain in the infected host (eg, Logan
& Shenk, 1984, Proc. Natl. Acad. Sci. USA 81: 3655-3
659). Alternatively, the vaccinia virus 7.5K promoter can be used (eg, Macckett et al., 19
82, Proc. Natl. Acad. Sci. USA 79: 7415-7419; Macket
t et al., 1984, J. Virol. 49: 857-864; Panicali et
al., 1982, Proc. Natl. Acad. Sci. USA 79: 4927-4931
reference). Of particular interest are bovine papillomavirus-based vectors that have the ability to replicate as extrachromosomal elements (Sarver et al., 1981, Mol. Cell. Biol. 1:48.
6). Immediately after this DNA enters mouse cells, the plasmid replicates at approximately 100 to 200 copies per cell. Transcription of the inserted cDNA does not require integration of the plasmid into the host chromosome, resulting in high levels of expression. These vectors can be used for stable expression by including a selectable marker such as neo gene in the plasmid. Alternatively, the retrovirus genome can be modified and used as a vector capable of introducing and expressing the TCR α chain gene in a host cell. (Co
ne & Mulligan, 1984, Proc. Natl. Acad. Sci. USA 8
1: 6349-6353). High levels of expression are associated with metallothionein I
It can also be achieved using inducible promoters, including but not limited to IA promoters and heat shock promoters.

For long-term, high-yield production of recombinant proteins, stable expression is preferred. Rather, an expression vector containing a viral origin of replication is used to host the TCRα cDNA controlled by appropriate expression control elements (eg, promoters, enhancers, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Can be transformed. The selectable marker in the recombinant plasmid confers resistance to selection, allowing the plasmid to integrate stably into the chromosome of the cell,
It can proliferate to form foci, which can then be cloned and expanded into cell lines. For example, an outpatient DN
After the introduction of A, engineered cells in high nutrient medium for 1-2
It may be grown daily and then switched to a selective medium. A large number of selection systems can be used, including tk ⁻ and hg, respectively.
can be used in prt ⁻ or aprt ⁻ cells,
Herpes simplex virus thymidine kinase (Wigler et a
l., 1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyl transferase (Szybalska & Szyb
alski, 1962, Proc. Natl. Acad. Sci. USA 48: 202
6), and adenine phosphoribosyl transferase (Lowry et al., 1980, Cell 22: 817) genes, but are not limited thereto. In addition, dhfr (Wigler et a that confers resistance to methotrexate)
l., 1980, Natl. Acad. Sci. USA 77: 3567; O'Hare et a
L., 1981, Proc. Natl. Acad. Sci. USA 78: 1527);
Gpt (Mulligan that confers resistance to mycophenolic acid)
& Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 207
2); confers resistance to aminoglycoside G-418 n
eo (Colberre-Garapin et al., 1981, J. Mol. Biol.
150: 1); and hy conferring resistance to hygromycin
Antimetabolite resistance can be used as the basis for selection for the gro (Santerre et al., 1984, Gene 30: 147) gene. Recently, an additional selectable gene, trpB, that causes cells to utilize indole instead of tryptophan; hisD (Ha that causes cells to utilize histinol instead of histidine)
rtman & Mulligan, 1988, Proc. Natl. Acad. Sci. USA
85: 8047); and 2- (difluoromethyl) -DL-ornithine which is an ornithine decarboxylase inhibitor, ODC (ornithine decarboxylase) which confers resistance to DFMO (McConlogue L., 1987, In: Current.
Communications in Molecular Biology, Cold Spring
Harbor Laboratory ed.) Is described.

5.1.5. Purification of TCRα Chain Expression Product Expression of the TCRα protein product by genetically engineered cells can be performed, for example, by Western blot or radioimmuno-assay.
It can be evaluated immunologically by immunoassay such as precipitation and enzyme linked immunoassay. However, to finally test the success of the expression system, biologically active T
To see the production of the CRα gene product. If the host cell secretes the gene product, TCRα or its immunoregulatory activity in cell-free media obtained from cultured transfected host cells may be assayed. If the gene product is not secreted, cell lysates are assayed for such activity. In either case, a number of assays can be used to assess TCRα activity, including expression of TC.
Assays that measure the ability of Rα to bind antibodies, Section 5.1.1. Above. And described in Section 6. below.
1.5. Examples include, but are not limited to, assays that assess immune function, such as the PFC assay illustrated in.

Once high level of biologically active TC
Once a clone producing Rα has been identified, this clone can be expanded and used to produce large quantities of protein.
The protein can be purified by methods well known in the art including, but not limited to, chromatographic methods including immunoaffinity purification, high performance liquid chromatography and the like. If the protein is secreted by the cultured cells, TCRα can be easily recovered from the medium.

The method of purifying TCRα from the crude culture medium of T cells can also be applied to the purification of cloned expression products. For example, TCRα from A1.1 cells used in the examples below can be purified from crude T cell culture medium by ammonium sulfate precipitation followed by affinity chromatography (Zheng et al., 1988, J.
Immunol. 140: 1351-1358; Bissonnette et al., 1991,
J. Immunol. 146: 2898-2907). All mouse TCRs
A purified monoclonal antibody specific for an antigenic determinant shared on the α chain or an antigen or an antigen or fragment containing a specific antigenic epitope thereof is bound to cyanogen bromide-activated Sepharose 4B (Pharmacia), and affinity chromatography is performed. Can be used for graphy. Thus, the biological activity of the protein purified from the crude culture medium was shown to increase 3000-fold. Alternatively, even antibodies raised against products of different Vα gene families can be used if it is known which particular Vα gene segment encodes the α chain protein of interest. Furthermore, an antibody against the variable region of a specific TCR α chain was prepared, which was
It can be used to purify alpha chains from a mixture of alpha chains. In this case, if a sufficient amount of protein is present, the specific α chain can be isolated even from the crude culture medium of bulk culture T cells.

When the TCRα coding sequence is engineered to encode a cleavable fusion protein, TCRα can be readily purified using affinity purification methods. For example, protease factor Xa
A cleavage recognition sequence can be engineered between the carboxyl terminus of TCRα and the maltose binding protein. The obtained fusion protein can be easily purified using a column to which amylose to which maltose binding protein binds is bound. The TCRα fusion protein is then eluted with maltose-containing buffer and then treated with Factor Xa. The cleaved TCR α chain was passed through a second amylose column for further purification and maltose binding protein (New En
(Grand Biolabs, Beverly, MA)
Is removed. Using this aspect of the invention, any cleavage site or enzyme cleavage substrate is provided with a TCRα sequence and a second peptide or protein with a bound Patner (eg, an antigen against which an immunoaffinity column can be prepared) that can be used for purification. Can be operated during.

5.1.6. Alternative Methods for Producing the TCR α Chain Once the specific TCR α chain gene has been molecularly cloned and its DNA sequence determined, its protein product may be produced by a number of methods in addition to those described above. it can. For example, based on the amino acid sequence deduced from the DNA sequence, TCRα using solid-phase chemical synthesis methods.
Chains can be produced wholly or partially (Creighton, 1
983, Proteins Structures and Molecular Principles,
See WH Freeman and Co., NY pp.50-60). This approach is particularly useful for making small portions of proteins that correspond to the active site of the molecule. In the case of the TCRα chain that binds antigen, the variable region at the amino terminus of the protein encoded by the V and J gene segments is likely important for antigen binding. Therefore, α
Synthetic peptides corresponding to the variable regions of the chains may be produced. In addition, even large peptides containing a specific portion of the α-chain constant region have been shown to be important for interacting with cofactors, for example if that region achieves a complete immune regulatory response. May be synthesized.

TCRα based on cloned DNA sequence
Another method of producing chains is transcription and translation of that gene in a cell-free system in vitro. In a particular embodiment shown as an example in Section 7 below, A
1.1 When the TCR α chain gene is transcribed and translated in vitro, the product is about 3 by SDS-PAGE.
It was shown to be a protein with a molecular weight of 2,000 daltons. This protein corresponds to a non-glycosylated TCRα polypeptide chain. Such cell-free in v
Although the in vitro system is not designed for large-scale protein production, the advantages of this approach conclusively indicate the contribution of a particular TCRα chain in a particular immunological reaction in the absence of other protein synthesis. Is to provide a method.

Molecular mimicry of protein conformation through antibody binding sites provides another method of producing proteins with binding specificities similar to those of a particular TCR α chain. For example, an anti-idiotypic antibody or a monoclonal antibody directed against the same antigenic determinant may have binding sites that are structurally identical to the variable domain of the TCR α chain. PFC described herein
Such antibodies exhibiting the TCRα chain immunoregulatory function assessed in the assay can be used in place of the TCRα chain. Under certain circumstances, for example, such an antibody has a longer i than the native α chain.
It is preferred to use such antibodies in cases such as those shown to have an n vivo half-life. For the other therapeutic applications described below, monoclonal antibodies that bind to and neutralize the TCRα chain are desirable. These antibodies are in vitro diagnostic assays,
For example, it can be used for detection of TCRα chain circulating in the human body such as radioimmunoassay and ELISA. Such monoclonal antibodies can be easily mass produced using techniques well known in the art.

For the production of antibodies that mimic TCRα, various host animals including, but not limited to, mice, rabbits, hamsters, rats and non-human primates can receive the desired antigen or anti-TCRα chain antibody. Sensitize with TCR
The ability to produce an antibody that mimics the α chain to competitively inhibit the antigen-specific binding of the TCR α chain to its antigen, as well as the specific immune response to the antigen as assessed by the PFC assay described herein. Measure your ability to control. T
To produce antibodies that bind to and neutralize the CRα chain, the host animal is sensitized with the TCRα chain itself. Various adjuvants can be used to enhance the immune response depending on the host species, including Freund's complete and incomplete adjuvants, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides. , Oil suspension, keyhole limpet hemocyanin, dinitrophenol, and B
CG (baccile Calmette-Gueri)
n) and Cornebacterium purbum (Coryneb)
and potentially useful human adjuvants such as, but not limited to.

Monoclonal antibodies may be prepared by any technique that results in the production of antibody molecules by continuous passage cell lines. First, but not exclusively, Kohler and Milstein (Nature, 1975,
256: 495-497), and the hybridoma method described by
Human B cell hybridoma method (Kosbor et al., 1983, Im
munology Today, 4:72 Cote et al., 1983, Proc. Nat
l. Acad. Sci. 80: 2026-2030) and the RBV-hybridoma method (Cole et al., 1985, Monoclonal Antibodies.
and Cancer Therapy, Alan R. Liss, Inc., pp.77-9
Including 6). Techniques developed to generate "chimeric antibodies" by splicing genes from mouse antibody molecules of appropriate antigen specificity with genes from human antibody molecules can be used (eg Morrison et al., 1984, Proc. . Nat
l. Acad. Sci. 81: 6851-6855; Neuberger et al., 198.
4, Nature, 312: 604-608; Takeda et al., 1985, Natur.
e 314: 452-454). Furthermore, the techniques described for the production of single chain antibodies (US Pat. No. 4,946,778) can be applied to the production of single chain antibodies.

