CA2179018A1 - Method for antigen-specific immunoregulation by t-cell alpha chain - Google Patents

Abstract

Methods for modulating immune responses in an antigen-specific fashion are disclosed. The methods utilize soluble TCR.alpha. chains which are capable of binding to the antigen, and which, in the presence of an accessory component, suppress the immune response in an antigen-specific manner. The use of TCR.alpha. chains which demonstrate such activity in therapeutic protocols for treating hyperimmune and immunodeficient conditions is described.

Description

2 1 7 9 Q 1 8 PCT/US94/14542 METHOD FOR ANTIGEN-SPECI~IC IMMUNOREGULATION
BY T-CELL ALPHA CHAIN

This application is a c~ t;on-in-part of application Serial No. 07/752,820, filed August 30, 1991.

BACKGROUND OF THE INVENTION

1. Field of the Invention This invention relates to methods for regulating the immune system in an antigen-specific manner. T cell eceptor alpha chains which are capable of binding to an antigen of interest are utilized in protocols decign~d for the ~u~ c~sion or allgmPnt-~ion of the immune l.,i.~,onse to the 10 particular antigen. The th~ap~ ic protocols dcsc-il)ed herein may be used in the treatment of allergy, autoimmunity, graft rejection and cancer.

2. Description of Related Art Immunologists and others have long studied the immune system in an attempt to find a mechanism for reg~ ting the immune response. To this end, various drugs or protocols are 15 utilized which either depress or augment the immune ~ponse in toto in a non-specific fashion.
However, this type of regulation is ---~ r~;lo~ y because it affects the entire immune system.
It is not based on an und~ ;..g of the particular co".ponel.ts of the immune system that would permit regulation of an immune lcs~uonse to only specific i ntigPnc For example, in the treatment of allergies it would be advantageous to selectively ~up~l-,ss an immune response to 20 a particular allergen without dep.c~sing the individual's entire immune system. The invention described and claimed herein, which is based, in part, on the discovery that soluble T cell receptor alpha chains, are antigen-specific - ed;~ ofthe immune Ic~n3e, relates to methods of using those T cell lecc~t~. alpha chains for either su~",.e3si-,g or augmentating the immune cis~,onse to specific antigenc wo 95/16462 ~ 1 7 q O 1 8 Pcr/uss4~l4542 ~ REGULATION OF THE IMM[JNE RESPONSE
The introduction of a foreign antigen into an individual elicits an immune Ic:,lJOl~S~ COnSi~lillg of two major collll,onc~ , the cellular and humoral immune ,c~nses, me~ tPd by fimctio~Ally distinct populations of Iymphocytes known as T and B cells"cs~Jc~livcly. T cells respond to 5 antigen stimulation by producing Iymphol~inPs which "help" or activate yarious other cell types in the immune system. In addition, certain T cells can become cytotoxic effector cells. On the other hand, the B cell ~c~lJollse primarily consists of their secrclu,y products, antibodies, which directly bind to Antigenc Helper T cells (TH) can be ~lictinguichPd from cytotoxic T cells and B
cells by their cell surface expression of a gl~cuplolcill maker termed CD4. Although the 10 meçhAnicm by which CD4+ helper T cells regulate other cell types has not been fu}ly elucidated, the role of certain subsets within the CD4+ T cell cullll.~ l,llcllt has been invPctig~ted (Mosmann and Coffman, 1989, Ann. Rev. Immunol. 7:145-173). Type I helper cells (THI) produce interleukin-2 (IL-2) and y-illlc.r~lu-- upon activation, while type 2 helper cells (TH2) produce ILA
and IL-5. Based on the profile of Iymphnl~ine procluctinn, THI appear to be involved in promoting 15 the proliferation of other T cells, whereas TH2 factors s~Jccirlcally regulate B cell proliferation, antibody synthesis, and antibody class switching. Furthermore, these two TH populations may regulate each other since ~-i"t, .rc,on produced by THI inhibits the proliferation and function of A salient feature of both B and T cell rc~onses is their exquisite specificity for the immunizing 20 antigen, however, the meçhArlicmc for antigen l~co~,ilion differ. Antibodies bind directly to antigens on a solid surface or in solution, whereas T cells only react with antigens that are present on a solid phase such as the surfaces of antigen-p,csc,lti"g cells. ~ itinn~lly, the AntigPnc must be p~csclltcd to T cells in the context of major ~ (UCOl~.l'A~ ility co...pleY (MHC}encoded class I or class II molecules. The MHC refers to a cluster of genes that encode proteins with diverse 25 immunological functions. Class I gene products are found on all cells and they are the targets of major transplantation rejection le~,.)ûnses. Class II gene products are mostly expressed on cells in various hem~lui)oi~lic lineages and they _re involved in cell-cell illh~ ions in the immune ~c~luonse. Both Class I and Class II proteins have been shown to also fiunction as lec~lol~ for antigens on the surface of antigen-pres- .li..g cells. Another level of complexity

-3-in the interaction between a T cell and an antigen is that it occurs only if the haplotype (the combination of all alleles within the complex) of the MHC is the same between that of the antigen-p-~s~ g cells and the responding T cells. Thus, a T cell specific for a particular antigen would respond only if the antigen is pl~s-~led by cells ~AIJlCSsillg a m~trhing MHC.
5 This phenomenon is known as MHC-restriction. G

In 1970, Gershon and Kondo (Gershon and Kondo, 1970, Immunology 18:723) proposed that T
cells could also negatively influence the course of an immune .~ponse. Although this concept of immune regulation was initially met with skepticism, it eventually became accepted by the majority of immunologists as it provided a conceptual framework for the m~;..l u~l-ce of 1 0 homeostasis in the immune system after an antigen had been elimin~ted by a given immune response and a continued ,e~ponse was no longer necçcc-.y. Since then, antigen-specific su~ sor T cells (Ts) have been reported in a wide variety of experimental systems (Green et al., 1983, Ann. Rev. Immunol. 1:439-463; Dorf and Benac~i.,af, 1984, Ann. Rev. Immunol.
;;~:127-158).

1 5 Attempts to delin~o~te the me~h~ m of Ts action led to the discovery of a number of soluble me~i~tors in T cell culture ~ t` ~1~, It was therefore post~ tpd that Ts functioned through the release of T ~u~ ol factors (TsF) which then acted on other T and B cells. Elaborate models had been proposed based on tA~ illlC~llal data to illustrate the complex interactions between di~~ Ts subsets and their TsF (Asherson et al., 1986, Ann. Rev. Immunol. 4:37-68).

Since specific cell surface markers had been identified for distinct functional subsets of T cells, a search for unique markers for Ts and their TsF was undertaken. A study of Ts surface phenotype first showed that they ~ ed CD8 (Lyt-2), a marker shared by T cells with cytotoxic potential. In 1976, an alllis.,lull~ was reported that apl)e~t;d to react with a ~11 u-;lule specifically ~;Ap.-,i,sed by Ts in mice (Murphy et al., 1976, J. Exp. Med. 144:699; Tada et al., 1976, J. Exp. Med. 1~:713). Mapping studies of the gene enco~ing the antigen localized it to the I region between I-E~ and I-E~ within the murine MHC. This locus was called I-J.

WO95/16462 2 1 7 9 n 1 8 PCT/US94/14542 In the early 1980's, the field of cellular immunology began to move from phenomenology to molecular ch~u~clc-i~lion. This transition resulted in a number of discoveries such as the chal~cl~fi~ion of the T cell receptor (TCR) (See Section 2.2, infra), the identification of various ly~nrhsl~in~oc~ and the e~ tion of the three dimensional structure of MHC proteins. However, application of molecular cloning techniques to the study of T cell-mediated ~ulJpression did not yield fruitful insights. For instance, attempts to biochemically purify TsF to homogeneity had been largely uncuGcçccful. When the genes of the I region of the mouse MHC were isolated and sequenced, there did not appear to be enough DNA between I-E~ and I-E~ to account for the I-J
gene. Moreover, when a large panel of T cell clones and T cell hybridomas were çY~mined for 1 0 TCR ~ gene rearrangements, only helper and cytotoxic T cells contained such l ca., angements while all Ts tested were negative, indicating that Ts might not express functional rec~to-s (Hedrick et al., 1985, Proc. Natl. Acad. Sci. USA 82:531-535).

STRUCTUP~F AND FUNCTION OF THE T CELL RECEPTOR
The specificity of T and B cell responses for antigen is a function of the unique lece~Jtu.~
1 5 eAy. essed by these cells. Progress in the study of the B cell receptor advanced rapidly when it was found that B cells secreted their receptors in the form of antibodies. Plasmacytomas are naturally-occurring tumors of antibody-producing cells that are monoclonal in origin. These tumors provided a cQntin~lQus source of homogeneous proteins which were used in the initial yu~ir~calion and chal~.;t~,.iLalion ofthe structure ofthe antibody molecule (Potter, 1972, Physiol.
Res. 52:631 -710). It has now been proven that antibodies are identical to their membrane-bound COUIIltl ~,a. Is except that the cell surface form contains a domain for transmembrane anchoring (Tonegawa, 1983, Nature 302:575-581).

Early work on the TCR, on the other hand, failed to detect a sec.clol~y form of the TCR and, therefore, the a~",.uachcs used with soluble antibodies could not be effectively employed. In ~ddition, the discovery of MHC-restriction in T cell recognition of antigen added another level of difficulty to the analysis of the TCR (Zinkernagel and Doherty, 1974, Nature ~:701-702).
At that time it was debatable whether a single TCR could account for binding to both antigen WO 95/16462 2 ! 7 9 0 1 8 PCT/US94/14542 plus MHC or two separate I ~C-,~)tOl ~ were involved. However, what seemed clear was that the TCR was unlikely to be idçntic~l to the B cell rec~;~to..

The advent of the development of monoclonal antibodies, recombinant DNA technology and methods for long-term culture of antigen-specific T cells greatly facilitated the identification of 5 the TCR in the 1980's. Monoclonal antibodies ge"~ ted against clonal popul~tionc of T cells were found to specifically react with only the immunizing T cells (Allison et al., 1982, J.
Immunol. 129:2293; Haskin et al. 1983, J. Exp. Med. 157:1149; Samelson et al., 1983, Proc.
Natl. Acad. Sci. USA 80:6972). The use of these clonally-specific antibodies to immuno~-~,ci~ t~ T cell membranes revealed a 46,000 dalton molecular weight band by SDS-1 0 PAGE. Under non-reducing conditions, a 90,000 dalton band was detected ~g&t~ g a dimeric structure for the TCR. Subsequent experiments established that a fun~tion~l TCR is a heterodimer c~ posed of two disulphide-linked gl~;op.oleills known as a and ~ (Marrack and Kappler, 1987, Science ;~: 1073- 1079). At about the same time, complementary DNA (cDNA) clones çnco ling the a and ~ chains were isolated in both human and mice (Hedrick et al., 1984, Nature 308:149-153; Hedrick et al., 1984, Nature 308:153-158; Yanagi et al., 1984, Nature ~Q~: 145-149). Sequence analysis of the cDNA demonstrated that the coding se.~u~,..ces were madeupoflwlangedgenesegJn~ntcsimilartothatofantibodies. Transferofthe a and ~ genes into ,~ci~,;e,-l cells was shown to be both nece~sa. ~ and sufficient to confer antigen specificity and MHC-restriction (Dembic et al., 1986, Nature 320:232-238). Thus, the heterodimeric TCR
appears to be responsible for recognizing the combination of antigen and MHC. While some studies suggest that the a and 1~ variable regions are skewed towards reco~.ilion of antigen and MHC, respectively (Kappler et al., 1987, Cell 49:263-271; Winoto et al., 1986, Nature 324:679-682; Tan et al., 1988, Cell 54:247-261), other studies suggest that ~cG~.ilion is an emergent property ofthe entire receptor(Kuo and Hood, 1987, Proc. Natl. Acad. Sci. USA 84:7614-7618;
Danska et al., 1990, J. Exp. Med. 172:27-33).

CD3 is a complex of polypepti~ec which are non-covalently linked to the TCR and which may be involved in transmembrane sigr qlling events leading to T cell activation triggered by TCR
occupancy (Clevers et al., 1988, Ann. Rev. Immunol. 6:629). Direct stimulation of CD3 with WO 95/16462 2 1 7 q O 1 8 PCT/US94/14~42 antibodies has been shown to mimic the normal pathways of T cell activation (Meuer et al., 1983, J. Exp. Med. 158:988). The ~ spOl L of CD3 to the T cell surface requires its association with complete heterodimeric TCR complexes intracellulary. It has also been demonstrated that complexes of both TCR a and 1~ chains and the CD3 polypeptides are assembled in the endoplasmic reticulum (Minami et al., 1987, Proc. Natl. Acad. Sci. USA 84:2688-2692; Alarcon et al., 1988, J. Biol. Chem. 236:2953-2961). The correctly formed complete ~ec~,~tol~, TCR/CD3, are then l,an~l,olled to the cell surface as a functional unit. The incompletely assembled lec~lJtor complexes are l.~llsl,oll~d through the Golgi to Iysosomes where they become degraded. Therefore, lln~ a and p chains do not appear to normally gain access to the exterior of T cells. Even complete TCR a and ~ rec.l~t~ are not readily detectable in secreted forms extracellularly. IIe~etofole, their function in antigen recognition was thought to be limited to the T cell surface and in the form of a heterodimer.

It is now clear that the a ~ TCR is ~ sed by the vast majority of functional T cells. Although a second type of TCR col..posed of y~ heterodimer has been identified, these l~CCIJtUl~ are 1 5 ~ ssed by a small ~e.ll~ge of pe,il)lle.~l T cells and their involvement in antigen-specific ,~co~lilion is yet to be d~monctrated. Structurally, the a~ and y~ lecc~)tol~ of T cells are highly homologous to antibody molecules in primary sequence, gene orgalli~alion and modes of DNA
rea.l~ gr~pnt (Davis and Bjorkman, 1988, Nature ~:395-402). However, the T cell antigen are distinct from ~nt~ ies in two major aspects: TCR are only found at cell surfaces 20 and they recognize ~ntigenc only in the context of MHC-encoded molecules.

2.3 SO!.UBT,F T CF-,T, }2FCFT'TORS
Recent s~udies suggest that the TCR may, in some occh~:ol-c, be shed or released from cells (Guy et al., 1989, Science 244: 1477-1480; Fairchild et al., l990, J. Immunol. 145:2001-2009).
However, it has not been demonstrated whether such secreted molecules are complete TCR, 25 partial fr~gmpntc~ or other molecules with TCR cross-reactive epitopes. Prior to the discoveries demon~ led by the e~llpl~s described herein, the notion that rull~ ollally active TCRa chains could be released from T cells independently of the r~m~ining TCR colllponents was controversial and met with ~ ptiricm Klausner and colleagues (Bonifacino et al.,1990, Science ~_:79-82) have shown that TCRa is retained and degraded in the endoplasmic reticulum unless complexed with CD3~, and further (Minami et al., 1987, Proc. Natl. Acad. Sci. USA 84:2688-2692) that TCRa that is not cA~llcd to the cell surface as part of the CD3-TCR complex is degraded in Iysosomes. These observations argue against a pathway whereby TCRa might be 5 released from cells. Studies on TCR~, which is similarly retained and degraded in the endoplasmic reticulum (Wileman et al., 1990, Cell Regulation 1:907-919), suggest that the assembly and ll all5~lul 1 of TCR is more complex. For example, in SCID mice c~ CSsi~lg a TCR~
transgene, TCR~ is cAl~essed on the surface of imm~ re thymocytes in the absence of TCRa or CD3 co...ro~ .lc (Kishi et al., 1991, EMBO J. 10:93-100). Further, a truncated TCR~ chain 1 0 gene has been con~l, uclcd, inrlv~lin~- only VDJ and the C ~, domain, that is secreted despite the r l~cl ,1 ;on that such a molecule should be degraded (Gascoigne, 1990, J. Biol. Chem. ~:9296-9301). Thus, the possibility existed that in some cells, TCR might be released in small 4~ ;Pc possibly in a complex with other l...ide..lir~Pd molecules and/or in a post-tr~n~ ion~lly l.u"c~t~d form.

1 5 A number of CA~.illlC.l~ reported the ~ s~,.,cc of an unidentified soluble regulatory factor or factors which reacted with antibodies to TCRa. For example, a cell free immunoregulatory activity was detected in an in vitro assay of a CD4+ helper T cell hybridoma, Al.1, specific for a synthetic polypeptide antigen, poly 18, plus I-Ad; the antigen fine specificity of the factor co"~,s~ dedtothatoftheTcellhybridoma(Zhengetal., 1988,J.Immunol. 140:1351-1358).Antic~n~ç oligonllcleQtides coll~ g to TCR Va and V~ were found to specifically inhibit cell surface TCR-CD3 expression, but only a-.~i~e~.~e for Va and not V~ (or control oligonucleQtidcs) inhibited the production of the soluble regulatory activity of A1.1 (Zheng et al., 1989, Proc. Natl. Acad. Sci. USA 86: 3758-3762). In a very recent study, the antigen-specific regu' y activity of A1.1 was bound and eluted from a monoclon~l antibody column specific for TCR a and resolved as a 46,000 dalton molecular weight protein from metabolically-labeled the activity was not bound by anti-TCR~, anti-TCR V~, or anti-CD3~ antibodies (Bissonnclle et al., 1991, J. lmmllnol. 146:2898-2907). Ts activities not derived from surface TCR, ~lthou~h sharing TCRa-chain determin~rlt~, were lcpo,lcd but not ch~aclcli~cd (Collins et al., 1990, J. Immunol. 145:2809-2812). Takada (1990, J. Immunol. 145: 2846-2853) also wo 95/16462 2 ! 7 9 n 1 8 PCT/US94/14542 reported a Ts activity which shared TCR-chain determin~ntc, but which was MHC restricted.
In contrastto these results, Fairchild (1990, J. lmmunol 145:2001-2009) reported a DNP-specific Ts factor which reacted with anti-TCR C~ but which also reacted with anti-Vp and anti-TCR-~antibodies. Prior to the discoveries described herein, no one had identified or ehlc~ t~d the role 5 of TCRa as a soluble, immunoregulatory ~ledialol ~c~ponsible for the observed antigen-specific regulatory activity.

Three main strategies, which replace or delete the TCR transmembrane region, have been allc."lJtcd for the production of soluble TCR molecules. In the most straightforward app~oach, translational termin~tion codons were introduced upsln,alll of the TCRa or TCRa/~ dimers. In 1 0 cDNA-transfected COS-l cells, COS-7 cells or Hela cells, TCR~ has been reported to be rapidly degraded in a nonlysosomal COlllpal Llllclll before entering the Golgi apl)a. atus (Wileman, et al., J. Cell. Biol., 110:973-986, 1990; Lip~ cull-Schwartz, et al., Cell,54:209-220, 1988; Baniyash, et al., J. Biol. Chem., 263:9874-9878, 1988; Bonifacino, et al., Science, ~:79-82, 1990;
Bonifacino, et al., Cell, 63 :503-S 13, 1990; Manolios, et al., Science, ~2:274-277, 1990; Shin, 1 5 et al., Science, ~: 1901 - 1904, 1993). In the second strategy, the extracellular V and C domains of the TCR~ and ~ chains have been shuffled to the glycosyl-phûsphalidylinositol membrane anchor of the placental alkaline phosph~t~ce or Thy- I molecules (Lin, et al., Science, 249:677-679, 1990; Slanetz, etaL, Eur. J: Immunol., 21:179-183, 1991). The coll~,;",onding lipid-linked TCR polypeptides were released from the membrane in soluble form by treatment of the cells with phosph~tidylinositol-specific phospholipase C, and the solubilized TCRo~ ~ heterodimers were shown to react specifically with an anti-clonotypic monoclonal antibody. However, the yield of released TCR polypeptides was too low to apply this molecule for clinical use. The third ~piûach was to engineer hybrid proteins of TCR with immunoglobin constant region (Gregoire, et al., Proc. Natl. Acad. Sci., USA, 88:8077-8081, 1991; Weber, et al., Nature, 356:793-796, 1992) and CD3 zeta chain (Engel, etal., Science, ~:1318-1321, 1992). These fusion proteins were secreted into the medium by transfection of myeloma cells or leuk~rnic cells, and these soluble TCRs were shown to retain all serologically detected epitopes of the corresponding cell-surface-bound TCR. However, these fusion proteins showed low-affinity ~ccogllilion of antigens WO 95/16462 2 ! 7 9 0 1 8 PCr/US94/14~42 and may be imm~nl g~nic. In a~ iti~n~ the funrtinnql e,~y~ ion of TCRa chain alone has never been suGce~ful.

The expression of TCR in E. coli was reported previously by using a fusion protein of Va and V~ polypeptide (Soo Hoo, et al., Proc. Natl. Acad. Sci. USA, 89:4759-4763, 1992). However, 5 only 1% of protein could be recovered as refolded protein. In the present invention, the yield of refolded protein is as much as typical soluble proteins such as cytokines, which will make it possible to provide homogeneous TCRa molecule for clinical use.

