EP0737076A1 - Method for antigen-specific immunoregulation by t-cell alpha chain - Google Patents

Abstract

Methods for modulating immune responses in an antigen-specific fashion are disclosed. The methods utilize soluble TCRα chains which are capable of binding to the antigen, and which, in the presence of an accessory component, suppress the immune response in an antigen-specific manner. The use of TCRα chains which demonstrate such activity in therapeutic protocols for treating hyperimmune and immunodeficient conditions is described.

Description

METHOD FOR ANTIGEN-SPECIFIC IMMUNOREGULATION BY T-CELL ALPHA CHAIN

This application is a continuation-in-part of application Serial No. 07/752,820, filed August 30, 1991.

BACKGROUND OF THE INVENTION

1. Field of the Invention

This invention relates to methods for regulating the immune system in an antigen-specific manner. T cell receptor alpha chains which are capable of binding to an antigen of interest are utilized in protocols designed for the suppression or augmentation of the immune response to the particular antigen. The therapeutic protocols described herein may be used in the treatment of allergy, autoimmunity, graft rejection and cancer.

2. Description of Related Art

Immunologists and others have long studied the immune system in an attempt to find a mechanism for regulating the immune response. To this end, various drugs or protocols are utilized which either depress or augment the immune response in toto in a non-specific fashion.

However, this type of regulation is unsatisfactory because it affects the entire immune system. It is not based on an understanding of the particular components of the immune system that would permit regulation of an immune response to only specific antigens. For example, in the treatment of allergies it would be advantageous to selectively suppress an immune response to a particular allergen without depressing the individual's entire immune system. The invention described and claimed herein, which is based, in part, on the discovery that soluble T cell receptor alpha chains, are antigen-specific mediators of the immune response, relates to methods of using those T cell receptor alpha chains for either suppressing or augmentating the immune response to specific antigens. 2A REGULATION OF THE IMMUNE RESPONSE

The introduction of a foreign antigen into an individual elicits an immune response consisting of two major components, the cellular and humoral immune responses, mediated by functionally distinct populations of lymphocytes known as T and B cells, respectively. T cells respond to antigen stimulation by producing lymphokines which "help" or activate various other cell types in the immune system. In addition, certain T cells can become cytotoxic effector cells. On the other hand, the B cell response primarily consists of their secretory products, antibodies, which directly bind to antigens. Helper T cells (T_H) can be distinguished from cytotoxic T cells and B cells by their cell surface expression of a glycoprotein maker termed CD4. Although the mechanism by which CD4⁺ helper T cells regulate other cell types has not been fully elucidated, the role of certain subsets within the CD4⁺ T cell compartment has been investigated (Mosmann and Coffman, 1989, Ann. Rev. Immunol. 7:145-173). Type 1 helper cells (T_H1) produce interleukin-2 (IL-2) and γ-interferon upon activation, while type 2 helper cells (T^) produce IL-4 and IL-5. Based on the profile of lymphokine production, T_H1 appear to be involved in promoting the proliferation of other T cells, whereas T_m factors specifically regulate B cell proliferation, antibody synthesis, and antibody class switching. Furthermore, these two T_H populations may regulate each other since γ-interferon produced by T_H, inhibits the proliferation and function of T ^l H_M2-

A salient feature of both B and T cell responses is their exquisite specificity for the immunizing antigen, however, the mechanisms for antigen recognition differ. Antibodies bind directly to antigens on a solid surface or in solution, whereas T cells only react with antigens that are present on a solid phase such as the surfaces of antigen-presenting cells. Additionally, the antigens must be presented to T cells in the context of major histocompatibility complex (MHC)-encoded class I or class II molecules. The MHC refers to a cluster of genes that encode proteins with diverse immunological functions. Class I gene products are found on all cells and they are the targets of major transplantation rejection responses. Class II gene products are mostly expressed on cells in various hematopoietic lineages and they are involved in cell-cell interactions in the immune response. Both Class I and Class II proteins have been shown to also function as receptors for antigens on the surface of antigen-presenting cells. Another level of complexity in the interaction between a T cell and an antigen is that it occurs only if the haplotype (the combination of all alleles within the complex) of the MHC is the same between that of the antigen-presenting cells and the responding T cells. Thus, a T cell specific for a particular antigen would respond only if the antigen is presented by cells expressing a matching MHC. This phenomenon is known as MHC-restriction.

In 1970, Gershon and Kondo (Gershon and Kondo, 1970, Immunology U5:723) proposed that T cells could also negatively influence the course of an immune response. Although this concept of immune regulation was initially met with skepticism, it eventually became accepted by the majority of immunologists as it provided a conceptual framework for the maintenance of homeostasis in the immune system after an antigen had been eliminated by a given immune response and a continued response was no longer necessary. Since then, antigen-specific suppressor T cells (Ts) have been reported in a wide variety of experimental systems (Green et al., 1983, Ann. Rev. Immunol. 1:439-463; Dorf and Benacerraf, 1984, Ann. Rev. Immunol. 2:127-158).

Attempts to delineate the mechanism of Ts action led to the discovery of a number of soluble mediators in T cell culture supernatants. It was therefore postulated that Ts functioned through the release of T suppressor factors (TsF) which then acted on other T and B cells. Elaborate models had been proposed based on experimental data to illustrate the complex interactions between different Ts subsets and their TsF (Asherson et al., 1986, Ann. Rev. Immunol. 4:37-68).

Since specific cell surface markers had been identified for distinct functional subsets of T cells, a search for unique markers for Ts and their TsF was undertaken. A study of Ts surface phenotype first showed that they expressed CD8 (Lyt-2), a marker shared by T cells with cytotoxic potential. In 1976, an antiserum was reported that appeared to react with a structure specifically expressed by Ts in mice (Murphy et al., 1976, J. Exp. Med. 144:699; Tada et al., 1976, J. Exp. Med. 144:713). Mapping studies of the gene encoding the antigen localized it to the I region between I-Eα and I-Eβ within the murine MHC. This locus was called l-J. In the early 1980's, the field of cellular immunology began to move from phenomenology to molecular characterization. This transition resulted in a number of discoveries such as the characterization of the T cell receptor (TCR) (See Section 2.2, infra., the identification of various lymphokines, and the elucidation of the three dimensional structure of MHC proteins. However, application of molecular cloning techniques to the study of T cell-mediated suppression did not yield fruitful insights. For instance, attempts to biochemically purify TsF to homogeneity had been largely unsuccessful. When the genes of the I region of the mouse MHC were isolated and sequenced, there did not appear to be enough DNA between I-Eα and I-Eβ to account for the l-J gene. Moreover, when a large panel of T cell clones and T cell hybridomas were examined for TCR β gene rearrangements, only helper and cytotoxic T cells contained such rearrangements while all Ts tested were negative, indicating that Ts might not express functional receptors (Hedrick et al., 1985, Proc. Natl. Acad. Sci. USA £2:531-535).

2_.1. STRUCTUREANDFUNCTIONOFTHETCELLRECEPTOR

The specificity of T and B cell responses for antigen is a function of the unique receptors expressed by these cells. Progress in the study of the B cell receptor advanced rapidly when it was found that B cells secreted their receptors in the form of antibodies. Plasmacytomas are naturally-occurring tumors of antibody-producing cells that are monoclonal in origin. These tumors provided a continuous source of homogeneous proteins which were used in the initial purification and characterization of the structure of the antibody molecule (Potter, 1972, Physiol. Res.52:631-710). It has now been proven that antibodies are identical to their membrane-bound counterparts except that the cell surface form contains a domain for transmembrane anchoring (Tonegawa, 1983, Nature 21)2:575-581).

Early work on the TCR, on the other hand, failed to detect a secretory form of the TCR and, therefore, the approaches used with soluble antibodies could not be effectively employed. In addition, the discovery of MHC-restriction in T cell recognition of antigen added another level of difficulty to the analysis of the TCR (Zinkernagel and Doherty, 1974, Nature 248:701-702). At that time it was debatable whether a single TCR could account for binding to both antigen plus MHC or two separate receptors were involved. However, what seemed clear was that the TCR was unlikely to be identical to the B cell receptor.

The advent of the development of monoclonal antibodies, recombinant DNA technology and methods for long-term culture of antigen-specific T cells greatly facilitated the identification of the TCR in the 1980's. Monoclonal antibodies generated against clonal populations of T cells were found to specifically react with only the immunizing T cells (Allison et al., 1982, J. Immunol. 122:2293; Haskin et al. 1983, J. Exp. Med. 15J:1149; Samelson et al., 1983, Proc. Natl. Acad. Sci. USA £Q:6972). The use of these clonally-specific antibodies to immunoprecipitate T cell membranes revealed a 46,000 dalton molecular weight band by SDS- PAGE. Under non-reducing conditions, a 90,000 dalton band was detected suggesting a dimeric structure for the TCR. Subsequent experiments established that a functional TCR is a heterodimer composed of two disulphide-linked glycoproteins known as α and β (Marrack and Kappler, 1987, Science 23_8_: 1073- 1079). At about the same time, complementary DNA (cDNA) clones encoding the α and β chains were isolated in both human and mice (Hedrick et al., 1984, Nature 3_fi£:149-153; Hedrick et al., 1984, Nature 3J)8_:153-158; Yanagi et al., 1984, Nature

308:145-149.. Sequence analysis of the cDNA demonstrated that the coding sequences were made up of rearranged gene segments similar to that of antibodies. Transfer of the a and β genes into recipient cells was shown to be both necessary and sufficient to confer antigen specificity and MHC-restriction (Dembic et al., 1986, Nature 3_2Q:232-238). Thus, the heterodimeric TCR appears to be responsible for recognizing the combination of antigen and MHC. While some studies suggest that the α and β variable regions are skewed towards recognition of antigen and MHC, respectively (Kappler et al., 1987, Cell 49:263-271; Winoto et al., 1986, Nature 324:679- 682; Tan et al., 1988, Cell 54:247-261), other studies suggest that recognition is an emergent property of the entire receptor (Kuo and Hood, 1987, Proc. Natl. Acad. Sci. USA 84:7614-7618; Danska et al., 1990, J. Exp. Med. 172:27-33).

CD3 is a complex of polypeptides which are non-covalently linked to the TCR and which may be involved in transmembrane signalling events leading to T cell activation triggered by TCR occupancy (Clevers et al., 1988, Ann. Rev. Immunol. 6:629). Direct stimulation of CD3 with antibodies has been shown to mimic the normal pathways of T cell activation (Meuer et al., 1983, J. Exp. Med. 158:988). The transport of CD3 to the T cell surface requires its association with complete heterodimeric TCR complexes intracellulary. It has also been demonstrated that complexes of both TCR o and β chains and the CD3 polypeptides are assembled in the endoplasmic reticulum (Minami et al., 1987, Proc. Natl. Acad. Sci. USA 84:2688-2692; Alarcon et al., 1988, J. Biol. Chem. 236:2953-2961). The correctly formed complete receptors, TCR/CD3, are then transported to the cell surface as a functional unit. The incompletely assembled receptor complexes are transported through the Golgi to lysosomes where they become degraded. Therefore, unlinked α and β chains do not appear to normally gain access to the exterior of T cells. Even complete TCR α and β receptors are not readily detectable in secreted forms extracellularly. Heretofore, their function in antigen recognition was thought to be limited to the T cell surface and in the form of a heterodimer.

It is now clear that the α β TCR is expressed by the vast majority of functional T cells. Although a second type of TCR composed of γδ heterodimer has been identified, these receptors are expressed by a small percentage of peripheral T cells and their involvement in antigen-specific recognition is yet to be demonstrated. Structurally, the α β and γδ receptors of T cells are highly homologous to antibody molecules in primary sequence, gene organization and modes of DNA rearrangement (Davis and Bjorkman, 1988, Nature 3_3_4:395-402). However, the T cell antigen receptors are distinct from antibodies in two major aspects: TCR are only found at cell surfaces and they recognize antigens only in the context of MHC-encoded molecules.

2£ SOLUBLETCELLRECEPTORS

Recent studies suggest that the TCR may, in some occasions, be shed or released from cells (Guy et al., 1989, Science 244: 1477-1480; Fairchild et al., 1990, J. Immunol. 145:2001-2009). However, it has not been demonstrated whether such secreted molecules are complete TCR, partial fragments, or other molecules with TCR cross-reactive epitopes. Prior to the discoveries demonstrated by the examples described herein, the notion that functionally active TCRα chains could be released from T cells independently of the remaining TCR components was controversial and met with skepticism. Klausner and colleagues (Bonifacino et al., 1990, Science 242:79-82) have shown that TCRα is retained and degraded in the endoplasmic reticulum unless complexed with CD3δ, and further (Minami et al., 1987, Proc. Natl. Acad. Sci. USA £4:2688- 2692) that TCRα that is not exported to the cell surface as part of the CD3-TCR complex is degraded in lysosomes. These observations argue against a pathway whereby TCRα might be released from cells. Studies on TCRβ, which is similarly retained and degraded in the endoplasmic reticulum (Wileman et al., 1990, Cell Regulation 1:907-919), suggest that the assembly and transport of TCR is more complex. For example, in SCID mice expressing a TCRβ transgene, TCRβ is expressed on the surface of immature thymocytes in the absence of TCRα or CD3 components (Kishi et al., 1991, EMBO J. ϋ_:93-100). Further, a truncated TCRβ chain gene has been constructed, including only VDJ and the Cβ, domain, that is secreted despite the expectation that such a molecule should be degraded (Gascoigne, 1990, J. Biol. Chem.265:9296- 9301). Thus, the possibility existed that in some cells, TCR might be released in small quantities, possibly in a complex with other unidentified molecules and/or in a post-translationally truncated form.