Antibody fragments containing a particular desired binding site can be prepared by known methods. For example, such fragments include, but are not limited to, F (ab ') ₂ fragments produced by pepsin digestion of antibody molecules, and F (a').
b ') Fab fragments produced by reducing the disulfide bridges of the ₂ fragments. Alternatively, a Fab expression library (Huse et al., 1989, Sci) that allows rapid and easy identification of monoclonal Fab fragments with the desired specificity.
ence, 246: 1275-1281) can be used.

5.2. Use of the TCR α Chain as an Immunomodulator The antigen-specific immunoregulatory activity of the TCR α chain has been demonstrated in human and animal subjects in vivo and in vitro.
Provides widespread use in. Any TCRα chain, or fragment thereof, and derivatives thereof capable of binding an antigen and exhibiting immunoregulatory activity assayed in vitro can be used to practice the methods of the invention. If the accessory component factor is present in the serum of the subject, TCRα
The chain can be administered as the sole active agent. However, T
The CRα chain is a biologically active factor found in accessory components,
It can be administered in combination with growth factors or inhibitors.
TCR alpha chains that are capable of binding an antigen and suppressing the immune response that normally occurs against that antigen are particularly useful for down-regulating antigen-specific immune responses such as hypersensitivity, transplant rejection, and autoimmune disorders. sell. Alternatively, removal or neutralization of such TCRα chains or factors that bind to such TCRα chains may be useful as a means of enhancing the immune response to diseases such as cancer and immunodeficiency. In another aspect of the invention, such antigen-specific responses can be enhanced in vivo by utilizing an antigen-specific TCRα chain that enhances the immune response.

5.2.1. Antigen-specific immunosuppression An antigen-binding TCR α chain exhibiting antigen-specific immunosuppression has a harmful immune reaction and can be used for treatment of a condition in which it is preferable to suppress such a response in an antigen-specific manner. Such diseases treated according to the present invention include, but are not limited to, hypersensitivity (types I-IV), autoimmune diseases and graft rejection responses after transplantation of organs or tissues.

Hypersensitivity is usually divided into 4 groups. Type I
The reaction is an immediate hypersensitivity resulting from antigen-specific IgE-triggered mast cell degranulation. Examples of type I diseases include pollen, mold spores, insect parts, animal dander, bee and snake venom, industrial dust, house dust,
Includes normal allergies caused by substances such as food and drugs. Type II reactions are triggered by the action of specific antibodies, usually IgG and IgM, on target cells that lead to cell destruction. Examples of type II diseases include transfusion reactions, erythroblastosis fetalis, autoimmune hemolytic anemia, myasthenia gravis and Graves' disease. The type III reaction is triggered by antigen-antibody complex formation and subsequent activation of the antibody effector mechanism. type
Examples of diseases of III include immune complex glomerulonephritis, Goodpasture's syndrome and some forms of arthritis. The type IV response is a cell-mediated response that includes T cells, macrophages, fibroblasts and other cell types. These are also called delayed type hypersensitivity. Allergic contact dermatitis is a typical example of this type.

Autoimmune diseases refer to a group of diseases in which the immune system reacts with self antigens to cause tissue destruction.
These responses are mediated by antibodies, autoreactive T cells, or both. Many of the conditions overlap with those described above for hypersensitivity. Some important autoimmune diseases include diabetes, autoimmune thyroiditis, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, and myasthenia gravis.

A basic understanding of MHC has led to technological advances in tissue typing, which has substantially improved the success rate of organ and tissue transplants. Some of the most common transplant procedures performed today include kidney, heart, liver,
Includes organs and tissues such as skin, pancreatic islets and bone marrow. However, graft rejection can occur in situations where the donor and recipient are not genetically identical.

For all situations involving, but not limited to, the particular diseases mentioned above, adverse down-regulation of the immune response is beneficial to the host. In this regard, antigen-specific TCRα can be used to specifically suppress the immune response mediated by T cells, antibodies, or both, while retaining all other normal immune functions. For example, experimental allergic encephalomyelitis (EAE) is an animal model of human multiple sclerosis that can be induced in mice by administering purified myelin basic protein. T _H that has been shown to play a critical role in pathogenesis of this disease (Wraith et al., 1
989, Cell 57: 709-715). The number of antigenic determinants recognized by autoreactive T cells in certain mouse strains is limited. Furthermore, the Vα and Vβ gene segments used to construct the autoimmune TCR are similarly limited, so that many of the T cell responses to a small number of encephalitis-producing epitopes have the same TCR. Antibodies against TCR antigenic determinants have been used to eliminate antigen-specific T cells in vivo, thereby achieving protection from disease (Owhashi and Heber-Katz, 1988, J. Exp. Med. .
168: 2153-2164). To carry out the present invention, a TCR α chain gene is isolated from such an autoreactive T cell and expressed in a suitable host cell, and its ability to suppress an antigen-specific immune response in vitro and in vivo is suppressed. Just test. The use of the TCR α chain for this purpose has led to the detection of autoimmune T cells in certain human diseases such as multiple sclerosis and myasthenia gravis, which are also restricted to certain Vα and Vβ alleles. Has recently been found to have certain uses (Oksenberg et al., 1989, Pr.
oc.Natl. Acad. Sci. USA 86: 988-992).

According to the present invention, the above conditions may be treated by administering to the patient an effective dose of the TCRα chain specific for that antigen which suppresses the immune response generated against that antigen. The choice of TCRα chain to be used can be assessed by in vitro immunoregulatory assays such as the PFC assay described herein. The TCR α chain is administered in a variety of ways, including but not limited to injection, infusion, intraperitoneal and oral. TCRα and its related derivatives, analogs such as peptides derived from the variable region can be used as the sole active agent or in combination with other compounds. Such compositions may be administered with physiologically acceptable carriers such as phosphate buffered saline, saline and sterile water. Or TCR
Liposomes can be used to deliver α. In this regard,
Liposomes are complexed with antibodies that recognize and bind to cell-specific antigens, thereby providing a means of "targeting" the TCRα composition.

An effective dose is the amount required to suppress the immune response that may have occurred against the relevant antigen in vivo. The amount of TCRα used will vary depending on the method of administration, the use of other active compounds and the like. Generally, from 0.1 μg
Dosages are used that result in circulating serum levels of 100 μg / ml. The most effective concentrations for suppressing the antigen-specific response are given in Section 6.1.5. It is determined by adding various concentrations of TCRα to an in vitro assay such as the PFC assay described in and monitoring the level of inhibition achieved.

5.2.2. Antigen-Specific Immune Stimulation Certain diseases result from inadequate or defective immune responses. Impairment of the immune response may be due to the lack of specific parts of the immune system or aberrant functioning, or the presence of factors that specifically downregulate these responses. In the latter case, for example, the antigen-specific TCRα that suppresses the immune response directed against a particular antigen may be overproduced by the patient. In such cases, T
Removal or neutralization of CRα would rescue responding cells from such suppression, thereby increasing their effectiveness against the antigens they recognize. The PFC assay described herein can be used to assay a patient's body fluid, such as serum, for the presence of circulating or soluble TCR alpha chains that exhibit an antigen-specific immunosuppressive effect. The patient can then be treated with an antibody to the TCR α chain to remove or neutralize the circulating inhibitory molecule.

Despite the tumor-specific immune response demonstrated, continuous tumor growth can be explained by T cell-mediated suppression. Exclusion of antigen-specific Ts and TsF has been reported to reveal potential anti-tumor responses in various experimental tumor lines (North, 198).
2, J. Exp. Med. 55: 106-107; Hellstrom et al., 197.
8, J. Exp. Med. 49: 799-804; Nepom et al., 1977, Bi
ochim. Biophy. Acta. 121-148). Antigen-specific suppressor factors are activated by tumor cells or when recognizing certain suppressor epitopes of tumor antigens.
may be directly emitted by s (Sercarz an
d Krzych, 1991, Immunol. Today 12: 111-118). Monoclonal antibodies originally raised against TsF may also react with tumor-specific T suppressor factors produced by T cell hybridomas (Steele et a
l., 1985, J. Immunol. 134: 2767-2778). Some of the TsF that binds to this antibody binds to anti-TCRα antibody. Therefore, TCR alpha chains with appropriate specificity for tumor antigens are associated with reduced tumor immunity.
g), in which case removal or neutralization of such TCRα would be beneficial in restoring and enhancing the tumor-specific response.

The activity of the native TCR α chain in a patient is the antibody that is specific to the α chain, which neutralizes the activity, that is, the ability to bind to an antigen and / or the resulting antigen-specific immunosuppressive effect. Would be inhibited by in vivo administration (section 5.1. Above).
4. reference). Antibodies to the constant or variable region of TCRα can be used, but bind to the variable region since only the TCRα chain specific for that particular antigen is neutralized, thereby enhancing the immune response in an antigen-specific manner. Things may be preferable. Alternatively, the serum of a cancer patient with detectable levels of soluble tumor antigen-specific TCR α chain can be passed ex vivo through a column containing the antibody, ie, adsorbed to the α chain or antigen or its peptide by plasmapheresis. it can.

For in vivo use, the antibody can be administered by a variety of methods including, but not limited to, injection, infusion, intraperitoneal and oral. The antibody is administered in a physiologically acceptable carrier, including phosphate buffered saline, saline and sterile water. The amount of antibody used depends on the method of administration,
Generally, the saturating dose is such that most, if not all, of the free systemic TCR α chain is bound, although it varies depending on the use of other active compounds. For ex vivo adsorption, the amount of antibody or antigen bound to the column is sufficient to remove most, if not all, of the free TCR alpha chain in the patient's serum.

Antisense oligonucleotides can be used to inhibit the expression and systemic release of certain immunosuppressive TCR α chains, thereby selectively enhancing the antigen-specific immune response. In this regard, complementary oligonucleotides that exhibit catalytic activity, the ribozyme approach, can be used. Generally, for example, PCT International Publication WO 90/11364; Sarver et al., 1990, S.
See cience 247: 1222-1225. The use of Vα antisense or ribozyme oligonucleotides for each TCRα chain is preferred to the use of complete TCRα as it inhibits only the specific TCRα of interest. To this end, nuclease resistant antisense Vα oligodeoxynucleotides complementary to the mRNA of any known TCR α chain sequence may be synthesized. When taken up by antigen-specific T cells, these agents may hybridize by base pairing to their complementary mRNA sequences, blocking translation and blocking the production of the encoded protein product (such techniques). Review of Green et al., 1986, Ann. Rev. Biochem. 55: 569-
See 597).