In order to express the animal proteins in E. coli, various systems have been developed by many investigators. However, a number of difficulties are frequently encountered when ~"I,ressing 10 heterologous genes in this organism. For example, the significant dirr~ ces between E. coli and animal genes, both in their patterns of codon usage and in their translation initiation signals, may i.~t..r~"e with the efficient translation of animal mRNA on bacterial riboso...cs (Orormo, et al., NucL Acids Res. 10:2971-2996, 1982). Alt~"..alively, heterologous proteins synthesized in E. coli may fail to accumulate to significant levels due to the activity of the host cell proteases (Gotte~m~n, Annu. Rev. Genet., 2~: 163- 198, 1989). In addition, the physical cl1al a~ l islics of th~ ic~lly useful proteins can cause l,.ubl ,-~s, since some secreted molecules or membrane associated molecules such as TCR require glycosylation and disulfied-crosslinking for both stability and solubility. Since such stabilizing processes are not available in the bacterial cytoplasm, heterologous proteins produced within E. coli often form insoluble a~ gates known as "inclusion bodies" (Schein, et al., Bio/Technolo~y,1: 1141-1149, 1989). The present invention provides methods to express truncated form of TCRa polypeptide in inrhlsion body in E. coli and to refold and purify biologically active TCRa.

WO 95/16462 2 ~ 7 q ~ 1 8 PCT/US94/14S42 3. SUlVll~l~Y OF 1~, ~VENTION

The present invention relates to methods which utilize the TCRa chain for mod~ ting an immune response in an antigen-specific manner. TCRa chains that demonstrate the following two i..-pc,. L~ulL characteristics, which can be evaluated in vitro, are selected for production and 5 use in the practice of the invention: TCRa chains used in the method of the invention must be capable of binding to the antigen of interest, and in the presence of an accessory component described herein, modulate the specific immune ~ ,onse g~ ,r~led against that antigen, i e., by su~ essing or augmenting the antigen-specific immune response.

The TCRa chains which demonstrate such properties may be used advantageously in protocols 10 described for the down-regulation or up-regulation of the antigen-specific immune response m vivo in human or animal subjects or in vitro. For example, in patients with hyperimmune responses, e.g., allergies, autoimmune ~Aice~CPs~ or graft rejection, an effective dose of TCRa chain specific for the responsible antigen which, in the presence of the acce~so-y component, su~ es the antigen-specific immune ~e~ se can be a~minictP~ed in vivo. Conversely, body fluids of an i.. ,.. ~o~ ,.essed patient can be tested for the p-~3ence of soluble TCRa chains that exhibit immunosul",--,s~ive effects. AugmPnt~tion of the patient's immune response for the antigen may be achieved by removal or neutralization of the soluble TCRa chains using antibodies specific for the TCR~ chain, or ~.~l ic~F n~e oligonucleotides that inhibit the expression of the TCRa chain.

20 In vitro assays which can be used to evaluate the TCRa chains used in the invention are described herein. For example, a number of imml-no~ffinity tçchniqu~Ps may be used to evaluate antigen binding, and a plaque forming cell (PFC) assay, described in detail infra, (hereinafter referred to as the "PFC assay") may be used to evaluate the regulatory function of the TCRa chain tested. Briefly, in this PFC assay, the TCRa chain to be tested is added, in the presence 25 of an acce~sc~-y co---poll~.-L, to a spleen cell culture collLah~ g the antigen of interest coupled to an immunogenic, Iysable carrier, such as xenogeneic red blood cells. The immunoregulatory effect of the TCRa chain is evaluated by ~ccPssing the immune l~n3e which is gene,aLt;d over the course of a few days, as in-licsted by the generation of plaque forming cells in the culture.
That is, the immune ~e~nse gen~,~le~ cells that produce complement-fixing antibodies against the carrier (ç,g" red blood cells), and these cells can be detected via an assay in which the cells are mixed with co~ )le.-,~nl and the carrier (e.g., red blood cells) and formed into a monolayer.
5 Lysis of the carrier results in the formation of one clear plaque, co,.-,;,~"ding to the presence of one plaque forming cell (PFC). Inhibition of the generation of PFC in the culture in-lic~fçs suppression of the immune ~e~l~onse, mediated by the TCRa chain specific for the coupled antigen. As explained in greater detail, infra, the acces~u,y colllponclll used in the assay is prepared from stimulated T cell supernatants depleted of soluble factors, such as TCRa chains, 10 that directly bind to the antigen used to stimul~tç the T cells. The accesso- y component in and of itself, has no effect on an immune response unless the TCRa chain is present.

The invention is based, in part, on the discovery of a soluble TCRa chain which is col,~liLulively secreted by a T cell hybridoma. As demonstrated in the working examples, this secreted TCRa chain is capable of directly binding to its antigen and, in the presence of accessory component, 15 su~",..,.,ses the immune ~ ,onse which would normally be gen~ led against the antigen.
However, the invention is not limited to the use of naturally secreted TCRa chains, since any TCRa chain gene can be cloned, ~A~ressed and the gene product tested for its suitability in the practice of the invention using the techniques and methods described herein. In addition, the assays described herein may be used to evaluate other molecules, e.g., antibodies, other TCR
20 CO---pOI-~ L~, which demonstrate an immunoregulatory function in an antigen-specific manner.

In one embodiment of the invention, a new fusion gene expression system based on the use of rat calmodulin as fusion partner is provided. The system can be preferably used for the high expression and purification of TCRa protein having biological activities. The expression of rat calmodulin in E. coli has been succçscful by employing an expression vector cont~ining the E.
coli trp promoter and trpA terminator (Matsuki, et al., Biotech, Appl. Biochem., 12:284-291, 1990). In this system, the rat calmodulin cDNA was modified so as to delete the 5'-nontranslated sequence and to i--cc~ le a co~ sequence for the E. coli ribosome-binding site. Several codons for the N-terminal amino acids were selected to fit the E. coli c- n~nc--~ nucleotide se~u~ e around the tr~nClsti~n initiation codon. By inducing expression in E. coli soluble rate calmodulin accounted for over 30% of total cellular proteins. About 100 mg of recombinant calmodulin of 90% purity was obt~",ed from I liter of culture by using phenyl-Se~,h~ ~ se column chromatography. In order to fuse TCR gene at the 3'-end of rat calmodulin gene in this 5 invention, a~ ition~l sequ-once enco-ling protease cleavage site, Lys-Val-Pro-Arg-Gly (SEQ ID
NO: 1), recognized by thrombin (Chang, Eu7. ~ Biochem., 151:217-224, 1985) is inserted at the C-terminus of calmodulin. This device makes it possible to cleave off the TCR~ protein for many reasons: 1) the ~A~Jr~ssiol~ level is high, 2) the fusion protein is ~ ,ssed as soluble form 3) purification ofthe protein is ~ullJl;singly easy, 4) individual refolding process for each TCR~
10 protein is not nccessa.y.

4. B~TF,F DF-~CI2~PTION OF T~F, DRAWll~GS

FIGURE lA and B. A T cell hybridoma, 3-1-V, produces an accessoly cc...ponc;nl which mediates immunoregulatory activity in the presence of antigen-specific TCRa chain from Al . l cells.

FIGURE 2. The complete nucleotide sequence ofthe TCRa gene isolated from Al.l cells. The colls~ll region of the gene is und~ l~col ed (SEQ ID NO: 14).

FIGURE 3. Gene transfer of TCRa from Al . l cells to 175.2 cells (175.2-Al . l a) transfers the ability to produce an antigen-specific regulatory activity. (A) Expression of CD3 on 175.2 cells before and after the transfer of Al.l TCRa. Antigen-specific regulatory activity in Al.l and 1 0 175.2-A1.1 t~ ~u~.lldtants in the presence of (B) relevant antigen, (C) carrier (SRBC) alone, and (D) irrelevant control antigen (SEQ ID NO: 15).

FIGURE 4. Peptides used in testing the regulatory activity of TCRa chain from hybridoma A 1.1 (SEQIDNOS: 16, 17, 18, 19,20,21,22,23 and24).
FIGURE 5. The immunoregulatoly activity produced by A1.1 cells is neutralized by an antibody to TCRa chain.

FIGURE 6 (A) and (B). Expression of CD3 on FIGURE 6 (A) AF5 and FIGURE 6 (B) AF6 cells (two subclones of 175.2) after the transfer of A 1.1 TCRa and selection with anti-CD3 antibodies.

FIGURE 7A and B. Gene transfer of TCRa from BB 19 cells to 175.2 cells does not transfer the ability to produce an antigen-specific immunoregulatory activity as shown by an anti-SRBC PFC
assay.
FIGURE 8. Gene transfer of TCRa from A1.1 cells to B9 cells (B9-A 1.1 a) transfers the ability to produce an antigen-specific regulatory activity.

21 790t 8 FIGURE 9. The regulatory activity released from B9-A1.1 a is bound by anti-TCRa and displays same antigen-specificity as the activity from A1.1 cells.

FIGURE 10A and B. Expression of the Al.l TCRa in cells lacking TCR~ is sufficient for

5 production of the antigen-specific regulatory activity.

FIGURE I lA. Antigen-specific binding activity in ~up~ akul~ of Al . l and other cell lines hlg Al . l TCRa.

10 FIGURE I I B. Competition of antigen-specific binding activity in ~ I IA1 AI II ~ of A l .1 and other cell lines ~Aple;.~ing A1.1 TCRa by peptides.

FIGURE 12. SDS-PAGE of in vitro translated A1.1 TCRa and ~ polypeptides.

FIGURE 13A and B. The regulatory activity of A1. 1 TCRa gene product translated in vitro is 15 bound by anti-TCRa and not anti-TCR~.

FIGURE 14. The complete nucleotide sequence and deduced amino acid sequence of Al.l TCRa cDNA is shown (SEQ ID NOS: 25 and 26).

FIGURE 15. The cull~pl~: nllrleotjde and deduced amino acid sequenl~e of 3B3-derived TCRa cDNA is shown (SEQ ID NOS: 27 and 28).

FIGURE 16. The ~A~ sion plasmid pST8 11 which carries a trp promoter and a trpA t~nninAtt)r ls shown.

FIGURE 17. The expression plasmid pST81 I-Al.l TCRaS5 is shown.

FIGURE 18. The expression plasmid pTCAL7 which carries rat calmodulin cDNA and a trp promoter is shown.

WO 95/16462 2 ! ~ 9 D 1 ~3 PCT/US94/14542 FIGURE 19. The ~A~ s~ion plasmid pCF 1 which carries rat r~lm~ulin and a trp promoter and contains additional cloning sites from pTCAL7 is shown.

FIGURE 20. The expression plasmid pCFl-3B3TCR is shown.

FIGURE 21. SDS-PAGE of E. coli produced calmodulin-TCRa from two expression plasmids 5 is shown.

FIGURE 22. SDS-PAGE of E. coli tiAI,.essed Al.l TCRaS5 protein.

FIGURE 23. SDS-PAGE of E. coli CA~ ssed 3B3TCRa (calmodulin-TCRa fusion protein).

FIGURE 24a. The immuno~u~ ive activity of recombinant Al.l TCRaS5 was dose de~Jende~

10 FIGURE 24b. The immunosu~ sive activity of recombinant Al.l TCRaS3 was dose dependent.

FIGURE 25. Immuno~u~ sive activity of the TCRa chain was observed when poly- l 8 or EYKEYAEYAEYAEYA (SEQ ID NO: 2) was used.

WO 95/16462 2 ~ 7 9 0 1 8 PCT/US94114542 5, T)ETAn,~,l) DF~CRIPIION OF THE INVENTION

The present invention involves the use of antigen-binding a chains of the T cell antigen ~ce~tu- ~
in the regulation of antigen-specific immune ~s~onses. In accoldance with one aspect of the invention, a TCRa chain is evaluated for its ability to bind antigen and to modulate the immune 5 ,c~nse specific for that antigen. In vitro assays are described herein which can be used for this purpose. TCR chains which demonstrate ap~. ~ p. idle activity can be produced in quantity, for example, using recombinant DNA and/or ch~mic~l synthetic methods and may be used to down-regulate or up-regulate the immune .c~nse to a specific antigen. For example, h~ nsili~ity reactions, autoimmune re~,onses and graft rejection responses may be ~ul~pressed using TCRa 10 chains which are specific for the corresponding ~ntigÇnS~ and which induce antigen-specific ~u~p~ession. Alternatively, immunity to an antigen may be augmented by the removal of such a chains, or by inhibiting production of such a chains in a subject to specifically enhance the immune response to a particular antigen. Conversely, TCRa chains that augment the immune response to an antigen may be identified and utilized.

15 The invention is based, in part, on the discovery of a secreted form of TCRa chain which directly binds to antigen and ~up~ es the immune response generated against that antigen. In particular, a CD4+ helper T cell hybridoma, Al.l, is described, specific for a synthetic polypeptide antigen, poly 18, plus I-Ad which co.-liluli~ely releases a secreted form of its TCRa chain that binds to antigen, and in the p ~s~nce of app.u~ te acce~ùl.y component, inhibits the 20 immune ,e;,~llse to the antigen. The isolation ofthe Al .l TCRa chain gene and its transfer into poly l 8 non-reactive T cell lines described herein (see Section 6, infra) and the demonstration that the product of in vitro l-~ns~ Jtion and translation of the A l . l TCRa chain gene mediates this regulatory activity (see Section 7, infra) demonstrate that the TCRa chain gene, not the TCR~ chain gene, is recpol-cible for encoding the regulatory factor which directly binds antigen 25 and mediates a regulatory function.

The produl tion of a TCRa chain and its use as an antigen-specific immunoregulatory agent are fully described and exemplified in the sections below.

wo 95/16462 2 ~ 7 ~ O 1 8 PCT/USg4114542 5.1 PRODUCTION OF TCR AT P~ CHAIN
The present invention relates to TCRa chains (not the complete T cell surface antigen ~CG~1~O1 of and ~) possçscine both antigen-binding and i...lllu..u.~,~ulatory activities. An antigen-binding TCR protein with antigen-specific regulatory activity may be produced in a variety ûf 5 ways. For example, eA~Jlession of TCR chain protein may be achieved by recûmbinant DNA
technology and/or chemical synthetic techniques based on known amino acid sequences.
Alternatively, the TCR chain may be purified directly from culture ~ lllat~ll~ of continuous T cell lines that release this activity.

~.1.1. EVALUATION OF TCR AT P~ CHAINS
10 Regardless of the method used to produce such TCR chains, the antigen binding capability and immunûregulatûry activity ûf the molecule should be evaluated. For example, the ability of the TCR chain to directly bind to an antigen ûf interest may be evaluated ~ modified immunoassay techniques including, but not limited to ELISA (enzyme-linked immunosorbent assay), immunoprGcipil~lion, Western blots, or radioimmunoassays in which the TCR chain is 15 substituted for the antibody normally used in these assay systems.

The immnnoregulatory capability ûfthe antigen-binding TCR chain may be evaluated using any assay system which allows the detection of an immune ~esl~ùnse in an antigen-specific fashion.
For example, the PFC assay as described and exemplified herein may be utilized to identify TCR chains that ~u,~ S immune ~ u~ses directed tûward a particular antigen. When spleen 20 cells are cultured in the p.~s.,l.ce of a highly immunogenic carrier, such as sheep red blood cells (SRBC), an immune r~ ~,o--se ûccurs which results in the generation of plaque fûrming cells.
The number of PFC gcne.~tGd per culture is ~ccessed by mixing the cultured spleen cells with SRBC (or a~ iaLe Iysable carrier) and cûmplement, and culturing the mixture as a monolayer.
Cells surrounded by a clear plaque (e.g., of Iysed red cells) are counted as PFCs. Inhibition of 25 PFC generation in the spleen cell culture, i e., a reduction in the number of PFC/culture, inf~ic~t~s ~U~ ion of the immune ~G~nse. In ûrder to test TCR chains fûr s~ e activity, and to ensure that the su~ G~ion is antigen specific, the PFC assay may be cûnducted as follows:
the antigen of interest is coupled to SRBC (Ag-SRBC) and added to spleen cells from wo 95/16462 2 1 7 9 0 1 ~ PCT/US94/14542 unimmunized mice. The immunoregulatory effect of a TCRa chain specific for the antigen is acsessed by adding the TCRa chain to be tested to the culture in the presence of an accessory co."pon~.,l described below (i e., the accesso,y colllponc.ll should be added to the culture prior to or sim~ usly with the TCRa chain to be tested). Control cultures receive the TCRa chain 5 in the absence of accessory colllpunclll or vice versa, or may involve the use of an irrelevant antigen. Following culture, the number of PFC/culture is ~csessed for each con~litio~ An inhibition of PFC generation in the test cultures, as compared to that observed in the controls, indicates that the TCRa chain tested ~u~""c~ses, in an antigen-specific manner, the immune ~;,,uonse which is normally gene,aled in the culture system.

10 The accesso, y co-l-ponc,-l used in the test system co",~,ises the ~ul~f ~ .l of stim~ ted T cells depleted of any soluble factors, including TCRa chains, that directly bind to the antigen which was used to stimulate the T cells, so that the accesso"~ component in and of itself does not ~upptess immune responses. The accf~suly co"~ljonenl is produced from T cells stimulated in vivo with the c&,i.,lt;.~icat-)r used in the antigen-specific PFC assay. For example, the 15 following p~ucedu~e may be used to prepare acccs~u,y co""~onel,l for use in the PFC assay system described above in which Ag-SRBC is the target. Spleen cells derived from SRBC-immunized mice are depleted of B cells, and the enriched T cells are cultured or used to generate T cell hybridomas that can be used as a reproducible, contin-~ouc supply of culture ~u~J~,lllal~ll.
The su,uclllal~lt~ of the T cell cultures are tested for their ability to inhibit an anti-SRBC immune 20 ~c~nse using a PFC assay in which SRBC are added to cultured spleen cells in the presence or absence of the T cell ~ lants. The T cell culture sur-- - which are found to inhibit the anti-SRBC ~c~Jullse are then ~- bcd with SRBC to remove any soluble factors, such as soluble TCRa chains, which bind directly to the SRBC. The adsorbed supernatants are then tested for their ability to inhibit an anti-SRBC immune response using the PFC assay. Those adsorbed 25 ~u~lllalhlll~ which do not inhibit the anti-SRBC ~,uonse are used as the accesso,y colllpon~
in the PFC assay des;g~fd to identify TCRa chains that demonstrate antigen-specific imm~ hs--p~ e activity Ci.~, the PFC assays which utilize Ag-SRBC targets). AIIGIIIaliVGIy, T cell hybridomas may be gell~l~tcd that produce the accessol y c.~ ~n~.~l without the need for an adsorption step; for example, hybridoma 3-1-V described in Section 8, infra (See FIG. I) WO 95/16462 2 1 7 ~ O 1 i~3 PCT/US94/14542 constitutively produces the acces~uly colllpûll.,,ll in culture SU~ dta ll~. Thus, the accessol y collll,one.ll contains one or more factors that, while not inhibil~l y on its own, allows an antigen-specific factor, i.e., the TCRa chain, to ~u~,ples~ an immune l.sl,onsc in an antigen-specific fashion. An example of such an assay system is set forth in Section 6.1.5 infra.

5 Conversely, TCRa chains which augment an immune response may be identified in a similar way. In such cases, an accesso-y component p-~,~cd from T cell hybridomas, or from T cell culture sul~c.--a~ that demonstrate increased PFC generation prior to adsorption and no activity after adsorption could be used in PFC assays designed to identify TCRa chains that augment the immune l~nse against the Ag-SRBC in an antigen-specific manner.

10 Since the fc,legoing assay systems utilize unprimed spleen cell cultures to assess immune ~c~nses~ and carrier-primed spleen cell cultures to prepare accessory component, they may be limited to the use of animal-derived sources for the cultured spleen cells CÇ,~, mice, rats, rabbits, and non-human primates). However, this does not preclude their use for testing the immuno-regulatory activity of human TCRa chains. Indeed a number of human immune functions can 15 be tested in animal-based assay systems; e.~., human antibody effector fi-nrtion~ such as complement mediated Iysis and antibody dependent cellular cytotoxicity can be demonstrated using animal serum and animal effector cells, ~ Jecli~rely~ However, it may be preferable to modify the PFC assay described above using human cell cultures in place ûf the animal spleen cell cultures. For example, the effect of a TCRa chain on the immune response to a particular 20 antigen can be evaluated using the reverse hemolytic PFC assay described by Thomas et al., 1980, J. Immunol. 125: 2402 (see also Thomas, 1982, J. Immunol. 128: 1386). Pokeweed mitogen stim~ ted T cell su~ may be used as a source of accesso. y component in this assay system.