A number of experimenters reported the presence of an unidentified soluble regulatory factor or factors which reacted with antibodies to TCRα. For example, a cell free immunoregulatory activity was detected in an vitro assay of a CD4⁺ helper T cell hybridoma, A 1.1 , specific for a synthetic polype ^de antigen, poly 18, plus I-A^d; the antigen fine specificity of the factor corresponded to that of the T cell hybridoma (Zheng et al., 1988, J. Immunol. 140:1351-1358). Antisense oligonucleotides corresponding to TCR Vα and Vβ were found to specifically inhibit cell surface TCR-CD3 expression, but only antisense for Vα and not Vβ (or control oligonucleotides) inhibited the production of the soluble regulatory activity of A 1.1 (Zheng et al., 1989, Proc. Natl. Acad. Sci. USA 86: 3758-3762). In a very recent study, the antigen-specific regulatory activity of A 1.1 was bound and eluted from a monoclonal antibody column specific for TCR α and resolved as a 46,000 dalton molecular weight protein from metabolically-labeled supernatants; the activity was not bound by anti-TCRβ, anti-TCR Vβ, or anti-CD3e antibodies (Bissonnette et al., 1991, J. Immunol. 146:2898-2907). Ts activities not derived from surface TCR, although sharing TCRα-chain determinants, were reported but not characterized (Collins et al., 1990, J. Immunol. 145:2809-2812). Takada (1990, J. Immunol. 145: 2846-2853) also reported a Ts activity which shared TCRα-chain determinants, but which was MHC restricted. In contrast to these results, Fairchild ( 1990, J. Immunol. 145 :2001 -2009) reported a DNP-specific Ts factor which reacted with anti-TCR Cα but which also reacted with anti-Vβ and anti-TCR-β antibodies. Prior to the discoveries described herein, no one had identified or elucidated the role of TCRα as a soluble, immunoregulatory mediator responsible for the observed antigen-specific regulatory activity.

Three main strategies, which replace or delete the TCR transmembrane region, have been attempted for the production of soluble TCR molecules. In the most straightforward approach, translational termination codons were introduced upstream of the TCRα or TCRα/β dimers. In cDNA-transfected COS-1 cells, COS-7 cells or Hela cells, TCRα has been reported to be rapidly degraded in a nonlysosomal compartment before entering the Golgi apparatus (Wileman, et al, J. Cell. Biol, lϋ):973-986, 1990; Lippincott-Schwartz, etal, Cell,5A:209-22Q, 1988; Baniyash, et al, J. Biol. Chem., 261:9874-9878, 1988; Bonifacino, et al, Science, 247:79-82, 1990; Bonifacino, et al, Cell, ≤3_:503-513, 1990; Manolios, et al, Science, 249:274-277, 1990; Shin, et al, Science, 2i2: 1901 - 1904, 1993). In the second strategy, the extracellular V and C domains of the TCRα and β chains have been shuffled to the glycosyl-phosphatidylinositol membrane anchor of the placental alkaline phosphatase or Thy-1 molecules (Lin, et al, Science, 249:677- 679, 1990; Slanetz, et al, Eur. J. Immunol, 21:179-183, 1991). The corresponding lipid-linked TCR polypeptides were released from the membrane in soluble form by treatment of the cells with phosphatidylinositol-specific phospholipase C, and the solubilized TCRαβ heterodimers were shown to react specifically with an anti-clonotypic monoclonal antibody. However, the yield of released TCR polypeptides was too low to apply this molecule for clinical use. The third approach was to engineer hybrid proteins of TCR with immunoglobin constant region (Gregoire, et al, Proc. Natl. Acad. Sci., USA, £8:8077-8081, 1991; Weber, et al, Nature, 356:793-796. 1992) and CD3 zeta chain (Engel, etal, Science, 25J>:1318-1321, 1992). These fusion proteins were secreted into the medium by transfection of myeloma cells or leukemic cells, and these soluble TCRs were shown to retain all serologically detected epitopes of the corresponding cell- surface-bound TCR. However, these fusion proteins showed low-affinity recognition of antigens and may be immunogenic. In addition, the functional expression of TCRα chain alone has never been successful.

The expression of TCR in E. coli was reported previously by using a fusion protein of Vα and Vβ polypeptide (Soo Hoo, et al, Proc. Natl. Acad. Sci. USA, £2:4759-4763, 1992). However, only 1% of protein could be recovered as refolded protein. In the present invention, the yield of refolded protein is as much as typical soluble proteins such as cytokines, which will make it possible to provide homogeneous TCRα molecule for clinical use.

In order to express the animal proteins in E. coli, various systems have been developed by many investigators. However, a number of difficulties are frequently encountered when expressing heterologous genes in this organism. For example, the significant differences between E. coli and animal genes, both in their patterns of codon usage and in their translation initiation signals, may interfere with the efficient translation of animal mRNA on bacterial ribosomes (Orormo, et al, Nucl. Acids Res. 10:2971-2996, 1982). Alternatively, heterologous proteins synthesized in E. coli may fail to accumulate to significant levels due to the activity of the host cell proteases (Gottesman., Annu. Rev. Genet. , 21: 163- 198, 1989). In addition, the physical characteristics of therapeutical ly useful proteins can cause problems, since some secreted molecules or membrane as „ - ciated molecules such as TCR require glycosylation and disulfied-crosslinking for both stability and solubility. Since such stabilizing processes are not available in the bacterial cytoplasm, heterologous proteins produced within E. coli often form insoluble aggregates known as "inclusion bodies" (Schein, et al, Bio/Technology, 7: 1141-1149, 1989). The present invention provides methods to express truncated form of TCRα polypeptide in inclusion body in E. coli and to refold and purify biologically active TCRα. 2,. SUMMARY OF THE INVENTION

The present invention relates to methods which utilize the TCRα chain for modulating an immune response in an antigen-specific manner. TCRα chains that demonstrate the following two important characteristics, which can be evaluated in vitro, are selected for production and use in the practice of the invention: TCRα chains used in the method of the invention must be capable of binding to the antigen of interest, and in the presence of an accessory component described herein, modulate the specific immune response generated against that antigen, L≤., by suppressing or augmenting the antigen-specific immune response.

The TCRα chains which demonstrate such properties may be used advantageously in protocols described for the down-regulation or up-regulation of the antigen-specific immune response in vivo in human or animal subjects or in vitro. For example, in patients with hyperimmune responses, e.g.. allergies, autoimmune diseases, or graft rejection, an effective dose of TCRα chain specific for the responsible antigen which, in the presence of the accessory component, suppresses the antigen-specific immune response can be administered in vivo. Conversely, body fluids of an immunosuppressed patient can be tested for the presence of soluble TCRα chains that exhibit immunosuppressive effects. Augmentation of the patient's immune response for the antigen may be achieved by removal or neutralization of the soluble TCRα chains using antibodies specific for the TCRα chain, or antisense oligonucleotides that inhibit the expression of the TCRα chain.

In vitro assays which can be used to evaluate the TCRα chains used in the invention are described herein. For example, a number of immunoaffinity techniques may be used to evaluate antigen binding, and a plaque forming cell (PFC) assay, described in detail infra, (hereinafter referred to as the "PFC assay") may be used to evaluate the regulatory function of the TCRα chain tested. Briefly, in this PFC assay, the TCRα chain to be tested is added, in the presence of an accessory component, to a spleen cell culture containing the antigen of interest coupled to an immunogenic, lysable carrier, such as xenogeneic red blood cells. The immunoregulatory effect of the TCRα chain is evaluated by assessing the immune response which is generated over the course of a few days, as indicated by the generation of plaque forming cells in the culture. That is, the immune response generates cells that produce complement-fixing antibodies against the carrier (e.g.. red blood cells), and these cells can be detected via an assay in which the cells are mixed with complement and the carrier (s^ red blood cells) and formed into a monolayer. Lysis of the carrier results in the formation of one clear plaque, corresponding to the presence of one plaque forming cell (PFC). Inhibition of the generation of PFC in the culture indicates suppression of the immune response, mediated by the TCRα chain specific for the coupled antigen. As explained in greater detail, infra, the accessory component used in the assay is prepared from stimulated T cell supernatants depleted of soluble factors, such as TCRα chains, that directly bind to the antigen used to stimulate the T cells. The accessory component in and of itself, has no effect on an immune response unless the TCRα chain is present.

The invention is based, in part, on the discovery of a soluble TCRα chain which is constitutively secreted by a T cell hybridoma. As demonstrated in the working examples, this secreted TCRα chain is capable of directly binding to its antigen and, in the presence of accessory component, suppresses the immune response which would normally be generated against the antigen.

However, the invention is not limited to the use of naturally secreted TCRα chains, since any TCRα chain gene can be cloned, expressed and the gene product tested for its suitability in the practice of the invention using the techniques and methods described herein. In addition, the assays described herein may be used to evaluate other molecules, &g., antibodies, other TCR components, which demonstrate an immunoregulatory function in an antigen-specific manner.

In one embodiment of the invention, a new fusion gene expression system based on the use of rat calmodulin as fusion partner is provided. The system can be preferably used for the high expression and purification of TCRα protein having biological activities. The expression of rat calmodulin in E. coli has been successful by employing an expression vector containing the E. coli trp promoter and trpA terminator (Matsuki, et al, Biotech, Appl. Biochem., 12:284-291,

1990). In this system, the rat calmodulin cDNA was modified so as to delete the 5'-nontranslated sequence and to incorporate a consensus sequence for the E. coli ribosome-binding site. Several codons for the N-terminal amino acids were selected to fit the E. coli consensus nucleotide sequence around the translation initiation codon. By inducing expression in E. coli, soluble rate calmodulin accounted for over 30% of total cellular proteins. About 100 mg of recombinant calmodulin of 90% purity was obtained from 1 liter of culture by using phenyl-Sepharose column chromatography. In order to fuse TCRα gene at the 3'-end of rat calmodulin gene in this invention, additional sequence encoding protease cleavage site, Lys-Val-Pro-Arg-Gly (SEQ ID

NO: 1), recognized by thrombin (Chang, Eur. J. Biochem., lϋ:217-224, 1985) is inserted at the C-terminus of calmodulin. This device makes it possible to cleave off the TCRα protein for many reasons: 1) the expression level is high, 2) the fusion protein is expressed as soluble form 3) purification of the protein is surprisingly easy, 4) individual refolding process for each TCRα protein is not necessary.

4,. BRIEF DESCRIPTION OF THE DRAWINGS

FIGURE IA and B. A T cell hybridoma, 3-1-V, produces an accessory component which mediates immunoregulatory activity in the presence of antigen-specific TCRα chain from Al.l cells.

FIGURE 2. The complete nucleoi ie sequence of the TCRα gene isolated from Al.l cells. The constant region of the gene is underscored (SEQ ID NO: 14).

FIGURE 3. Gene transfer of TCRα from Al.l cells to 175.2 cells (175.2-Al.lα) transfers the ability to produce an antigen-specific regulatory activity. (A) Expression of CD3 on 175.2 cells before and after the transfer of Al.l TCRα. Antigen-specif regulatory activity in Al.l and 175.2-A 1.1 α supernatants in the presence of (B) relevant antigen, (C) carrier (SRBC) alone, and

(D) irrelevant control antigen (SEQ ID NO: 15).

FIGURE 4. Peptides used in testing the regulatory activity of TCRα chain from hybridoma Al.l (SEQ ID NOS: 16, 17, 18, 19, 20, 21, 22, 23 and 24).

FIGURE 5. The immunoregulatory activity produced by Al.l cells is neutralized by an antibody to TCRα chain.

FIGURE 6 (A) and (B). Expression of CD3 on FIGURE 6 (A) AF5 and FIGURE 6 (B) AF6 cells (two subclones of 175.2) after the transfer of Al.l TCRα and selection with anti-CD3 antibodies.

FIGURE 7A and B. Gene transfer of TCRα from BB19 cells to 175.2 cells does not transfer the ability to produce an antigen-specific immunoregulatory activity as shown by an anti-SRBC PFC assay.

FIGURE 8 Gene transfer of TCRα from Al.l cells to B9 cells (B9-A1.1 α) transfers the ability to produce an antigen-specific regulatory activity. FIGURE 9. The regulatory activity released from B9-A1.1 α is bound by anti-TCRα and displays same antigen-specificity as the activity from Al.l cells.

FIGURE 10A and B. Expression of the Al.l TCRα in cells lacking TCRβ is sufficient for production of the antigen-specific regulatory activity.

FIGURE 1 IA. Antigen-specific binding activity in supematants of Al.l and other cell lines expressing Al.l TCRα.

FIGURE 1 IB. Competition of antigen-specific binding activity in supematants of Al.l and other cell lines expressing Al.l TCRα by peptides.

FIGURE 12. SDS-PAGE of in YittQ translated Al.l TCRα and β polypeptides.

FIGURE 13A and B. The regulatory activity of Al.l TCRα gene product translated in vitro is bound by anti-TCRα and not anti-TCRβ.

FIGURE 14. The complete nucleotide sequence and deduced amino acid sequence of Al.l TCRα cDNA is shown (SEQ ID NOS: 25 and 26).

FIGURE 15. The complete nucleotide and deduced amino acid sequence of 3B3-derived TCRα cDNA is shown (SEQ ID NOS: 27 and 28).

FIGURE 16. The expression plasmid pST811 which carries a trp promoter and a trpA terminator is shown.

FIGURE 17. The expression plasmid pST811-A1.1 TCRαS5 is shown.

FIGURE 18. The expression plasmid pTCAL7 which carries rat calmodulin cDNA and a trp promoter is shown. FIGURE 19. The expression plasmid pCFl which carries rat calmodulin and a trp promoter and contains additional cloning sites from pTCAL7 is shown.