In another aspect of the invention, a T that is specific for the antigen of interest and that enhances the specific immune response.
The CRα chain is described above in Section 5.1.1. Can be identified as described above. To enhance the patient's immune response to a particular antigen, a therapeutically effective dose of such T
The CRα chain may be administered to the patient. In embodiments of the distinction, the present invention is substantially pure fusion polypeptide R ₁ -
[X _1] -R ₂ (wherein, R ₁ is a carrier peptide, polypeptide R ₂ is encoded by a structural gene, and X ₁ is a is a proteolytic enzyme recognition sequence) provides. The "carrier peptide" is located at the amino terminus of the fusion peptide sequence. In the case of prokaryotes, the carrier peptide of the fusion polypeptide of the invention may function to transport the fusion protein to inclusion bodies, the exoplasmic, outer membrane, or preferably to the external environment.
In eukaryotes, the carrier peptide is believed to function to transport the fusion polypeptide through the endoplasmic reticulum. The secreted protein is then transported through the Golgi apparatus, into secretory vesicles, and into the extracellular space, and preferably to the external environment. Carrier peptides of the invention include, but are not limited to, calmodulin polypeptides. The category of carrier peptides that can be used in accordance with the present invention includes prepropeptides and outer membrane peptides containing proteolytic enzyme recognition sites. Acceptable carrier peptides also include the amino terminal pro region of the hormone. Other carrier peptides with similar properties described herein are known to those of skill in the art and can be readily identified without undue experimentation.

In one aspect of the invention, a carrier peptide is included in the expression vector, which is specifically located near the N-terminus of the carrier protein. The vectors used in the examples of the present invention use calmodulin nucleotide sequences, but transfer the fusion protein to the endoplasmic reticulum (for eukaryotes) and to the external environment or inclusion bodies (for prokaryotes). Other arrangements that provide a means of transport would be equally useful in the present invention. Such sequences described above are known to those of skill in the art.

The carboxy terminus of the carrier peptides of the present invention contains a proteolytic enzyme recognition site so that the polypeptide encoded by the structural gene can be easily separated from the fusion protein. If there is a difference in the cleavage recognition site, it is possible that there are enzymes with different proteolytic specificities. Preferably, the cleavage site is a sequence recognized by thrombin, Lys-Val-Pro-Arg-.
It is Gly. This recognition site allows the production of unexpectedly high levels of active protein encoded by the structural gene. Other cleavage sites as recognized by Factor Xa protease will become known to those of skill in the art.

The fusion polypeptide of the invention comprises a polypeptide encoded by a structural gene, preferably at the carboxy terminus of the fusion polypeptide. Any structural gene is co-expressed with the carrier peptide and the cleavage site.
The structural gene is operably linked in the expression vector with a carrier and a cleavage site such that the fusion polypeptide is expressed as a single unit. Examples of structural genes that can be used to produce the fusion polypeptides of the invention are TCR
It encodes a truncated TCRα containing only the extracellular domain of α.

The present invention provides a substantially pure polypeptide. As used herein, "substantially pure" refers to a polypeptide that is substantially free of other proteins, lipids, hydrocarbons or other substances with which it can be naturally associated. One of skill in the art will be able to purify the polypeptide using standard methods for protein purification, such as affinity chromatography using monoclonal antibodies that bind to the epitope of the polypeptide. A substantially pure polypeptide yields a single major band on a polyacrylamide gel. The purity of a polypeptide can be determined by amino terminal amino acid sequence analysis. Polypeptide also includes functional fragments of the polypeptide, so long as the activity of the polypeptide is retained. Smaller peptides having the biological activity of the polypeptide are also included in the invention.

The present invention also provides a polynucleotide encoding the fusion polypeptide. These polynucleotides include DNA, cDNA, and RNA sequences.
All polynucleotides encoding all or part of a fusion polypeptide are also understood to be included herein as long as the cleavage product encodes a biologically active polynucleotide. Such polynucleotides include naturally occurring, synthetic, and deliberately modified polynucleotides. For example, site-directed mutagenesis can be introduced into the polynucleotide. Polynucleotide sequences also include antisense sequences and sequences that degenerate as a result of the genetic code. There are 20 amino acids in nature, many of which are specified by one or more codons. Therefore, all degenerate nucleotide sequences are included in the present invention, so long as the amino acid sequence of the fusion polypeptide encoded by the nucleotide sequence is functionally unchanged.

The DNA sequence of the present invention can be obtained by the several methods described above. For example, DNA can be isolated using hybridization methods well known in the art. These include, but are not limited to, 1) hybridization of the probe to a genomic or cDNA library to detect shared nucleotide sequences; 2) detection of shared structural features. Antibody screening of expression libraries; and 3) synthesis by polymerase chain reaction (PCR).

When the entire sequence of amino acid residues of the desired polypeptide product is known, synthetic DNA sequence synthesis is often the method of choice. If the entire sequence of amino acid residues of the desired polypeptide is unknown, direct synthesis of DNA sequences is not possible, the method of choice is the synthesis of cDNA sequences. Among the standard methods for isolating cDNA sequences, it is of interest to form cDNA libraries with plasmids or phage derived from reverse transcription of abundant mRNA in donor cells with high levels of gene expression. When used in combination with the polymerase chain reaction method, even rare expression products can be cloned. If a significant portion of the amino acid sequence of the polypeptide is known, create a labeled single or double stranded DNA or RNA probe sequence that replicates the putatively present sequence in the target cDNA. Alternatively, it may be used in a DNA / DNA hybridization method carried out on a cloned copy of cDNA which has been denatured in advance into a single-stranded form (Jay et al., Nucl. Acid Res. 11: 2.
325, 1983).

D encoding a fusion polypeptide of the invention
NA sequences can be expressed in vitro by DNA transfer into a suitable host cell. ”
A "host cell" is one in which a vector is propagated and
A cell that expresses NA. The term also includes all progeny of the host cell. It is understood that all progeny may not be identical to the parental cell, as mutations may occur during replication. However, such progeny are included when the term "host cell" is used.
Preferred host cells of the invention are E. coli, S. aur
eus and P.E. Aeruginosa, but other Gram-negative and Gram-positive organisms known in the art can also be used, so long as the expression vector contains a replication origin that enables expression in the host. Stable transfer methods, or in other words methods in which foreign DNA is continuously maintained in the host, are known in the art.

In the present invention, the polynucleotide sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a plasmid, virus or other vehicle known in the art that has been engineered to insert or incorporate the gene sequence for TCRα with, for example, a carrier peptide and a cleavage site. Such expression vectors contain a promoter sequence which facilitates the efficient translation of the inserted gene sequences by the host. Expression vectors typically contain an origin of replication, a promoter, as well as specific genes that allow phenotypic selection of transformed cells. Vectors suitable for use in the present invention include, but are not limited to, T7-based expression vectors used for expression in bacteria (Rosenberg et al., Gene 56: 125, 198).
7), pMSXN used for expression in mammalian cells
D expression vector (Lee and Nathans, J. Biol. Chem. 26
3: 3521, 1988) and baculovirus-derived vectors used for expression in insect cells. The DNA segment may be present in the vector operably linked to regulatory elements such as a promoter (eg, T7, metallothionein I, or polyhedrin promoter).

For example, the expression of the fusion peptide of the present invention is
It may be under the control of E. coli chromosomal DNA containing the lactose or lac operons that mediate lactose utilization by regulation of the enzyme β-galactosidase. The lac control system can be induced by IPTG. The plasmid can be constructed to contain the lac Iq repressor gene which allows repression of the lac promoter until IPTG is added. Other promoter systems known in the art include the beta-lactamase, lambda promoter, protein A promoter, and tryptophan promoter systems. These are most commonly used, but other microbial promoters can be used as well. The vector contains replicon sites as well as control sequences derived from a species compatible with the host cell. In addition, the vector can contain specific genes capable of providing phenotypic selection in transformed cells. For example, the beta-lactamase gene confers resistance to ampicillin on transformed cells containing a vector carrying the beta-lactamase gene.

A polynucleotide sequence encoding a fusion polypeptide of the invention can be expressed in prokaryotes or eukaryotes. Hosts can include microorganisms, yeasts, insects and mammalian organisms. Methods of expressing DNA sequences with eukaryotic or viral sequences in prokaryotic cells are well known in the art. Biologically functional viral and plasmid DNA vectors capable of expressing and replicating in a host are known in the art. Such a vector is the D of the present invention.
It can be used to incorporate NA sequences. The host cell of the invention may naturally encode an enzyme that recognizes the cleavage site of the fusion protein. However, if the host in which the expression of the fusion polypeptide is desired does not inherently have an enzyme that recognizes the cleavage site, the gene sequence encoding such an enzyme may be included with the polynucleotide sequence for the fusion protein. Host cells can be co-transfected.

Transformation of host cells with recombinant DNA
It can be carried out by conventional methods well known to those skilled in the art. Host is large intestine
In the case of prokaryotes such as bacteria, DNA uptake
Competent cells were harvested after the exponential growth phase
Prepared from cells and then C by methods well known in the art.
aCl₂Can be treated by law. Alternatively, MgCl₂ Well
Alternatively, RbCl can also be used. Transformation is also a host
After the protoplasts of the cells have been formed, or
It can be done by ration.

When the host is a eukaryote, conventional mechanical methods such as calcium phosphate co-precipitation, microinjection, electroporation, DNA encapsulation in liposomes and insertion of plasmids or viral vectors.
Transfection methods can be used. Eukaryotic cells can also be cotransfected with a DNA sequence encoding a fusion polypeptide of the invention and a second foreign DNA molecule encoding a selectable phenotype such as the herpes simplex thymisin kinase gene. Another method uses eukaryotic viral vectors such as Simian virus 40 (SV40) or bovine papilloma virus to transiently infect or transform eukaryotic cells to express proteins (Eukaryotic Viral Vectors, Cold). Spring
Harbor Laboratory, Gluzman ed., 1982).

Methods of isolating and purifying the microbial or eukaryotic expressed polypeptides of the present invention include any method, including separation by preparative chromatography, and immunological separations, including the use of monoclonal or polyclonal antibodies and the like. It can also be done by conventional methods. The above description generally describes the present invention. The invention will be more fully understood by reference to the following specific examples, which are provided for purposes of illustration and are not intended to limit the scope of the invention.

[0091]

【Example】

6. Example: Immunomodulatory activity of TCR α chain demonstrated by retroviral gene transfer 6.1. Materials and methods 6.1.1. Animals C57B1 / 10 and C57B1 / 6 animals were purchased from Jackson Laboratories (Bar Harbor, ME). 6.1.2. Cell line A1.1 (Foteder et al., 1985, J. Immunol.
135: 3028-3033), B9 (Foteder et al., 1985, J. Immun
ol. 135: 3028-3033), BW1100 (White)
1989, J. Immunol. 143: 1822-1825), 175.2 (Glaichenhaus et al., 1991, J. Immunol.
146: 2095) and derivatives of these cell lines expressing the A1.1 TCR gene (see section 6.1.4. Below).
Maintained in MI1640 + 10% FCS. Many cell lines were also adapted to protein-free and serum-free medium (Cell Biotechnology, Rockville, MD).