~. SF~ F.CTION OF T CF.~ ~ ~
25 Antigen-specific T cells which can serve as the source of the TCRa chains and/or the source of genetic material used to produce the TCRa chains used in the methods of the invention may be generated and selected by a number of in vitro techniqu-os that are well-known in the art. A

217~0t8 source of T cells may be p~ h~ ~al blood, Iymph nodes, spleens, and other Iymphoid organs as well as tissue sites into which T cells have infiltrated such as tumor nodules. The T cell fraction may be selJ~aled from other cell types by density gradient centrifugation or cell sorting meth~c using antibodies to T cell surface markers such as CD2, CD3, CD4, CD8, etc. These methods 5 include, but are not limited to p~nning affinity chromatography, flow cytometry, m~gnetic bead separations. Negative selectiorl procedures may also be employed to enrich for T cells by removing non-T cell populations using antibodies directed to markers not ~AI ressed by T cells or utilizing membrane properties of non-T cells such as adhesion to various substrates. Further selection of the T cell subsets of interest may apply the above-mentioned techniques using 10 antibodies to more specific markers such as anti-CD4 and anti-CD8 in selecting for helper and cytotoxic/supp,~3sor T cells, ~ e.~ ely or to markers ~-essed on T cell subsets such as memory cells.

Antigen-specific T cell lines may be generated in vitro by repetitive stimulation with optimal conc~ -dtions of specific antigenc in the plesence of a~ u~lidte irradiated antigen-~ s~ ;..g 15 cells and cytokines. Antigen-p-~ g cells should be obtained from autologous or MHC-matrhed sources and they may be macrophages, dendritic cells, Langerhans cells, EBV-transformed B cells or ~-s~p~_ d p~fil)h~,~al blood mononuclear cells. Cytokines may include various interleukins such as interleukin 1, 2, 4, and 6 in natural or recombinant forms. For one such technique, see, for example, Takata et al., 1990, J. Immunol. 145: 2846-2853.

20 Clonal populations of antigen-specific T cells may be derived by T cell cloning using limiting dilution cloning methods in the p.~,sence of irradiated feeder cells, antigen and cytokines.
Alternatively, T cell hybridomas may be generated by fusion ofthe antigen-specific T cells with fusion partner tumor lines such as BW5147 or BWII00 followed by HAT selection and recloning. Antigen-specific T cells have also been cloned and propag~ted by the use of 25 monoclonal antibodies to CD3. T cell clones and T cell hybridomas can be generated using cells obtai..ed directly from in vivo sources followed by testing and selection for antigen-specificity or antigen-specific T cell lines can be secured prior to the cloning and fusion events. T cell clones can be m~int~in~od long-term in culture by repetitive stimulation with antigen or anti-CD3 WO95/16462 2 1 7 q O 1 8 PCT/US94/14542 every 7-14 days followed by i;A~JaIIS;On with cytokines while T cell hybridomas can be grown in the app,~ te culture media without periodic antigen stimulation.

The antigen-specificity of monnclorl~l T cell populations can be acsessed in in vitro assays ",~ ~w~ Ulg the proliferation and/or Iymph-)kine production of these cells in response to antigen.
5 Phenotype ofthe T cells may be ~.ri....ed by staining with antibodies to various T cell markers.

Such antigen-specific T cells may secrete TCRa chains consliluli-~ely or they may require activation signals for the release of their a chains. Preferably, the antigen-specific T cells may be used as the source of genetic material required to produce the TCRa chain by recombinant DNA and/or r~l~tnir~l synthetic techniques. Using this zpp,uacll, certain antigen-specific T cells 10 which may not secrete naturally-occurring TCRa chains can serve as a source of genetic material for the TCRa chain to be used in accor~lce with the invention.

5.1.3. ISOT ~TION OF THE TCR Al PH~ CHAIN CODING SEQUENCE
MF ~ gel RNA (mRNA) for the p~ Ja.dtion of cDNA may be obtained from cell sources that produce the desired a chain, whereas genomic se~lu._l-ces for TCRa may be obtained from any 15 cell source. Any of the T cells g~n~ Led as described in Section 5.1.2. cupra~ may be utilized either as the source of the coding sequences for the TCRa chain, and/or to prepare cDNA or genomic libraries. Additionally, parts of Iymphoid organs (e.~., spleens, Iymph nodes, thymus glands, and p~.;"hclal blood Iymphocytes) may be ground and used as the source for CA~ illg DNA or RNA. Alternatively, T cell lines can be used as a convenient source of DNA or RNA.
20 GenPtic~lly engineered mi~ ..nis",s or cell lines C~ -illg TCRa coding sequences may be used as a convenient source of DNA for this purpose.
Either cDNA or genomic libraries may be plep~,d from the DNA rr~ gen~,ldtt;d using techniques well known in the art. The r,~l".l-l~ which encode TCRa may be identified by screening such libraries with a nucl~oti-le probe homologous to a portion of the TCRa sequence.
25 In this regard, it should be noted that there is a single CC!n`~ region gene for TCRa (Ca) in human and mice. Since the nucleotide sequences encoding the Ca for both species are known, DNA probes homologous to the cons~ant region may be synthesi7çd by standard methods in the wo 95/16462 PCr/USs4/14s42 217~Q~8 art and used to isolate from such T cells described in Section 5.1.2. ~, the TCRa gene or mRNA Llalls~ Jt which can be used to synthesize TCRa cDNA or to identify ~p~u~fi_l~ TCRa sequences in cDNA libraries prepared from such T cells or genomic clones. Alternatively, oligon-~r,leotides specific for the variable region of the desired TCRa chain could be con~LI u~ d~
5 but these would have to be desi~d on a case by case basis, depending on the sequence of the variable region. Oligonucleotide probes de~i~ned based on the collsl~l region offer an advantage in this regard, since they can be used to "fish out" any TCRa chain gene or coding sequenre Although portions of the coding se~lue"ce may be utilized for cloning and expression, full length clones, i e, those co~ ;"g the entire coding region for TCRa, may be preferable for 1 0 expression. To these ends, techniques well known to those skilled in the art for the isolation of DNA, generation of alJ~nUpl ;ate restriction fragments, construction of clones and libraries, and screening recombinants may be used. Methods which are well-known to those skilled in the art can be used to this end. See, for example, the ter~miqlles described in Maniatis et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. In a specific 1 5 embodiment, by way of example in Section 6, infra, the complete nucleotide coding sequence for the TCRa chain gene was isolated from T cell hybridoma, A1.1, depicted in FIG. 2.

Alternatively, oligonucleotide probes derived from specific TCRa sequences could be used as primers in PCR (polymerase chain reactions) methodologies to generate cDNA or genomic copies of TCRa sequ.,nces which can be directly cloned. For a review of such PCR techniques, 20 see for example, Gelfand, D.H., 1989, "PCR Technology. Principles and Applications for DNA
Amplification," Ed., H.A. Erlich, Stockton Press, N.Y.; and "Current-Protocols in Molecular Biology," Vol. 2, Ch. 15, Eds. Ausubel et al., John Wiley & Sons, 1988.

Regardless of the method chosen to identify and clone the TCRa coding sequence, expression cloning methods may be utilized to sub~ ly reduce the scl~,~.,h~g effort. Recently, a one step 25 ploce.lu,~ for cloning and ~iAI,.es~i"g antibody genes has been reported (McCafferty et al., 1990, Nature 348:552-554; Winterand Milstein, l991, Nature 349:293-299). Based on this technology, TCRa chain genes may likewise be cloned directly into a vector at a site adj~cent to the coat protein gene of a bacteriophage such as A or fd. The phage carrying a TCRa gene t;A~,resses the wo 95/16462 ~ ! 7 9 0 1 8 PCT/USg4/14542 fusion protein on its surface so that columns c~nt~ining the antigen or a TCRa-specific antibody can be used to select and isolate phage particles with binding activity. Transient gene eA~ io systems may also be utilized to identify the correct TCRa gene. For example, the COS cell system (~,g" Gerard & Gluzman, 1986, Mol. Cell. Biol.6(12) 4570-4577) may be used; however, 5 the expression ofthe TCRa chain should be detected in extracts of COS cells which had been co-re~;led with the CD3 ~ chain gene (Bonifacino, et al., 1990, Cell 63: 503-513).

Due to the degent.~.~,y of the nucleotide coding sequences, other DNA sequences which encode analogous amino acid se-~uences for any known antigen-specific TCRa chain gene may be used in the practice of the present invention for the cloning and ~ sion of TCRa. Such alterations 10 include deletions, additions or sub~ .llionc of dirr~el~l nucleotide residues resulting in a seql~ence that encodes the same or a fi~nCtion~lly equivalent gene product. The gene product may contain deletions, ~ ition~ or sub~ l ions of amino acid residues within the sequence, which result in a silent change thus producing a bioactive product. Such amino acid sllbstitl-tions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity 1 5 and/or the an.r~ .d1~;c nature of the residues involved. For example, negatively charged amino acids include aspartic acid and glut niC acid; positively charged amino acids include Iysine and arginine; amino acids with unch~g~d polar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glllt~mine; serine, threonine; phenyl~l~nine7 tyrosine.

20 The TCRa chain sequence may be modified to obtain a gene product having improved p.~ .lies for use in vivo, such as i--.proved stability and half-life. For example, a hybrid gene can be constructed by ligating the TCRa chain gene, or its variable region, to the co~ region of a human immunoglobulin gene such as IgG. For a technique which can be applied, see Capon et al., 1989, Nature 337: 525-531.

25 ~ F.~P~F.~SION OF THE AT P~A CHAIN COD~G SEOUFNCF
In order to express a biologically active TCRa chain, the nucleotide sequenre coding for TCRa, or a functional equivalent as desc.ibed in Section 5.1.3 ~, is inserted into an a~.plop.iate WO9S/16462 2 1 7 q O 1 8 PC~ 2 t;,.~.~;,~ion vector, i e., a vector which cont~in~ the necesc~ry elements for the transcription and translation of the inserted coding se.~u~l,ce. Modified versions of the TCRa coding sequence could be er~g;.~ d to enhance stability, production, purification or yield of the expressed product. For example, the expression of a fusion protein or a cleavable fusion protein comprising 5 TCRa and a heterologous protein may be engine~red. Such a fusion protein may be readily isolated by affinity chromatography; e.g. by immobilization on a column specific for the heterologous protein. Where a cleavage site is engineered between the TCRa moiety and the heterologous protein, the TCRa chain can be released from the chromatographic column by treatment with an ~."P~ Jl ia~ enzyme or agent that disrupts the cleavage site (e.g., see Booth et al., 1988, Immunol. LeK. 19:65-70; and Gardella et al., 1990, J. Biol. Chem. 265:15854-15859).

Methods which are well known to those skilled in the art can be used to construct expression vectors co--l~ining the TCRa coding se.~u.,ncc and approp-ial~ transcriptionalltranslational control signals. These methods include in yitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. See, for example, the techniques 15 dese- ibed in Maniatis et al., 1989 Molecular Cloning A T ~' ~. alOl y Manual, Cold Spring Harbor Labc,. alOl y, N.Y.

A variety of host-expression vector systems may be utilized to express the TCRa coding sequence. These include but are not limited to mi~,luol~ ---s such as bacteria transformed with recombinant ba~t~liu~hâge DNA, plasmid DNA or cosmid DNA expression vectorC containing 20 a TCR coding sequence; yeast llallar~ lled with recombinant yeast expression vectors co~ g the TCRa coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or I~-sru",.cd with recombinant plasmid ~yressi~n vectors (e.g., Ti plasmid) containing a TCRa coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., 25 baculovirus) cont~inin~ a TCRa coding sequence; or animal cell systems infected with recombinant virus expression vectors (ç,g., retroviruses, adenovirus, vaccinia virus) containing a TCR coding s~.~ e or 1~- .,sr "--.cd animal cell systems engineered for stable expression.
As demohsllated by the working examples described in Section 7, infra, glycosylation of the WO 95/16462 ~ 1 7 9 0 1 8 PCT/USg4/14542 expressed product does not appear to be rc4ui.ed for TCRa immunoregulatory activity.
Th~lcfo-c, bacterial expression systems may be advantageously utilized for high yield TCR
production. However, glycosylation may be i---~ l for in vivo applications, even though it is not rc~ui~ed for immunoregulatory activity; e.g., the glycosylated product may demonstrate 5 an i..~ ased half-life in vivo. In such cases, cA~ ion systems that provide for tr~n~l~tion~l and post-translational mo~lific~tionc may be used; e.g., m~mm~ n, insect, yeast or plant expression systems.

Depending on the hostlvector system utilized, any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, Ll~sc.i~tion enh~ncer 1 0 elem~ntc, I-ans~ tion t~ min~t rs, etc. may be used in the cAl~-t~ion vector (see eg., Bitter et al., 1987, Methods in Enzymology 153:516-544). For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage A, plac, ptrp, ptac (ptrp-lac hybrid promoter) and the like may be used. When cloning in m~mm~ n cell systems, promoters derived from the genome of m~mm~ n cells (e.g., metallothionein promoter) or from 1 5 m~mm~ n viruses (ç,g~, the retrovirus long terminal repeat; the adenovirus late promoter; the vaccinia virus 7.5K promoter) may be used. Promoters produced by recombinant DNA or synthetic techniqu~c may also be used to provide for l-~nsc- i~Jtion of the inserted TCRa coding sequence.

In bacterial systems a number of cA~ ion vectors may be advantageously selected depending 20 upon the use int~nd~d for the TCRa c"~ ed. For example, when large qu~ntiti~s of TCRa are to be produced, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Those which are en~ d to contain a cleavage site to aid in recovering TCRa are p~c~cd. Such vectors include but are not limited to the E~ coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2: 1791), in which the TCRa coding 25 sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid TCRa-lac Z protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic acids Res.
13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 264:5503-5509); and the like.

WO 95/16462 ~ ~ T ~ 1~ t~ 8 PCT/US94/14542 In yeast, a number of vectors cont~ining conctitlltive or inducible promoters may be used. For a review see, CulTent Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Illtt-~cicnce, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, in Methods in Enzymology, Eds. Wu & Grossman,31987, Acad. Press, N.Y., Vol. 153, pp.516-544; Glover, 1986, DNA Cloning, Vol. II, IRL Press, Wash., D.C., Ch. 3; and Bitter, 1987, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger &
Kimmel, Acad. Press, N.Y., Vol. 152, pp. 673-684; and The Molecular Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al., Cold Spring Harbor Press, Vols. I and II. A
c~ e yeast promoter such as ADH or LEU2 or an inducible promoter such as GAL may1 0 be used (Cloning in Yeast, Ch.3, R. Rothstein In: DNA Cloning Vol.l l, A Practical Approach, Ed. DM Glover, 1986, IRL Press, Wash., D.C.). Alternatively, vectors may be used which promote integration of foreign DNA sequences into the yeast chromosome.

In cases where plant ~ ion vectors are used, the ~;;A~ ;)n of a TCRa coding sequence may be driven by any of a number of promoters. For example, viral promoters such as the 35S RNA
1 5 and l 9S RNA promoters of CaMV (Brisson et al., 1984, Nature 310:511 -514), or the coat protein promoter to TMV (TA~AmAtCI1 et al., l 987, EMBO J.6:307-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J. 3:1671-1680;
Broglie et al., 1984, Science 224:838-843); or heat shock promoters, e.~., soybean hspl7.5-E or hspl 7.3-B (Gurley et al., 1986, Mol. Cell. Biol. 6:559-565) may be used. These constructs can be introduced into plant cells using Ti plasmids, Ri p!~cmi-lc, plant virus vectors, direct DNA
transformation, micloillje~;lion, ele~illul)ulalion~ etc. For reviews of such techniques see, for example, Weissbach & Wel~bâcll, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp. 421-463; and Grierson & Corey, 1988, Plant Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9.
An alternative ~A~,le~ion system which could be used to express TCRa is an insect system. In one such system, Auto~hA californica nuclear polylled~ is virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frn&iperda cells. The TCRa coding sequence may be cloned into non e sce .~ ;AI regions (for e~llple the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).

WO 95/16462 ~ ! 7 9 0 t ~ PCT/US94/14542 Successful insertion of the TCRa coding sequence will result in inactivation of the polyhedrin gene and production of non-occl~ ed recombinant virus (L-, virus lacking the prulc;.~ceouc coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera fr~u7erda cells in which the inserted gene is cA~ ssed. (~., see Smith et al., 1983, J. Viol.
46:584; Smith, U.S. PatentNo. 4,215,051).

Eukaryotic systems, and preferably m~mm~ n expression systems, allow for proper post-tr~nCl ~ion~l modifications of tA~ sed m~mm~ n proteins to occur. Eukaryotic cells which possess the cellular m~ in~ry for proper processing of the primary l~sc.ip~, glycosylation, phosphorylation, and, adva ll~eously secretion of the gene product should be used as host cells 1 0 for the expression of TCR. M~rnm~ n cell lines are preferred. Such host cell lines may include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, -293, and WI38.

It may be that production of TCRa in a T cell host enh~ncec its activity, for example, due to - plefcl~.llial prûce~ lg and/or ~oc~ ;on with other T cell molecules. Where such expression is desired, T cell hosts inc!~ ing but not limited to T cell tumor cell lines, T cell hybridomas, T
1 5 cells which produce acce~soly col-,ponc.-l, or T cells which produce immunoregulatory factors may be utilized.

M~rnm~ n cell systems which utilize recombinant viruses or viral el~,.ll~,.l~ to direct expression may be engineered. For cA~ullple, when using adenovirus expression vectors, the TCRa coding se~u.,ncc may be ligated to an adenovirus llal ~cl;l~tion/translation control CUlllPICA~ e.~., the late promoter and Lli~ ilc leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in Yitro or in vivo recombination. Insertion in a non eQse~ l region of the viral genome (e.~., region El or E3) will result in a recombinant virus that is viable and capable of cA~ ing the TCRa chain in infected hosts (ç~" see Logan & Shenk, 1984, Proc.
Natl. Acad. Sci. USA 81: 3655-3659). Alternatively, the vaccinia virus 7.5K promoter may be used. (ç,~, see, Mackett et al., 1982, Proc. Natl. Acad. Sci. USA 79: 7415-7419; Mackett et al., 1984, J. Virol. 49: 857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. USA 79: 4927-4931).
Of particular interest are vectors based on bovine papilloma virus which have the ability to Wo 95/16462 PCT/US94/14542 2 ~ 7 901 8 replicate as eAllachlulllosomal elements (Sarver, et al., 1981, Mol. Cell. Biol. 1: 486). Shortly after entry of this DNA into mouse cells, the plasmid replicates to about 100 to 200 copies per cell. Transcription of the inserted cDNA does not require integration of the plasmid into the host's chromosome, thereby yielding a high level of expression. These vectors can be used for stable expression by including a selectable marker in the plasmid,~such as the neo gene.
Alternatively, the retroviral genome can be modified for use as a vector capable of introducing and directing the expression of the TCRa chain gene in host cells (Cone & Mulligan, 1984, Proc.
Natl. Acad. Sci. USA 81:6349-6353). High level expression may also be achieved using inducible promoters, including, but not limited to, the metallothionine IIA promoter and heat 1 0 shock promoters.

For lûng-term, high-yield production of recombinant proteins, stable expression is p.efe"cd.
Rather than using expression vectors which contain viral origins of replication, host cells can be L.~lsr~,.llled with the TCRa cDNA controlled by ~IJlulJliale expression control elements (ç~"
promoter, enh~ncer, se~u~llces, llanscl;lJtion t~rnin~tors~ polyadenylation sites, etc.), and 1 5 selectable marker. The selectable marker in the recombinant plasmid confers resict~nce to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and ~xppnded into cell lines. For example, following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an cl.l;ched media, and then are switched to a selective media. A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11: 223), h~.~ - ,ll.;.~e-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48: 2026), and adenine phos~Jhol;l)o~yltransferase (Lowy, et al., 1980, Cell 22: 817) genes can be employed in tk-, hgprt~ or aprt~ cells re~l,e.;lively. Also, ;"-~t~olite ,~ -,ce can be used as the basis of selection for dhfr, which confers resict~nre to methotl~le (Wigler, et al., 1980, Natl. Acad. Sci. USA 77: 3S67; O'Hare, et al., 1981, Proc.
Natl. Acad. Sci. USA 78: 1527); gpt, which confers res;cl~ce to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072; neo, which confers ~ ce to the amino-glycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150: 1); and hygro, which confers resict~nce to hygromycin (Santerre, et al., 1984, Gene 30: 147) genes. Recently, additional WO 95/16462 2 1 7 9~ ~ 8 PCT/US94114542 selectable genes have been described, namely trpB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of hicti-lin~ (Hartman &
Mulligan, 1988, Proc. Natl. Acad. Sci. USA 85: 8047); and ODC (ornithine decall,vAylase) which confers reCict~nce to the ornithine deca.L.uAylase inhibitor, 2-(difluoromethyl)-DL-5 ornithine, DFMO (McConlogue L., 1987, In: Current Communications in Molecular Biology, Cold Spring Harbor Labv. alv~ y ed.).