FIGURE 20. The expression plasmid pCFl-3B3TCRα is shown.

FIGURE 21. SDS-PAGE of E. coli produced calmodulin-TCRα from two expression plasmids is shown.

FIGURE 22. SDS-PAGE of E coli expressed Al.l TCRαS5 protein.

FIGURE 23. SDS-PAGE of E. coli expressed 3B3TCRα (calmodulin-TCRα fusion protein).

FIGURE 24a. The immunosuppressive activity of recombinant Al.l TCRαS5 was dose dependent.

FIGURE 24b. The immunosuppressive activity of recombinant Al.l TCRα S3 was dose dependent.

FIGURE 25. Immunosuppressive activity of the TCRα chain was observed when poly- 18 or EYKEYAEYAEYAEYA (SEQ ID NO: 2) was used.

5,. DETAILED DESCRIPTION OF THE INVENTION

The present invention involves the use of antigen-binding α chains of the T cell antigen receptors in the regulation of antigen-specific immune responses. In accordance with one aspect of the invention, a TCRα chain is evaluated for its ability to bind antigen and to modulate the immune response specific for that antigen. In vitro assays are described herein which can be used for this purpose. TCRα chains which demonstrate appropriate activity can be produced in quantity, for example, using recombinant DNA and/or chemical synthetic methods and may be used to down- regulate or up-regulate the immune response to a specific antigen. For example, hypersensitivity reactions, autoimmune responses and graft rejection responses may be suppressed using TCRα chains which are specific for the corresponding antigens, and which induce antigen-specific suppression. Alternatively, immunity to an antigen may be augmented by the removal of such α chains, or by inhibiting production of such α chains in a subject to specifically enhance the immune response to a particular antigen. Conversely, TCRα chains that augment the immune response to an antigen may be identified and utilized.

The invention is based, in part, on the discovery of a secreted form of TCRα chain which directly binds to antigen and suppresses the immune response generated against that antigen. In particular, a CD4⁺ helper T cell hybridoma, Al.l, is described, specific for a synthetic polypeptide antigen, poly 18, plus I-A^d which contitutively releases a secreted form of its TCRα chain that binds to antigen, and in the presence of appropriate accessory component, inhibits the immune response to the antigen. The isolation of the Al .1 TCRα chain gene and its transfer into poly 18 non-reactive T cell lines described herein (see Section 6, infra) and the demonstration that the product of in vitro transcription and translation of the Al .1 TCRα chain gene mediates this regulatory activity (see Section 7, infra) demonstrate that the TCRα chain gene, not the TCRβ chain gene, is responsible for encoding the regulatory factor which directly binds antigen and mediates a regulatory function.

The production of a TCRα chain and its use as an antigen-specific immunoregulatory agent are fully described and exemplified in the sections below. S _. PRODUCTIONOFTCRALPHACHAIN

The present invention relates to TCRα chains (not the complete T cell surface antigen receptor of α and β) possessing both antigen-binding and immunoregulatory activities. An antigen- binding TCRα protein with antigen-specific regulatory activity may be produced in a variety of ways. For example, expression of TCRα chain protein may be achieved by recombinant DNA technology and/or chemical synthetic techniques based on known amino acid sequences. Alternatively, the TCRα chain may be purified directly from culture supematants of continuous T cell lines that release this activity.

5.1.1. EVALUATION OF TCR ALPHA CHAINS Regardless of the method used to produce such TCRα chains, the antigen binding capability and immunoregulatory activity of the molecule should be evaluated. For example, the ability of the TCRα chain to directly bind to an antigen of interest may be evaluated by modified immunoassay techniques including, but not limited to ELISA (enzyme-linked immunosorbent assay), immunoprecipitation, Western blots, or radioimmunoassays in which the TCRα chain is substituted for the antibody normally used in these assay systems.

The immunoregulatory capability of the antigen-binding TCRα chain may be evaluated using any assay system which allows the detection of an immune response in an antigen-specific fashion. For example, the PFC assay as described and exemplified herein may be utilized to identify TCRα chains that suppress immune responses directed toward a particular antigen. When spleen cells are cultured in the presence of a highly immunogenic carrier, such as sheep red blood cells

(SRBC), an immune response occurs which results in the generation of plaque forming cells. The number of PFC generated per culture is assessed by mixing the cultured spleen cells with SRBC (or appropriate lysable carrier) and complement, and culturing the mixture as a monolayer. Cells surrounded by a clear plaque (e.g.. of lysed red cells) are counted as PFCs. Inhibition of PFC generation in the spleen cell culture, Lg., a reduction in the number of PFC/culture, indicates suppression of the immune response. In order to test TCRα chains for suppressive activity, and to ensure that the suppression is antigen specific, the PFC assay may be conducted as follows: the antigen of interest is coupled to SRBC (Ag-SRBC) and added to spleen cells from unimmunized mice. The immunoregulatory effect of a TCRα chain specific for the antigen is assessed by adding the TCRα chain to be tested to the culture in the presence of an accessory component described below (i.e.. the accessory component should be added to the culture prior to or simultaneously with the TCRα chain to be tested). Control cultures receive the TCRα chain in the absence of accessory component or vice versa, or may involve the use of an irrelevant antigen. Following culture, the number of PFC/culture is assessed for each condition. An inhibition of PFC generation in the test cultures, as compared to that observed in the controls, indicates that the TCRα chain tested suppresses, in an antigen-specific manner, the immune response which is normally generated in the culture system.

The accessory component used in the test system comprises the supernatant of stimulated T cells depleted of any soluble factors, including TCRα chains, that directly bind to the antigen which was used to stimulate the T cells, so that the accessory component in and of itself does not suppress immune responses. The accessory component is produced from T cells stimulated in vivo with the carrier/indicator used in the antigen-specific PFC assay. For example, the following procedure may be used to prepare accessory component for use in the PFC assay system described above in which Ag-SRBC is the target. Spleen cells derived from SRBC- immunized mice are depleted of B cells, and the enriched T cells are cultured or used to generate T cell hybridomas that can be used as a reproducible, continuous supply of culture supernatant. The supematants of the T cell cultures are tested for their ability to inhibit an anti-SRBC immune response using a PFC assay in which SRBC are added to cultured spleen cells in the presence or absence of the T cell supematants. The T cell culture supematants which are found to inhibit the anti-SRBC response are then adsorbed with SRBC to remove any soluble factors, such as soluble TCRα chains, which bind directly to the SRBC. The adsorbed supematants are then tested for their ability to inhibit an anti-SRBC immune response using the PFC assay. Those adsorbed supematants which do not inhibit the anti-SRBC response are used as the accessory component in the PFC assay designed to identify TCRα chains that demonstrate antigen-specific immunosuppressive activity (i.e.. the PFC assays which utilize Ag-SRBC targets). Alternatively, T cell hybridomas may be generated that produce the accessory component without the need for an adsoφtion step; for example, hybridoma 3-1-V described in Section 8, infra (See FIG. 1) constitutively produces the accessory component in culture supematants. Thus, the accessory component contains one or more factors that, while not inhibitory on its own, allows an antigen- specific factor, L£., the TCRα chain, to suppress an immune response in an antigen-specific fashion. An example of such an assay system is set forth in Section 6.1.5 infra.

Conversely, TCRα chains which augment an immune response may be identified in a similar way. In such cases, an accessory component prepared from T cell hybridomas, or from T cell culture supematants that demonstrate increased PFC generation prior to adsoφtion and no activity after adsoφtion could be used in PFC assays designed to identify TCRα chains that augment the immune response against the Ag-SRBC in an antigen-specific manner.

Since the foregoing assay systems utilize unprimed spleen cell cultures to assess immune responses, and carrier-primed spleen cell cultures to prepare accessory component, they may be limited to the use of animal-derived sources for the cultured spleen cells (e.g.. mice, rats, rabbits, and non-human primates). However, this does not preclude their use for testing the immuno¬ regulatory activity of human TCRα chains. Indeed a number of human immune functions can be tested in animal-based assay systems; £,£., human antibody effector functions, such as complement mediated lysis and antibody dependent cellular cytotoxicity can be demonstrated using animal serum and animal effector cells, respectively. However, it may be preferable to modify the PFC assay described above using human cell cultures in place of the animal spleen cell cultures. For example, the effect of a TCRα chain on the immune response to a particular antigen can be evaluated using the reverse hemolytic PFC assay described by Thomas et al.,

1980, J. Immunol. 125: 2402 (see also Thomas, 1982, J. Immunol. 128: 1386). Pokeweed mitogen stimulated T cell supematants may be used as a source of accessory component in this assay system.

5.1.2. SELECTION OF T CELLS Antigen-specific T cells which can serve as the source of the TCRα chains and/or the source of genetic material used to produce the TCRα chains used in the methods of the invention may be generated and selected by a number of in vitro techniques that are well-known in the art. A source of T cells may be peripheral blood, lymph nodes, spleens, and other lymphoid organs as well as tissue sites into which T cells have infiltrated such as tumor nodules. The T cell fraction may be separated from other cell types by density gradient centrifugation or cell sorting methods using antibodies to T cell surface markers such as CD2, CD3, CD4, CD8, etc. These methods include, but are not limited to panning, affinity chromatography, flow cytometry, magnetic bead separations. Negative selection procedures may also be employed to enrich for T cells by removing non-T cell populations using antibodies directed to markers not expressed by T cells or utilizing membrane properties of non-T cells such as adhesion to various substrates. Further selection of the T cell subsets of interest may apply the above-mentioned techniques using antibodies to more specific markers such as anti-CD4 and anti-CD8 in selecting for helper and cytotoxic/suppressor T cells, respectively or to markers expressed on T cell subsets such as memory cells.

Antigen-specific T cell lines may be generated in vitro by repetitive stimulation with optimal concentrations of specific antigens in the presence of appropriate irradiated antigen-presenting cells and cytokines. Antigen-presenting cells should be obtained from autologous or MHC- matched sources and they may be macrophages, dendritic cells, Langerhans cells, EBV- transformed B cells or unseparated peripheral blood mononuclear cells. Cytokines may include various interleukins such as interleukin 1, 2, 4, and 6 in natural or recombinant forms. For one such technique, see, for example, Takata et al., 1990, J. Immunol. 145: 2846-2853.

Clonal populations of antigen-specific T cells may be derived by T cell cloning using limiting dilution cloning methods in the presence of irradiated feeder cells, antigen and cytokines. Alternatively, T cell hybridomas may be generated by fusion of the antigen-specific T cells with fusion partner tumor lines such as BW5147 or BW1100 followed by HAT selection and recloning. Antigen-specific T cells have also been cloned and propagated by the use of monoclonal antibodies to CD3. T cell clones and T cell hybridomas can be generated using cells obtained directly from in vivo sources followed by testing and selection for antigen-specificity or antigen-specific T cell lines can be secured prior to the cloning and fusion events. T cell clones can be maintained long-term in culture by repetitive stimulation with antigen or anti-CD3 every 7-14 days followed by expansion with cytokines while T cell hybridomas can be grown in the appropriate culture media without periodic antigen stimulation.

The antigen-specificity of monoclonal T cell populations can be assessed in i vitro assays measuring the proliferation and/or lymphokine production of these cells in response to antigen. Phenotype of the T cells may be confirmed by staining with antibodies to various T cell markers.

Such antigen-specific T cells may secrete TCRα chains constitutively or they may require activation signals for the release of their α chains. Preferably, the antigen-specific T cells may be used as the source of genetic material required to produce the TCRα chain by recombinant DNA and/or chemical synthetic techniques. Using this approach, certain antigen-specific T cells which may not secrete naturally-occurring TCRα chains can serve as a source of genetic material for the TCRα chain to be used in accordance with the invention.

5.1.3. ISOLATION OF THE TCR ALPHA CHAIN CODING SEQUENCE

Messenger RNA (mRNA) for the preparation of cDNA may be obtained from cell sources that produce the desired α chain, whereas genomic sequences for TCRα may be obtained from any cell source. Any of the T cells generated as described in Section 5.1.2. supra, may be utilized either as the source of the coding sequences for the TCRα chain, and/or to prepare cDNA or genomic libraries. Additionally, parts of lymphoid organs (££., spleens, lymph nodes, thymus glands, and peripheral blood lymphocytes) may be ground and used as the source for extracting DNA or RNA. Alternatively, T cell lines can be used as a convenient source of DNA or RNA. Genetically engineered microorganisms or cell lines containing TCRα coding sequences may be used as a convenient source of DNA for this puφose.

Either cDNA or genomic libraries may be prepared from the DNA fragments generated using techniques well known in the art. The fragments which encode TCRα may be identified by screening such libraries with a nucleotide probe homologous to a portion of the TCRα sequence. In this regard, it should be noted that there is a single constant region gene for TCRα (Cα) in human and mice. Since the nucleotide sequences encoding the Cα for both species are known, DNA probes homologous to the constant region may be synthesized by standard methods in the art and used to isolate from such T cells described in Section 5.1.2. supra, the TCRα gene or mRNA transcript which can be used to synthesize TCRα cDNA or to identify appropriate TCRα sequences in cDNA libraries prepared from such T cells or genomic clones. Alternatively, oligonucleotides specific for the variable region of the desired TCRα chain could be constructed, but these would have to be designed on a case by case basis, depending on the sequence of the variable region. Oligonucleotide probes designed based on the constant region offer an advantage in this regard, since they can be used to "fish out" any TCRα chain gene or coding sequence. Although portions of the coding sequence may be utilized for cloning and expression, full length clones, Lg, those containing the entire coding region for TCRα, may be preferable for expression. To these ends, techniques well known to those skilled in the art for the isolation of

DNA, generation of appropriate restriction fragments, construction of clones and libraries, and screening recombinants may be used. Methods which are well-known to those skilled in the art can be used to this end. See, for example, the techniques described in Maniatis et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y. In a specific embodiment, by way of example in Section 6, infra, the complete nucleotide coding sequence for the TCRα chain gene was isolated from T cell hybridoma, Al.l, depicted in FIG. 2.