6.1.3. Antibodies and Antigens Monoclonal antibodies having specificity for CD3ε (145
-2C11, hamster IgG) (Leo et al., 198
7, Proc. Natl. Acad. Sci. USA 84: 1374-1378), and a monoclonal antibody having specificity for TCR Cα (H
28-710.16, Hamster lgG) (Becker (Be
cker) et al., 1989, Cell 58: 911-921) using Protein A affinity chromatography (Protein A Superos).
e, Pharmacia). Fluorescent staining and FACS analysis of surface CD3 (Zheng et al., 1989, Pro
c. Natl. Acad. Sci. USA 86: 3758-3762) and H28.
Antibody affinity chromatography at -710 was performed as previously described (Bissonet.
te) et al., 1991, J. Immunol 146: 28-98-2907). SRB
C is Morse Biologicals (Edmonton, A
B) or from Colorado Sialum Company (Denver, CO). Selected synthetic polypeptides, namely poly 18 and peptides based on its structure (listed in FIG. 4), were prepared as previously described (Foteder et al., 1985, J.
Immunol. 135: 3028-3033).

6.1.4. TC into T cell hybridomas
Retroviral transfer of R gene total cellular RNA was isolated from 10 ⁹ cells by the conventional guanidine-isothiocyanate and cesium chloride method. Poly A ⁺ RNA was recovered by oligo-dT cellulose affinity chromatography. First strand synthesis was performed using oligo-dT primer and reverse transcriptase
Strand synthesis by DNA polymerase I and RNase (RNase)
Performed using H. The methylated blunt ended double stranded (ds) cDNA was ligated to an EcoRI linker. E
Following coRI digestion, the ds cDNA was screened for its size on an agarose gel, purified by spermine precipitation, and cloned into λgt10. The λD
NA was packaged in vitro (Gigapack Gold, Stratagene, La Jolla, CA). About 200,000
Single plaques were screened by in situ hybridization using ³² P radiolabeled Cα and Cβ probes. The Cα and Cβ probes were used to screen a cDNA library (prepared from bovine insulin-specific T cell hybridomas). For standard dideoxy sequencing, insert DNA from positive clones into M13mp18 and M13mp
Linked to 19.

All of the examples used in the examples described herein
Retrovirus vector is a derivative of N2 vector
(Keller et al., 1985, Nature 318: 149-154).
The A1.1 TCR α and β cDNAs were sequenced in their entirety. Simple
Simply, the A1.1α cDNA is Vα_1.2(Ade
Arden et al., 1985, Nature 316: 783-787) and JαT.
A1.1 β cDNA using A65 gene segment
Is Vβ₆(Barth et al., 1985, Nature 316: 517-5.
23), Dβ₂(Sui et al., 1984, Nature 311: 344-34.
9) and Jβ_2.7(Gascoigne et al., 1984, Nat
ure 310: 387-391) gene segment. α chain
Expression of cDNA begins with the retrovirus LTR, and the β chain
Expression of TCR Vβ₂Promoter and TCRβ en
It was done under the control of Hansar. Both inserts of the N2 vector
It was cloned into the XhoI site. Pack these constructs
Caging cell line ψ2 (Mann et al., 1983, Cell
 33: 153-159) and PA317 (Miller and
Buttimore et al., 1986, Mol. Cell. Biol., 6:
 2895-2902). The claw
The produced producer cell line is
Bibutimore et al., 1986, Mol. Cell. Biol., 6: 2895-290.
Measured according to 2), 5 × 10^Five~ 1 × 10 ⁶of
Had a titer. Receptor T cell hybridomas
Supernatant of Ducer cell line, as described
(Keller et al., 1985, Nature 318: 149-154) infected with G
418 (0.8-1.0 mg / ml) for 10 days
Was. In the case of 175.2 cells expressing A1.1α, anti-C
Fluorescent staining with D3 and then FACStar Plus (vector
N. Dickinson) for further selection by cell sorting.
Made a choice. Expression of the transduced TCR gene
Vβ₆Monoclonal antibody (Payne et al., 1988,
Proc. Natl. Acad. Sci. USA 85: 7695-7698) or anti-CD
By FACS analysis using any of 3 or
From Troll and Infected Receptor T Cell Hybridomas
Was confirmed by PCR analysis of RNA. Vα₁And Cα
Primers specific to gene segment are used for PCR
did. The amplified product was added to the junction region of A1.1α cDNA.
Specific 5'end labeled antisense oligonucleosides
Hybridized with Cido.

6.1.5.In vitro of antigen-specific regulatory activity
analysis Easy to analyze A1.1-induced antigen-specific regulatory activity
Various antigen-specific systems (Zeng et al., 1988, J. Immunol
 140: 1351-1358; Bisonette et al., 1991, J. Immunol 14
6: 28-98-2907; Zeng et al., 1989, Proc. Natl. Acad. Sc
i. USA 86: 3758-3762). C57B1 / 6 or C57B
Spleen cells from 1/10 mouse (1 x 10 ⁷) To 10
% FCS and 5 × 10^-FiveRPM supplemented with M2-ME
I1640 was placed in a 1 ml culture. For each culture,
1% S bound to poly 18 or substituted polypeptide
50 μl of RBC was added. "Auxiliary component" in the culture
Filter sterilization (with 10-15%) or without "auxiliary ingredients"
Suppressed by adding the hybridoma supernatant
The activity was evaluated. This auxiliary ingredient is described in Section 5.1.1. Above.
As listed (Zeng et al., 1988, J. Immunol 140: 1.
351-1358; Bisonette et al., 1991, J. Immunol 146: 28-98.
-2907), animals immunized with SRBC
After culturing these mouse T cells, the supernatant was subjected to SRBC.
It was prepared by adsorption. Also, culture of T cell hybridoma
Supernatant, 3-1-V (as described in Section 8 below)
May be used as an auxiliary supernatant (FIG. 1). The culture
92% air / 8% CO humidified liquid at 37 ° C₂Inn in
Incubate and perform anti-SRBC PFC evaluation 5 days later
Was. In all experiments presented herein, T cell high
When both the supernatant of the bridoma and the auxiliary supernatant were added alone
Had no effect on the immune response. Therefore, this specification
All control and experimental cultures described in
Results of containing and without auxiliary supernatant are not shown.

6.1.6. Biotin for T cell-derived proteins
Direct binding peptide EYK (EYA) ₄ EYK and EYKEYAEY
AAYAEYAEYK as described (Bayer and Wilcheck, 1980, Me.
thods Biochem. Anal., 26: 1-45) Modified ELISA assay by complexing with biotin (Gallina et al., 199
0, J. Immunol., 145: 3570-3577) to evaluate the antigen binding activity in the cell supernatant. Approximately 50-2 of supernatant from cell lines grown in protein-free and serum-free medium on Centricon 30 filtration system (Amicon, Danvers, MA)
It was concentrated to 1/00, diluted with carbonate buffer (pH 9.6) to various concentrations, and coated on an Immunolone II plate (Dynatech, Chantilly, VA) at 37 ° C. for 2 hours. After washing with PBS + 0.05% Tween 20,
Bound material was incubated with 100 μl of biotinylated peptide at a dilution of 1: 500 for 1 hour at 37 ° C., washed and incubated with extra avidin-alkaline phosphatase complex (Sigma) diluted 1: 2000 and washed. , And developed with nitrophenyl phosphate substrate (Sigma). OD410n after proper incubation (often overnight at 4 ° C)
m was measured. In some experiments, 100 ng to 1 per well to assess competitiveness for binding.
μg peptide (without biotin) as well as active biotinylated peptide was added.

[0097] 6.2. Results 6.2.1. Transfer of TCRα that the or without with TCRβ gives the ability lath have an antigen-specific activity as shown in Figure 3B, SR combined with Eyk (EYA) ₄
Inhibition of anti-SRBC PFC response by the A1.1 supernatant was observed when BC was present in the culture, but unbound SRBC or SRBC bound to other peptides
Was not present if present. The superior antigen specificity of immunomodulatory activity demonstrated by A1.1 has been previously described (Zeng et al., 1988, J. Immunol 140: 1351-135.
8; Bisonette et al., 1991, J. Immunol 146: 28-98-2907.
), Some of these results are summarized in FIG.

Cell line 175.2 expresses the TCRβ and CD3 components but lacks the functional TCRα gene (Greichenhaus et al., 1991, J. Immunol. 146: 2095). 1
75.2 cells were infected with a retrovirus expressing A1.1-TCRα (see section 6.1.4. Above) and selected in G418, followed by cell sorting of CD3 ⁺ cells. Further selected. Expression of CD3 on the selected cells (FIG. 3A) resulted in the TCR α chain being transferred to the selected cells (17
It was confirmed to be expressed in 5.2-A1.1α). 1
The supernatant from 75.2-A1.1α was collected and tested by in vitro analysis. As shown in Figure 3B, these supernatants were A1.
It showed the same antigen-specific regulatory activity as the supernatant of No. 1, but 175.
The supernatant from 2 had no activity. The original TCR and specificity of 175.2 are completely unrelated to that of A1.1 (Greichenhaus et al., 1991, J. Immunol. 146: 2095).
Thus, these results demonstrate that the expression of the A1.1 TCR α chain gene results in the antigen-specific regulatory activity. In addition, this immunomodulatory activity
It could be neutralized by adding antibodies to α, indicating that the TCR α chain secreted in the supernatant is responsible for this activity (FIG. 5). As a control, FIGS. 6A and B show that the TCRα gene transfection from T cell hybridoma BB19 specific for an epitope of poly18 different from that recognized by A1.1 resulted in two subclones of 175.2 ( It is shown that CD3 expression was induced on the cell surface of AF5 and AF6). However, like parental clone BB19, the transfectants did not confer any immunomodulatory activity in their supernatants (FIG. 7). Therefore,
All poly-18-specific T cells have immunomodulatory activity
It does not always secrete the CRα chain.

To further investigate this observation, another cell line, B9, was infected with a retroviral vector carrying the A1.1 TCR α or β. A1.1
, B9 expresses both TCR α and β, and I-
IL2 in response to the antigen designated A ^d , poly18
(Foteder et al., 1985, J. Immunol. 135: 30
28-3033). As shown in FIG. 8, the supernatant from A1.1 but not B9 showed antigen-specific regulatory activity and B9 cells expressing the A1.1 TCR α chain (B9-A1.1α) also gave this activity, B9 cells expressing A1.1 TCR β chain (B
9-A1.1β) did not result. TC from A1.1
B9 cells expressing both Rα and β (B9-A1.1α
The latter is not due to the blocking action of TCRβ, since β) provided the regulatory activity.