5.1.5. PURIFICATION OF T~ TCR ALPHA CHAIN EXPRF.~SION PRODUCT
The expression of TCRa protein product by genetic~lly-engi"eeled cells can be acsecced immunologically, for example by Western blotc, immunoassays such as radioimmuno-10 prGci~ tion, enzyme-linked imml...o~ ys and the like. The ultimate test of the success of the ~A~I ei,~ivn system, however, involves the production of biologically active TCRa gene product.
Where the host cell secretes the gene product, the cell free media obtained from the cultured transfectant host cell may be assayed for TCRa or its immunoregulatory activity. Where the gene product is not secreted, cell Iysates may be assayed for such activity. In either case, a 15 number of assays can be used to assess TCRa activity, including but not limited to assays measuring the ability of the eAIJlGSSed TCRa to bind antigen, and assays to evaluate its immunologic function, such as the PFC assays described in Section 5.1.1. supra and exemplified in Section 6.1.5, infra.

Once a clone that produces high levels of biologically active TCRais identified, the clone may 20 be e~p~n~ed and used to produce large amounts of the protein which may be purified using techniques well-known in the art including, but not limited to immunoaffinity purification, chromatographic methods including high performance liquid chromatography and the like.
Where the protein is secreted by the cultured cells, TCRa may be readily r~co~,e.~,d from the culture medium.

25 M~ Ihods for purifying TCRa from crude culture media of T cells may be adapted for purification ofthe cloned, expressed product. For eAample~ TCRa from A1.1 cells, used in the examples, ~, can be purified from the crude culture media of T cells by ammonium sulfate p~ iOn wo 95/16462 2 1 7 9 0 1 8 PCT/US94/14542 followed by affinity chromatography (Zheng et al., 1988, J. Immunol. 140:1351-1358;
Bicconl.- lle et al., 1991, J. Immunol. 146:2898-2907). Purified monoclonal antibodies specific for a commonly shared determinant on all murine TCRa chains or an antigen or a fragment cont~ining a specific antigenic epitope thereof can be coupled to cyanogen bromide-activated 5 Se~,ha, -~se 4B (Pl ~ ) and used for affinity chromatography. The biological activity of the protein purified in this manner from crude culture media has been shown to be enriched 3,000-fold. Alternatively, antibodies made to pro.lu~ of dirrGl`Glll V gene families may also be used if it is known which specific Va gene segment encodes the a chain protein in question. In addition, antibodies may be raised to the variable region of a specific TCRa chain and used in 1 0 the purification of the a chain from a mixture of other irrelevant TCRa chains. In this case, a specific a chain may be isolated even from the crude media of bulk culture T cells if sufficient quantity of the protein is present.

Where the TCRa coding sequence is en~;.,r~l~ed to encode a cleavable fusion protein, the purification of TCRa may be readily accomplished using affinity purification techniques. For 1 5 example, a protease factor Xa cleavage ~Gco~lilion se.~u~ e can be ~nginçered between the carboxyl tellllillus of TCRa and a maltose binding protein. The resulting fusion protein can be readily purified using a column conjugated with amylose to which the maltose binding protein binds. The TCRa fusion protein is then eluted from the column with maltose co.,l ~ioi~g buffer followed by treatment with Factor Xa. The cleaved TCR~ chain is further purified by passage 20 through a second amylose column to remove the maltose binding protein (New England Biolabs, Beverly, MA). Using this aspect of the invention, any cleavage site or enzyme cleavage substrate may be engineered between the TCRa sequence and a second peptide or protein that has a binding partner which could be used for purification, e.g., any antigen for which an immunoaffinity column can be prepared.

wo 95/16462 2 ! 7 9 (~ t 8 PCT/US94/14542 A I TT~'.Rl~ATE TT~'.CT~IQUES TQ PRODUCE T~. TCR ~LP~A CHATl~l Once a specific TCR chain gene has been molecularly cloned and its DNA sequencedetermined, its protein product may be produced by a number of methods in ~d~ition to those des~;,il,ed supra. For example, solid phase chemical synthetic t~r~ ues can be used to produce 5 a TCRa chain in whole or in part based on an amino acid sequence deduced from the DNA
sequenre (see Creighton, 1983, Proteins SI~u~,lu,~,s and Molecular Pfi,lciples, W.H. Freeman and Co., N.Y. pp. 50-60). This approach is particularly useful in g.,.lclalillg small portions of proteins that co"espond to the active site of a molecule. In the case of a TCRa chain which binds antigen, it is highly likely that the variable region in the amino-terminal end of the protein 10 encoded by the V and J gene segments is illlpoll~lll to antigen-binding. Therefore, synthetic peptides col,~ ,onding to the variable region of the a chain may be produced. In addition, a larger peptide co..~ .g a specific portion of an a chain constant region may also be synth~ci7pd if, for example, that region is known to be hllp~ t for its interaction with acces~o,y factors in achieving a full immunoregulatory ,~,s~ onse.

15 Another method of producing TCRa chain based on its cloned DNA sequence is by llansc'i~tion and l~ .Cl~' ;Ol~ of its gene in an in vitro cell free system. In a particular embodiment by way of example in Section 7, infra the Al.l TCRa chain gene is in vitro transcribed and translated and its product is shown to be a protein of about 32,000 dalton molecular weight by SDS-PAGE.
This protein co"~il)onds to an unglycosylated TCRa polypeptide chain. Although such a cell 20 free in vitro system is not desi~ed for large scale protein production, the ad~ a,lt~ge of this approach is to provide a method for definitively demon~l,ali"g the contribution of a specific TCRa chain in a specific immunological reaction in the absence of the synthesis of other proteins.

Molecular mimicry of protein conf~""~ation by antibody combining sites provides another 25 method for producing a protein with binding specir.cily similar to that of a specific TCRa chain.
For example, anti-idiotypic antibodies or monoclonal antibodies directed to the same antigenic determinant as the specific TCRa chain may possess a binding site that is structurally identical to the TCRa chain variable domain. Such antibodies which demonstrate a TCRa chain WO95/16462 2 ~ a PCT/US94/14542 u~ule~ulatûry functiûn as evaluated in the PFC assays desc,;bed herein may be used in place ûf TCRa chain. The use ûf such antibûdies may be prcrc.,~d under certain circumct~ncec for example, where it can be shown that the antibody has a longer in vivo half life than a native a chain. In alternative therapeutic applications described infra. monoclon~l antibodies which bind 5 to and neutralize the TCRa chain may be desired. These antibodies may also be used in tii~gnostic assays in vitro, e.~., radiui...~ .o~cs~ys, ELISAs, to detect circulating TCRa chains in humans. Such monoclonal antibodies can be readily produced in large quantities using techniques well known in the art.

For the production of antibodies that mimic TCRa, various host ~nim~lc, including but not 1 0 limited to mice, rabbits, hamsters, rats, and non-human primates, may be immlmi7~d with the desired antigen or an anti-TCRa chain antibody in order to g~ ,.alc antibodies that mimic the TCRa chain, as measured by their ability to competitively inhibit the antigen-specific binding of the TCRa chain to its antigen, and their ability to regulate an immune response specific for the antigen as evaluated in the PFC assays described herein. For the production of antibodies that 1 5 bind to and neutralize TCRa chain, the host animal would be immunized with the TCRa chain itself. Various adjuvants may be used to increase the immunological les~ se"lcpen~;,.g on the host species, inrluAing but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as Iysolecithin, pluronic polyols, polyanions, peptides, oil em~ onc~ keyhole limpet hemocyanin, di~ ru~ enol~ and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Cor~"eba.;lc.iu", parvum.

Mon~clon~l ~ntibo~ies may be p~epa cd using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hyl" idu~a technique originally described by Kohler and Milstein, (Nature, 1975, 256:495-497), the human B-cell hybridoma terhnique (Kosbor et al., 1983, Immunology Today, 4:72;
Cote et al., 1983, Proc. Natl. Acad. Sci. 80:2026-2030) and the EBV-hyl"ido",a tc- lmi~ue (Cole et al., 1985, Monoclonal ~ntihodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).
Ter~lniques dcvelo~ for the production of "chimeric antibodies" by splicing the genes from a mouse antibody molecule of ..~,p,û~,,iale antigen specificity together with genes from a human WO 95/16462 2 ! 7 9 0 1 8 PCT/US94/14542 antibodymoleculecanbeused(ç~,Morrisonetal., 1984,Proc.Natl.Acad. Sci., 81:6851-6855;
Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985, Nature, 314:452-454). In addition, tecllniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies.

5 Antibody ~ "c"l~ which contain the specific desired binding sites may be generated by known techniques. For example, such Lagllll lll~ include but are not limited to: the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be gc"-"ut~d by reducing the ~ fide bridges ofthe F(ab')2 fr~Elnentc- Alternatively, techniques described for the coll~ll uclion of Fab expression libraries (Huse et al., 1989, Science, 1 0 246: 1275- 1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity can be used.

5.2 USE OF THE TCR ~T PHA CHAIN AS AN IMMUNOMODUT ~TORY
AGFl~T
The antigen-specific i~ u~o~c~ulatory activity of a TCRa chain provides for a wide variety of 1 5 uses in vivo in human or animal subjects and in yitro. Any TCRa chain, or fragments and derivatives thereof, which are capable of binding to the antigen and which exhibit immunoregulatory activities as assayed in vitro may be used in the practice of the method of the invention. Where the factors of the acces~u~ y colllpon,~ are present in a subject's serum, the TCRa chain may be ~m;~ ed as the sole active agent. However, the TCRa chain could be 20 a~lrnini~t~red in conjunction with biologically active factors found in the accesso,y component, growth factors, or inhibitors. The TCRa chains which are capable of binding to the antigen and which ~u~""cjs the immune ,c~nse that would nommally be generated against the antigen may be especially useful in the down-regulation of antigen-specific immune responses such as hy~ el,sili~ity reaotil n~, transplantation rejecti--n~ and auk,i"""une disorders. Altematively, 25 the removal or neutralization of such TCRa chains, or the factors which associate with such TCRa chains, may be useful as a means of augment~finE an immune response against diseases such as cancer and immunodeficiency. In an altemative embodiment of the invention, TCRa wo 95/16462 2 1 7 9 0 1 8 pcTtuss4ll4s42 chains specific for the antigen which augment the immune I ~-lse could be utilized to augment such antigen-specific responses in vivo.

5.2.1 ANTIGFN-SPECIFIC IMMUNOSUPP~F..~SION
The antigen-binding TCRa chains that demonstrate antigen-specific immuno~u~p,~ ion may 5 be used in the lleallll."ll of con~itic~nc in which immune reactions are deleterious and ~u~pression of such ,~,onses in an antigen-specific manner is desirable. These disorders which may be treated in acco,.la"ce with the invention include but are not limited to hypersensitivity (types 1-IV), autoimmune disease as well as graft rejection ,e~ ollses after organ and tissue transplantations .
10 Hypersensitivity reactions are commonly classified into four groups. Type I reactions are immediate-type hyy~,aenailivily which result from mast cell degranulation triggered by antigen-specific IgE. Examples of type I diseases include most common allergies caused by substances such as plant pollens, mold spores, insect parts, ani nal danders, bee and snake venom, industrial dusts, house dusts, food products, chemicals and drugs. Type II reactions are caused by the 15 action of specific antibodies, usually IgG and IgM, on target cells leading to cellular destruction.
Examples of type II diseases include lr~,srusion reactions, erythroblastosis fehlis, autoimmune hemolytic anemia, myasthenia gravis and Grave's disease. Type III reactions are caused by antigen-antibody complex formations and the subsequent activation of antibody effector mech~nicmc Examples of type III diseases include immune complex glomerulonephritis, 20 Goodpasture's syndrome and cerhin forms of arthritis. Type IV reactions are cell-mediated reactions involving T cells, mac,upl~agcs, fibroblasts and other cell types. These are also referred to as delayed-type h~c.~ensili~ity. Allergic conhct dermatitis is a typical example of this category.

Autoimmune disorders refer to a group of diseases that are caused by reactions of the immune 25 system to self ~ntigenc leading to tissue destruction. These l~ ,onses may be mediated by antibodies, auto-reactive T cells or both. Many ofthese con-~iti. nC overlap with those described under hy~.a~nailivity above. Some i",pu,l~,.l aul.i"""u"e diseases include diabetes, WO 95/16462 Z I 7 9 ~ ~ 8 PCT/USs4/14542 aul~ ullune thyroiditis, multiple sclerosis, rheu n~toid arthritis, systemic lupus ery~h~m~to~ic and myasthenia gravis.

Basic undersPn~ling of the MHC has led to technical advances in tissue typing which, in turn, have sub~ lly i,,,pro~cd the rate of success in organ and tissue transplantation. Some of the commonly ~,Çu-",ed L~ ,1;on surgery today includes organs and tissues such as kidneys, hearts, livers, skin, pal,clc dtic islets and bone marrow. However, in situations where the donors and recipients are not geneti~lly identical, graft rejections can still occur.

For all of the above-identified conditions, including but not limited to the specific diseases mentioned, a down-regulation of adverse immune reactions is beneficial to the host. In this 1 0 regard, an antigen-specific TCRa may be used to specifically ~u~ es~ an immune ,e;,~onse mediated by T cells, antibodies or both while retaining all other normal immune functions. For example, experimental allergic encephalomyelitis (EAE) is an animal model for multiple sclerosis in man which can be induced in mice by the ~rlmini~tration of purified myelin basic protein. TH have been shown to play a critical role in the pathogenesis of the disease (Wraith et 1 5 al., 1989, Cell 57:709-715). The number of antigenic determinants recognized by auto-reactive T cells in a given mouse strain are limited. Furthermore, the Va and V~ gene segments used for the con~l~u-;lion of ~ului"""une TCR is equally restricted so that the majority of the T cell , c~onse to the small number of ~nceph~litog~nic c~,ilopes has an ;dPnti~ ~l TCR. Antibodies to TCR determinants have been ~uccci,~rully used to deplete antigen-specific T cells in vivo leading to protection from disease. (Owhashi and Heber-Katz, 1988, J. Exp. Med. 168:21S3-2164). For the practice of the present i~ .ltiOll, a TCRa chain gene may be isolated from such auto-reactive T cells, eAI,lessed in an apl,rop,iale host cell and tested for its ability to ~u~p~css the antigen-specific immune ,c~l)onses in vitro and in vivo. The use of TCRa chains for this purpose is particularly in~po,l~,t in light of the recent findings that in certain human diseases such as multiple sclerosis and m~ enia gravis, autoimmune T cells have been detected and they appear to similarly have a restricted usage of certain Va and V~ alleles (Ok~cnb~ et al., 1989, Proc.
Natl. Acad. Sci. USA 86:988-992).

wO 95/16462 2 1 7 9 Q l 8 PCT/USg4/14~42 In accordance with the invention, the r,.~gOil~g conditions may be treated by ~lmini~tçring to the patient an effective dose of TCRa chain specific for the relevant antigen which ~upl~lesses the immune ~ ,onse gc~ ed against that antigen. The TCRa chains selected for use may be evaluated by an immlln~regulatory assay in vitro, such as the PFC assays described herein. The TCRa chain may be a~lmini~tered in a variety of ways, including but not limited to injection, infusion, pale,.t~ lly, and orally. TCRa and its related derivatives, analogs e.g., peptides derived from the variable region, may be used as the sole active agent, or with other compounds.
Such compositions may be ~minictçred with a physiologically acceptable carrier, including phosph~te buffered saline, saline and sterilized water. Alternatively, liposomes may be used to 10 deliver the TCRa. In this regard, the liposome may be conjugated to antibodies that recognize and bind to cell specific antigçnC, thereby providing a means for "l~ lh-g" the TCRa composltions.

An effective dose is the amount required to su~ .;.s the immune response which would have been generated against the relevant antigen in vivo. The amount of TCRa employed will vary 15 with the manner of ~mini~tration, the use of other active collll)oullds, and the like. Generally a dose which will result in circulating serum levels of 0.1 ',Ig to 100 ~,lg/ml may be utilized. The most effective conc~.~LIalion for ~uppl~ssillg antigen-specific les~,ol1ses may be determined in vitro by adding various col-c~ lions of TCRa to an in vitro assay such as the PFC assays described in Section 6.1.5., infra. and monitoring the level of inhibition achieved.

52.2. ANTIGF.N-SPEC~IC IMMUNOSTIMUI.~TION
Certain diseases are the result of de~ ll or defective immune lc~llses. An impaired immune onse may be due to the absence or aberrant function of certain co---~ Il..ents of the immune system, or the presence of factors that specifically down-regulate these l~ ,onses. In the latter scenario, for example, a patient's overproduction of an antigen-specific TCRa which ~ul",. esses 25 the immune response directed toward a particular antigen may be involved. In such cases, the systemic removal or neutralization of TCRa may be able to rescue the les~ondillg cells from such ~upp-~sion and thereby enhance their efficacy against the antigens they recognize. The PFC assay described herein can be utilized to assay the patient's body fluids, such as serum for WO 95/16462 2 1 7 9 0 ~ ~ PCT/USg4/14542 the pl~s~ince of circulating or soluble TCRa chains that exert an antigen-specific immuno~u~ ssive effect. Such patients may then be treated using antibodies for the TCRa chain to remove or neutralize the circulating ~u~ ,;.sive molecules.

T cell-mediated su~")ression can explain the continual growth of a tumor in the face of a 5 demonstrable tumor-specific immune response. In a variety of experimental tumor systems, the elimination of antigen-specific Ts and TsF have been reported to uncover the underlying anti-tumor r~ ,~nces (North, 1982, J. Exp. Med. 55: 106- 107; Hellstrom et al., 1978, J. Exp. Med. 49-799-804; Nepom et al., 1977, Biochim Biophy. Acta; 121-148). Antigen-specific ~upp~essor factors may be released directly by tumor cells or by Ts which are activated upon recognizing 1 0 certain ~uyylc~'~Ogr~iC epitopes of tumor antigens (Sercarz and Krzych, 1991, Immunol. Today 12: 111-118). A monoclonal antibody originally raised to a TsF may also react with a tumor-specific T ~u~ ,;.sor factor produced by a T cell hybridoma (Steele et al., 1985, J. Immunol.
134: 2767-2778). Several of the TsF that bind to this antibody bind to anti-TCRa antibodies.
TCRa chains, lI.~,ero.e, with a~)lJlu~liale specificity for tumor antigens may participate in the 1 5 d&--~,-i--g of tumor i.. u.-ity, in which case, the removal or neutralization of such TCRa will likely be advantageous to the restoration and augmentation of tumor-specific responses.

The activity of such native TCRa chains in a patient may be inhibited by the a~lmini~tration in yivo of ~ntibo-~ies specific for the a chain (see Section 5.1.4, supra) which neutralize its activity, i e., either its ability to bind antigen and/or its resulting antigen-specific immuno~uppressive 20 effect. While antibodies to the coll~ t or variable region of TCRa may be used, those which bind the variable region may be p-ef~ d since only the TCRa chains specific for that particular antigen will be neutralized so that the immune response is augmented in an antigen-specific fashion. Alternatively, sera of cancer patients with detectable levels of soluble tumor antigen-specific TCRa chain may be ~ ed by Q vivo passage through columns cû~ ;nil~g an 25 antibody to a chain or the antigen or a peptide thereof; i e., pl~m~phoresis.
For in yivo use, an antibody may be ~1m;-;~ d in a variety of ways, including but not limited to injection, infusion, pale~lt~,rdlly and orally. The antibody may be ~rlmini~tered in any 21 7~1 8 physiologically accept~hle carrier, including phosphate buffered saline, saline and sterilized water. The amount employed of the subject antibody will vary with the manner of arlminictration, the employment of other active compounds, and the like, generally being in a salulalillg dose which will result in the binding of most if not all of the free systemic TCR
5 chains. For Q vivo adsorption, the amount of antibody or antigen coupled to the column will be that which is sufficent for removing most if not all free TCRa chain in patients' sera.

~nticPnce oligQnllcl~Potides may be used to interfere with the expression and systemic release of a specific imml~.ns--~ e TCRa chain, and thereby selectively enhance an antigen-specific immune response. In this regard, complementary oligonucleotides which exhibit catalytic 10 activity, i.e., a ribozyme apploach may be used. See generally, e.g., PCT International Publication WO90/11364; Sarver et al., 1990, Science 247: 1222-1225. The use of Va ~nticPnce or ribozyme oligonucleotides for each TCRa chain is preferred over the use of the complete TCRa since this will only inhibit a specific TCRa of interest. For this purpose, nuclease resistant anticence Va oligodeoxynucleotides complementary to the mRNA of any known TCRa chain 1 5 sequence may be synthP~i7Pd Following their uptake into the antigen-specific T cells, these agents can hybridize to their complement~ry mRNA sequences through base pairing, block translation and disrupt the production of the encoded protein products (for review of such techniques, see Green et al., 1986, Ann. Rev. Biochem. 55:569-597).

In an alternate emhodimPnt of the invention, TCRa chains specific for the antigen of interest and 20 which ~ 1 the antigen specific immune response may be identified as described in Section 5.1.1., ~L- ThC~-~p~u~;c~lly effective doses of such TCRa chains may be a~lminictPred to a patient to augment the patient's immune ,c~l,onse against that particular antigen.