Alternatively, oligonucleotide probes derived from specific TCRα sequences could be used as primers in PCR (polymerase chain reactions) methodologies to generate cDNA or genomic copies of TCRα sequences which can be directly cloned. For a review of such PCR techniques, see for example, Gelfand, D.H., 1989, "PCR Technology. Principles and Applications for DNA

Amplification," Ed., H.A. Erlich, Stockton Press, N.Y.; and "Current-Protocols in Molecular Biology," Vol. 2, Ch. 15, Eds. Ausubel et al., John Wiley & Sons, 1988.

Regardless of the method chosen to identify and clone the TCRα coding sequence, expression cloning methods may be utilized to substantially reduce the screening effort. Recently, a one step procedure for cloning and expressing antibody genes has been reported (McCafferty et al., 1990,

Nature 348:552-554; Winter and Milstein, 1991, Nature 349:293-299). Based on this technology, TCRα chain genes may likewise be cloned directly into a vector at a site adjacent to the coat protein gene of a bacteriophage such as λ or fd. The phage carrying a TCRα gene expresses the fusion protein on its surface so that columns containing the antigen or a TCRα-specific antibody can be used to select and isolate phage particles with binding activity. Transient gene expression systems may also be utilized to identify the correct TCRα gene. For example, the COS cell system (s&, Gerard & Gluzman, 1986, Mol. Cell. Biol.6(12) 4570-4577) may be used; however, the expression of the TCRα chain should be detected in extracts of COS cells which had been co- transfected with the CD3 δ chain gene (Bonifacino, et al., 1990, Cell 63: 503-513).

Due to the degeneracy of the nucleotide coding sequences, other DNA sequences which encode analogous amino acid sequences for any known antigen-specific TCRα chain gene may be used in the practice of the present invention for the cloning and expression of TCRα. Such alterations include deletions, additions or substitutions of different nucleotide residues resulting in a sequence that encodes the same or a functionally equivalent gene product. The gene product may contain deletions, additions or substitutions of amino acid residues within the sequence, which result in a silent change thus producing a bioactive product. Such amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the amphipathic nature of the residues involved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; amino acids with uncharged polar head groups having similar hydrophilicity values include the following: leucine, isoleucine, valine; glycine, alanine; asparagine, glutamine; serine, threonine; phenylalanine, tyrosine.

The TCRα chain sequence may be modified to obtain a gene product having improved properties for use in vivo, such as improved stability and half-life. For example, a hybrid gene can be constructed by ligating the TCRα chain gene, or its variable region, to the constant region of a human immunoglobulin gene such as IgG. For a technique which can be applied, see Capon et al., 1989, Nature 337: 525-531.

5J EXPRESSION OF THE ALPHA CHAIN CODING SEQUENCE

In order to express a biologically active TCRα chain, the nucleotide sequence coding for TCRα, or a functional equivalent as described in Section 5.1.3 supra, is inserted into an appropriate expression vector, Lg., a vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Modified versions of the TCRα coding sequence could be engineered to enhance stability, production, purification or yield of the expressed product. For example, the expression of a fusion protein or a cleavable fusion protein comprising TCRα and a heterologous protein may be engineered. Such a fusion protein may be readily isolated by affinity chromatography; ≤JJ. by immobilization on a column specific for the heterologous protein. Where a cleavage site is engineered between the TCRα moiety and the heterologous protein, the TCRα chain can be released from the chromatographic column by treatment with an appropriate enzyme or agent that disrapts the cleavage site (e.g.. see Booth et al., 1988, Immunol. Lett. 19:65-70; and Gardella et al., 1990, J. Biol. Chem. 265:15854-15859).

Methods which are well known to those skilled in the art can be used to construct expression vectors containing the TCRα coding sequence and appropriate transcriptional translational control signals. These methods include in vitro recombinant DNA techniques, synthetic techniques and in vivo recombination/genetic recombination. See, for example, the techniques described in Maniatis et al., 1989 Molecular Cloning A Laboratory Manual, Cold Spring Harbor

Laboratory, N.Y.

A variety of host-expression vector systems may be utilized to express the TCRα coding sequence. These include but are not limited to microorganisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing a TCRα coding sequence; yeast transformed with recombinant yeast expression vectors containing the TCRα coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g.. Ti plasmid) containing a TCRα coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g.. baculovirus) containing a TCRα coding sequence; or animal cell systems infected with recombinant virus expression vectors (e_^g., retroviruses, adenovirus, vaccinia virus) containing a TCRα coding sequence, or transformed animal cell systems engineered for stable expression. As demonstrated by the working examples described in Section 7, infra, glycosylation of the expressed product does not appear to be required for TCRα immunoregulatory activity. Therefore, bacterial expression systems may be advantageously utilized for high yield TCRα production. However, glycosylation may be important for in vivo applications, even though it is not required for immunoregulatory activity; e.g.. the glycosylated product may demonstrate an increased half-life in vivo. In such cases, expression systems that provide for translational and post-translational modifications may be used; £,£., mammalian, insect, yeast or plant expression systems.

Depending on the host/vector system utilized, any of a number of suitable transcription and translation elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. may be used in the expression vector (see e.g.. Bitter et al., 1987, Methods in Enzymology 153:516-544). For example, when cloning in bacterial systems, inducible promoters such as pL of bacteriophage λ, plac, ptφ, ptac (ptφ-lac hybrid promoter) and the like may be used. When cloning in mammalian cell systems, promoters derived from the genome of mammalian cells (e.g.. metallothionein promoter) or from mammalian viruses (e.g.. the retrovirus long terminal repeat; the adenoviras late promoter; the vaccinia virus 7.5K promoter) may be used. Promoters produced by recombinant DNA or synthetic techniques may also be used to provide for transcription of the inserted TCRα coding sequence.

In bacterial systems a number of expression vectors may be advantageously selected depending upon the use intended for the TCRα expressed. For example, when large quantities of TCRα are to be produced, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Those which are engineered to contain a cleavage site to aid in recovering TCRα are preferred. Such vectors include but are not limited to the £ coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which the TCRα coding sequence may be ligated into the vector in frame with the lac Z coding region so that a hybrid

TCRα-lac Z protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 264:5503-5509); and the like. In yeast, a number of vectors containing constitutive or inducible promoters may be used. For a review see, Current Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13; Grant et al., 1987, Expression and Secretion Vectors for Yeast, m Methods in Enzymology, Eds. Wu & Grossman, 31987, Acad. Press, NY., Vol. 153, pp.516-544; Glover, 1986, DΝA Cloning, Vol. II, IRL Press, Wash., D.C., Ch. 3; and

Bitter, 1987, Heterologous Gene Expression in Yeast, Methods in Enzymology, Eds. Berger & Kimmel, Acad. Press, Ν.Y., Vol. 152, pp. 673-684; and The Molecular Biology of the Yeast Saccharomyces, 1982, Eds. Strathern et al., Cold Spring Harbor Press, Vols. I and II. A constitutive yeast promoter such as ADH or LEU2 or an inducible promoter such as GAL may be used (Cloning in Yeast, Ch.3, R. Rothstein In: DNA Cloning Vol.11 , A Practical Approach,

Ed. DM Glover, 1986, IRL Press, Wash., D.C.). Alternatively, vectors may be used which promote integration of foreign DNA sequences into the yeast chromosome.

In cases where plant expression vectors are used, the expression of a TCRα coding sequence may be driven by any of a number of promoters. For example, viral promoters such as the 35 S RNA and 19S RNA promoters ofCaMV (Brisson etal., 1984, Nature 310:511-514), or the coat protein promoter to TMV (Takamatsu et al., 1987, EMBO J. 6:307-311) may be used; alternatively, plant promoters such as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO J. 3:1671-1680; Broglie et al., 1984, Science 224:838-843); or heat shock promoters, e_^g., soybean hspl 7.5-E or hspl7.3-B (Gurley et al., 1986, Mol. Cell. Biol. 6:559-565) may be used. These constructs can be introduced into plant cells using Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. For reviews of such techniques see, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp. 421-463; and Grierson & Corey, 1988, Plant Molecular Biology, 2d Ed., Blackie, London, Ch. 7-9. An alternative expression system which could be used to express TCRα is an insect system. In one such system, Autographa califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The TCRα coding sequence may be cloned into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of the TCRα coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus (Lg., virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed. (Tig., see Smith et al., 1983, J. Viol. 46:584; Smith, U.S. Patent No. 4,215,051).

Eukaryotic systems, and preferably mammalian expression systems, allow for proper post- translational modifications of expressed mammalian proteins to occur. Eukaryotic cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, phosphorylation, and, advantageously secretion of the gene product should be used as host cells for the expression of TCRα. Mammalian cell lines are preferred. Such host cell lines may include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, -293, and WI38.

It may be that production of TCRα in a T cell host enhances its activity, for example, due to preferential processing and/or association with other T cell molecules. Where such expression is desired, T cell hosts including but not limited to T cell tumor cell lines, T cell hybridomas, T cells which produce accessory component, or T cells which produce immunoregulatory factors may be utilized.

Mammalian cell systems which utilize recombinant viruses or viral elements to direct expression may be engineered. For example, when using adenoviras expression vectors, the TCRα coding sequence may be ligated to an adenoviras transcription/translation control complex, e.g.. the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenoviras genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g.. region El or E3) will result in a recombinant viras that is viable and capable of expressing the TCRα chain in infected hosts (e.g.. see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81: 3655-3659). Alternatively, the vaccinia virus 7.5K promoter may be used, (g.g., see, Mackett et al., 1982, Proc. Natl. Acad. Sci. USA 79: 7415-7419; Mackett et al.,

1984, J. Virol.49: 857-864; Panicali et al., 1982, Proc. Natl. Acad. Sci. USA 79: 4927-4931). Of particular interest are vectors based on bovine papilloma viras which have the ability to replicate as extrachromosomal elements (Sarver, et al., 1981, Mol. Cell. Biol. 1: 486). Shortly after entry of this DNA into mouse cells, the plasmid replicates to about 100 to 200 copies per cell. Transcription of the inserted cDNA does not require integration of the plasmid into the host's chromosome, thereby yielding a high level of expression. These vectors can be used for stable expression by including a selectable marker in the plasmid, such as the n__2 gene.

Alternatively, the retroviral genome can be modified for use as a vector capable of introducing and directing the expression of the TCRα chain gene in host cells (Cone & Mulligan, 1984, Proc. Natl. Acad. Sci. USA 81:6349-6353). High level expression may also be achieved using inducible promoters, including, but not limited to, the metallothionine IIA promoter and heat shock promoters.

For long-term, high-yield production of recombinant proteins, stable expression is preferred. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with the TCRα cDNA controlled by appropriate expression control elements (e.g.. promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. For example, following the introduction of foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. A number of selection systems may be used, including but not limited to the heφes simplex viras thymidine kinase (Wigler, et al.,

1977, Cell 11: 223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48: 2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22: 817) genes can be employed in tk", hgprt^" or aprt" cells respectively. Also, antimetabolite resistance can be used as the basis of selection for dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77: 3567; O'Hare, et al., 1981, Proc.

Natl. Acad. Sci. USA 78: 1527); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072; neo, which confers resistance to the amino- glycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150: 1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30: 147) genes. Recently, additional selectable genes have been described, namely tφB, which allows cells to utilize indole in place of tryptophan; hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, 1988, Proc. Natl. Acad. Sci. USA 85: 8047); and ODC (ornithine decarboxylase) which confers resistance to the ornithine decarboxylase inhibitor, 2-(difluoromethyl)-DL- ornithine, DFMO (McConlogue L., 1987, In: Current Communications in Molecular Biology,

Cold Spring Harbor Laboratory ed.).

S.1.... PURIFICATION OF THE TCR ALPHA CHAIN EXPRESSION PRODUCT

The expression of TCRα protein product by genetically-engineered cells can be assessed immunologically, for example by Western blots, immunoassays such as radioimmuno- precipitation, enzyme-linked immunoassays and the like. The ultimate test of the success of the expression systerr.. however, involves the production of biologically active TCRα gene product. Where the host cell secretes the gene product, the cell free media obtained from the cultured transfectant host cell may be assayed for TCRα or its immunoregulatory activity. Where the gene product is not secreted, cell lysates may be assayed for such activity. In either case, a number of assays can be used to assess TCRα activity, including but not limited to assays measuring the ability of the expressed TCRα to bind antigen, and assays to evaluate its immunologic function, such as the PFC assays described in Section 5.1.1. supra and exemplified in Section 6.1.5, infm-

Once a clone that produces high levels of biologically active TCRα is identified, the clone may be expanded and used to produce large amounts of the protein which may be purified using techniques well-known in the art including, but not limited to immunoaffinity purification, chromatographic methods including high performance liquid chromatography and the like. Where the protein is secreted by the cultured cells, TCRα may be readily recovered from the culture medium.