The supernatant of B9-A1.1α was immobilized with anti-TCRα.
Fractionation with antibody by antibody affinity chromatography was tested for antigen-specific regulatory activity. In this analysis, a panel of 4 peptides bound to SRBC was used. As shown in FIG. 9, the soluble active ingredient from B9-A1.1α bound to the anti-TCRα and eluted. The observed specificity for the unsubstituted peptide and the peptide substituted at amino acid 7 (as opposed to the peptide substituted at residue 3 or 10) is characteristic of antigen-specific activity from A1.1. (Bisonette et al., 1991, J. Imm
unol 146: 2898-2907) (see Figure 4). As discussed above, this specificity correlates with the poly18 epitope recognized by the A1.1 TCR (Bisonette et al., 1991, J. Immunol 146: 28-98-2907).

In addition to B9, a retroviral vector was used to transduce the A1.1 TCRα gene into another poly18-specific cell line, B1.1. After selection with G418, the B1.1-A1.1α cell line was found to confer antigen-specific immunomodulatory activity. The original cell line (B1.1) does not bring this. Thus, 2
One TCRα ^{+ b +} (b represents β) T cell hybridoma (B9, B1.1) and one TCRα ^{-b +} T cell hybridoma (175.2) were poly-18-specific regulated after A1.1 TCRα gene transfer. Brought activity. T
To further elucidate whether expression of A1.1TCRα in the absence of CRβ can result in antigen-specific regulatory activity, A1.1TCRα or A1.1TCRβ was added to BW
1100 cells were transferred. BW1100 cells have complete T
Lacking CR α and β (White et al., 1989, J. Imm
unol., 143: 1822-1825), any effect of TCRα gene transfer is directly due to TCRα. As shown in FIG. 10, not BW1100-A1.1β but BW11
The supernatant from 00-A1.1α showed immunomodulatory activity. In other gene transfer experiments, this activity showed A1.1 antigen specificity.

[0102] 6.2.2. Introgression TCR a are correlated and bringing direct antigen binding activity experiments described herein, was released from A1.1 TCR a
It reveals that the chains bind directly to the antigen. It is a distinctive feature conferring biological activity on this TCR α chain compared to that of other cells. As shown in FIG. 11A, supernatants from cell lines expressing A1.1 and A1.1 TCRα contained antigen-binding components detected by the modified ELISA assay (see 6.1.6. Above). are doing. This antigen binding was effectively competed by the unlabeled peptide but not by the two unsuitable peptides (Fig. 11B). One of these two peptides differs from the antigenic peptide by only one residue. This replacement is an antigen presentation assay (an
tigen presentation assay) for A1.1 TCR (Boyer et al., 1990, Eur. J. Immunol.
20: 2145-2148) and A1.1 induction regulatory activity (Bisonette et al., 1991, J. Immunol 146: 28-98-2907).
It has been previously shown to eliminate the antigenicity of peptides. These results indicate that the antigen binding activity is a biologically active product of cells expressing A1.1TCRα, and that the characteristic of antigen binding by this molecule confers its biological activity. It indicates that

6.3. Discussion The data presented here indicate that the TCR α chain was released from A1.1 cells (in our biological analysis SR
Specific antigen (combined with BC) and in vitro
Clearly demonstrating that it is involved in the induction of inhibition of the immune response to SRBC. The CD4 ⁺ T cell hybridoma, A1.1, constitutively releases immunomodulatory activity specific for the synthetic antigen poly-18 and related peptides (Zeng et al., 1988, J. Immunol 140: 1351-1358; Visonette et al., 1991, J. Immunol 146: 28-98-2907). Gene transfer of the A1.1 TCRα gene into other T cell lines as described herein confers the ability to constitutively confer this antigen-specific regulatory activity (FIGS. 3, 8, 9 and 10). A1.1
Transfer of the TCR β chain does not cause or interfere with this effect (Fig. 8). The antigenic specificity of the soluble active ingredient produced by each transduced receptor T cell line is identical to that of A1.1. This active ingredient binds to the monoclonal anti-TCRα antibody (Fig. 9) and the eluted active ingredient is shown by the A1.1 supernatant (Bisonette et al., 1991, J. Immunol 146: 28-98-2907). It showed the same stringent antigen specificity.

In this example, the TCRα chain was CD3 / TC.
It is also clearly demonstrated to be released from cells in a manner independent of the R complex and to regulate antigen-specific immune responses. Specifically, transfection of the A1.1 TCRα gene into BW1100 constitutively resulted in antigen-specific regulatory activity despite BW1100 completely lacking TCRβ (FIG. 10). The results presented here indicate that it is A1.1 TCRα that gives activity to this molecule in PFC analysis.
It is also shown to be direct recognition of the antigen by the chains (FIG. 11) and that other T cells do not exhibit such activity to release the TCRα chain which cannot bind directly to the epip.

While not intending to limit the scope of the invention,
At least two models can be proposed at this point in how TCRα mediates an immune response. For example, the complex of TCRα and antigen is immunogenic, which may result in a regulatory immune response to the TCR. Recent research has shown that specific T cells (Lide
r) et al., 1988, Science 239: 181-183; Sun et al., 1
988, Nature 332: 843-845) or a peptide corresponding to a region in the V region of TCR (Vandenbulk (Vandenba
rk) et al., 1989, Nature 341: 541-544; Howell (Howel
l) et al., 1989, Science 246: 668-670) have shown that immunization can lead to dramatic immunomodulatory effects in vivo. The regulatory action associated with the A1.1 TCR α chain may symbolize such a form of TCR “vaccine method” in vitro.

In addition, an unidentified molecule is an antigen-binding TCRα.
It is possible that this second molecule, attached to the chain, confers a biological function to the system. For example, Iwata et al.
1989, J. Immunol., 143: 3917-3924) show the solubility of a molecule having glycosylation inhibitory activity and a molecule carrying a TCR determinant released in the supernatant of some T cell hybridomas. The complex is described.

7. Example: By in vitro transcription and translation
Production of Biologically Active TCR α Chains 7.1. Materials and Methods 7.1.1. In Vitro Transcription and Translation DNA oligonucleotide probes were designed based on the known sequences of the mouse Cα and Cβ genes. The probe was synthesized and used to screen a cDNA library prepared from poly-18-specific A1.1 hybridoma cells. Full length TCRα and TCR from A1.1
The βcDNA was characterized and cloned into the Bluescript vector (Stratagen, La Jolla, CA). RNA for both Cα and Cβ is eukaryotic in
In vitro transcription was performed using an in vitro transcription system (BRL, Geiselburg, MD). The RNA is then added to the rabbit reticulocyte lysate system (BRL, Geiselburg, M.
Translated in vitro using D). ³⁵ S-Met (New England Nuclear, Boston, MA) was included in the translation for autoradiography. The material was translated in the absence of radionucleotides for biological analysis. The in vitro translated material was then concentrated by affinity chromatography with monoclonal anti-TCRα or anti-TCRβ antibodies. The labeled material was analyzed by SDS-PAGE, treated with enhance and exposed to X-ray film. Biological activity was analyzed as in the system described in Section 6.1.5. Above.

7.2. Results In addition to the findings in section 6 above, that transfer of the TCRα gene from T cell hybridomas, ie A1.1 into other T cell lines transferred the ability to confer antigen-specific immunomodulatory activity. Thus, it is important to confirm whether the pure recombinant TCRα protein produced by this gene has biological activity in this system. Previous studies have shown that mRNA from T cells that make such biologically active factors can be translated in vitro to produce regulatory activity. By analogy with that, TCR
In vitro translation of αRNA may produce biologically active proteins. 7.2.1. In vitro transcription and translation products In vitro transcription and translation results in unglycosylated T
A protein of the predicted size of 32,000 daltons was produced for the CRα protein, which protein is anti-T
It was found to specifically bind to the CRα antibody and not to the anti-TCRβ antibody (Figs. 12 and 13). 7.2.2. Immunoregulatory activity of translation products produced in vitro
The TCRα protein was found to have biological activity in the PFC assay and this activity was completely bound (and eluted) by the anti-TCRα antibody (FIG. 13). FIG.
In A, immunomodulatory activity from in vitro translated TCRα was found in the filtrate of the anti-TCRβ antibody column (non-adsorbed fraction) and in the eluate of the anti-TCRα antibody column (adsorbed fraction). Titering of the activity filtrate (anti-TCRβ) and eluate (anti-TCRα) showed that these activities were similar. TCRα transcribed and translated in vitro showed immunomodulatory activity, whereas TCRβ
The protein produced from RNA was not shown.

7.3. Discussion Combining the experiments detailed above with the studies described in section 6 above, it is clear that recombinant TCRα has a biological function. Thus, the TCR α chain gene encoding such a biologically active factor is a product that is expressed in various expression systems and has biological activity, that is, it specifically suppresses an immune response directed to its target antigen. TC that can
An Rα chain can be produced.

8. Example: T-fines leading to auxiliary ingredient activity
Generation of Cellular Hybridomas 8.1. Materials and Methods 8.1.1. Animals C57B1 / 6 animals were purchased from Jackson Laboratories (Bar Harbor, ME). 8.1.2. Cell line and reagents BW1100 and T cell hybridomas were RPMI16
Maintained in 40 + 10% FCS. Monoclonal antibody directed against CD4 (GK1.5) (Dialyna
s) et al., 1983, Immunol. Rev., 74:29)
Type Culture Collection (Rockville, M
Obtained from D). Rabbit and guinea pig complement were obtained from SciCan (Edmonton, Alberta, Canada) and GIBCO (Grand Island, NY), respectively. Both complement samples were first screened for low background activity before use. Magnetic beads coated with anti-rat IgG antibody were purchased from Dynal.

8.1.3. Generation of T cell hybridomas Spleen cells from C57B1 / 6 mice immunized with SRBC were obtained and, in the presence of complement, antibodies against CD4 (G
K1.5). The CD4-depleted cells are subsequently treated with anti-rat IgG to remove all IgG ⁺ cells.
Reaction was performed with magnetic beads coated with antibody (Dynal beads). Remaining T cells are Lympholite M
(lympholyte M) (Cedar Run Laboratories, P
A) Centrifuged and viable T cells were fused with BW1100 in the presence of PEG at a 1: 1 ratio. Hybridomas were selected in the presence of hypoxanthine, thymidine, aminopterin and ouabain. Mouse red blood cells were used as filler cells. Supernatants from wells judged positive for growth were tested for their ability to replace auxiliary supernatant in combination with A1.1 supernatant in PFC analysis as described in detail in 6.1.5. Above. did.
The active medium was split into secondary medium and the secondary cell lines were retested for activity. Active secondary cell lines were subdivided and those with activity were cloned at 0.4 cells / well. Clones were rescreened for activity.

8.2. Results 8.2.1. T cell hybridomas produce accessory component activity
SRBC immunized mouse spleen cells, except for the to CD4 ⁺ T cells and IgG ⁺ B cells were fused with BW1100. After cloning, one such T cell hybridoma, 3-1-V, has a co-activity that replaces the co-supernatant in mediating antigen-specific immunomodulatory activity when tested in the presence of A1.1 supernatant. It was found to bring it into the culture supernatant (Fig. 1). 3-1-V supernatant is A1.1 TCRα
It functions in combination with the A1.1 supernatant, regardless of whether the gene is a naturally secreted or in vitro translated product. Thus, it is possible to obtain a monoclonal population of T cells that reproducibly and constitutively secrete accessory components for use with the antigen-specific TCR α chain.