In another embodiment, the invention provides a subst~nti~lly pure fusion polypeptide R,-[X,]-R2, wherein R, is a carrier peptide, R2 is a polypeptide encoded by a structural gene, and X, is a 25 proteolytic enzyme ~cco~ilion sequPnre The "carrier peptide", is located at the amino terminal end of the fusion peptide se.~u~ ce. In the case of prokaryotes, the carrier peptide of the fusion polypeptide of the invention may function to l~ ~l l the fusion peptide to inclusion bodies, the periplasm, the outer membrane or, preferably, the external environment. In the case of eukaryotes, the carrier peptide is believed to function to transport the fusion polypeptide across the endoplasmic retiCulllm The seclcl(,y protein is then ~ ed through the Golgi appalalus, into secr~lu~y vesicles and into the extracellular space or, preferably, the external 5 environment. Carrier peptides of the invention include, but are not limited to, the calmodulin polypeptide. Calegol;cs of carrier peptide which can be utilized according to the invention include pre-pro peptides and outer membrane peptides which may include a proteolytic enzyme recognition site. Acceptable carrier peptides also include the amino terminal pro-region of hormones. Other carrier peptides with similar properties described herein are known to those 10 skilled in the art, or can be readily ascertained without undue experiment~tion In one embodiment of the invention, a carrier peptide is included in an expression vector, which is specifically located adjacent to the N-terminal end ofthe carrier protein. While the vector used in the example of the present invention uses the calmodulin nucleotide sequence, other sequ~nres which provide the means for transport of the fusion protein to the endoplasmic reticulum (for 15 eukaryotes) and into the external environment or into inclusion bodies (for prokaryotes), will be equally effective in the invention. Such sequPnces as described above are known to those of skill in the art.

The carboxy-terminal end of the carrier peptide of the invention cont~inc a proteolytic enzyme recognition site so that polypeptide encoded by the structural gene can be easily separated from 20 the fusion polypeptide. Di~.cnce-s in the cleavage ~cog,.ilion site are possible in that dirr~.~.
enzymes exist for the proteolytic ~ ,irl~ y. Preferably, the cleavage site is the sequence, Lys-Val-Pro-Arg-Gly (SEQ ID NO: l), which is recognized by thrombin. This recognition site allows for an ~ .e~ledly high level of active protein encoded by the ~Llu~;lu~l gene to be produced. Other cleavage sites, such as that recognized by Factor Xa protease, will be known 25 to those of skill in the art.

The fusion polypeptide of the invention includes a polypeptide encoded by a structural gene, preferably at the carboxy terminus of the fusion polypetide. Any ~ll uClul al gene is ~;Ayressed in 2l 7901 8 ~o-conjunction with the carrier peptide and cleavage site. The structural gene is operably linked with the carrier and cleavage site in an expression vector so that the fusion polypeptide is ~A~l~,;,sed as a single unit. An exarnple of a ~1 u~;lulal gene that can be used to produce a fusion polypeptide of the invention encodes the truncated form of TCRa, which includes only the 5 extracellular membrane domain of TCRa.

The invention provides a sllbstsrltislly pure polypeptide. The term "s~lbsP-ntislly pure" as used herein refers to a polypeptide which is ~.~b~ ;slly free of other proteins, lipids, carbohydrates or other materials with which it may be naturally a~isocialed~ One skilled in the art can purify the polypeptide using standard terhniques for protein purification, such as affinity chromatography 10 using a monoclonal antibody which binds an epitope of the polypeptide. The ~ul~ t jslly pure polypeptide will yield a single major band on a polyacrylamide gel. The purity of the polypeptide can also be determined by amino-terminal amino acid sequence analysis. The polypeptide includes functional fragments of the polypeptide, as long as the activity of the polypeptide remains. Smaller peptides contsining the biological activity of polypeptide are 15 included in the invention.

The invention also provides polynucleotides encoding the fusion polypeptide. These polynucleotides include DNA, cDNA, and RNA sequences. It is understood that all polynucleotides encoding all or a portion of the fusion polypeptide are also included herein, as long as they encode a polypeptide of which the cleavage product has biological activity. Such 20 polynucleotides include naturally occulling, synthetic, and intentionally manipulated poly-nucleotides. For exa nple, the polynucleotide may be subjected to site-directed mutsgenesic The polynucleotide sey~le ce also includes h-~ e~-ce se.l~le~ ~s and sequences that are degenerate as a result of genetic code. There a re 20 natural arnino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the 25 invention as long as the amino acid se4u~ ~ce of the fusion polypeptide encoded by the nucleotide sequence is functionally llnrhsnged WO 95/16462 2 1 7 9 () 1 B PCT/US94/14542 DNA sequences of the invention can be obtained by several methods as described above. For example, the DNA can be isolated using hybridization procedures which are well known in the art. These include, but are not limited to: 1) hybridization of probes to genomic or cDNA
libraries to detect shared nucleotide sequences; 2) antibody screening of expression libraries to 5 detect shared structural features; and 3) synthesis by the polymerase chain reaction (PCR).

The synthesis of DNA sequences is frequently the method of choice when the entire sequence of amino acid residues of the desired polypeptide product is known. When the entire sequence of amino acid residues of the desired polypeptide is not known, the direct synthesis of DNA
sequences is not possible and the method of choice is the synthesis of cDNA sequences. Among 10 the standard p.~cc(lulcs for isolating cDNA sequences of interest is the formation of plasmid-or phage-carrying cDNA libraries which are derived from reverse transcription of mRNA which is abundant in donor cells that have a high level of genetic ~pression. When used in combination with polymerase chain reaction technology, even rare expression products can be cloned. In those cases where significant portions of the amino acid sequence of the polypeptide 15 are known, the production of labeled single or double-stranded DNA or RNA probe sequences duplicating a sequence putatively present in the target cDNA may be employed in DNA/DNA
hybridization p..)ceJures which are carried out on cloned copies of the cDNA which have been denatured into a single-stranded form (Jay et al., Nucl. Acid Res. 11:2325, 1983).

DNA sequences encocling the fusion polypeptide ofthe invention can be t;~.cssed in vitro by 20 DNA transfer into a suitable host cell. "Host cells" are cells in which a vector can be ,.,lop~..t~d and its DNA ~I...,ssed. The term also includes any progeny of the subject host cell. It is undel~ood that all progeny may not be id~ntic~l to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell" is used. Preferred host cells of the invention include E. coli, 5. allreus and P. aeruginosa, although 25 other Gram-negative and Gram-positive c,~gani~llls known in the art can be utilized as long as the expression vectors contain an origin of replication to permit expression in the host. Methods of stable transfer, in other words when the foreign DNA is continllously m~int~ined in the host, are known in the art.

WO95/16462 2 1 7 q O 1 8 PCT/US94/14542 ~2-In the present invention, the polynucleotide sequences may be inserted into a recombinant expression vector. The term "recombinant ~ cssion vector" refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or hlcol~.ul~lion of the genetic sequences for TCR~, for example, and a carrier peptide and cleavage site. Such expression 5 vectors contain a promoter sequence which facilitates the efficient l~ans~ tion of the inserted genetic sequence of the host. The expression vector typically cont~inc an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the transformed cells.
Vectors suitable for use in the present invention include, but are not limited to the T7-based expression vector for expression in bacteria (Rosenberg et al., Gene 56:125, 1987), the pMS~ND
10 expression vector for expression in m~mm~ n cells (Lee and Nathans, ~ Biol. Chem. ~ :352 1 , 1988) and baculovirus-derived vectors for expression in insect cells. The DNA segment can be present in the vector operably linked to regulatory elements, for example, a promoter (e.g., T7, metallothionein I, or polyhedrin promoters).

For example, the expression of the fusion peptide of the invention can be placed under control 15 of E. coli chromosomal DNA COlll~liSil-g a lactose or lac operon which mediates lactose ~lSili7~tiQn by elaborating the enzyme beta-e~l~cto~ ce The lac control system can be induced by IPTG. A plasmid can be constructed to contain the lac Iq leplessol gene, permitting repression of the lac promoter until IPTG is added. Other promoter systems known in the art include beta l~rt~m~cP, lambda promoters, the protein A promoter, and the tr~tophan promoter 20 systems. While these are the most commonly used, other microbial promoters can be utilized as well. The vector contains a replicon site and control se~uellces which are derived from species compatible with the host cell. In addition, the vector may carry specific gene(s) which are capable of providing phenotypic selection in l~ r~Jlllled cells. For example, the beta-l~rt~m~ce gene confers ampicillin l ~ ce to those 1~ Ç~.l lllcd cells c,~ ; e the vector with the beta-25 l~ct~m~e gene.

Polynucleotide sequences Pnr~jn~ the fusion polypeptide of the invention can be t;Apressed ineither prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and m~mm~ n org~ni~mc Methods of ~A~le~sing DNA sequences having eukaryotic or viral sequences in WO 95/16462 2 ! 7 9 0 1 8 PCTtUSg4/14542 prokaryotes are well known in the art. Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art. Such vectors are used to incul~,u-dte DNA sequences of the invention. The host cell of the invention may naturally encode an en_yme which I~Co~.i~Ps the cleavage site of the fusion protein. However, if the host 5 cell in which expression of the fusion polypeptide is desired does not inherently possess an enzyme which recogr i7Ps the cleavage site, the genetic sequence encoding such enzyme can be cotransfected to the host cell along with the polynucleotide sequence for the fusion protein.

Transforrnation of a host cell with recombinant DNA may be carried out by conventional te~hniqu~Ps as are well known to those skilled in the art. Where the host is prokaryotic, such as 10 E. coli, co~ )cl~ cells which are capable of DNA uptake can be prepared from cells harvested after ~nelllial growth phase and ~ubse4u~lllly treated by the CaC12 method by procedures well known in the art. Alternatively, MgC12 or RbCI can be used. Transformation can also be performed after forming a protoplast of the host cell or by ele-;l,opolalion.

When the host is a eukaryote, such methods of l~a.l~r~ilion of DNA as calcium phosphate co-15 plccipil~les, conventional meçh~iC~I proce.lul~s such as microinjection, cle~,llupolalion, insertion of a plasmid encased in li~oso..lcs, or virus vectors may be used. Eukaryotic cells can also be cotransfected with DNA seqUPnrPs encoding the fusion polypeptide of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the herpes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 20 40 (SV40) or bovine papilloma virus, to llal~ .llly infect or l-a l~r~llll eukaryotic cells and express the protein. (Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).

Techniques for the isolation and purification of either microbially or eukaryotically expressed polypeptides of the invention may be by any conventional means such as, for example, 25 ~ Ja.ali~e chromatographic SCIJa~dtiOnS and immunological separations such as those involving the use of monoclonal or polyclonal antibodies.

WO 95/16462 ~ t 7 ~ ~ ~ 8 PCT/US94/14~42 The above disclosure generally describes the present invention. A more colllplctc underst~n~iing can be obtained by lc~clence to the following specific examples which are provided herein for purposes of illustration only, and are not int~nded to limit the scope of the invention.

6. EXAMPLES: II~IUNOREGULATORY ACTIVITY OF THE TCR ALPHA
C~T~IN DEMONSTRATED BY RETROVIRAL GENE TRANSFER
6.1. MATF.~IALS AND METHODS

6.1.1. ~NIMALS

C57Bl/10 and C57Bl/6 animals were purchased from Jackson Laboratories (Bar Harbor, ME).

6.1.2 CT~'.T T. T.Tl~
1 0 Al.l (Fotedar et al., 1985, J. Immunol. 135:3028-3033), B9 (Fotedar et al., 1985, J. Immunol.
135:3028-3033),BW1100(Whiteetal.,1989,J.Immunol.143:1822-1825),175.2(Gl~irlllonh~--c et al., 1991, J. Immunol. 146: 2095), and derivatives of these lines c~l,lc~si"g Al . l TCR genes (See Section 6.1.4, infra) were m~int~ined in RPMI 1640 plus 10% FCS. Many of the cell lines were also adapted to a protein free, serum free medium (Cell Biotechnologies, Rockville, MD).

6.13. ANTIBODIES Al~D ANTIGENS
Monoclonal antibodies with specificity for CD3~ (145-2C 11, hamster IgG) (Leo et al., 1987, Proc. Natl. Acad. Sci. USA 84:1374-1378), and TCR Ca (H28-710.16, hamster IgG) (Becker et al., 1989, Cell 58:911-921) were purified by protein A affinity chromatography (Protein A
Superose, Pharmacia). Fluorescent staining and FACS analysis of surface CD3 (Zheng et al., 1989, Proc. Natl. Acad. Sci. USA 86:3758-3762) and antibody-affinity chromatography with H28-710 (Bissoll~lle et al., 1991, J. Immunol. 146:28-98-2907) were performed as previously dcsc, ibed. SRBC were ~ ,hased from Morse Biologicals (Edmonton, AB) or from Colorado Serum Co. (Denver, CO). The nonrandom synthetic polypeptide, poly-18, and peptides based Wo 95/16462 2 1 7 9 0 1 ~ PCT/US94/14542 on its structure (listed in FIG. 4) were gcn.,.aled as previously described (Fotedar et al., 1985, J. Immunol. 135:3028-3033).

6.1.4. RETROVIRAL TRANSFER OF TCR GENES INTO T CFT T, HYIRRIDOM~S

Total cellular RNA was isolated from 109 cells by the conventional gll~n~ rn-isothiocyanate and cesium chloride method. Poly A+ RNA was recovered by oligo-dT cellulose affinity chromatography. The first strand synthesis was ge~ .al~d using an oligo-dT primer and reverse Llai~s~ lase and the second strand using DNA polymerase I and RNase H. The methylated blunt ended double-stranded (ds) cDNA was ligated to EcoRI linkers. Subsequent to EcoRI digestion the dscDNA was size selected on agarose gels, purified by spermine preci~i~lion, and cloned into AgtlO. The lDNA was in vitro pac~g~d (Gigapack Gold, Str~t~gene, La Jolla, CA).
App~ i,llately 200,000 plaques were screened by in ~i~ hybridization using -32p radiolabelled Ca and C~ probes. The C~ probes and Ca probes were used to screen a cDNA library (made from a beef insulin specific T cell hybridoma). Insert DNA from the positive clones was ligated into M13mpl8 and M13mpl9 for standard dideoxy sequencing.

All of the retroviral vectors used in the examples described herein are derivatives of the N2 vector (Keller et al., 1985, Nature ;~1~:149-154)- The Al.l TCR a and ~ cDNAs were completely sequenced. In brief, the Al.l a cDNA uses the Val2 (Arden et al., 1985, Nature ;~:783-787) and JaTA65 and the A l . l p cDNA uses V ~6 (Barth et al., 1985, Nature ~: 517-523), D~2 (Sui et al., 1984, Nature 311:344-349), and J~2., (Gascoigne et al., 1984, Nature 310:3 87-391 ) gene se~m~ntc. Expression of the alpha cDNA was driven off the retroviral LTR, and the expression of the ~ chain was under the control of the TCR V~2 promotor and the TCR
~ el~h~nce~. Both inserts were cloned into the XhoI site of the N2 vector. These C~ u~ i were transfected into the p~rl~ging cell lines ~2 (Mann et al., 1983, Cell 33 :153-159) and the PA3 17 (Miller and Buttimore, 1986, Mol. Cell. Biol. 6:2895-2902). The cloned producer cell lines had titers from SxlO5 to lx106 as dete~mined by standard m~othodc (Miller and Buttimore, 1986, Mol.
Cell. Biol. 6:2895-2902). The ~ nt T cell hybridomas were infected by the ~u~,lllal~ll~ of 2 1 7~0t 8 theproducerlinesasdirected(Kelleretal., 1985,Nature~ l49-ls4)andselectedinG4l8(o~8 -1.0 mg/ml) for 10 days. In the case of 175.2 cells cA~ lg Al.la, further selection was ~.Ç~..",ed by fluorescent staining with anti-CD3, followed by cell sorting using a FACStar Plus (Becton-Dickinson). The expression of the tr~ncd-lced TCR gene was determined by FACS
5 analysis using either an anti-V~6 monoclonal antibody (Payne et al., 1988, Proc. Natl. Acad. Sci.
USA 85:769S-7698) or anti-CD3, or by PCR analysis of RNAs from control and infected leci~,iclll T cell hybridomas. Primers specific for the Val and Ca gene segments were used for PCR. The amplified products were hybridized with a 5'end-labeled h.,lise.,se oligonucleotide specific forthe junctional region of Al.l ~ cDNA.

1 0 6.1.5. IN VITRO ASSAY FOR ANTIGEN-SP~.CIFIC REGU~,~TORY ACTIVIllY

To assay for Al . l derived antigen-specific regulatory activity, a simple antigen-specific system was employed (Zheng et al., 1988, J. Immunol. 140:1351-1358; Bissonellc et al., 1991, J.
Immunol.146:2898-2907; Zheng et al.,1989, Proc. Natl. Acad. Sci. USA 86:3758-3762). Spleen cells (1x10') from C57Bl/6 or C57Bl/10 mice were placed into 1 ml cultures in RPMI 1640 1 5 supplemented with 10% FCS and Sx10-5 M 2-ME. Each culture received 50~11 1% SRBC coupled with poly-18 or a ~ub~lilul~d polypeptide. Su~ cssive activity was accecced by adding filter-sterilized hybridoma au~elllal~ll with or without an "acce~.y co",ponenl" (10-15%) to the cultures. This accesso- y co",~n._.-l was prepared from cultures of murine T cells from animals immlmi7.od to SRBC, followed by adsorption of the ~ul,c",~t~-l with SRBC, as described supra, in Section 5.1.1. (see also Zheng et al.,1988, J. Immunol.140:1351-1358; Bic~o.. ~ Ile et al., 1991, J. Immunol. 146:2898-2907). Alternatively, culture su~c,,,~t~ull of a T cell hybridoma, 3-1-V
(described in Section 8, infra), may be used as accessory supernatant (FIG. IA and B). The cultures were ;~ u~ t~,d at 37`C in hllmirlified 92% air/8% CO2 and anti-SRBC PFC acc~cced 5 days later. In all of the eA~I illlC~It j shown herein, neither the T cell hybridoma ~u~ llakt~ nor 25 the accessory ~up~ ult significantly affected the immune ~ ,onse when added alone.
Therefore, all control and c~ llc~lt~l cultures desc,;bed herein contain ~ ~ce~ .,y supelllaL~
while results without accesso, y sul~,.llal~l are not shown.

2 1 790~ ~8 6.1.6. DrRF~cT BINDING OF BIoTIN-coNJuGA
~:rlll)F~ TO T CFT T~DFl~IVED PROTF~

The peptides EYIC(EYA)4EYK (SEQ ID NO: 3) and EYKEYAEYAAYAEYAEYK (SEQ ID
NO: 4) were conjugated to biotin as described (Bayer and Wilcheck, 1980, Methods Biochem.
5 Anal. 26:1-45) and antigen-binding activity was ~cse~ed in cell ~u~c...~ by a modified ELISA assay (Gallina et al., 1990, J. Immunol. 145:3570-3577). Supernatants from cell lines grown in protein free, serum free medium were conce~ aled ap~ illlately 50-200x on a Centricon 30 filtration system (Amicon, Danvers, MA) and coated at various dilutions on Immunolon II plates (Dynatech, Chantilly, VA) in carbonate buffer (pH 9.6) for 2 hrs at 37` C.
1 0 After washing with PBS plus 0.05% Tween 20, the bound material was incub~ted with 100~11 of biotinylated peptides at 1:500 dilution for 1 hr at 37` C, washed, incub~ted with Extravidin-alkaline pho~.k ~t~e conjugate (Sigma) diluted I :2000, washed, and developed with nitrophenyl phosphate ~ul)~lral~ (Sigma). OD 410 nm was determined after suitable incubation (often overnight at 4` C). In some experiments, peptides (without biotin) were added at 100 ng to I ~lg 1 5 per well, together with the active biotinylated peptide to assess competition for binding.

6.2 RESUI TS

6.2.1. TRANSF~R OF TC~ WITH OR WITHOUT TCR~ CONFERS THE ABILITY
TO PRODUCE ANTIGFN-SPECIFIC ACTIVIlY

As shown in FIG. 3B, inhibition of the anti-SRBC PFC response by the Al .1 supernatant was 20 observed when SRBC coupled with EYK(EYA)4 were present in the culture, but not when uncoupled SRBC or SRBC coupled with another peptide were present. The antigenic fine-specificity of the immunoregulatory activity demon~l~dted by A 1.1 has been des~fibed previously (Zhengetal., 1988,J.Immunol. 140:1351-1358,Bi~sc~ eetal., 1991,J.Immunol. 146:28-98-2907), and some of these results are compiled in FIG. 4.