Methods for purifying TCRα from crude culture media of T cells may be adapted for purification of the cloned, expressed product. For example, TCRα from Al.l cells, used in the examples, infra, can be purified from the crude culture media of T cells by ammonium sulfate precipitation followed by affinity chromatography (Zheng et al., 1988, J. Immunol. 140:1351-1358; Bissonnette et al., 1991, J. Immunol. 146:2898-2907). Purified monoclonal antibodies specific for a commonly shared determinant on all murine TCRα chains or an antigen or a fragment containing a specific antigenic epitope thereof can be coupled to cyanogen bromide-activated Sepharose 4B (Pharmacia) and used for affinity chromatography. The biological activity of the protein purified in this manner from crude culture media has been shown to be enriched 3, 000- fold. Alternatively, antibodies made to products of different Vα gene families may also be used if it is known which specific Vα gene segment encodes the α chain protein in question. In addition, antibodies may be raised to the variable region of a specific TCRα chain and used in the purification of the α chain from a mixture of other irrelevant TCRα chains. In this case, a specific α chain may be isolated even from the crude media of bulk culture T cells if sufficient quantity of the protein is present.

Where the TCRα coding sequence is engineered to encode a cleavable fusion protein, the purification of TCRα may be readily accomplished using affinity purification techniques. For example, a protease factor Xa cleavage recognition sequence can be engineered between the carboxyl terminus of TCRα and a maltose binding protein. The resulting fusion protein can be readily purified using a column conjugated with amylose to which the maltose binding protein binds. The TCRα fusion protein is then eluted from the column with maltose containing buffer followed by treatment with Factor Xa. The cleaved TCRα chain is further purified by passage through a second amylose column to remove the maltose binding protein (New England Biolabs,

Beverly, MA). Using this aspect of the invention, any cleavage site or enzyme cleavage substrate may be engineered between the TCRα sequence and a second peptide or protein that has a binding partner which could be used for purification, e.g.. any antigen for which an immunoaffinity column can be prepared. 5_1 ALTERNATE TECHNIQUES TO PRODUCE THE TCR ALPHA CHAIN

Once a specific TCRα chain gene has been molecularly cloned and its DNA sequence determined, its protein product may be produced by a number of methods in addition to those described supra. For example, solid phas chemical synthetic techniques can be used to produce a TCRα chain in whole or in part based on an amino acid sequence deduced from the DNA sequence (see Creighton, 1983, Proteins Structures and Molecular Principles, W.H. Freeman and Co., N.Y. pp. 50-60). This approach is particularly useful in generating small portions of proteins that correspond to the active site of a molecule. In the case of a TCRα chain which binds antigen, it is highly likely that the variable region in the amino-terminal end of the protein encoded by the V and J gene segments is important to antigen-binding. Therefore, synthetic peptides cc sponding to the variable region of the α chain may be produced. In addition, a larger peptide containing a specific portion of an α chain constant region may also be synthesized if, for example, that region is known to be important for its interaction with accessory factors in achieving a full immunoregulatory response.

Another method of producing TCRα chain based on its cloned DNA sequence is by transcription and translation of its gene in an in vitro cell free system. In a particular embodiment by way of example in Section 7, jnfra. the A 1.1 TCRα chain gene is in vitro transcribed and translated and its product is shown to be a protein of about 32,000 dalton molecular weight by SDS-PAGE. This protein corresponds to an unglycosylated TCRα polypeptide chain. Although such a cell free in vitro system is not designed for large scale protein production, the advantage of this approach is to provide a method for definitively demonstrating the contribution of a specific TCRα chain in a specific immunological reaction in the absence of the synthesis of other proteins.

Molecular mimicry of protein conformation by antibody combining sites provides another method for producing a protein with binding specificity similar to that of a specific TCRα chain.

For example, anti-idiotypic antibodies or monoclonal antibodies directed to the same antigenic determinant as the specific TCRα chain may possess a binding site that is structurally identical to the TCRα chain variable domain. Such antibodies which demonstrate a TCRα chain immunoregulatory function as evaluated in the PFC assays described herein may be used in place of TCRα chain. The use of such antibodies may be preferred under certain circumstances, for example, where it can be shown that the antibody has a longer in vivo half life than a native α chain. In alternative therapeutic applications described infra, monoclonal antibodies which bind to and neutralize the TCRα chain may be desired. These antibodies may also be used in diagnostic assays in vitro, e.g.. radioimmunoassays, ELISAs, to detect circulating TCRα chains in humans. Such monoclonal antibodies can be readily produced in large quantities using techniques well known in the art.

For the production of antibodies that mimic TCRα, various host animals, including but not limited to mice, rabbits, hamsters, rats, and non-human primates, may be immunized with the desired antigen or an anti-TCRα chain antibody in order to generate antibodies that mimic the

TCRα chain, as measured by their ability to competitively inhibit the antigen-specific binding of the TCRα chain to its antigen, and their ability to regulate an immune response specific for the antigen as evaluated in the PFC assays described herein. For the production of antibodies that bind to and neutralize TCRα chain, the host animal would be immunized with the TCRα chain itself. Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corvnebacterium parvum.

Monoclonal antibodies may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohler and Milstein, (Nature, 1975, 256:495- 497), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today, 4:72; Cote et al., 1983, Proc. Natl. Acad. Sci. 80:2026-2030) and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Techniques developed for the production of "chimeric antibodies" by splicing the genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule can be used (ejj., Morrison et al., 1984, Proc. Natl. Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985, Nature, 314:452-454). In addition, techniques described for the production of single chain antibodies (U.S. Patent 4,946,778) can be adapted to produce single chain antibodies.

Antibody fragments which contain the specific desired binding sites may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragments. Alternatively, techniques described for the construction of Fab expression libraries (Huse et al., 1989, Science, 246: 1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity can be used.

5.2 USE OF THE TCR ALPHA CHAIN AS AN TMMUNOMODTILATORY AGENT

The antigen-specific immunoregulatory activity of a TCRα chain provides for a wide variety of uses in vivo in human or animal subjects and in vitro. Any TCRα chain, or fragments and derivatives thereof, which are capable of binding to the antigen and which exhibit immunoregulatory activities as assayed in vitro may be used in the practice of the method of the invention. Where the factors of the accessory component are present in a subject's serum, the

TCRα chain may be administered as the sole active agent. However, the TCRα chain could be administered in conjunction with biologically active factors found in the accessory component, growth factors, or inhibitors. The TCRα chains which are capable of binding to the antigen and which suppress the immune response that would normally be generated against the antigen may be especially useful in the down-regulation of antigen-specific immune responses such as hypersensitivity reactions, transplantation rejections, and autoimmune disorders. Alternatively, the removal or neutralization of such TCRα chains, or the factors which associate with such

TCRα chains, may be useful as a means of augmentating an immune response against diseases such as cancer and immunodeficiency. In an alternative embodiment of the invention, TCRα chains specific for the antigen which augment the immune response could be utilized to augment such antigen-specific responses in vivo.

5.2.1 ANTIGEN-SPECIFIC IMMUNOSUPPRESSION

The antigen-binding TCRα chains that demonstrate antigen-specific immunosuppression may be used in the treatment of conditions in which immune reactions are deleterious and suppression of such responses in an antigen-specific manner is desirable. These disorders which may be treated in accordance with the invention include but are not limited to hypersensitivity (types I- IV), autoimmune disease as well as graft rejection responses after organ and tissue transplantations. Hypersensitivity reactions are commonly classified into four groups. Type I reactions are immediate-type hypersensitivity which result from mast cell degranulation triggered by antigen- specific IgE. Examples of type I diseases include most common allergies caused by substances such as plant pollens, mold spores, insect parts, animal danders, bee and snake venom, industrial dusts, house dusts, food products, chemicals and drags. Type II reactions are caused by the action of specific antibodies, usually IgG and IgM, on target cells leading to cellular destruction.

Examples of type II diseases include transfusion reactions, erythroblastosis fetalis, autoimmune hemolytic anemia, myasthenia gravis and Grave's disease. Type III reactions are caused by antigen-antibody complex formations and the subsequent activation of antibody effector mechanisms. Examples of type III diseases include immune complex glomerulonephritis, Goodpasture's syndrome and certain forms of arthritis. Type IV reactions are cell-mediated reactions involving T cells, macrophages, fibroblasts and other cell types. These are also referred to as delayed-type hypersensitivity. Allergic contact dermatitis is a typical example of this category.

Autoimmune disorders refer to a group of diseases that are caused by reactions of the immune system to self antigens leading to tissue destruction. These responses may be mediated by antibodies, auto-reactive T cells or both. Many of these conditions overlap with those described under hypersensitivity above. Some important autoimmune diseases include diabetes, autoimmune thyroiditis, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosis, and myasthenia gravis.

Basic understanding of the MHC has led to technical advances in tissue typing which, in turn, have substantially improved the rate of success in organ and tissue transplantation. Some of the commonly performed transplantation surgery today includes organs and tissues such as kidneys, hearts, livers, skin, pancreatic islets and bone marrow. However, in situations where the donors and recipients are not genetically identical, graft rejections can still occur.

For all of the above-identified conditions, including but not limited to the specific diseases mentioned, a down-regulation of adverse immune reactions is beneficial to the host. In this regard, an antigen-specific TCRα may be used to specifically suppress an immune response mediated by T cells, antibodies or both while retaining all other normal immune functions. For example, experimental allergic encephalomyelitis (EAE) is an animal model for multiple sclerosis in man which can be induced in mice by the administration of purified myelin basic protein. T_H have been shown to play a critical role in the pathogenesis of the disease (Wraith et al., 1989, Cell 57:709-715). The number of antigenic determinants recognized by auto-reactive

T cells in a given mouse strain are limited. Furthermore, the Vα and Vβ gene segments used for the construction of autoimmune TCR is equally restricted so that the majority of the T cell response to the small number of encephalitogenic epitopes has an identical TCR. Antibodies to TCR determinants have been successfully used.to deplete antigen-specific T cells in vivo leading to protection from disease. (Owhashi and Heber-Katz, 1988, J. Exp. Med. 168:2153-2164). For the practice of the present invention, a TCRα chain gene may be isolated from such auto-reactive T cells, expressed in an appropriate host cell and tested for its ability to suppress the antigen- specific immune responses in vitro and in vivo. The use of TCRα chains for this puφose is particularly important in light of the recent findings that in certain human diseases such as multiple sclerosis and myasthenia gravis, autoimmune T cells have been detected and they appear to similarly have a restricted usage of certain Vα and Vβ alleles (Oksenberg et al., 1989, Proc. Natl. Acad. Sci. USA 86:988-992). In accordance with the invention, the foregoing conditions may be treated by administering to the patient an effective dose of TCRα chain specific for the relevant antigen which suppresses the immune response generated against that antigen. The TCRα chains selected for use may be evaluated by an immunoregulatory assay in vitro, such as the PFC assays described herein. The TCRα chain may be administered in a variety of ways, including but not limited to injection, infusion, parenterally, and orally. TCRα and its related derivatives, analogs e.g.. peptides derived from the variable region, may be used as the sole active agent, or with other compounds. Such compositions may be administered with a physiologically acceptable carrier, including phosphate buffered saline, saline and sterilized water. Alternatively, liposomes may be used to deliver the TCRα. In this regard, the liposome may be conjugated to antibodies that recognize and bind to cell specific antigens, thereby providing a means for "targeting" the TCRα compositions.

An effective dose is the amount required to suppress the immune response which would have been generated against the relevant antigen in vivo. The amount of TCRα employed will vary with the manner of administration, the use of other active compounds, and the like. Generally a dose which will result in circulating serum levels of 0.1 μg to 100 μg/ml may be utilized. The most effective concentration for suppressing antigen-specific responses may be determined in vitro by adding various concentrations of TCRα to an in vitro assay such as the PFC assays described in Section 6.1.5., infra, and monitoring the level of inhibition achieved.

5.2.2. ANTIGEN-SPECIFIC IMMUNOSTIMULATION

Certain diseases are the result of deficient or defective immune responses. An impaired immune response may be due to the absence or aberrant function of certain compartments of the immune system, or the presence of factors that specifically down-regulate these responses. In the latter scenario, for example, a patient's oveφroduction of an antigen-specific TCRα which suppresses the immune response directed toward a particular antigen may be involved. In such cases, the systemic removal or neutralization of TCRα may be able to rescue the responding cells from such suppression and thereby enhance their efficacy against the antigens they recognize. The PFC assay described herein can be utilized to assay the patient's body fluids, such as serum for the presence of circulating or soluble TCRα chains that exert an antigen-specific immunosuppressive effect. Such patients may then be treated using antibodies for the TCRα chain to remove or neutralize the circulating suppressive molecules.

T cell-mediated suppression can explain the continual growth of a tumor in the face of a demonstrable tumor-specific immune response. In a variety of experimental tumor systems, the elimination of antigen-specific Ts and TsF have been reported to uncover the underlying anti- tumor responses (North, 1982, J. Exp. Med. 55:106-107; Hellstrom et al., 1978, J. Exp. Med.49- 799-804; Nepom et al., 1977, Biochim Biophy. Acta; 121-148). Antigen-specific suppressor factors may be released directly by tumor cells or by Ts which are activated upon recognizing certain suppressogenic epitopes of tumor antigens (Sercarz and Krzych, 1991, Immunol. Today

12:111-118). A monoclonal antibody originally raised to a TsF may also react with a tumor- specific T suppressor factor produced by a T cell hybridoma (Steele et al., 1985, J. Immunol. 134: 2767-2778). Several of the TsF that bind to this antibody bind to anti-TCRα antibodies. TCRα chains, therefore, with appropriate specificity for tumor antigens may participate in the dampening of tumor immunity, in which case, the removal or neutralization of such TCRα will likely be advantageous to the restoration and augmentation of tumor-specific responses.