9. Example: cDNA of TCRα gene
Rowing From T cells to cDNA using techniques well known in the art
A library can be prepared. The nucleotide sequence encoding the single C region gene for TCRα (Cα) in humans and mice is known (Willson et al., Immunol. Rev., 101: 149-172, 198).
8), a DNA probe homologous to Cα can be synthesized by standard methods and such a library screened for T
It can be used to identify CRα cDNA. In addition, an oligonucleotide probe derived from a specific TCRα sequence was subjected to a PCR (polymerase chain reaction) method (Mullis et al., Method in Enzymol., 155: 335-350,
1987) to generate a cDNA for the TCRα sequence that can be directly cloned (Roman-Roman et al., 199).
1, Eur. J. Immunol., 21: 927-933).

Helper T cell hybridoma, A
1.1 is described above (Foteder et al., 1985, J. I.
mmunol. 135: 3028-3033), poly 18 (poly (Glu-
It expresses TCR α and β molecules specific for a synthetic polypeptide designated Tyr-Lys- (Glu-Tyr-Ala) ₅ )) and releases lymphokines in the presence of specific antigens and I-Ad. The T cell hybridomas also constitutively produce poly 18-specific soluble factors involved in antigen-specific suppression. The factor produced by A1.1 is A
It showed the same excellent antigen specificity as that exhibited by TCR on 1.1 cells (Zeng et al., 1988, J. Immunol 14
0: 1351-1358), and that the immunomodulatory activity of the A1.1 inducer was at least partially encoded by the TCRα protein (Bisonette et al., 1991, J. Immunol 146: 28-98).
-2907) is shown.

The TCRα cDNA of A1.1 cells was cloned from the cDNA library using the Cα probe. MRNA was isolated from 10 ⁹ cells by the conventional guanidine-isothiocyanate and cesium chloride method and recovered by oligo-dT cellulose affinity chromatography. First-strand cDNA was synthesized using oligo-dT primer and reverse transcriptase, and second-strand cDNA was synthesized using DNA polymerase I and RNase H. Ecotranslation of the methylated blunt-ended double-stranded cDNA
It was linked to a RI linker. Following EcoRI digestion, the DNA was screened for its size on an agarose gel, purified by spermine precipitation and cloned into λgt10. The phage DNA was packaged in vitro using Gigapack Gold ™ (Stratagen). Approximately 200,000 plaques were screened by in situ hybridization using a ³² P radiolabeled Cα probe. Inserted DNA from positive clones was M1 for standard dideoxy sequencing.
It was ligated into 3mp18. The complete nucleotide sequence of the A1.1 TCRα cDNA is shown in FIG.

A PLA ₂ specific glycosylation inhibitor (GIF) producing hybridoma (3) expressing TCR α and β chains specific for bee venom phospholipase A ₂ (PLA ₂ ).
B3) has been established (Mori et al., Int. Immunol., 5: 8.
33-842, 1993). This T cell hybridoma constitutively produces immunosuppressive factors, namely GIF and PLA ₂ -bound GIF upon stimulation with cognate antigen and antigen presenting cells. Accumulated evidence suggests that antigen-bound GIF is in vivo
Have been shown to specifically suppress the immune response to the antigen, and that the antigen-bound GIF may be at least partially encoded by TCRα expressed on the cells (Iwata et al. , J. Immunol., 141: 3270-327.
7, 1988; Iwata et al., J. Immunol., 143: 3917-3924, 198.
9; Mori et al., Int. Immunol., 5: 833-842, 1993).

The TCRα cDNA of 3B3 cells was cloned by PCR according to the method described in Murris et al., Nucl. Acids. Res., 8: 3895-3950, 1980. MRNA was isolated from 5 × 10 ⁷ 3B3 cells using the FastTrack ™ mRNA Isolation Kit (Invitrogen). cDNA was generated using the cDNA synthesis system (Pharmacia). After its generation, T4 ligase (Takara) was used to ligate the cDNAs at the 5'and 3'ends to construct a circular DNA. An oligonucleotide primer encoding mouse CαDNA was phosphoramidated by a DNA / RNA synthesizer (Applied Biosystems).
synthesized using the midite method (Beaucage)
Et al., Tetrahedron Lett., 22: 1859-1862, 1981).

The sequences of these primers are as follows. 5'-GTGGTCCAGTTGAGGTCTGCAA
GA-3 '5'-TTGAAAGTTTTAGGTCATCATC-
3 ′ PCR was carried out by Taql DNA polymerase (Takara) in the presence of template cDNA, primers and dNTPs.
I went in a thermo cycler. PC
The conditions of R were 94 ° C. for 1 minute for the denaturation step; 54 ° C. for 1 minute for the annealing step; and 72 ° C. for 2 minutes for the extension step, and these were cycled 35 times. The amplified cDNA was converted into pC of TA Cloning System (trademark) (Invitrogen).
Subcloned into R1000 vector. The DNA sequence of the insert was determined by the dideoxy sequencing method (Sanger (Sa
Nger) et al., Proc. Natl. Acad. Sci. USA 74: 5463-546.
7, 1977). 3 different TCRαcDN
A was cloned and sequenced. Two of them are fusion partner cells of 3B3 hybridoma, namely BW5147 (Chien et al., Nature, 312: 31-3.
5, 1984; Kumar et al., J. Exp. Med., 170: 218.
3-2188, 1989). No other TCRα cDNA was expressed in BW5147, confirmed using several PCR primers encoding different parts of this TCRα gene. This indicates that this TCRα originated from PLA ₂ -specific T cells. Two independent clones encoding this TCRα cDNA were isolated and their DNA sequences were confirmed to be identical. This 3B3 lead TCR
The DNA sequence of αcDNA is shown in FIG. This TCRα
The cDNA encoded a 268 amino acid open reading frame and the first 20 amino acids were identified as the signal peptide (McElligott).
Et al., J. Immunol., 140: 4123-4131, 1988).

10. Example: Recombinant TCR in E. coli
Expression of α-Direct Expression 10.1. Construction of expression plasmid for TCRα To construct an expression plasmid encoding the extracellular region of A1.1TCRα, DNA fragments were amplified by PCR using oligonucleotides as primers. It encodes amino acids 26-240 in the extracellular region and has a ClaI restriction site at the 5'end and a Shine-Dalgano sequence (Scherer et al., Nucl. Acids. Res., 8: 389.
5-3950, 1980) and met start codon, and A1.1 containing two stop codons at the 3'end and a BamHI restriction site.
The TCRα cDNA was amplified using PCR with two primers. The sequences of these primers are as follows. 5'-AACATCGATTAATTTTATTAAAA
CTTAAGGAGGATTAATTATGAGCCCA
GAATCCCTCAGTGTCC-3'5'-AACGGATCCCTATTATTGAAAG
TTTAGGTTCATATC-3 '

Unless otherwise stated, the denaturation step of each PCR cycle was set at 94 ° C. for 1 minute and the extension step at 72 ° C. for 2 minutes.
It was a minute. The DNA fragment was digested with ClaI and Ba
It was digested with mHI and cloned into the expression plasmid pST811 vector carrying the trp promoter and the trpA terminator (Fig. 16, JP 63-269983) at its unique ClaI and BamHI sites. Competent RR1 E. coli host cells were transformed with a novel plasmid (FIG. 17) called pST811-A1.1TCRαS5. Selection of plasmid-containing cells is carried out using pS
By the antibiotic (ampicillin) resistance marker gene carried on the T811 vector. The DNA sequences of the synthetic oligonucleotides and the entire TCRα gene were confirmed by the DNA sequencing method of plasmid DNA. 26-20
Different truncated A1.1 TCRα encoding 3 amino acids
Another expression plasmid containing the was constructed using the following 3'-end primers. 5'-CGTTGGTCTGTTCGAAGTGGGAT
TATCCGTAGGCAA-3 'The amplified DNA was inserted into the pST811 vector to give p
An expression plasmid designated ST811-A1.1TCRαS3 was generated.

10.2. TCRα-producing E. coli culture plasmid pST811-A1.1 TCRαS5 or pS
RR1 E. coli harboring T811-A1.1TCRαS3 was added to 50 ml containing 50 μg / ml ampicillin.
It was grown in Luria medium and grown overnight at 37 ° C. The inoculum culture medium was added with 0.8% glucose, 0.4% casamino acid, 1%.
The cells were transferred to a 1-liter M9 medium containing 0 mg / liter thiamine and 50 mg / liter ampicillin so that other bacteria did not enter, and cultured at 37 ° C. for 3 hours. To the end of this first incubation, 40 mg of indole acrylic acid was added and the culture was incubated for another 5 hours at 37 ° C.

11. Example: Recombinant TCR in E. coli
Expression of α-fusion expression system 11.1. Construction of expression plasmid Matsuki et al. developed a rat calmodulin expression plasmid carrying a calmodulin cDNA and trp promoter, namely pTCAL7 (Matsuki et al., Biotec.
h. Appl. Biochem., 12: 284-291, 1990) (Fig. 18).
To express the fusion protein, several cloning sites were created at the 3'end of the calmodulin cDNA which also contained a thrombin cleavage sequence. For details, pTCA
The calmodulin cDNA inserted in L7 was amplified by PCR using the following two primers: one C
It encodes the 5'end of the calmodulin cDNA containing the laI site, the other one is the sequence at the 3'end of the calmodulin cDNA, namely the thrombin cleavage site and Bam.
HI, XbaI, NotI and BglII sites were provided. 5'-CGCAATCGATTAATTTTATTAA
ACTTAAGGAGGTAATTATTGGCA-
3'5'-GAAGATCTGCCGCCGCTCTAGA
GGATCCACGCGGAACCAGTTTTTGCA
The GTCATC-3 'amplified DNA fragment was digested with ClaI and BglII.
Digested with ClaI and BglII digested pTCA
Inserted into a larger fragment of the L7 plasmid.
Competent DH5 E. coli host cells were transformed with this new plasmid, called pCF1 (FIG. 19). The DNA sequence of the synthetic oligonucleotide was confirmed by the DNA sequencing method.

11.2. Expression plasmid for TCRα
3B3-derived TCR encoding constructed amino acids 21-241
The α extracellular region DNA fragment was amplified from the pCR1000-3B3TCRα plasmid by PCR using two primers each containing an XbaI site for the 5 ′ end and a stop codon and a NotI site for the 3 ′ end. . The sequences of these primers are as follows. 5'-GCTCTAGAGGACAGCAAGTGCAG
CAGAGT-3 '5'-AAGCGGCCGCTTAGTTTTGAAAG
The TTTAGGTT-3 'amplified DNA fragment was ligated with the XbaI and NotI digested pCF1 plasmid. pCF1-3
This novel plasmid, called B3TCRα (FIG. 20) was transformed into competent W3110 E. coli cells and the DNA sequence was confirmed.