WO 95/16462 2 1 7 9 0 ~ 8 PCT/US94/14542 The cell line 175.2 ~ sses TCR~ and the CD3 ~ , but lacks a functional TCRa gene (Gl~ -h~c et al., 1991, J. Immunol. 146: 2095). 175.2 cells were infected with a retrovirus cA~ sillg Al.1-TCRa (See Section 6.1.4, ~) and the cells were selected in G418, then further selected by cell sorting of CD3+ cells. The expression of CD3 on the selected cells (FIG.
5 3A), confirmed that the TCRa chain was cAI,.cssed in the selected cells (175.2-Al.la).
Su~,llal~ll:~ from 175.2-A1.1 a were collected and tested in the in vitro assay. As shown in FIG.
3B, these ~ w-,. ~ displayed the sarne antigen-specific regulatory activity as those of A1.1, while those from 175.2 had no activity. Rec~llce the original TCR and specificity of 175.2 are co---pl~lcly unrelated to those of A1.1 (Gl~irhenh~l~c et al., 1991, J. Immunol. 146: 2095), these 1 0 results demonstrate that expression of the A1.1 TCRa chain gene results in the production of the antigen-specific regulatory activity. In addition, this immunoregulatory activity can be neutralized by the addition of an antibody to TCRa in-~ir,~ting that the TCRa chain secreted in the ~"~*~ " ~ is ~n~iblc for this activity (FIG. 5). As a control, FIGS. 6A and B show that transfection of a TCRa gene from T cell hybridoma BB19 specific for an epitope of poly 18 1 5 which is distinct from that ~co~-i~ed by A1.1 induced CD3 expression on the cell surface of 2 subclon~s of 175.2 (AF5 and AF6). However, like the parent clone BB19, the tran~Çcc~-L~ did not produce any immunoregulatory activity in their ~ al~.l (FIG. 7A and B). Therefore, not all poly 18-specific T cells secrete a TCRa chain with immunoregulatory activity.

20 To further explore this observation, another cell line, B9, was infected with retroviral vectors carrying the TCRa or ~ of Al .1. Like A1.1, B9 cA~ sses both TCRa and ~, and produces IL2 in response to the antigen, poly 18, plese..led with l-Ad (Fotedar et al., 1985, J. Immunol.
135:3028-3033). As shown in Figure 8, supernatants from Al.1, but not B9, displayed antigen-specific regulatory activity, and B9 cells cAI l.,ssing the A1.1 TCRa chain (B9-Al.la) also 25 produced this activity, while those cAI~ressh~g the Al.l TCR~ chain (B9-Al.l ~) did not. The latter was not due to a blocking effect of TCR~, since B9 cells CAIJlC~illg both the TCRa and ~ from Al.1 (B9-Al.lal~) produced the regulatory activity.

Supernatants of B9-Al.la were fractionated by antibody-affinity chromatography on 30 immobiliæd anti-TCRa antibody and tested for antigen-specific reg~ o.y activity, using a WO 95/16462 ~ ~ 7 ~ O 1 8 PCT/US94/14542 ~9 panel of four peptides coupled to SRBC in the assay. As shown in FIG. 9, the soluble activity from B9-Al.la was bound and eluted from anti-TCR. The observed specificity for the uncubstituted peptide and the peptide substitllted as amino acid 7 (but not those su~s~ led at residues 3 or 10) is cha.aet. .i~lic ofthe antigen-specific activity from Al.l (Bissonette et al., 1991, J. Immunol. 146:28-98-2907) (see FIG. 4). As previously dic.;us~ed this specificity correlates with the poly 18 epitope recogni7ed by the Al.l TCR (Bissonette et al., 1991, J.
lmmunol. 146:28-98-2907).

In addition to B9, the Al.l TCRa gene was tr~ncdllced using retroviral vectors into another poly 1 0 18-specific cell line, B 1.1. Following selection with G418, the B 1.1 -A 1.1 a lines were found to produce the antigen-specific immunoregulatory activity, although the original cell line (B 1.1) does not. Thus, two TCRa+P+ T cell hybridomas (B9, B 1.1) and one TCRa~l~+ T cell hybridoma (175.2) produced the poly 18-specific regulatory activity following gene transfer ofthe Al.l TCRa gene. To further address whether or not expression of Al.l TCRa, in the absence of 1 5 TCR~, can lead to production of the antigen-specific regulatory activity, Al . l TCRa or Al . l TCR~ was transferred into BW1100 cells. Since BW1100 cells lack intact TCRa and ~ (White et al ., 1989, J. Immunol. 143: 1822- 1825), any effect of TCRa gene transfer should be directly attribut~ ~ to TCRa. As shown in FIG. 10A and B, su~,el.lal~.b from BW1100-Al .1 a, but not BW1100-Al.l~, displayed immunoregulatory activity. As with the other gene transfer cA~ .hnents~ this activity showed the antigenic specificity of Al.l.

6.2.2. GF.l~E TRANSFER QF TCRa CORRF.I,~TES WlTH PRODUCTION OF A
DI~FCT Al~TIGFl'l-RINDING ACTIVITY

The experiments described herein demonstrate that the released TCRa chain from Al.l binds directly to antigen. It is this t~ictinguiching feature which imparts biological activity to this TCRa chain versus that of other cells. As shown in FIG. I lA, ~uy~lnal~ from Al.l, and cell lines cAlJlcs~ing Al.l TCRa, contain an antigen-binding cu...pone..L as detected in a modified ELISA assay (See Section 6.1.6., supra). This antigen binding wac effectively co~ cled by the llnl~led peptide, but not by two h~aplu~ ul). iale peptides (FIG. 1 I B), one of which differs from wo 95/16462 2 l 7 9 0 ~ 8 PCT/US94/14542 the antigenic peptide by only a single residue. This substitl-ti~ n has been previously shown to destroy the antigenicity of the peptide for the Al . I TCR (in an antigen p-ece-" ~ n assay) (Boyer et al., 1990, Eur. J. Immunol. ~Q:2145-2148) and for the Al.l-derived regulatory activity (Bissonette et al., 1991, J. Immunol. 146:28-98-2907). These results indicate that the antigen-5 binding activity is the biologically active product of cells ~". ssi..g Al.l TCRa, and that thecha acl~- islic of antigen-binding by this molecule imparts its biOlogicâl activity.

6.3 DISCUSSION

The data presented herein unequivocally dernonctrate that the TCRa chain is released from Al . l 1 0 cells, binds to specific antigen (coupled to SRBC in our bioassay), and participates in inducing inhibition of the immune response to SRBC in vitro. The CD4+ T cell hybridoma, Al.l, consliluli-~ely releases an immunoregulatory activity specific for the synthetic antigen poly 18 and related peptides (Zheng et al., 1988, J. Immunol. 140: 1351-1358; Bissonette et al., 1991, J.
Immunol. 146:28-98-2907). Gene transfer of the A1.1 TCRa gene into other T cell lines as 1 5 described herein confers the ability to constitutively produce this antigen-specific regulatory activity (FIGS.3, 8, 9 and 10). Transfer ofthe Al.l TCR~ chain neither produced nor h.l~.r~ d with this effect (FIG. 8). The antigenic specificity of the soluble activity produced by each trancduced .-,cipi~,..l T cell line was id~ntic~l to that of Al.l. This activity was bound by a monoclonal anti-TCRa antibody (FIG. 9) and the eluted activity displayed the same antigenic fine-specificity shown by Al.l s~p- ,,h~ x (Bisson~lle et al., 1991, J. Immunol. 146:28-98-2907).

This example also conslusively demonslrales that the TCRa chain is released from the cell in a form that is independent of the CD3/TCR complex, and which modulates an antigen-specific immune ,~i,ponse. Specifically, the transfer of the A1.1 TCRa gene into BW1100, which cu...plet~ly lacks TCR~, nevertheless resulted in CQ~ e production of the antigen-specific regulatory activity (FIG. 10). The results described herein also indicate that it is the direct recognition of antigen by the Al . I TCRa chain (FIG. 11) that gives this molecule activity in the WO 95/164fi2 ~ 1 7 9 D ~ i8 PCT/US94/14~42 PFC assay, and that other T cells release TCRa chains that fail to directly bind to the epitope and therefore do not display such activity.

While not int~n~led to limit the scope of the invention, at least two models may be proposed at this time for how TCR mediates the immune response. It is possibl~, for example, that the complex of TCRa and antigen is imml-nog~nir resulting in regulatory immune responses to the TCR Recent studies have in~lir~tçd that immunization with specific T cells (Lider et al., 1988, Science ~: 181- 183; Sun et al., 1988, Nature 332:843-845) or peptides co.lc~nding to regions in the TCR variable region (V ldenb~rk et al., 1989, Nature 341 :541-544; Howell et al., 1989, 1 0 Science ~:668-670) can result in dramatic immunoregulatory effects in vivo. The regulatory effects associated with the AI .1 TCRa chain may ~ csellt a form of such TCR "vaccination"
in vitro.

Alternatively, it may be that an llnidPntified molecule ~ccoci~tçs with the antigen-binding TCRa 1 5 chain and this second molecule imparts biological function to the system. For example, Iwata, et al. (Iwata et al., 1989, J. Immunol. 143:3917-3924) have described a soluble complex of a molecule with glycosylation-inhibitory activity and a molecule bearing TCR determinants, released into ~ul~c~a~ of some T cell hybridomas.

7. EXAMPT F: PRODUCTION OF BIOT.OGICATT.Y ACTIVF~ TCR AT.PHA
CT~T~IN BY TN VITRO TRANSCRIPTION AND TRANST,~TION

7.1 MATEI2T~LS AND METHODS

7.1.1. IN VITRO TRANSCRIPTION AND TRANSLATION

DNA oligonucleotide probes were designed based on the known sequences of the C and C~
25 genes in mice. The probes were synthesized and used to screen a cDNA library prepared from poly 18-specific Al.l hybridoma cells. Full-length TCRa and TCR~ cDNAs from Al.l were WO 95/16462 2 1 7 9 0 t 8 PCT/US94/14542 chala~;t~,~i~d and cloned into a Bluescript vector (Str~t~gen~, La Jolla, CA). RNA for both Ca and C~ was transcribed in vitro using a eukaryotic in vitro lr~sC~ tiOn system (BRL, Gaithersburg, MD). The RNA was then translated in vitro using a rabbit reticulocyte Iysate system (BRL, C;aill,." ~b~ ~, ~)). For autoradiography, 35S-Met (New Fngl~n~l Nuclear, Boston, 5 MA) was included in the translation. For bioassays, the material was tran~l~ted in the absence of radionucleotides.

The in vitro translated material was then enriched by affinity chromatography with monoclonal anti-TCR~ or anti-TCR~ antibodies. Labelled material was analyzed by SDS-PAGE, treated 10 with Enhance, and exposed to X-ray film. Biological activity was assayed as in the system described in Section 6.1.5, ~.

7.2 p~F~ul~Ts In addition to the finding in Section 6, ~, that the transfer of the TCR gene from T cell 15 hybridoma, Al.1, to other T cell lines l.~l~r~ed the ability to produce the antigen-specific immunoregulatory activity, it was i...po. l~-l to determine whether a pure, recombinant TCR
protein produced by this gene would have biological activity in this system. Previous studies have shown that mRNA from T cells making such biologically active factors could be tr~n~lat~l in vitro, to yield the regulatory activity. By analogy, then, in vitro translation of TCR RNA
20 might yield a biologically active protein.

7.2.1. IN VIIRO TRANSCRIPTION AND TRANSLATION PRODUCTS

In vitro l ~lSC- ;~ion and translation yielded proteins of the ~pected size of 32,000 daltons for an unglycosylated TCR protein and this protein was found to ~cirlcally bind to the anti-TCR
25 antibody and not the anti-TCR~ antibody (FIGS. 12 and 13).

wo 95/16462 2 1 7 q O 1 8 PCT/USg4/14542 7.2.2. Il~IUNOT OGICAL I~F.GUT,~TORY ACTIVITY OF TRANSLATION
PRODUCT MADF IN VITRO

The TCRa protein was found to have biological activity in the PFC assay, and this activity was completely bound (and eluted) from the anti-TCRa antibody (FIG. 13A and B). In FIG. 13A, the immunoregulatory activity from the in vitro translated TCR was found in filtrates of the anti-TCR~ antibody column and in eluates of the anti-TCRa antibody column. Titration of the active filtrate (anti-TCR~) and eluate (anti-TCRa) showed the activities to be similar.

While the in vitro transcribed and translated TCRa showed immunoregulatory activity, the protein produced from TCR~ RNA did not.

7.3 DISCUSSION

The experiments detailed above coupled with the studies described in Section 6, ~, demonstrate that recombinant TCRa has biological function. Thus, a TCRa chain gene encoding such a biologically active factor can be ~A,.,ressed in various expression systems to yield a product with biological activity; i e., a TCR chain that can specifically ~u~r~ss an immune response directed against its target antigen.

8. EXAMPT.F GENERATION OF T CFT T. HYBRIDOMAS
THAT PRODUCE ACCF.~ORY COMPONENT ACT~VITY

8.1 MATEI~TAl ~ AND MFTHODS

8.1.1. ANIl~iLAT ~

25 C57BI/6 animals were purchased from Jackson Labolalolics (Bar Harbor, ME).

WO95/16462 2 ~ 790 T 8 PCT/US94114542 8.1.2. CT'.T - T Tl~. ~l~D 12T~'~GT'l`ITS

BWI 100 and T cell hybridomas were m~int~inPd in RPMI-1640 plus 10% FCS. Monoclonal antibody directed to CD4 (GK1.5) (Dialynas et al., 1983, Immunol. Rev. 74:29) was obtained S from American Type Culture Collection (Rockville, MD). Rabbit and ~uinea pig complement were obtained from SciCan (FAmonton, Alberta, Canada) and from GIBCO (Grand Island, NY), respectively. Both complement samples were first screened for low background activity before use. Magnetic beads coated with anti-rat IgG antibodies were purchased from Dynal.

8.1.3. GT~'l~T~ATION OF T CFT T T~YBRIDO~S
Spleen cells from C57BI/6 mice imm~ i7Pd to SRBC were obtained and treated with an antibody to CD4 (Gkl.5) in the yl~lsGnce of complement. The CD4 depleted cells were subse4ue"lly reacted with m~gnPtic beads coated with anti-rat IgG antibodies (Dynalbeads) for the removal of all IgGt cells. The rPm~ining T cells were centrifuged on Iympholyte M (Cedarlane Labu,do,i.,s, PA) and viable T cells were fused with BWl 100 in a 1:1 ratio in the pr~ence of PEG. Hybridomas were selected in the l"~sence of h~ hinP, thymidine, aminopterin and ouabin. Mouse red blood cells were used as filler cells. Su~ of the wells that scored positive for growth were tested for ability to s~ ule for accesso- y :iU~ llaktlll in combination with A1.1 ~uy~llatanl in the PFC assay as described in detail in 6.1.5., ~. Cultures with 20 activity were split into subcultllres and the sublines were retested for activity. The sublines with activity were again split and those with activity were cloned at 0.4 cells/well. Clones were , escreened for activity.

WO 95/16462 2 1 7 9 0 1 ~ PCT/US94/14542 8.2 ~T'',.CiUT,TS

8.2.1. A T CT''T~T~ HYBRIDQMA PRODUCES
ACCF,~SORY COMPONli,NT ACTIVIIY

SRBC-immunized murine spleen cells depleted of CD4+ T cells and IgG+ B cells were fused with BWl lO0. After cloning, one such T cell hybridoma, 3-1-V, was shown to produce an accessory activity in the culture ~u~c~ ~lL that when tested in the presence of Al.l su~,cll.a~nl could substitute for accesso~ ul~c~ t in mediating antigen-specific immunoregulatory activity (FIG. 1). 3-1-V supernatant functions in combination with Al.l :~UIJCllla~ irrespective of 1 0 whether it is the naturally secreted product or the in vitro translated product of the Al . l TCRa gene. Therefore, monoclonal populations of T cells can be obtained that reproducibly and consliluLi~ely secrete accessory colll~onelll~ for use with antigen-specific TCRa chains.

9. EX~IPT,T'',: cDNA clnni~ of TCRa ~ene A cDNA library can be ~lel~cd from T cells using techniques well known in the art. Since the 1 5 nucleotide sequences encoding the single con~ nl region gene for TCRa (Ca) in human and mice are known (Willson, etal., Immunol. ~ev., 101:149-172, 1988), DNA probes homologous to Ca can be s~ l.es;~l~,d by standard methrdc and used to screen such libraries to identify TCRa cDNA. Alternatively, oligonucleotide probes derived from specific TCRa sequences could be used as primers in PCR (polymerase chain reaction) method (Mullis, et al., Methods in Enzymol., 155:335-350, 1987) to generate cDNA of TCRa sequences which can be directory cloned (Roman-Roman, et al., Eur. J Immunol., ;~1~927-933, 1991).

A helper T cell hybridoma, Al.l, has been described above (Fotedar, et al., J. Immunol., ~3028-3033, 1985) and ~i~l.,sses TCRa and ~ molecules specific for a synthetic polypeptide decign~ted poly- 18 (poly (Glu-Tyr-Lys-(Glu-Tyr-Ala)5)) and, in the ~lcsellce of specific antigen and l-Ad, releases Iymphokines. This T cell hybridoma also con~liluli~ely produces a poly-18-Wo 95/16462 PCT/US94/14542 specific soluble factor involved in antigen-specific ~u~ ,s~ion. It has been shown that the factor produced by A 1.1 displayed the same ~rltigenic fine specificity exhibited by the TCR on the A 1.1 cell (Zheng., et al., J Immunol., 140:1351-1358, 1988), and that the immunoregulatory activity of the Al .l derived factor was encocleA at least in part, by the TCRa protein (Bi~onPtte, et al., J. Immunol., 146:2898-2907, 1991).

TCRa cDNA of A 1.1 cells was cloned from cDNA library using Ca probes. mRNA was isolated from 109 cells by the conventional gl~nidine-isothiocyanate and cesium chloride method, and recovered by oligo-dT cellulose affinity chromatography. The first strand cDNA was synth~si7~d using an oligo-dT primer and reverse ~ s.i, iyt~sc and the second strand using DNA
1 0 polymerase I and RNase H. The methylated blunt ended double-strand cDNA was ligated to EcoRI linkers. Subse4u~.,l to EcoRI digestion, the DNA was size selected to agarose-gel, purified by spermine pl~,cipildtion, and cloned into lambda-gtlO. The phage DNA was p~ g~d in vitro by using Gigapack GoldTM (Stratagene). Approximately 200,000 plaques were screened by in situ hybridization using 32P-radiolabelled Ca probes. The insert DNA from the positive 1 5 clones were ligated into M13mpl8 for standard dideoxy sequencing. The complete nucleotide sequence of Al . l TCRa cDNA is shown in Figure 14.

A bee venom phospholipase A2 (PLA2}specific glycosylation inhibiting factor (GIF) producing hybridoma, (3B3), has been established that ~A~,ejses TCRa and ~ chains specific for PLA2 (Mori, et al., Int. Immunol., 5:833-842, 1993). This T cell hybridoma co.~ ";v~ly produces immunosu~)~,ressive factor, GIF, and PLA2 binding GIF upon stimulation with homologous antigen and antigen pl.s~ g cells. Accumulated evidences show that antigen-binding GIF
specifically ~ulJpl~,sS the immune ,esponse to the antigen in vivo, and that the antigen binding GIF may be encoded, at least in part, by TCRa ~ ;"g on the cell (Iwata, et al., J. Immunol., 141:3270-3277, 1988; Iwata, et al., J. Immunol., 1~;3917-3924, 1989; Mori, et al., Int.
Immunol., 5:833-842, 1993).

TCRa cDNA of 3B3 cells was cloned by PCR following the method described by Mullis, et al., Nucl. Acids. Res., 8:3895-3950,1980). mRNA was isolated from 5 X 10' 3B3 cells by using Fast WO 95/~6462 2 ~ ~ 9 0 t 8 PCT/US94/14542 TracklM mRNA isolation kit (Invitrogen). cDNA was generated by using cDNA synthesis system (Pharmacia). After their generation, cDNAs were ligated at the 5'-end and the 3'-end by using T4 ligase (Takara) to construct circular DNA. Oligonucleotide primers encoding murine Ca DNA were srthPci7Pd by DNA/RNA synthPci7Pr (Applied Biosystems) using pho~hG~ idite method (Be~uc~ge, et al., T~lruheJrvr~ Lett., ~1859- 1862, 1981).