The activity of such native TCRα chains in a patient may be inhibited by the administration in vivo of antibodies specific for the α chain (see Section 5.1.4, supra, which neutralize its activity, i.e.. either its ability to bind antigen and/or its resulting antigen-specific immunosuppressive effect. While antibodies to the constant or variable region of TCRα may be used, those which bind the variable region may be preferred since only the TCRα chains specific for that particular antigen will be neutralized so that the immune response is augmented in an antigen-specific fashion. Alternatively, sera of cancer patients with detectable levels of soluble tumor antigen- specific TCRα chain may be adsorbed by gx vivo passage through columns containing an antibody to α chain or the antigen or a peptide thereof; g., plasmaphoresis.

For in vivo use, an antibody may be administered in a variety of ways, including but not limited to injection, infusion, parenterally and orally. The antibody may be administered in any physiologically acceptable carrier, including phosphate buffered saline, saline and sterilized water. The amount employed of the subject antibody will vary with the manner of administration, the employment of other active compounds, and the like, generally being in a saturating dose which will result in the binding of most if not all of the free systemic TCRα chains. For gx vivo adsoφtion, the amount of antibody or antigen coupled to the column will be that which is sufficent for removing most if not all free TCRα chain in patients' sera.

Antisense oligonucleotides may be used to interfere with the expression and systemic release of a specific immunosuppressive TCRα chain, and thereby selectively enhance an antigen-specific immune response. In this regard, complementary oligonucleotides which exhibit catalytic activity, Lg., a ribozyme approach may be used. See generally, _^g., PCT International

Publication WO90/11364; Sarver et al., 1990, Science 247: 1222-1225. The use of Vα antisense or ribozyme oligonucleotides for each TCRα chain is preferred over the use of the complete TCRα since this will only inhibit a specific TCRα of interest. For this purpose, nuclease resistant antisense Vα oligodeoxynucleotides complementary to the mRNA of any known TCRα chain sequence may be synthesized. Following their uptake into the antigen-specific T cells, these agents can hybridize to their complementary mRNA sequences through base pairing, block translation and disrupt the production of the encoded protein products (for review of such techniques, see Green et al., 1986, Ann. Rev. Biochem. 55:569-597).

In an alternate embodiment of the invention, TCRα chains specific for the antigen of interest and which augment the antigen specific immune response may be identified as described in Section

5.1.1., supra. Therapeutically effective doses of such TCRα chains may be administered to a patient to augment the patient's immune response against that particular antigen.

In another embodiment, the invention provides a substantially pure fusion polypeptide R,-[X,]- R₂, wherein R_t is a carrier peptide, R₂ is a polypeptide encoded by a structural gene, and X, is a proteolytic enzyme recognition sequence. The "carrier peptide", is located at the amino terminal end of the fusion peptide sequence. In the case of prokaryotes, the carrier peptide of the fusion polypeptide of the invention may function to transport the fusion peptide to inclusion bodies, the periplasm, the outer membrane or, preferably, the extemal environment. In the case of eukaryotes, the carrier peptide is believed to function to transport the fusion polypeptide across the endoplasmic reticulum. The secretory protein is then transported through the Golgi apparatus, into secretory vesicles and into the extracellular space or, preferably, the extemal environment. Carrier peptides of the invention include, but are not limited to, the calmodulin polypeptide. Categories of carrier peptide which can be utilized according to the invention include pre-pro peptides and outer membrane peptides which may include a proteolytic enzyme recognition site. Acceptable carrier peptides also include the amino terminal pro-region of hormones. Other carrier peptides with similar properties described herein are known to those skilled in the art, or can be readily ascertained without undue experimentation.

In one embodiment of the invention, a carrier peptide is included in an expression vector, which is specifically located adjacent to the N-terminal end of the carrier protein. While the vector used in the example of the present invention uses the calmodulin nucleotide sequence, other sequences which provide the means for transport of the fusion protein to the endoplasmic reticulum (for eukaryotes) and into the extemal environment or into inclusion bodies (for prokaryotes), will be equally effective in the invention. Such sequences as described above are known to those of skill in the art.

The carboxy-terminal end of the carrier peptide of the invention contains a proteolytic enzyme recognition site so that polypeptide encoded by the structural gene can be easily separated from the fusion polypeptide. Differences in the cleavage recognition site are possible in that different enzymes exist for the proteolytic specificity. Preferably, the cleavage site is the sequence, Lys- Val-Pro-Arg-Gly (SEQ ID NO: 1), which is recognized by thrombin. This recognition site allows for an unexpectedly high level of active protein encoded by the structural gene to be produced. Other cleavage sites, such as that recognized by Factor Xa protease, will be known to those of skill in the art.

The fusion polypeptide of the invention includes a polypeptide encoded by a structural gene, preferably at the carboxy terminus of the fusion polypetide. Any structural gene is expressed in conjunction with the carrier peptide and cleavage site. The structural gene is operably linked with the carrier and cleavage site in an expression vector so that the fusion polypeptide is expressed as a single unit. An example of a stractural gene that can be used to produce a fusion polypeptide of the invention encodes the truncated form of TCRα, which includes only the extracellular membrane domain of TCRα .

The invention provides a substantially pure polypeptide. The term "substantially pure" as used herein refers to a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it may be naturally associated. One skilled in the art can purify the polypeptide using standard techniques for protein purification, such as affinity chromatography using a monoclonal antibody which binds an epitope of the polypeptide. The substantially pure polypeptide will yield a single major band on a polyacrylamide gel. The purity of the polypeptide can also be determined by amino-terminal amino acid sequence analysis. The polypeptide includes functional fragments of the polypeptide, as long as the activity of the polypeptide remains. Smaller peptides containing the biological activity of polypeptide are included in the invention.

The invention also provides polynucleotides encoding the fusion polypeptide. These polynucleotides include DNA, cDNA, and RNA sequences. It is understood that all polynucleotides encoding all or a portion of the fusion polypeptide are also included herein, as long as they encode a polypeptide of which the cleavage product has biological activity. Such polynucleotides include naturally occurring, synthetic, and intentionally manipulated poly¬ nucleotides. For example, the polynucleotide may be subjected to site-directed mutagenesis. The polynucleotide sequence also includes antisense sequences and sequences that are degenerate as a result of genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences are included in the invention as long as the amino acid sequence of the fusion polypeptide encoded by the nucleotide sequence is functionally unchanged. DNA sequences of the invention can be obtained by several methods as described above. For example, the DNA can be isolated using hybridization procedures which are well known in the art. These include, but are not limited to : 1) hybridization of probes to genomic or cDNA libraries to detect shared nucleotide sequences; 2) antibody screening of expression libraries to detect shared stractural features; and 3) synthesis by the polymerase chain reaction (PCR).

The synthesis of DNA sequences is frequently the method of choice when the entire sequence of amino acid residues of the desired polypeptide product is known. When the entire sequence of amino acid residues of the desired polypeptide is not known, the direct synthesis of DNA sequences is not possible and the method of choice is the synthesis of cDNA sequences. Among the standard procedures for isolating cDNA sequences of interest is the formation of plasmid- or phage-carrying cDNA libraries which are derived from reverse transcription of mRNA which is abundant in donor cells that have a high level of genetic expression. When used in combination with polymerase chain reaction technology, even rare expression products can be cloned. In those cases where significant portions of the amino acid sequence of the polypeptide are known, the production of labeled single or double-stranded DNA or RNA probe sequences duplicating a sequence putatively present in the target cDNA may be employed in DNA/DNA hybridization procedures which are carried out on cloned copies of the cDNA which have been denatured into a single-stranded form (Jay etal, Nucl. Acid Res. 11:2325, 1983).

DNA sequences encoding the fusion polypeptide of the invention can be expressed in vitro by DNA transfer into a suitable host cell. "Host cells" are cells in which a vector can be propagated and its DNA expressed. The term also includes any progeny of the subject host cell. It is understood that all progeny may not be identical to the parental cell since there may be mutations that occur during replication. However, such progeny are included when the term "host cell" is used. Preferred host cells of the invention include E. coli, S. aureus and P. aeruginosa, although other Gram-negative and Gram-positive organisms known in the art can be utilized as long as the expression vectors contain an origin of replication to permit expression in the host. Methods of stable transfer, in other words when the foreign DNA is continuously maintained in the host, are known in the art. In the present invention, the polynucleotide sequences may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a plasmid, virus or other vehicle known in the art that has been manipulated by insertion or incoφoration of the genetic sequences for TCRα, for example, and a carrier peptide and cleavage site. Such expression vectors contain a promoter sequence which facilitates the efficient transcription of the inserted genetic sequence of the host. The expression vector typically contains an origin of replication, a promoter, as well as specific genes which allow phenotypic selection of the transformed cells. Vectors suitable for use in the present invention include, but are not limited to the T7-based expression vector for expression in bacteria (Rosenberg et al, Gene 56:125, 1987), the pMSXND expression vector for expression in mammalian cells (Lee and Nathans, J. Biol. Chem. 261:3521 ,

1988) and baculovirus-derived vectors for expression in insect cells. The DNA segment can be present in the vector operably linked to regulatory elements, for example, a promoter (e.g., T7, metallothionein I, or polyhedrin promoters).

For example, the expression of the fusion peptide of the invention can be placed under control of E. coli chromosomal DNA comprising a lactose or lac operon which mediates lactose utilization by elaborating the enzyme beta-galactosidase. The lac control system can be induced by IPTG. A plasmid can be constructed to contain the lac Iq repressor gene, permitting repression of the lac promoter until IPTG is added. Other promoter systems known in the art include beta lactamase, lambda promoters, the protein A promoter, and the tryptophan promoter systems. While these are the most commonly, used, other microbial promoters can be utilized as well. The vector contains a replicon site and control sequences which are derived from species compatible with the host cell. In addition, the vector may carry specific gene(s) which are capable of providing phenotypic selection in transformed cells. For example, the beta-lactamase gene confers ampicillin resistance to those transformed cells containing the vector with the beta- lactamase gene.

Polynucleotide sequences encoding the fusion polypeptide of the invention can be expressed in either prokaryotes or eukaryotes. Hosts can include microbial, yeast, insect and mammalian organisms. Methods of expressing DNA sequences having eukaryotic or viral sequences in prokaryotes are well known in the art. Biologically functional viral and plasmid DNA vectors capable of expression and replication in a host are known in the art. Such vectors are used to incoφorate DNA sequences of the invention. The host cell of the invention may naturally encode an enzyme which recognizes the cleavage site of the fusion protein. However, if the host cell in which expression of the fusion polypeptide is desired does not inherently possess an enzyme which recognizes the cleavage site, the genetic sequence encoding such enzyme can be cotransfected to the host cell along with the polynucleotide sequence for the fusion protein.

Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art. Where the host is prokaryotic, such as E. coli, competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl₂ method by procedures well known in the art. Alternatively, MgCl₂ or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell or by electroporation.

When the host is a eukaryote, such methods of transfection of DNA as calcium phosphate co- precipitates, conventional mechanical procedures such as microinjection, electroporation, insertion of a plasmid encased in liposomes, or viras vectors may be used. Eukaryotic cells can also be cotransfected with DNA sequences encoding the fusion polypeptide of the invention, and a second foreign DNA molecule encoding a selectable phenotype, such as the heφes simplex thymidine kinase gene. Another method is to use a eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or transform eukaryotic cells and express the protein. (Eukaryotic Viral Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982).

Techniques for the isolation and purification of either microbially or eukaryotically expressed polypeptides of the invention may be by any conventional means such as, for example, preparative chromatographic separations and immunological separations such as those involving the use of monoclonal or polyclonal antibodies. The above disclosure generally describes the present invention. A more complete understanding can be obtained by reference to the following specific examples which are provided herein for puφoses of illustration only, and are not intended to limit the scope of the invention.

6. EXAMPLES: IMMUNOREGULATORY ACTIVITY OF THE TCR ALPHA CHAIN DEMONSTRATED BY RETROVIRAL GENE TRANSFER

6.1. MATERIALS AND METHODS

6.1.1. ANIMALS

C57B1/10 and C57B1/6 animals were purchased from Jackson Laboratories (Bar Harbor, ME).

6.1.2 CELL LINES Al.l (Fotedar et al., 1985, J. Immunol. 115:3028-3033), B9 (Fotedar et al., 1985, J. Immunol.

111:3028-3033), BWl 100 (White etal., 1989, J. Immunol.141:1822-1825), 175.2 (Glaichenhaus et al., 1991, J. Immunol. 146: 2095), and derivatives of these lines expressing Al.l TCR genes (See Section 6.1.4, infra, were maintained in RPMI 1640 plus 10% FCS. Many of the cell lines were also adapted to a protein free, serum free medium (Cell Biotechnologies, Rockville, MD).

6.1.3. ANTIBODIES AND ANTIGENS

Monoclonal antibodies with specificity for CD3e (145-2C11, hamster IgG) (Leo et al., 1987, Proc. Natl. Acad. Sci. USA £4:1374-1378), and TCR Cα (H28-710.16, hamster IgG) (Becker et al., 1989, Cell 5_8:911-921) were purified by protein A affinity chromatography (Protein A Superose, Pharmacia). Fluorescent staining and FACS analysis of surface CD3 (Zheng et al., 1989, Proc. Natl. Acad. Sci. USA £6:3758-3762) and antibody-affinity chromatography with

H28-710 (Bissonette et al., 1991, J. Immunol. 146:28-98-2907) were performed as previously described. SRBC were purchased from Morse Biologicals (Edmonton, AB) or from Colorado Serum Co. (Denver, CO). The nonrandom synthetic polypeptide, poly- 18, and peptides based on its stracture (listed in FIG. 4) were generated as previously described (Fotedar et al., 1985, J. Immunol. H£:3028-3033).