A1.1 which encodes amino acids 26-240
The derived TCRα cDNA was also inserted into pCF1 by the above method using the following two primers to construct a novel expression plasmid pCF1-A1.1TCRαS5. 5'-GATCTAGACAGAGCCCAGAATC
CCTCAGTG-3 '5'-AAGCGGCCGCTTATTGAAAGTT
The culture of E. coli producing TAGGTTCATATC-3 'TCRα was described in Example 10. In this expression system, calmodulin 3B3TCR
The fusion protein of α or calmodulin A1.1 TCRαS5 was expressed in soluble form, accounting for about 10% of the total protein (Fig. 21).

12. Example: Purification of Recombinant TCRα 12.1. Purification and Regeneration of Recombinant TCRα-Direct Expression System A1.1 TCRαS5 expressing cells About 1 g wet weight 30 m
suspended in 1 l of water and 562 kg / cm by French-press
^It was destroyed 4 times at ² (8000 psi). The disrupted cell pellet was obtained by centrifugation at 15,000 xg for 10 minutes at 4 ° C and washed twice with water. By SDS polyacrylamide gel electrophoresis analysis, most of the pellets were A1.1
It was revealed to be a TCRαS5 protein (Fig. 22). Insoluble A1.1 estimated to be 1-2 mg
The pellet fraction containing TCRαS5 was added to 4 ml of the appropriate mixture so that the final concentration of the components in the mixture was 8M.
Urea, 50 mM sodium acetate and 0.1 mM EDTA
It was made to become. The mixture was kept at room temperature for 3 hours
1.1 TCRαS5 was solubilized. Residual insoluble material was removed by centrifugation at 15,000 xg for 10 minutes at room temperature.

For the regeneration / reoxidation of soluble A1.1 TCRαS5, the supernatant fraction was added to 40 ml of the appropriate mixture with slow agitation to give a final concentration of the components of 2.5 M in the mixture. Urea, 5 mM sodium acetate, 0.01 mM
EDTA, 50 mM Tris HCl (pH 8.5), 1 mM
Glutathione (reduced type) and 0.1 mM glutathione (oxidized type) were prepared. After 16 hours at 4 ° C,
400 μl of trifluoroacetate (TFA) was added to the mixture. The mixture was applied to a reverse phase Vydac C4 column (1 x 10 cm) equilibrated with 0.1% (v / v) TFA / water at room temperature and a flow rate of 1 ml / min. After applying the sample to the column, apply 10% to the column.
(V / v) Washed with 0.1% TFA / water in acetonitrile. The A1.1TCRαS5 substance bound to the column was treated with acetonitrile at a concentration gradient of 30 to 40% (v / v) of 0.1% T.
Elute with FA / water. Fraction solutions taken from the C4 column were analyzed by SDS-polyacrylamide gel electrophoresis without reduction and purified into fractions 25-30 of A1.
The 1TCRαS5 protein was identified. These fractions were pooled and dried under vacuum. PB the dried protein
Dissolved in S, but other similar buffers may be used.
A1.1TCRαS3 was purified and regenerated by the same procedure as above.

12.2. Purification of recombinant TCRα-fusion expression
System 3B3 TCRα expressing cells Approximately 1 g Wet weight 100 ml
Suspended in 50 mM Tris-HCl buffer (pH 8.0) of
562 kg / cm ² (8000 ps by French-press
It was destroyed 4 times in i). The supernatant was collected by centrifugation at 15,000 × g for 10 minutes at 4 ° C., and 50 mM Tris-HCl buffer containing 2 mM glutathione (reduced form) and 0.2 mM glutathione (oxidized form) was added overnight at 4 ° C. It was dialyzed. The sample solution was added to a suitable mixture to give a final concentration of the components in the mixture of 150 mM NaCl, 1 m.
M CaCl ₂ and 5 mM MgCl ₂ . This mixed solution was added to 50 mM Tris HCl (pH 8.
0), a fast-flowing, low-height subcolumn of phenyl sepharose 6 equilibrated with 150 mM NaCl, 1 mM CaCl ₂ and 5 mM MgCl ₂ (Pharmacia,
3 × 6 cm) at 4 ° C. and a flow rate of 0.5 ml / min. After washing the column with the same buffer, calmodulin-TCRα fusion protein was added to 50 mM Tris HCl (p
H8.0) and analyzed by SDS-polyacrylamide gel electrophoresis showed that the fusion protein was highly purified (FIG. 23).

The elution fraction contained 150 mM NaCl.
For 50 mM Tris-HCl buffer (pH 8.0)
And dialyzed overnight at 4 ° C. Ca in 50 ml of dialyzed fraction
Cl ₂To a final concentration of 2.5 mM and add 1% thrombi
(Sigma) and incubate at 25 ° C for 6 hours
And the fusion protein was digested. To stop digestion,
EDTA was added to the reaction to a final concentration of 4 mM and then
With 50 mM Tris-HCl buffer (pH 8.0)
And dialyzed. After dialysis, the mixture is ultrafiltered to 5 ml
Concentrated and equilibrated with 2x PBS buffer
TSK G2000 gel filtration column (Toyo Soda)
And fractionated by HPLC at a flow rate of 3 ml / min. 2m
g of purified 3B3TCRα protein is
Recovered on 26.

13. Example: Recombinant TCRα Biological
Activity 13.1. In vitro immunosuppressive activity of recombinant A1.1 TCRα
To evaluate the biological activity of sexually modified A1.1 TCRα,
A simple antigen-specific system was used (Zeng et al., 1988, J. I.
mmunol 40: 1351-1358; Zeng et al., 1989, Proc. Natl.
Acad. Sci. USA 86: 3758-3762; Bisonette et al., 1991,
J. Immunol 146: 2898-2907). C57B1 / 6 or C5
1 × 10 ⁷ spleen cells from 7B1 / 10 mouse,
1 ml of RPMI1640 supplemented with 10% FCS and 5 × 10 ⁻⁵ M 2-mercaptoethanol (2-ME)
It was placed in the culture solution. 50 μl of 1% SRB conjugated with poly 18 (EYK (EYA) ₅ ) or substituted polypeptide
C was added to each culture. In the culture medium, "auxiliary components" (1
Recombinant T with 0-15%) or without "auxiliary ingredients"
The inhibitory activity was evaluated by adding CRα. This auxiliary component was prepared by culturing mouse T cells from an animal immunized with SRBC, and then adsorbing the supernatant by SRBC. 92% air / 8 humidified at 37 ° C.
Incubate in% CO ₂ and after 5 days anti-SRBC
PFC evaluation (plaque forming cells) was performed. In all experiments presented herein, A1.1 cell culture supernatant was used as a positive control. Recombinant A1.1 TCRα
The immunosuppressive activity of S5 (cf Example 10.1) was observed in the dose dependent behavior shown in Figure 24a. This figure is 2
Shown are the results from one encoded experiment, recombinant TCRα molecules were titrated and then each dilution was encoded. Recombinant A1.1 TCRαS3 (c.
f. The immunosuppressive activity of Example 10.1) was also observed in a dose-dependent manner (Fig. 24b).

13.2. Recombinant A1.1 TCRα Antigen Specificity
Immunosuppressive activity The excellent immunospecificity of the A1.1-induced TCR α chain has been described (Bisonette et al., 1991, J. Immunol 146: 2898-2907;
Green et al., 1991, Proc. Natl. Acad. Sci.
USA 88: 8475-8479). The immunosuppressive activity of TCR α chain is
EYAEYAEYAEYAEY, which is observed when using Poly 18 or EYKEYAEYAEYAEYA
It was not detected when using substituted peptides such as A and EYKEYAEYAYAYAEYA. Thus, the antigen specificity of recombinant A1.1TCRαS5 was evaluated by using these four peptides. Recombinant TCRα protein is poly 18 or EYKEY
4x10 only if AEYAEYAEYA is present
^The inhibitory activity was shown at the final concentration of ^-10 M (Fig. 25). The figure shows the results from four experiments, in which each peptide (or saline) listed on the left was added to a coded test tube. The coded sample was then used to bind SRBC and assayed in the presence of auxiliary supernatant. No inhibition was observed in any case where the auxiliary supernatant was absent. Note that a different code was used for each experiment.

13.3. In vivo immunosuppression of recombinant TCRα
To assess whether anti -active recombinant TCRα regulates the immune response in vivo, recombinant 3B3TCRα protein was administered to mice immunized with bee venom PLA ₂ . As an antigen, a DNP (dinitrophenyl) derivative of bee venom PLA ₂ was prepared by standard procedures. Balb /
C mouse was adsorbed on 2 mg of alum, DNP-
Immunization was carried out by intraperitoneal injection of 10 μg PLA ₂ . Recombinant 3B3 TCRα was injected intraperitoneally at doses of 5 μg per dose on days -1, 0, 2, 4, 6 and control mice received PBS alone. Serum was collected from each mouse two weeks after immunization, and anti-DNP-IgG1 and anti-DNP-IgE were tested by ELISA (Iwata et al., J. Immuno).
L., 141: 3270-3277, 1988). Anti-DNP
-IgG1 and anti-DNP-IgE were significantly suppressed (Table 1). To assess antigen specificity, recombinant 3B3TCR using DNP-ovalbumin as antigen
The activity of α was evaluated. As expected, the anti-DNP antibody response to DNP-ovalbumin was unaffected by treatment of mice immunized with recombinant TCRα.

These results show the antigen-specific immunosuppressive activity of the recombinant TCRα protein. None of the mice showed side effects on the recombinant TCRα protein. It is used in recombinant TCs to suppress immune responses that mediate disorders such as autoimmune diseases and allergies.
This shows the possibility that Rα protein can be used.

Table 1 Inhibition of anti-hapten antibody response of Balb / c mice by recombinant 3B3 TCRα ──────────────────────────────── ─── Anti-DNP IgE (μg / ml) ^a Anti-DNP IgG1 (μg / ml) ^a ───────────────────────────── ───── PBS (N = 4) 0.50 ± 0.26 56.8 ± 9.8 3B3TCRα (N = 6) 0.12 ± 0.03 ^b 5.8 ± 2.6 ^b ──────────────────── ─────────────── a) 2 weeks after immunization with alum-adsorbed DNP-PLA ₂ b) p <0.05

The present invention is not limited in its scope by these embodiments exemplified for the purpose of explaining one aspect of the present invention, and any microorganisms which are functionally equivalent to the present invention can be used. Is within the range of. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are within the scope of the appended claims. All publications cited herein are incorporated by reference in their entirety.

[Brief description of drawings]

1 is a T cell hybridoma, namely 3-1.
It has been shown that -V produces accessory components that mediate immunomodulatory activity in the presence of antigen-specific TCR alpha chains from A1.1 cells.

FIG. 2 shows the complete nucleotide sequence of the TCRα gene isolated from A1.1 cells. C of the gene
The area is underlined.