The sequences of these primers were:
5'-GTGGTCCAGTTGAGGTCTGCAAGA-3' 5'-TTGAAAGmAGGTTCATATC-3' -R was carried out by Taql DNA polymerase (Takara) in the presence of template cDNA, 1 0 primers and dNTPs in a ther no cycler. The conditions of PCR were that the denaturation step was 940C, I min; the ~nnP~ling step was 54C, 1 min; and the elongation step was 720C, 2 min;
for 35 cycles. Amplified cDNA was subcloned into pCR1000 vector of TA cloning system~M
(Invitrogen). DNA sequences of the inserts were confirmed by dideoxy sequencing technique (Sanger, etal., Proc NatqAcad. Sci. USA, 74:5463-5467, 1977). Three dirr~ ll TCRa cDNA
1 5 were cloned and sequenced. Two of them were identified to be originated from the fusion partner cell of 3B3 hybridoma, BW5147 (Chien, et al., Nature, 312:31-35, 1984; Kumar et aL, Eixp. Med., 170:2183-2188, 1989). The other TCRa cDNA was confirmed not to be eA~,l c~sed in BW5147 by using several PCR primers encoding the different portion of this TCRa gene, which in~ic~t~Pd that this TCRa originated from PLA2-specific T cells. Two of independent 20 clones Pnco~ling this TCRa cDNA were isolated and their DNA sequences were confirmed to be identical. The DNA sequence of this 3B3 derived TCRa cDNA is shown in Figure 15. This TCRa cDNA encodes 268 amino acids open reading frame and the first 20 amino acids were identified to be a signal peptide (McElligott, et al., J. Immunol., 140:4123-4131, 1988).

wo 95/16462 2 1 ~ 9 Q 1 8 PCT/US94/14542

10. Expression of recombinant TCRa in F. rnli direct e~ Q~

10.1 Conslr~lion of ~A~ ola id for TCRa In order to construct expression plasmid encoding extracellular region of A1.1 TCRa, the oligonucletides were used as primers to amplify DNA fragments by PCR. A1.1 TCRa cDNA, 5 which encodes amino acid 26 to 240 in extracellular region, and includes a Clal restriction site, Shine Dalgano sequence (Scherer, et al., NucL Acids. Res., 8:3895-3950, 1980) and met initi~tion codon in the 5' terminus, and two tennin~tion codons and BamHI restriction site in the 3' terminus, was amplified by two primers using PCR. The sequences of these primers were:

5 '-AACATCGATTAATTTATTAAAACTTAAGGAGGTATATTATGAGCCCAGAAT
1 0 CCCTCAGTGTCC-3' (SEQ ID NO: 5) 5'-AACGGATCCCTATTATTGAAAGTTTAGGTTCATATC-3' (SEQ ID NO: 6) Unless otherwise noted, the dc,,du,alion step in each PCR cycle was set at 94C for I min, and elongation was at 72C for 2 min. The DNA r,~g".~.,l was ~1igested with Clal and BamHI, and cloned into the CA~JI c~iOn plasmid pST81 I vector carrying a trp promoter and a trpA terminator 1 5 (Figure 16, J~p~n~ce patent, ~l~b~ikoho 63269983) at the unique Clal and BamHI sites. The new plasmid, called pST811-A1.1 TCRaS5 (Figure 17) was l~ sru~ ed into co..lpelc..l RRI ~. coli host cells. Selection for plasmid colll~illillg cells was on the basis of the antibiotic (ampicillin) resistance marker gene carried on the pST811 vector. The DNA sequence of the synthetic oligonucleotides and the entire TCRa gene was col.~....cd by DNA se4ucncillg of plasmid DNA.

20 Another expression plasmid containing the dirre~e,.t truncated form of Al.l TCRa which encodes 26 to 203 amino acids was constructed using the primer of 3'-te~rninllc:

5'-CGTTGGTCTGTTCGAAGTGGATTATCCGTAGGCAA-3' (SEQ ID NO: 7) 2 ~ 790 1 8 The amplified DNA was inserted into pST811 vector and g~ t~ the expression plasmid, call pST811-Al.l TCRaS3.

10.2 C--lture of E. coli produ~ in~ TCRa RR1 E. coli carrying plasmid pST811 -A 1.1 TCRaS5 or pST811-A1.1 TCRaS3 were cultured in 50 ml of Luria broth cont~ining 50 ~lglml of ampicillin, and grown overnight at 37DC. The inoculum culture was acepti( ~lly transferred to 1 liter of M9 broth which was colllposed of 0.8%
glucose, 0.4% c~minr acid, 10 mg/liter thi~Tnin~ and 50 mg/liter ampicillin, and culture for 3 hours at 37C. At the end of this initial incubation, 40 mg of indoleacrylic acid was added and the culture was incuh~t~d for an additional 5 hours at 37C.

1 0 11. F~pression of recombinant TCRain F rnli - fusion ex~. eDDioll system

11.1 CooDlr~-tioD of ~ Dr plasln~

Matsuki, et al. has developed a rat calmodulin expression plasmid, pTCAL7, which carries rat calmodulin cDNA and trp promoter (M2~ '-i et al., Biotech Appl. Biochem., 12.284-291, 1990) (FIGURE 18). In order to express fusion proteins, several cloning sites were ge.,c.~ed at the 3'-end of calmodulin cDNA, which also cont~inc a thrombin cleavage sequence. In detail,calmodulin cDNA inserted into pTCAL7 was ~rnrlified by PCR using two prirners: one encoded 5'-terminus of calmodulin cDNA co"~ ;..g Clal site, the other one provided the sequence of 3'-terminus of calmodulin cDNA, thrombin cleavage site and both BamHI, Xbal, Notl and Bglll sites.

5'CGCAATCGATTAATTTATTAAAACTTAAGGAGGTATATTATGGCA-3' (SEQ ID NO:
8) 5'-GAAGATCTGCGGCCGCTCTAGAGGATCCACGCGGAACCAGTTTTGCAGTCATC-3' (SEQ ID NO: 9) WO95/16462 2 1 7~ PCT/US94/14542 The amplified DNA fragment was digested with Clal and Bglll, and inserted into the larger r~a~lle.-l of pTCAL7 plasmid which was digested with Clal and Bglll. The new plasmid, called pCFI (Figure 19) was transformed into competent DH5 E. coli host cells. The DNA sequence of the synthetic oligonucleotides was confirmed by DNA sequencing of the synthetic 5 oligonucleotides was conr..lllcd by DNA sequencing.

11.2 Conslr~-ti~n of ~a~ cn plasmids for TCRa The DNA r...~..ell~ of 3B3-derived TCR extracellular region, which encodes amino acid 21 to 241, was amplified from pCR1000-3B3TCRa plasmid by PCR using two primers cont~ining Xbal site for S'-terminus, stop codon and Notl site for 3'-terminus .e~,e.ilively. The sequences 10 of those primers were:

5'-GCTCTAGAGGACAGCAAGTGCAGCAGAGT-3' (SEQ ID NO: 10) S'-AAGCGGCCGCTTAGTTTTGAAAGTTTAGGTT-3' (SEQ ID NO: 11) The amplified DNA r.a~ll. .ll was ligated with Xbal and Notl digested pCF1 plasmid. The new plasmid, called pCF1-3B3TCRa (Figure 20) was ~ rulllled into c~-mpet~nt W3 1 10 E.coli cells, 15 and the DNA se~u~nce was collr.llllcd.

A 1.1-derived TCRa cDNA which encodes amino acid 26 to 240 was also inserted into pCF 1 by the method described above by using two primers;
S'-GATCTAGACAGAGCCCAGAATCCCTCAGTG-3' (SEQ ID NO: 12) S'-AAGCGGCCGCTTATTGAAAGTTTAGGTTCATATC-3' (SEQ ID NO: 13) 20 and the new ~A~ ion plasmid pCF1-Al.lTCRaSS was con~ led. A culture of E. coli producing TCRa was des-libed in EXAMPLE 10. In this expression system, the fusion protein of calmodulin-3B3TCRa or c~lmod~llin-A 1.1 TCRaSS was ~A,ul~s~ed in a soluble form, and was approximately 10% of total protein (Figure 21).

WO 95/16462 2 i ~ 9 0 1 8 PCT/USs4/14542

12. FX~ F: P~r;fi~ali^n of recombi-~ant TCRa 12.1 Pur.i~c~ r aDd r-f 1~ of reco~lbinant TCRa - (lirect c~ oll svstem About I g wet weight of cells cAI"eS~ g Al.l TCRaSS was ~ d~d in 30 ml of water and broken by French-Press at 8000 psi, 4 times. The broken cell pellet was obtained by centrifugation, 15000 X g, 10 min at 4C, and washed twice with water. By SDS-polyacrylamide gel electrophoresis analysis, it was evident that the majority of the pellet was A1.1 TCRaS5 protein (Figure 22). The pellet fraction cont~ining insoluble Al.l TCRaS5, e~ t~d at 1 to 2 mg, was added to 4 ml of an a~lulJI;dt~, mixture such that the final col~( 7-~1~aliOI15 of col,-pon~
in the mixture were 8 M urea, 50 mM sodium acetate and 0.1 mM EDTA. The mixture was kept at room tC---p~ re for 3 hours to solubilize Al.l TCRaS5. R~orn~inin~ insoluble material was removed by centrifugation, 15000 X g, 10 min at room l~ ,ldtu~t.

For refolding/reoxidation of the soluble Al.l TCRaS5, the ~u~ fraction was addedslowly, with stirring, to 40 ml of an a~ p~uy~ialc mixture such that the final cûllce~ alion of CO""~OI,~ "1~ in the mixture were 2.5 M urea, S mM sodium acetate, 0.01 mM EDTA 50 mM Tris-HCI pH8.5, 1 mM glutathione (reduced form) and 0.1 mM glutathione (oxidized form). After 16 hours at 4C, 400 ~11 of trifluoroacetat~ (TFA) was added in the mixture. The mixture was applied at room t~,llp~alulc to an reverse phase Vydac C4 column (1 X 10 cm) equilibrated in 0.1% (v/v) TFA/water, at a flow rate of 1 ml per min. After a sample application, the column was washed with 10% (v/v) acct~ ile in 0.1% TFA/water. Al.l TCRaSS material, which was bound to the column, was eluted with a gradient of 30 to 40% (v/v) acetonitrile in 0.1%
TFA/water. Aliquots from fractions collected from the C4 column were analyzed by SDS-polyacrylamide gel el~llupho,.,~i~ without reduGtirn ofthe samples and purified Al.l TCRaS5 protein was identified in fraction 25 to 30. Those fractions were pooled and dried in vacuum condition. The dried protein was dissolved in PBS, however other similar buffers could be used.

Al .1 TCRaS3 was purified and refolded by the same procedure described above.

WO 95/16462 2 1 7 q O 1 8 PCT/US94/14542 12.2 Purif c~tior of recombinant TCRa - fusion expression system About I g wet weight of cells ~ si"g 3B3 TCR was ~ led 100 ml of 50 mM Tris-HClbuffer, pH 8.0, and broken by French Press at 8000 psi, 4 times. The supernatant was collected by centrifugation, 15000 X g, 10 min at 4C, and dialyzed against 50 mM Tris-HCl buffer, pH
8.0, containing 2 mM glut~thionP (reduced form) and 0.2 mM glllt~thione (~ i7~d form) at 4C
for overnight. The sample solution was added an ap~lropliate mixture such that the final conce"L,~lion of col"po~ in the mixture were 150 mM NaCl, I mM CaCI2 and 5 mM MgCI2.
This mixture was applied at 4OC to a phenyl sepharose 6 fast flow low sub column (Pharmacia, 3 X 6 cm) equilibrated with 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM CaCl2 and 5 mM
MgCl2 and run at a flow rate of 0.5 ml per min. After washing the column with the same buffer, calmodulin-TCRa fusion protein was eluted with 50 mM Tris-HCl pH8.0 cont~ining 4 mM
EDTA at a flow rate of 0.5 ml per min. Aliquots of fractions was analyzed by SDS-polyacrylamide gel elc~ Iro~ oresis~ which inr~ tPd that the fusion protein was highly enriched (Figure 23).

The elution fraction was dialyzed against 50 mM Tris-HCl buffer pH8.0 containing 150 mM
NaCl at 4C for overnight. CaC12 was added to the 50 ml of dialyzed fraction to the final 2.5 mM
concentration, and 1% of thrombin (Sigma) was added and inc~lbated at 25C for 6 hours to digest the fusion protein. In order to stop digestion, EDTA was added to a final concentration of 4mM to the reaction mixture which was then dialyzed against 50 mM Tris-HCl buffer pH8Ø
After dialysis, the mixture was conc~"l,aled to S ml by ultrafiltration and applied to TSK G2000 gel filtration column (Toyo Soda) equilibrated with 2 X PBS buffer and fractionated by HPLC
at flow rate of 3 ml per min. The 2 mg of purified 3B3 TCRa protein was collected in fraction 24to26.

WO 95/16462 2 ! 7 9 0 1 8 PCT/US94/14542

13. F.XAl~lpT F.- l~inln~cal activities of recombinant TCRa 13.1 In Vitro i~munosupv. e~ acffvity of recombinant Al.1 TCR

To assess bioactivity of recombinant A1.1 TCRa, a simple antigen-specific system was employed (Zheng, et al., J Immt~ol., 40: 1351-1358, 1988; Zheng, et al., Proc. Natq Acad. Sci.
USA, 86:3758-3762, 1989; Bicco!.. Ile, etal., J: Imm2mol., 146:2898-2907, 1991). 1 X 10' spleen cells from C57BI/6 or C57BI/10 mice were placed into 1 ml cultures in RPM11640 supplemented with 10% FCS and S X 10-5 M 2-mercaptoethAnol (2-ME). Each culture received 50 ,L.I 1%
SRBC coupled with poly-18 (EYK(EYA)5) or a substituted polypeptide. Su~ ive activity was Accecced by adding recombinant TCRa with or without an "acce~sol y co~ lt;lll" (10-15%) 1 0 to the cultures. This accesso.y c~---ponel-l was p-~,?arcd from cultures of murine T cells from animals immunized to SRBC, followed by absorption of the ~upcll~aLnt with SRBC. The cultures were i~.cul.Atcd at 37~C in humidified 92% air/8% C02 and anti-SRBC PFC (plaque forming cells) Accesce-d 5 days later. In all ofthe experiments shown herein, Al.l cell cultured su~J~,.lla~ was used as a positive control.

15 The immuno~u~ ssi~e activity of recombinant Al.l TCRaS5 (c.f. EXAMPLE 10.1) was observed in a dose clepen~l~rlt manner which is shown in Figure 24a. This figure shows the results from two coded e,.~.illlc.lt~, in which the recombinant TCRa molecule was titrated, and theneachdilutionwascoded. Theimml~ s~lpp~ siveactivityofrecombinantAl.l TCRaS3 (c.f. EXAMPLE 10.1) was also observed in a dose dependent manner (Figure 24b).

20 13.2 Antipen specific immunosuppcessive acffvity of recombinant TCRa The fine antigenic sl)ecir-,ily ofthe Al.l-derived TCRa chain has been described (Bissonnette, et al., J. Immunol., L46:2898-2907, 1991; Green, et al., Proc. Nat'l Acad. Sci. USA, 88:8475-8479, 1991). Immunosul-plc~si~e activity of the TCRa chain was observed when poly-18 or EYKEYAEYAEYAEYA was used, but not detl~cted when a ~ ed peptide such as 25 EYAEYAEYAEYAEYA and EYKEYAEYAAYAEYA was employed. Thus, the antigenic WO 95/l6462 2 1 7 9 Q 1 8 PCT/US94/14542 specificity of the recombinant Al .1 TCRaS5 was ~csçcced by using these four peptides. The recombinant TCRa protein showed ~uyylc~si~e activity at a final concentration of 4 X 10-' M
only with poly- 18 or EYKEYAEYAEYAEYA (Figure 25). The figure ~ ,s~llL~ the data from four experiments, in which each of the peptides shown on the left (or saline) were added into 5 coded tubes. The coded samples were then used for coupling to SRBC~for the assay culture in the yl~sence of acc~ ~ul y ~UpClll~tàllt. No ~uyylcssion was observed in any case in the absence of accessory ~uyclllal~ll. The codes for each experiment were different.

13.3 In vivo immunosupp. ~ activity of recombinaot TCRa In order to assess whether the recombinant TCR regulate the immune response in vivo, 10 recombinant 3B3 TCRa protein was ~ ninictçred to mice which were immunized with bee venom PLA2-As an antigen, DNP (dh~ vphenyl) derivatives of bee venom PLA2 (Sigma) were prepared bystandard procedure. Balb/C mice were i"""uni~ed by an i.p. injection of 10 ~g of DNP-PLA2 absorbed to 2 mg of alum. Recombinant 3B3 TCRa was injected i.p. on day -1, 0, 2, 4, 6 at a 15 dose of 5 ~g/injection, and control mice received PBS alone. Two weeks after immunization, serum was obt~inPd from each animal and anti DNP-lgG1 and anti DNP-lgE were measured by ELISA (Iwata, et al., J. Immunol., ~L~3270-3277, 1988). Anti-DNP-IgG1 and anti-DNP-IgE
were cignifi~ntly ~uyyl~ed (Table 1). To evaluate antigenic specificity, DNP-ovalbumin was used as an antigen and the activity of recombinant 3B3 TCRa was ~CsçCce~ As expected, anti-DNP antibody ~yonse to DNP-OVA was not affected by the ll~allllclll of ;.. l-.. i,~d mice with the recombinant TCRa.

These results in-~ic~t~s the immuno~uyylessive activity of recombinant TCRa protein in an antigen specific manner. None of the animals had adverse reactions to the recombinant TCRa protein, in~1ic~ting potenti~l use of the recombinant TCRa protein to SuyylciS irnmune rc~yvnses 25 which mediate diso,dc.~ such as auloi"""une diseases and allergy.

WO 95/164622 ! 7 9 0 ~ 8 PCT/US94/14542 TABT F. 1 SUPPP~F~SION OF T~TF. ANTI-~PTF.N ANTIBODY
RF~PONSF OF Balb/c r.!t~CF BY RFCOMBINANT 3B3 TCR~
Anti-DNP IgE(~g/ml)' Anti-DNP IgGl(~g/ml)~
PBS(N=4)0.50+0.26 56.8 l 9.8 3B3TCR a (N=6) 0.12+0.03 b 5.8 l 2.6 b a) 2 weeks after immunization with alum-absorbed DNP-PLA2 b) p(0.05 The present invention is not to be limited in scope by the exemplified embodiments which are intended as illustrations of single aspects of the invention and any microo~ llls which are 10 functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become ayyalcnt to those skilled in the art from the Çol~goillg description and accollly&lying drawings. Such modifications are intçnded to fall within the scope of the appended claims.

All publications cited herein are hlcoly~ldted by reference in their entirety.

~yu~ LISTING

(1) GENERAL INFORMATION:
(i) APPLICANT: LA JOLLA lNSlllul~ FOR ALLERGY AND IMMUNOLOGY
and KIRIN BEER KA~u~lKl KAISHA
(ii) TITLE OF INVENTION: METHOD FOR ANTIGEN-SPECIFIC
IMMUNOREGULATION BY T-CELL ALPHA CHAIN
(iii) NUMBER OF ~yu~N~S: 28 (iv) CORRESPONDENCE ADDRESS:
(A) ADDRESSEE: Spensley Horn Jubas & Lubitz (B) STREET: 1880 Century Park East, Suite 500 (C) CITY: Los Angeles (D) STATE: California (E) cou~l~r: USA
(F) ZIP: 90067 (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: Floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS/MS-DOS
(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:
(A) APPLICATION NUMBER: PCT/
(B) FILING DATE: 12 December 1994 (C) CLASSIFICATION:
(viii) AllOkN~Y/AGENT INFORMATION:
(A) NAME: Wetherell, Jr., Ph.D., John R.
(B) REGISTRATION NUMBER: 31,678 (C) R~K~N~/DOCKET NUMBER: FD-3085 W O 95/16462 PCTrUS94/14542 2! 79018 (ix) TELECOMMUNICATION INFORMATION:
(A) TELEPHONE: (619) 455-5100 (B) TELEFAX: (619) 455-5110 (2) INFORMATION FOR SEQ ID NO:1:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 5 amino acids (B) TYPE: amino acid (C) STRANn~nNR~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..5 (xi) ~u~ DESCRIPTION: SEQ ID NO:1:
Lys Val Pro Arg Gly (2) INFORMATION FOR SEQ ID NO:2:
(i) ~Quk~ CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..15 W O 95/16462 2 ~ 7 q O ~ ~ PCTrUS94/14542 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala (2) INFORMATION FOR SEQ ID NO:3:
(i) ~Uu~N~ CHARACTERISTICS:
(A) LENGTH: 18 amino acids (B) TYPE: amino acid (C) STRA~ S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..18 (xi) S~YU~N~ DESCRIPTION: SEQ ID NO:3:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Lys (2) IN~ORMATION FOR SEQ ID NO:4:
u NC~: CHARACTERISTICS:
(A) LENGTH: 18 amino acids (B) TYPE: amino acid (C) STRAN~vN~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/REY: Peptide (B) LOCATION: 1..18 W 095/16462 ? 1 7 9 0 1 8 PCTrUS94/14542 (Xi ) S~UU~N~'~ DESCRIPTION: SEQ ID NO:4:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Ala Tyr Ala Glu Tyr Ala Glu l 5 l0 15 Tyr Lys (2) INFORMATION FOR SEQ ID NO:5:
( i ) S~U~N~ CHARACTERISTICS:
(A) LENGTH: 63 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..63 (Xi ) S~YU~N~ DESCRIPTION: SEQ ID NO:5:
AACATCGATT AATTTATTAA AACTTAAGGA GGTATATTAT GAGCCCAGAA lCCcl~AGTG 60 (2) INFORMATION FOR SEQ ID NO:6:
(i) S~:~u~ CHARACTERISTICS:
(A) LENGTH: 36 base pairs (B) TYPE: nucleic acid (C) STR~NnRnN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..36 W 095116462 2 1 7 9 Q 1 8 PCT~US94/14542 ~xi) S~uukN~ DESCRIPTION: SEQ ID NO:6:

(2) INFORMATION FOR SEQ ID NO:7:
(i) ~Uu~ CHARACTERISTICS:
(A) LENGTH: 35 base pairs (B) TYPE: nucleic acid (C) sTRANnRnNR~s: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/REY: CDS
(B) LOCATION: 1..35 (Xi ) S~UU~N~ DESCRIPTION: SEQ ID NO:7:

(2) INFORMATION FOR SEQ ID NO:8:
(i) ~uu~ CHARACTERISTICS:
(A) LENGTH: 45 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: l..45 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:
CGCAATCGAT TAA m ATTA AAACTTAAGG AGGTATATTA TGGCA 45 W O 95/16462 2 1 7 9 Q t 8 PCT~US94/14542 (2) INFORMATION FOR SEQ ID NO:9:
~UU~N~ CHARACTERISTICS:
(A) LENGTH: 53 baSe PairS
(B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: Sing1e (D) TOPOLOGY: 1inear (ii) MOLECULE TYPE: DNA (genOmiC) (iX) FEATURE:
(A) NAME/KEY: CDS
~B) LOCATION: 1..53 (Xi) ~U~N~'~ DESCRIPTION: SEQ ID NO:9:
GAAGATCTGC GGCCG~1C1A GAGGATCCAC GCGGAACCAG TTTTGCAGTC ATC 53 (2) INFORMATION FOR SEQ ID NO:10:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 29 baSe PairS
(B) TYPE: nUC1eiC aCid (C) STRANDEDNESS: Sing1e (D) TOPOLOGY: 1inear (ii) MOLECULE TYPE: DNA (genOmiC) (iX) FEATURE:
(A) NAME/REY: CDS
(B) LOCATION: 1..29 (Xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

W O 95/16462 2 1 7 q O t 8 PCT/US94/14542 ~2) INFORMATION FOR SEQ ID NO:ll:
(i) S~QU~N~ CHARACTERISTICS:
(A) LENGTH: 31 base pairs (B) TYPE: nucleic acid (C) STRAN~ N~:5S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..31 (xi) S~Uu~ DESCRIPTION: SEQ ID NO:11:

(2) INFORMATION FOR SEQ ID NO:12:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 30 base pairs (B) TYPE: nucleic acid (C) STRANn~nN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..30 (xi) S~Uu~ DESCRIPTION: SEQ ID NO:12:
GATCTAGACA GAGCCCAGAA ~CC~-L~AGTG 30 W O 95/16462 2 1 7 9 ~ ~ 8 PCTrUS94/14542 (2) INFORMATION FOR SEQ ID NO:13:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 34 base pairs (B) TYPE: nucleic acid (C) STRAN~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEAT~RE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..34 (xi) S~yu~N.~ DESCRIPTION: SEQ ID NO:13:

(2) INFORMATION FOR SEQ ID NO:14:
CHARACTERISTICS:
(A) LENGTH: 1092 base pairs (B) TYPE: nucleic acid (C) STRANnRnNR~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEAT~RE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..1092 WO 95/16462 2 1 7 ~ Q 1 8 PCT/US94/14542 (xi) S~:S,?U~ ; DESCRIPTION: SEQ ID NO:14:
GCTAGCAAAG CTG~lllllA ~ CCTA TAGGAGATGT CAAAACTTAT GAACAGCAAC 60 TCCTTGAGTG TTTTACTAGT G~lCw ~lGG CTCCAGTTAA A~;lGC~l~iAG GAGCCAGCAG 180 AAGGTGCAGC AGAGCCCAGA AlCC~ AGT GTCCCAGAGA GCATGGCCTC TCTCAACTGC 240 ACTTCAAGTG ATCGTAATTT TCAGTACTTC lG~ lACA GACAGCATTC TGGAGAAGGC 300 CCCAAGGCAC TGATGTCCAT ~ iAT GGTGACAAGA AAGAAGGQG ATTCACAGCT 360 ACCTCAATA AGGCCAGCCT GCAl~lllCC CTGCACATCA GAGACTCCCA GCCCAGTGAC 420 TCCGCTCTCT A~ll~l~ilGC AGCTAGTGAG CCGGGTTACC AGAACTTCTA TTTTGGGAAA 480 ACCTGCCAAG ATATCTTCAA AGAGACCAAC GCCACCTACC CCAGTTCAGA C~,llCC~l~l 780 TCAGTTATGG GACTCCGAAT C~lC~ lG AAAGTAGCCG GATTTAACCT GCTCATGACG 900 C~1C~1~ACC CClCCG-:lCC ll~ AAGC CAAAAGGAGC CCTCCCACCT CGTCAAGACG 1020 G~ lGGG GTCTGGTTGG CCCTGATTCA CAATCCCACC TGGATCTCCC AGA~ ilGA 1080 (2) INFORMATION FOR SEQ ID NO:15:
(i) S~;Qu~:N~ CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRANDEDNESS: ~ingle (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide W 095116462 2 ! 7 9 0 1 8 PCT~US94/14542 ~ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Ala Tyr Ala Glu Tyr~ Ala (2) INFORMATION FOR SEQ ID NO:16:
(i) s~uu~: CHARACTERISTICS:
(A) LENGTH: 18 amino acids (B) TYPE: amino acid (C) STR~Nn~n~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..18 (xi) s~u~ DESCRIPTION: SEQ ID NO:16:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala (2) INFORMATION FOR SEQ ID NO:17:

(i) S~Uu~N~ CHARACTERISTICS:
(A) LENGTH: 12 amino acids (B) TYPE: amino acid (C) STR~NIJ~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide W O 95/16462 2 1 ~ ~ O 1 8 PCT~US94/14542 (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..12 (xi) S~Qu~ DESCRIPTION: SEQ ID NO:17:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala (2) INFORMATION FOR SEQ ID NO:18:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRPNn~nN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..15 (xi) ~UU~N~: DESCRIPTION: SEQ ID NO:18:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala (2) INFORMATION FOR SEQ ID NO:l9:
u~ CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRPNn~nN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide W O 9Sl16462 2 1 7 9 ~ 1 8 PCTrUS94/14S42 (ix) FEATURE:
~A) NAME/KEY: Peptide (B) LOCATION: 1..15 (xi) ~yu~ DESCRIPTION: SEQ ID NO:19:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Lys (2) INFORMATION FOR SEQ ID NO:20:
(i) s~u~ CHARACTERISTICS:
(A) LENGTH: 18 amino acids (B) TYPE: amino acid (C) sTR~Nn~nN~s single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..18 (xi) s~u~ DESCRIPTION: SEQ ID NO:20:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Lys (2) INFORMATION FOR SEQ ID NO:21:
(i) s~:Qu~ CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRPN~ N~:~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide W 095/16462 PCTrUS94/14542 (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:
Glu Tyr Lys Glu Tyr Ala Glu Ala Ala Glu Tyr Ala Glu Tyr Ala (2) INFORMATION FOR SEQ ID NO:22:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STRAN~N~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: 1..15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:
Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala (2) INFORMATION FOR SEQ ID NO:23:
Uu~N~ CHARACTERISTICS:
(A) LENGTH: 15 amino acids (B) TYPE: amino acid (C) STR~Nn~nN~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide W 095/16462 ~ 1 7 9 0 1 8 PCTrUS94/14542 (ix) FEATURE:
(A) NAME/KEY: Peptide (B) LOCATION: l..l5 (xi) S~YU~N~ DESCRIPTION: SEQ ID NO:23:
Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Ala Tyr Ala Glu Tyr Ala l 5 l0 15 (2) INFORMATION FOR SEQ ID NO:24:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 16 amino acids (B) TYPE: amino acid (C) STRANn~nNR~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:
(A) NAME/~EY: Peptide (B) LOCATION: l..16 (xi) S~:Qu~N~ DESCRIPTION: SEQ ID NO:24:
Asp Tyr Thr Gly Lys Ile Met Trp Thr Pro Pro Ala Ile Phe Lys Ser l 5 l0 15 (2) INFORMATION FOR SEQ ID NO:25:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 696 base pairs (B) TYPE: nucleic acid (C) STRANn~nN~SS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide W 095/16462 2 1 7 ~ 3 1 ~ PCTrUS94/14S42 (ix) FEATURE:
(A) NAME/REY: CDS
(B) LO QTION: 37..681 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:

Met Ser Pro Glu Ser Leu Ser Val Pro Glu Ser Met Ala Ser Leu Asn Cys Thr Ser Ser Asp Arg Asn Phe Gln Tyr Phe Trp Trp Tyr Arg Gln His Ser Gly Glu Gly Pro Lys Ala Leu Met Ser Ile Phe Ser Asp Gly Asp Lys Lys Glu Gly Arg Phe Thr Ala His Leu Asn Lys Ala Ser Leu His Val Ser Leu His Ile Arg Asp Ser Gln Pro Ser Asp Ser Ala Leu Tyr Phe Cys Ala Ala Ser Glu Pro Gly Tyr Gln Asn Phe Tyr Phe Gly Lys Gly Thr Ser Leu Thr go 95 100 Cys Ile Pro Asn Asp Ile Cln Asn Pro Glu Pro Ala Val Tyr Gln Leu ~ys Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe W O 95/16462 ~ ~ 7 ~ O 1 8 PCTrUS94/14542 Asp Ser Gln Ile Asn Val Pro Ly9 Thr Met Glu Ser Gly Thr Phe Ile ACT GAC AAA ACT GTG CTG GAC ATG AAA GCT ATG GAT TCC AAG AGC~AAT 534 Thr Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gln (2) INFORMATION FOR SEQ ID NO:26:
(i) S~yU~N~: CHARACTERISTICS:
(A) LENGTH: 215 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein WO 95/16462 2 1 7 ~ O t 8 PCT/US94/14S42 (xi) ~uu~ ; DESCRIPTION: SEQ ID NO:26:
et Ser Pro Glu Ser Leu Ser Val Pro Glu Ser Met Ala Ser Leu Asn ys Thr Ser Ser Asp Arg Asn Phe Gln Tyr Phe Trp Trp Tyr Arg Gln is Ser Gly Glu Gly Pro Lys Ala Leu Met Ser Ile Phe Ser Asp Gly Asp Lys Lys Glu Gly Arg Phe Thr Ala His Leu Asn Lys Ala Ser Leu His Val Ser Leu His Ile Arg Asp Ser Gln Pro Ser Asp Ser Ala Leu yr Phe Cys Ala Ala Ser Glu Pro Gly Tyr Gln Asn Phe Tyr Phe Gly ys Gly Thr Ser Leu Thr Cys Ile Pro Asn Asp Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile Thr Asp Lys Thr Val Leu Asp Met Lys Ala et Asp Ser Lys Ser Asn Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser he Thr Cys Gln Asp Ile Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gln W 095/16462 2 1 7 9 0 1 8 PCTrUS94/14S42 (2) INFORMATION FOR SEQ ID NO:27:
(i) S~Q~N~ CHARACTERISTICS:
(A) LENGTH: 807 base pairs (B) TYPE: nucleic acid (C) STRANn~nN~S: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:
(A) NAME/KEY: CDS
(B) LOCATION: 1..804 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:

Met Lys Ser Leu Leu Ser Ser Leu Leu Gly Leu Leu Cys Thr Gln Val Cys Trp Val Lys Gly Gln Gln Val Gln Gln Ser Pro Ala Ser Leu Val Leu Gln Glu Gly Glu Asn Ala Glu Leu Gln Cys Asn Phe Ser Ser Thr Ala Thr Gln Leu Gln Trp Phe Tyr Gln Arg Pro Gly Gly Ser Leu Val Ser Leu Leu Tyr Asn Pro Ser Gly Thr Lys His Thr Gly Arg Leu Thr Ser Thr Thr Val Thr Lys Glu Arg Arg Ser Ser Leu His Ile Ser Ser Ser Gln Ile Thr Asp Ser Gly Thr Tyr Phe Cys Ala Met Glu Asp Thr Gly Ala Asn Thr Gly Lys Leu Thr Phe Gly His Gly Thr Ile Leu.Arg GTC CAT CCA AAC ATC CAG AAC CCA GAA CCT GCT GTG TAC CAG TTA A~A 432 Val Hls Pro Asn Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu Lys Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp TCC CAA ATC AAT GTG CCG A~A ACC ATG GAA TCT GGA ACG TTC ATC ACT 528 Ser Gln Ile Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe Ile Thr GAC A~A ACT GTG CTG GAC ATG AAA GCT ATG GAT TCC AAG AGC AAT GGG 576 Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly GCC ATT GCC TGG AGC AAC CAG ACA AGC TTC ACC TGC CA~ GAT ATC TTC 624 Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala ACG TTG ACC GAG A~A AGC TTT GAA ACA GAT ATG AAC CTA AAC m CAA 720 Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gln Asn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser (2) INFORMATION FOR SEQ ID NO:28:
( i ) S~U~N~ CHARACTERISTICS:
(A) LENGTH: 268 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:
Met Lys Ser Leu Leu Ser Ser Leu Leu Gly Leu Leu Cys Thr Gln Val ys Trp Val Lys Gly Gln Gln Val Gln Gln Ser Pro Ala Ser Leu Val Leu Gln Glu Gly Glu Asn Ala Glu Leu Gln Cys Asn Phe Ser Ser Thr Ala Thr Gln Leu Gln Trp Phe Tyr Gln Arg Pro Gly Gly Ser Leu Val Ser Leu Leu Tyr Asn Pro Ser Gly Thr Lys His Thr Gly Arg Leu Thr er Thr Thr Val Thr Lys Glu Arg Arg Ser Ser Leu His Ile Ser Ser er Gln Ile Thr Asp Ser Gly Thr Tyr Phe Cys Ala Met Glu Asp Thr ly Ala Asn Thr Gly Lys Leu Thr Phe Gly His Gly Thr Ile Leu Arg al His Pro Asn Ile Gln Asn Pro Glu Pro Ala Val Tyr Gln Leu Lys 217901~

Asp Pro Arg Ser Gln Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp er Gln Ile Asn Val Pro Ly~ Thr Met Glu Ser Gly Thr Phe Ile Thr sp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly Ala Ile Ala Trp Ser Asn Gln Thr Ser Phe Thr Cys Gln Asp Ile Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gln sn Leu Ser Val Met Gly Leu Arg Ile Leu Leu Leu Lys Val Ala Gly he Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser

Claims (45)

CLAIMS:

1. A method for modulating an immune response to an antigen, comprising contacting the antigen with an effective amount of TCR.alpha. chain specific for the antigen so that the TCR.alpha. chain modulates the immune response in an antigen-specific manner.

2. The method of Claim 1 in which the TCR.alpha. chain is contacted with the antigen in the presence of an accessory component.

3. The method of Claim 2 in which the accessory component comprises soluble factors produced by a stimulated T cell which, in the absence of TCR.alpha., has no immune modulatory effect.

4. The method of Claim 3 in which the accessory component comprises soluble factors produced by a stimulated T cell depleted of soluble TCR.alpha. chains.

5. The method of Claim 4 in which the accessory component is produced by a T cell hybridoma.

6. The method according to Claim 1, 2, 3, 4 or 5 in which the TCR.alpha. chain suppresses the immune response in an antigen-specific manner.

7. The method according to Claim 1, 2, 3, 4 or 5 in which the TCR.alpha. chain augments the immune response in an antigen-specific manner.

8. A method for augmenting an antigen-specific immune response suppressed by a TCR.alpha.
chain, comprising contacting the TCR.alpha. chain with an antibody specific for the TCR.alpha.
chain in an amount effective to bind the TCR.alpha. chain, thereby augmenting the immune response.

9. The method of Claim 8 in which the antibody is immobilized and the TCR.alpha. chain is removed.

10. The method of Claim 8 in which the antibody binds to the TCR.alpha. chain and neutralizes its activity.

I l. A method for augmenting an antigen-specific immune response suppressed by a TCR.alpha.
chain secreted by a T cell, comprising contacting the T cell with an antisense oligonucleotide complementary to the TCR.alpha. chain message, so that expression and secretion of the TCR.alpha. chain is inhibited.

12. The method of Claim 11 in which the antisense oligonucleotide complements the variable region of the TCR.alpha. chain message.

13. A method for detecting in a body fluid a soluble antigen-specific TCR.alpha. chain which modulates an immune response to the antigen, comprising:

(a) exposing a test culture of spleen cells containing the antigen coupled to a lysable carrier, to a sample suspected of containing the TCR.alpha. chain in the presence of the accessory component for a time sufficient for an immune response to occur as indicated by PFC generation; and (b) comparing the PFC generation in the test culture with a control culture without sample, in which a decrease in PFC generation as compared to the control indicates the presence of a TCR.alpha. chain that suppresses the immune response in an antigen-specific manner and an increase in PFC generation as compared to the control indicates the presence of a TCR.alpha. chain that augments the immune response in an antigen-specific manner.

14. The method of Claim 13, in which the TCR.alpha. chain suppresses the immune response in an antigen-specific manner.

15. The method of Claim 13, in which the TCR.alpha. chain augments the immune response in an antigen-specific manner.

16. A purified TCR.alpha. chain which is capable of binding to an antigen and which modulates an immune response to the antigen as evaluated in an in vitro assay system comprising:

(a) exposing a test culture of spleen cells containing the antigen coupled to a lysable carrier, to the purified TCR.alpha. chain in the presence of the accessory component, for a time sufficient for an immune response to occur as indicated by PFC
generation; and (b) comparing the PFC generation in the test culture with a control culture without the purified TCR.alpha. chain, in which a decrease in PFC generation as comparedto the control indicates that the TCR.alpha. chain suppresses the immune response in an antigen-specific manner, and an increase in PFC generation as compared to the control indicates that the TCR.alpha. chain augments the immune response in an antigen-specific manner.

17. The purified TCR.alpha. chain of Claim 16 which supresses the immune response in an antigen-specific manner.

18. The purified TCR.alpha. chain of Claim 16 which augments the immune response in an antigen-specific manner.

19. A substantially pure fusion polypeptide of the formula:
R1-[X1]-R2; wherein R1 is a carrier peptide, X1 is a proteolytic enzyme recognition sequence and R2 is a polypeptide encoded by a structural gene.

20. The fusion polypeptide of claim 19, wherein the carrier peptide is calmodulin.

21. The fusion polypeptide of claim 19, wherein the polypeptide encoded by the structural gene is T-cell receptor alpha (TCR.alpha.) chain.

22. The fusion polypeptide of claim 21, wherein the TCR.alpha. chain is the extracellular membrane domain of the polypeptide.

23. The fusion polypeptide of claim 19, wherein the proteolytic enzyme recognition sequence is recognized by thrombin.

24. The fusion polypeptide of claim 23, wherein the proteolytic enzyme recognition sequence is Lys-Val-Pro-Arg-Gly (SEQ ID NO: 1).

25. An isolated polynucleotide sequence which encodes the fusion polypeptide of claim 19.

26. A recombinant expression vector containing the polynucleotide sequence of claim 25.

27. The vector of claim 26, wherein the vector is a virus.

28. The vector of claim 26, wherein the vector is a plasmid.

29. The vector of claim 28, wherein the vector contains a phenotypic selection marker DNA
sequence.

30. The method of claim 29, wherein the phenotypic selection marker is selected from the group consisting of beta-lactamase and chloramphenicol acetyltransferase.

31. A host cell containing the vector of claim 26.

32. The host cell of claim 31, wherein the host cell is eukaryotic.

33. The host cell of claim 31, wherein the host cell is prokaryotic.

34. The host cell of claim 33, wherein the prokaryotic cell is selected from the group concicting of Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa.

35. A method of producing substantially pure, biologically active TCR.alpha. chain which comprises:
(a) culturing a host cell transformed with a vector containing in operable linkage, a polynucleotide sequence encoding TCR.alpha. chain; and (b) isolating the substantially pure, biologically active TCR.alpha. chain.

36. The method of claim 35, wherein the polynucleotide encoding TCR.alpha. chain is operably linked to a polynucleotide encoding a polypeptide of the formula:
R1-[X1]; wherein R1 is a carrier peptide and X1 is a proteolytic enzyme recognition sequence.

37. The method of claim 36, wherein the carrier peptide is calmodulin.

38. The method of claim 36, wherein the proteolytic enzyme recognition sequence is recognized by thrombin.

39. The method of claim 38, wherein the plolease cleavage sequence is Lys-Val-Pro-Arg-Gly (SEQ ID NO: 1).

40. The method of claim 35, wherein the TCR.alpha. chain is the extracellular membrane domain of the polypeptide.

41. The method of claim 36, further comprising cleaving the TCR.alpha. chain portion from the fusion peptide.

42. A pharmaceutical composition comprising immunosuppressive amounts of substantially purified TCR.alpha. chain and a pharmaceutically inert carrier.

43. The pharmaceutical composition of claim 42, wherein the TCR.alpha. chain is the extracellular membrane domain.

44. The method of any of claims 1, 8, or 13, wherein the TCR.alpha. chain is the extracellular membrane domain.

45. The TCR.alpha. chain of claim 16, wherein the TCR.alpha. chain is the extracellular membrane domain.