6.1.4. RETROVIRALTRANSFEROFTCRGENESBVTOTCELL HYBI

Total cellular RNA was isolated from IO⁹ cells by the conventional guanidium-isothiocyanate and cesium chloride method. Poly A⁺ RNA was recovered by oligo-dT cellulose affinity chromatography. The first strand synthesis was generated using an oligo-dT primer and reverse transcriptase and the second strand using DNA polymerase I and RNase H. The methylated blunt ended double-stranded (ds) cDNA was ligated to EcoRI linkers. Subsequent to EcoRI digestion the dscDNA was size selected on agarose gels, purified by spermine precipitation, and cloned into λgtlO. The λDNA was in vitro packaged (Gigapack Gold, Stratagene, La Jolla, CA). Approximately 200,000 plaques were screened by in situ hybridization using "³²P radiolabelled Cα and Cβ probes. The Cβ probes and Cα probes were used to screen a cDNA library (made from a beef insulin specific T cell hybridoma). Insert DNA from the positive clones was ligated into M13mpl 8 and M13mpl9 for standard dideoxy sequencing.

All of the retroviral vectors used in the examples described herein are derivatives of the N2 vector (Keller et al., 1985, Nature H£:149-154). The Al.l TCR α and β cDNAs were completely sequenced. In brief, the Al.l α cDNA uses the Vα,₂ (Arden et al., 1985, Nature 11^:783-787) and JαTA65 and the Al.l β cDNA uses Vβ₆ (Barth et al., 1985, Nature 316:517- 523), Dβ₂ (Sui et al., 1984, Nature 111:344-349), and Jβ_2.7 (Gascoigne et al., 1984, Nature

110:387-391) gene segments. Expression of the alpha cDNA was driven off the retroviral LTR, and the expression of the β chain was under the control of the TCR Vβ₂ promotor and the TCR β enhancer. Both inserts were cloned into the Xhol site of the N2 vector. These constructs were transfected into the packaging cell lines φ2 (Mann etal., 1983, Cell 11:153-159) and the PA317 (Miller and Buttimore, 1986, Mol. Cell. Biol. (5:2895-2902). The cloned producer cell lines had titers from 5xl0⁵ to lxlO⁶ as determined by standard methods (Miller and Buttimore, 1986, Mol. Cell. Biol. 6_:2895-2902). The recipient T cell hybridomas were infected by the supematants of the producer lines as directed (Keller et al., 1985, Nature U£: 149-154) and selected in G418 (0.8 -1.0 mg/ml) for 10 days. In the case of 175.2 cells expressing Al.lα, further selection was performed by fluorescent staining with anti-CD3, followed by cell sorting using a FACStar Plus (Becton-Dickinson). The expression of the transduced TCR gene was determined by FACS analysis using either an anti-Vβ₆ monoclonal antibody (Payne et al., 1988, Proc. Natl. Acad. Sci.

USA £1:7695-7698) or anti-CD3, or by PCR analysis of RNAs from control and infected recipient T cell hybridomas. Primers specific for the Vα, and Cα gene segments were used for PCR. The amplified products were hybridized with a 5'end-labeled antisense oligonucleotide specific for the junctional region of Al.l α cDNA.

6.1.5. TN VITRO ASSAY FOR ANTIGEN-SPECIFIC REGULATORY ACTIVITY

To assay for Al.l derived antigen-specific regulatory activity, a simple antigen-specific system was employed (Zheng et al., 1988, J. Immunol. 14fi:1351-1358; Bissonette et al., 1991, J. Immunol.146:2898-2907; Zheng et al., 1989, Proc. Natl. Acad. Sci. USA £6:3758-3762). Spleen cells (lxlO⁷) from C57B1/6 or C57B1/10 mice were placed into 1 ml cultures in RPMI 1640 supplemented with 10% FCS and 5x10^"5 M 2-ME. Each culture received 50μl 1 % SRBC coupled with poly- 18 or a substituted polypeptide. Suppressive activity was assessed by adding filter- sterilized hybridoma supernatant with or without an "accessory component" (10-15%) to the cultures. This accessory component was prepared from cultures of murine T cells from animals immunized to SRBC, followed by adsoφtion of the supernatant with SRBC, as described supra. in Section 5.1.1. (see also Zheng et al., 1988, J. Immunol.140:1351-1358; Bissonette et al., 1991,

J. Immunol.146:2898-2907). Alternatively, culture supernatant of a T cell hybridoma, 3-1-V (described in Section 8, infra., may be used as accessory supernatant (FIG. IA and B). The cultures were incubated at 37'C in humidified 92% air/8% C0₂ and anti-SRBC PFC assessed 5 days later. In all of the experiments shown herein, neither the T cell hybridoma supematants nor the accessory supernatant significantly affected the immune response when added alone.

Therefore, all control and experimental cultures described herein contain accessory supernatant, while results without accessory supernatant are not shown. jhl DIRECT BINDING OF BIOTIN-CONJtJGATED PEPTIDES TO T CELL-DERIVED PROTEIN

The peptides EYK(EYA)₄EYK (SEQ ID NO: 3) and EYKEYAEYAAYAEYAEYK (SEQ ID NO: 4) were conjugated to biotin as described (Bayer and Wilcheck, 1980, Methods Biochem. Anal. 2__.:l-45) and antigen-binding activity was assessed in cell supematants by a modified

ELISA assay (Gallina et al., 1990, J. Immunol. 141:3570-3577). Supematants from cell lines grown in protein free, serum free medium were concentrated approximately 50-200x on a Centricon 30 filtration system (Amicon, Danvers, MA) and coated at various dilutions on Immunolon II plates (Dynatech, Chantilly, VA) in carbonate buffer (pH 9.6) for 2 hrs at 37' C. After washing with PBS plus 0.05% Tween 20, the bound material was incubated with 1 OOμl of biotinylated peptides at 1:500 dilution for 1 hr at 37' C, washed, incubated with Extravidin- alkaline phosphatase conjugate (Sigma) diluted 1:2000, washed, and developed with nitrophenyl phosphate substrate (Sigma). OD 410 nm was determined after suitable incubation (often overnight at 4' C). In some experiments, peptides (without biotin) were added at 100 ng to 1 μg per well, together with the active biotinylated peptide to assess competition for binding.

6.2 RESULTS

6.2.1. TRANSFER OF TCRα WITH OR WITHOUT TCRβ CONFERS THE ABILITY TO PRODUCE ANTIGEN-SPECIFIC ACTIVITY

As shown in FIG. 3B, inhibition of the anti-SRBC PFC response by the Al.l supernatant was observed when SRBC coupled with EYK(EYA)₄ were present in the culture, but not when uncoupled SRBC or SRBC coupled with another peptide were present. The antigenic fine- specificity of the immunoregulatory activity demonstrated by Al .1 has been described previously (Zheng et al., 1988, J. Immunol.14fi:1351-1358, Bissonette et al., 1991, J. Immunol. 146:28-98- 2907), and some of these results are compiled in FIG. 4. The cell line 175.2 expresses TCRβ and the CD3 components, but lacks a functional TCRα gene (Glaichenhaus et al., 1991, J. Immunol.14$: 2095). 175.2 cells were infected with a retroviras expressing A 1.1 -TCRα (See Section 6.1.4, supra, and the cells were selected in G418, then further selected by cell sorting of CD3⁺ cells. The expression of CD3 on the selected cells (FIG. 3A), confirmed that the TCRα chain was expressed in the selected cells (175.2-Al.lα).

Supematants from 175.2-A1.1 α were collected and tested in the in vitro assay. As shown in FIG. 3B, these supematants displayed the same antigen-specific regulatory activity as those of Al.l, while those from 175.2 had no activity. Because the original TCR and specificity of 175.2 are completely unrelated to those of Al.l (Glaichenhaus et al., 1991, J. Immunol.14£: 2095), these results demonstrate that expression of the Al .1 TCRα chain gene results in the production of the antigen-specific regulatory activity. In addition, this immunoregulatory activity can be neutralized by the addition of an antibody to TCRα indicating that the TCRα chain secreted in the supernatant is responsible for this activity (FIG. 5). As a control, FIGS. 6A and B show that transfection of a TCRα gene from T cell hybridoma BB19 specific for an epitope of poly 18 which is distinct from that recognized by A 1.1 induced CD3 expression on the cell surface of 2 subclones of 175.2 (AF5 and AF6). However, like the parent clone BB19, the transfectants did not produce any immunoregulatory activity in their supernatant (FIG. 7A and B). Therefore, not all poly 18-specific T cells secrete a TCRα chain with immunoregulatory activity.

To further explore this observation, another cell line, B9, was infected with retroviral vectors carrying the TCRα or β of Al.l. Like Al.l, B9 expresses both TCRα and β, and produces IL2 in response to the antigen, poly 18, presented with I-A^d (Fotedar et al., 1985, J. Immunol. 111:3028-3033). As shown in Figure 8, supematants from Al.l, but not B9, displayed antigen- specific regulatory activity, and B9 cells expressing the Al.l TCRα chain (B9-Al.lα) also produced this activity, while those expressing the Al .1 TCRβ chain (B9-A1.1 β) did not. The latter was not due to a blocking effect of TCRβ, since B9 cells expressing both the TCRα and β from Al.l (B9-Al.lαβ) produced the regulatory activity.

Supematants of B9-Al.lα were fractionated by antibody-affinity chromatography on immobilized anti-TCRα antibody and tested for antigen-specific regulatory activity, using a panel of four peptides coupled to SRBC in the assay. As shown in FIG. 9, the soluble activity from B9-Al.lα was bound and eluted from anti-TCRα. The observed specificity for the unsubstituted peptide and the peptide substituted as amino acid 7 (but not those substituted at residues 3 or 10) is characteristic of the antigen-specific activity from Al.l (Bissonette et al., 1991, J. Immunol. 146:28-98-2907) (see FIG. 4). As previously discussed, this specificity correlates with the poly 18 epitope recognized by the Al.l TCR (Bissonette et al., 1991, J. Immunol.146:28-98-2907).

In addition to B9, the Al.l TCRα gene was transduced using retroviral vectors into another poly 18-specific cell line, B 1.1. Following selection with G418, the B 1.1 -A 1.1 α lines were found to produce the antigen-specific immunoregulatory activity, although the original cell line (Bl.l) does not. Thus, two TCRα^+|,+ T cell hybridomas (B9, Bl.l) and one TCRα-^p+ T cell hybridoma

(175.2^ πroduced the poly 18-specific regulatory activity following gene transfer of the Al.l

TCRα gene. To further address whether or not expression of Al.l TCRα, in the absence of TCRβ, can lead to production of the antigen-specific regulatory activity, Al.l TCRα or Al.l

TCRβ was transferred into BWl 100 cells. Since BWl 100 cells lack intact TCRα and β (White et al., 1989, J. Immunol.141:1822-1825), any effect of TCRα gene transfer should be directly attributable to TCRα. As shown in FIG. 10A and B, supematants from BWl 100-Al .1 α, but not

BWl lOO-Al.l β, displayed immunoregulatory activity. As with the other gene transfer experiments, this activity showed the antigenic specificity of Al .1.

6.2.2. GENE TRANSFER OF TCRα CORRELATES WITH PRODUCTION OF A DIRECT AΝTIGEΝ-BIΝDIΝG ACTIVITY

The experiments described herein demonstrate that the released TCRα chain from Al.l binds directly to antigen. It is this distinguishing feature which imparts biological activity to this

TCRα chain versus that of other cells. As shown in FIG. 11 A, supematants from Al.l, and cell lines expressing Al.l TCRα, contain an antigen-binding component as detected in a modified ELISA assay (See Section 6.1.6., supra.. This antigen binding was effectively competed by the unlabeled peptide, but not by two inappropriate peptides (FIG. 1 IB), one of which differs from the antigenic peptide by only a single residue. This substitution has been previously shown to destroy the antigenicity of the peptide for the Al .1 TCR (in an antigen presentation assay) (Boyer et al., 1990, Eur. J. Immunol. 20:2145-2148) and for the A 1.1 -derived regulatory activity (Bissonette et al., 1991, J. Immunol.146:28-98-2907). These results indicate that the antigen- binding activity is the biologically active product of cells expressing Al .1 TCRα, and that the characteristic of antigen-binding by this molecule imparts its biological activity.

6.3 DISCUSSION

The data presented herein unequivocally demonstrate that the TCRα chain is released from Al.l cells, binds to specific antigen (coupled to SRBC in our bioassay), and participates in inducing inhibition of the immune response to SRBC in vitro. The CD4⁺ T cell hybridoma, Al.l, constitutively releases an immunoregulatory activity specific for the synthetic antigen poly 18 and related peptides (Zheng et al., 1988, J. Immunol.14 :1351-1358; Bissonette et al., 1991, J.

Immunol. 146:28-98-2907). Gene transfer of the Al.l TCRα gene into other T cell lines as described herein confers the ability to constitutively produce this antigen-specific regulatory activity (FIGS.3, 8, 9 and 10). Transfer of the Al.l TCRβ chain neither produced nor interfered with this effect (FIG. 8). The antigenic specificity of the soluble activity produced by each transduced recipient T cell line was identical to that of Al.l. This activity was bound by a monoclonal anti-TCRα antibody (FIG. 9) and the eluted activity displayed the same antigenic fine-specificity shown by Al.l supematants (Bissonette et al., 1991, J. Immunol. 146:28-98-

2907).

This example also conslusively demonstrates that the TCRα chain is released from the cell in a form that is independent of the CD3/TCR complex, and which modulates an antigen-specific immune response. Specifically, the transfer of the Al.l TCRα gene into BWl 100, which completely lacks TCRβ, nevertheless resulted in constitutive production of the antigen-specific regulatory activity (FIG. 10). The results described herein also indicate that it is the direct recognition of antigen by the Al .1 TCRα chain (FIG. 11) that gives this molecule activity in the PFC assay, and that other T cells release TCRα chains that fail to directly bind to the epitope and therefore do not display such activity.