FIG. 3 shows TC from A1.1 cells to 175.2 cells.
It has been shown that gene transfer of Rα (175.2-A1.1α) confers the ability to confer antigen-specific regulatory activity.
(A) Expression of CD3 on 175.2 cells before and after transfer of A1.1 TCRα. (B) Related antigen, (C) Carrier (SR
BC) alone and (D) unrelated control antigen,
A1.1, 175.2, and 175.2-A1.1 in the presence of
Antigen-specific regulatory activity in alpha supernatant.

FIG. 4 shows TCRα from hybridoma A1.1.
The peptides used to test the regulatory activity of the chains are shown.

FIG. 5 shows that the immunomodulatory activity elicited by A1.1 cells is neutralized by antibodies to the TCR α chain.

FIG. 6 shows expression of CD3 on (A) AF5 cells and (B) AF6 cells (2 subclones of 175.2) after transfection of A1.1 TCRα and selection with anti-CD3 antibody. Shows.

FIG. 7 shows T from BB19 cells to 175.2 cells.
It has been shown that CRα gene transfer does not confer the ability to provide antigen-specific immunomodulatory activity.

FIG. 8 shows TCRα from A1.1 cells to B9 cells.
It has been shown that the introgression (B9-A1.1α) of E. coli confers the ability to confer antigen-specific regulatory activity.

FIG. 9 shows that the regulatory activity released from B9-A1.1α binds anti-TCRα and exhibits the same antigen specificity as that from A1.1 cells.

FIG. 10 shows that expression of A1.1TCRα in cells lacking TCRβ is sufficient to confer antigen-specific regulatory activity.

FIG. 11: A1.1 expressing A1.1 TCRα
And antigen-specific binding activity in supernatants of other cell lines.

FIG. 12 shows in vitro translated A1.1T.
Figure 3 shows SDS-PAGE of CRα and β polypeptides.

FIG. 13: In vitro translated A1.1T
The regulatory activity of the CRα gene product indicates that it binds anti-TCRα but not anti-TCRβ.

FIG. 14 shows the complete nucleotide sequence and deduced amino acid sequence of A1.1 TCRα cDNA.

FIG. 15 shows the complete nucleotide sequence and deduced amino acid sequence of 3B3-derived TCRα cDNA.

FIG. 16: trp promoter and trpA
Expression plasmid pST811 carrying a terminator
Is shown.

FIG. 17: Expression plasmid pST811-A
1.1 TCRαS5 is shown.

FIG. 18: Expression plasmid pTC harboring rat calmodulin cDNA and trp promoter
It shows AL7.

FIG. 19 shows rat calmodulin and trp.
The expression plasmid pCF1 carrying the promoter and containing an additional cloning site from pTCAL7 is shown.

FIG. 20: Expression plasmid pCF1-3B3
The TCRα is shown.

FIG. 21 shows SDS-PAGE of E. coli-produced calmodulin-TCRα from two expression plasmids.

FIG. 22 shows SDS-PAGE of E. coli-expressed A1.1TCRαS5 protein.

FIG. 23. SDS-PA of E. coli expressed 3B3TCRα (calmodulin-TCRα fusion protein).
GE is shown.

Figure 24: Recombinant A1.1TCRαS5 (Figure 24a) and recombinant A1.1TCRαS3 (Figure 24b).
It is shown that the immunosuppressive activity of is dependent on dose.

FIG. 25 shows poly 18 or EYKEYAEYA.
It shows that the immunosuppressive activity of the TCR α chain is observed when EYAEYA is used.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁶ Identification code Internal reference number FI Technical display location C07K 7/00 8318-4H 14/725 8318-4H 19/00 8318-4H C12N 1/21 8828- 4B C12P 21/02 C 9282-4B G01N 33/53 DK // (C12N 1/21 C12R 1:19) (C12N 1/21 C12R 1: 445) (C12N 1/21 C12R 1:38) (72) Inventor Douglas Earl. Green USA 92130 Tyneborn Circle, San Diego, CA 4153 4153 (72) Inventor Alan Fotteder USA 92130 San Diego, Calif., No. 65 Kerarum Court 13167 (72) Inventor Raid P. Bissonet United States 92130 San Diego, California, number 105 Camerview 4039 (72) Inventor Toshifumi Sankayama 314-5 Fukushima, Gunma-cho, Gunma-gun, Japan (72) Yasuyuki Ishii United States 92122 San Diego, California, Caminito Merriad 4082

Claims (45)

[Claims] 1. An effective amount of TCRα specific for the antigen.
A method of modulating an immune response to an antigen, which comprises contacting the chain with the TCRα chain to modulate the immune response in an antigen-specific manner. 2. The method according to claim 1, wherein the TCR α chain is contacted with an antigen in the presence of an auxiliary component. 3. The method of claim 2, wherein the accessory component comprises a soluble factor produced by stimulated T cells that has no immunomodulatory effect in the absence of TCRα chain. 4. The method of claim 3, wherein the accessory component comprises a soluble factor produced by stimulated T cells minus the soluble TCR α chain. 5. The method of claim 4, wherein the accessory component is produced by a T cell hybridoma. 6. The method according to claim 1, wherein the TCR α chain suppresses an immune response in an antigen-specific manner. 7. The method according to claim 1, wherein the TCR α chain enhances the immune response in an antigen-specific manner. 8. A TCR α chain is contacted with an antibody specific to the TCR α chain in an amount effective for binding to the TCR α chain,
TCR consisting of thereby enhancing the immune response
A method for enhancing an antigen-specific immune response suppressed by an α chain. 9. The method according to claim 8, wherein the antibody is immobilized to remove the TCR α chain. 10. The method according to claim 8, wherein the antibody binds to the TCR α chain and neutralizes its activity. 11. Contacting a T cell with an antisense oligonucleotide complementary to a TCR α chain message to produce TC
A method of enhancing an antigen-specific immune response suppressed by a TCRα chain secreted by T cells, wherein expression and secretion of Rα chain is inhibited. 12. The antisense oligonucleotide is TC
12. Complementary to the variable region of the Rα chain message.
The method described in. 13. The following steps: (a) A test culture of spleen cells containing an antigen bound to a hemolyzable carrier, in the presence of an auxiliary component, sufficient to generate an immune response suggested by PFC production. In time, TCR
exposed to a sample suspected of containing alpha chains; and (b)
PFC production in test cultures was compared to control cultures without sample, where a decrease in PFC production compared to controls indicates the presence of a TCR alpha chain that suppresses the immune response in an antigen-specific manner,
An increase in PFC production relative to a control also indicates the presence of a TCRα chain that enhances the immune response in an antigen-specific manner, comprising: a soluble antigen-specific TCRα chain that regulates an immune response to an antigen in a body fluid. . 14. The method according to claim 13, wherein the TCR α chain suppresses an immune response in an antigen-specific manner. 15. The method according to claim 13, wherein the TCR α chain enhances the immune response in an antigen-specific manner. 16. The following steps: (a) a test culture of spleen cells containing an antigen bound to a hemolyzable carrier, in the presence of an auxiliary component, for a time sufficient for the immune response shown by PFC production to occur. And refined TC
Exposed to Rα chain; and (b) PFC production in the test culture was compared to a control culture without purified TCRα chain, where the reduction in PFC production compared to the control indicates that the TCRα chain immunospecifically responds to the antigen. In vitro, and an increase in PFC production relative to controls indicates that the TCR α chain enhances the immune response in an antigen-specific manner.
A purified T capable of binding to an antigen and modulating the immune response to the antigen when evaluated in a ro assay system
CRα chain. 17. The purified TCR α chain according to claim 16, which suppresses an immune response in an antigen-specific manner. 18. The purified TCR α chain according to claim 16, which enhances an immune response in an antigen-specific manner. 19. The following formula: R _1- [X ₁ ] -R ₂ (wherein R ₁ is a carrier peptide, X ₁ is a proteolytic enzyme recognition sequence, and R ₂ is a polypeptide encoded by a structural gene. Is a substantially pure fusion polypeptide. 20. The fusion polypeptide according to claim 19, wherein the carrier peptide is calmodulin. 21. The fusion polypeptide of claim 19, wherein the polypeptide encoded by the structural gene is the T cell receptor alpha (TCRα) chain. 22. The fusion polypeptide according to claim 21, wherein the TCR α chain is the extracellular domain of the polypeptide. 23. The fusion polypeptide according to claim 19, wherein the proteolytic enzyme recognition sequence is recognized by thrombin. 24. The fusion polypeptide according to claim 23, wherein the proteolytic enzyme recognition sequence is Lys-Val-Pro-Arg-Gly. 25. An isolated polynucleotide sequence encoding the fusion polypeptide of claim 19. 26. A recombinant expression vector comprising the polynucleotide sequence of claim 25. 27. The vector according to claim 26, wherein the vector is a virus. 28. The vector according to claim 26, which is a plasmid.
Vector described in. 29. The vector of claim 28, wherein the vector comprises a phenotypic selectable marker DNA sequence. 30. The vector according to claim 29, wherein the phenotypic selection marker is selected from the group consisting of β-lactamase and chloramphenicol acetyltransferase. 31. A host cell containing the vector according to claim 26. 32. The host cell of claim 31, wherein the host cell is eukaryotic. 33. The host cell of claim 31, wherein the host cell is prokaryotic. 34. The prokaryotic cell is Escherichia coli (Esc).
herichiacoli), Staphylococcus aureu
s) and Pseudomonas aeruginosa (Pseud)
34. The host cell according to claim 33, selected from the group consisting of: monasaera uginosa). 35. The following steps: (a) culturing a host cell transformed with a vector containing a polynucleotide sequence encoding a TCR α chain in a operably linked manner; and (b) substantially pure and biological. Isolating the biologically active TCRα chain, which comprises producing a substantially pure, biologically active TCRα chain. 36. A polynucleotide encoding a TCR α chain is a polypeptide of the following formula: R _1- [X ₁ ] (wherein R ₁ is a carrier peptide and X ₁ is a proteolytic enzyme recognition sequence). 36. The method of claim 35, operably linked to an encoding polynucleotide. 37. The method of claim 36, wherein the carrier peptide is calmodulin. 38. The method according to claim 36, wherein the proteolytic enzyme recognition sequence is recognized by thrombin. 39. The method according to claim 38, wherein the proteolytic enzyme recognition sequence is Lys-Val-Pro-Arg-Gly. 40. The method according to claim 35, wherein the TCR α chain is the extracellular domain of the polypeptide. 41. The method of claim 36, further comprising cleaving the TCR α chain portion from the fusion peptide. 42. A pharmaceutical composition comprising an immunosuppressive amount of a substantially purified TCR α chain and a pharmaceutically inactive carrier. 43. The pharmaceutical composition according to claim 42, wherein the TCR α chain is an extracellular domain. 44. The method according to claim 1, wherein the TCR α chain is an extracellular domain. 45. The TCRα chain according to claim 16, wherein the TCRα chain is an extracellular domain.