While not intended to limit the scope of the invention, at least two models may be proposed at this time for how TCRα mediates the immune response. It is possible, for example, that the complex of TCRα and antigen is immunogenic, resulting in regulatory immune responses to the TCR. Recent studies have indicated that immunization with specific T cells (Lider et al., 1988, Science 212: 181-183; Sun et al., 1988, Nature 112:843-845) or peptides corresponding to regions in the TCR variable region (Vandenbark et al., 1989, Nature 241:541-544; Howell et al., 1989, Science 246:668-670) can result in dramatic immunoregulatory effects in vivo. The regulatory effects associated with the Al.l TCRα chain may represent a form of such TCR "vaccination" in__i_ -

Alternatively, it may be that an unidentified molecule associates with the antigen-binding TCRα chain and this second molecule imparts biological function to the system. For example, Iwata, et al. (Iwata et al., 1989, J. Immunol. 141:3917-3924) have described a soluble complex of a molecule with glycosylation-inhibitory activity and a molecule bearing TCR determinants, released into supematants of some T cell hybridomas.

7. EXAMPLE: PRODUCTION OF BIOLOGICALLY ACTIVE TCR ALPHA CHAIN BY IN VITRO TRANSCRIPTION AND TRANSLATION

7.1 MATERIALS AND METHODS o

7.1.1. TN VTTRO TRANSCRIPTION AND TRANSLATION

DNA oligonucleotide probes were designed based on the known sequences of the Cα and Cβ genes in mice. The probes were synthesized and used to screen a cDNA library prepared from poly 18-specific Al.l hybridoma cells. Full-length TCRα and TCRβ cDNAs from Al.l were characterized and cloned into a Bluescript vector (Stratagene, La Jolla, CA). RNA for both Cα and Cβ was transcribed in vitro using a eukaryotic in vitro transcription system (BRL, Gaithersburg, MD). The RNA was then translated in vitro using a rabbit reticulocyte lysate system (BRL, Gaithersburg, MD). For autoradiography, ^3SS-Met (New England Nuclear, Boston, MA) was included in the translation. For bioassays, the material was translated in the absence of radionucleotides.

The in vitro translated material was then enriched by affinity chromatography with monoclonal anti-TCRα or anti-TCRβ antibodies. Labelled material was analyzed by SDS-PAGE, treated with Enhance, and exposed to X-ray film. Biological activity was assayed as in the system described in Section 6.1.5, supra.

7.2 RESULTS

In addition to the finding in Section 6, supra, that the transfer of the TCRα gene from T cell hybridoma, Al.l, to other T cell lines transferred the ability to produce the antigen-specific immunoregulatory activity, it was important to determine whether a pure, recombinant TCRα protein produced by this gene would have biological activity in this system. Previous studies have shown that mRNA from T cells making such biologically active factors could be translated, in vitro, to yield the regulatory activity. By analogy, then, in vitro translation of TCRα RNA might yield a biologically active protein.

7.2.1. TN VTTRO TRANSCRIPTION AND TRANSLATION PRODUCTS

In vitro transcription and translation yielded proteins of the expected size of 32,000 daltons for an unglycosylated TCRα protein and this protein was found to specifically bind to the anti-TCRα antibody and not the anti-TCRβ antibody (FIGS. 12 and 13). 7.2.2. IMMUNOLOGICAL REGULATORY ACTTVTTY OF TRANSLATION PRODUCT MADE IN V_TRO

The TCRα protein was found to have biological activity in the PFC assay, and this activity was completely bound (and eluted) from the anti-TCRα antibody (FIG. 13A and B). In FIG. 13 A, the immunoregulatory activity from the in vitro translated TCRα was found in filtrates of the anti-TCRβ antibody column and in eluates of the anti-TCRα antibody column. Titration of the active filtrate (anti-TCRβ) and eluate (anti-TCRα) showed the activities to be similar.

While the in vitro transcribed and translated TCRα showed immunoregulatory activity, the protein produced from TCRβ RNA did not.

7.3 DISCUSSION

T experiments detailed above coupled with the studies described in Section 6, supra. demonstrate that recombinant TCRα has biological function. Thus, a TCRα chain gene encoding such a biologically active factor can be expressed in various expression systems to yield a product with biological activity; i_^ ., a TCRα chain that can specifically suppress an immune response directed against its target antigen.

8. EXAMPLE: GENERATION OF T CELL HYBRIDOMAS THAT PRODUCE ACCESSORY COMPONENT ACTIVITY

8.1 MATERIALS AND METHODS

8.1.1. ANIMALS

C57B1/6 animals were purchased from Jackson Laboratories (Bar Harbor, ME). 8.1.2. CELL LINE AND REAGENTS

BWl 100 and T cell hybridomas were maintained in RPMI-1640 plus 10% FCS. Monoclonal antibody directed to CD4 (GK1.5) (Dialynas et al., 1983, Immunol. Rev. 74:29) was obtained from American Type Culture Collection (Rockville, MD). Rabbit and guinea pig complement were obtained from SciCan (Edmonton, Alberta, Canada) and from GIBCO (Grand Island, NY), respectively. Both complement samples were first screened for low background activity before use. Magnetic beads coated with anti-rat IgG antibodies were purchased from Dynal.

8.1.3. GENERATION OF T CELL HYBRIDOMAS

Spleen cells from C57B1/6 mice immunized to SRBC were obtained and treated with an antibody to CD4 (Gkl.5) in the presence of complement. The CD4 depleted cells were subsequently reacted with magnetic beads coated with anti-rat IgG antibodies (Dynalbeads) for the removal of all IgG⁺ cells. The remaining T cells were centrifuged on lympholyte M (Cedarlane Laboratories, PA) and viable T cells were fused with B W 1100 in a 1 : 1 ratio in the presence of

PEG. Hybridomas were selected in the presence of hypoxanthine, thymidine, aminopterin and ouabin. Mouse red blood cells were used as filler cells. Supematants of the wells that scored positive for growth were tested for ability to substitute for accessory supernatant in combination with Al.l supernatant in the PFC assay as described in detail in 6.1.5., supra. Cultures with activity were split into subcultures and the sublines were retested for activity. The sublines with activity were again split and those with activity were cloned at 0.4 cells/well. Clones were rescreened for activity.

8.2 RESULTS

8.2.1. A T CELL HYBRIDOMA PRODUCES

ACCESSORY COMPONENT ACTIVITY

SRBC-imm unized murine spleen cells depleted of CD4⁺ T cells and IgG⁺ B cells were fused with

BWl 100. After cloning, one such T cell hybridoma, 3-1-V, was shown to produce an accessory activity in the culture supematant that when tested in the presence of Al.l supematant could substitute for accessory supematant in mediating antigen-specific immunoregulatory activity (FIG. 1). 3-1-V supematant functions in combination with Al.l supematant irrespective of whether it is the naturally secreted product or the in vjtro translated product of the A 1.1 TCRα gene. Therefore, monoclonal populations of T cells can be obtained that reproducibly and constitutively secrete accessory components for use with antigen-specific TCRα chains.

9. EXAMPLE: cDNA cloning of TCRα gene

A cDNA library can be prepared from T cells using techniques well known in the art. Since the nucleotide sequences encoding the single constant region gene for TCRα (Cα) in human and mice are known (Willson, etal, Immunol. Rev., 101:149-172. 1988), DNA probes homologous to Cα can be synthesized by standard methods and used to screen such libraries to identify TCRα cDNA. Alternatively, oligonucleotide probes derived from specific TCRα sequences could be used as primers in PCR (polymerase chain reaction) method (Mullis, et al, Methods in Enzymol, Hlι335-350, 1987) to generate cDNA of TCRα sequences which can be directory cloned

(Roman-Roman, etal, Eur. J. Immunol, 21:927-933, 1991).

A helper T cell hybridoma, Al.l, has been described above (Fotedar, et al, J. Immunol,

135:3028-3033. 1985) and expresses TCRα and β molecules specific for a synthetic polypeptide designated poly- 18 (poly (Glu-Tyr-Lys-(Glu-Tyr-Ala)₅)) and, in the presence of specific antigen and 1-Ad, releases lymphokines. This T cell hybridoma also constitutively produces a poly- 18- specific soluble factor involved in antigen-specific suppression. It has been shown that the factor produced by A 1.1 displayed the same antigenic fine specificity exhibited by the TCR on the A 1.1 cell (Zheng., et al, J. Immunol, 14Q: 1351-1358, 1988), and that the immunoregulatory activity of the Al .1 derived factor was encoded, at least in part, by the TCRα protein (Bissonette, et al, J. Immunol, 146:2898-2907, 1991).

TCRα cDNA of Al.l cells was cloned from cDNA library using Cα probes. mRNA was isolated from IO⁹ cells by the conventional guanidine-isothiocyanate and cesium chloride method, and recovered by oligo-dT cellulose affinity chromatography. The first strand cDNA was synthesized using an oligo-dT primer and reverse transcriptase and the second strand using DNA polymerase 1 and RNase H. The methylated blunt ended double-strand cDNA was ligated to

EcoRI linkers. Subsequent to EcoRI digestion, the DNA was size selected to agarose gel, purified by spermine precipitation, and cloned into lambda-gtlO. The phage DNA was packaged in vitro by using Gigapack Gold™ (Stratagene). Approximately 200,000 plaques were screened by in situ hybridization using ³²P-radiolabelled Cα probes. The insert DNA from the positive clones were ligated into M13mpl 8 for standard dideoxy sequencing. The complete nucleotide sequence of Al.l TCRα cDNA is shown in Figure 14.

A bee venom phospholipase A₂ (PLA₂ specific glycosylation inhibiting factor (GIF) producing hybridoma, (3B3), has been established that expresses TCRα and β chains specific for PLA₂ (Mori, et al, Int. Immunol, 1:833-842, 1993). This T cell hybridoma constitutively produces immunosuppressive factor, GIF, and PLA₂ binding GIF upon stimulation with homologous antigen and antigen presenting cells. Accumulated evidences show that antigen-binding GIF specifically suppress the immune response to the antigen in vivo, and that the antigen binding GIF may be encoded, at least in part, by TCRα expressing on the cell (Iwata, et al, J. Immunol, 141:3270-3277, 1988; Iwata, et al, J. Immunol, 141:3917-3924, 1989; Mori, et al, Int. Immunol, 1:833-842, 1993).

TCRα cDNA of 3B3 cells was cloned by PCR following the method described by Mullis, et al, Nucl. Acids. Res., &3895-3950, 1980). mRNA was isolated from 5 X IO⁷3B3 cells by using Fast Track™ mRNA isolation kit (Invitrogen). cDNA was generated by using cDNA synthesis system (Pharmacia). After their generation, cDNAs were ligated at the 5'-end and the 3'-end by using T4 ligase (Takara) to construct circular DNA. Oligonucleotide primers encoding murine Cα DNA were synthesized by DNA/RNA synthesizer (Applied Biosystems) using phosphoramidite method (Beaucage, et al, Tetrahedron Lett., 22:1859-1862, 1981).

The sequences of these primers were:

5*-GTGGTCCAGTTGAGGTCTGCAAGA-3'

5'-TTGAAAGTTTAGGTTCATATC-3'

PCR was carried out by Taql DNA polymerase (Takara) in the presence of template cDNA, primers and dNTPs in a thermo cycler. The conditions of PCR were that the denaturation step was 94^βC, 1 min; the annealing step was 54 ^βC, 1 min; and the elongation step was 72°C, 2 min; for 35 cycles. Amplified cDNA was subcloned into pCRlOOO vector of TA cloning system™ (Invitrogen). DNA sequences of the inserts were confirmed by dideoxy sequencing technique (Sanger, etal, Proc. Nat'lAcad. Sci. USA, 24:5463-5467, 1977). Three different TCRα cDNA were cloned and sequenced. Two of them were identified to be originated from the fusion partner cell of 3B3 hybridoma, BW5147 (Chien, etal, Nature, . 12:31-35. 1984; Kumar et al, J. Exp. Med, 170:2183-2188, 1989). The other TCRα cDNA was confirmed not to be expressed in BW5147 by using several PCR primers encoding the different portion of this TCRα gene, which indicated that this TCRα originated from PLA₂-specific T cells. Two of independent clones encoding this TCRα cDNA were isolated and their DNA sequences were confirmed to be identical. The DNA sequence of this 3B3 derived TCRα cDNA is shown in Figure 15. This TCRα cDNA encodes 268 amino acids open reading frame and the first 20 amino acids were identified to be a signal peptide (McEUigott, et al, J. Immunol, 140:4123-4131. 1988). 10. Expression of recombinant TCRα in E.coli - direct expression

10.1 Construction of expression plasmid for TCRα

In order to constract expression plasmid encoding extracellular region of Al.l TCRα, the oligonucletides were used as primers to amplify DNA fragments by PCR. Al.l TCRα cDNA, which encodes amino acid 26 to 240 in extracellular region, and includes a Cla\ restriction site,

Shine Dalgano sequence (Scherer, etal, Nucl. Acids. Res., £ 3895-3950, 1980) and met initiation codon in the 5' terminus, and two termination codons and BamHl restriction site in the 3' terminus, was amplified by two primers using PCR. The sequences of these primers were:

5'-AACATCGATTAATTTATTAAAACTTAAGGAGGTATATTATGAGCCCAGAAT CCCTCAGTGTCC-3^* (SEQ ID NO: 5)

5'-AACGGATCCCTATTATTGAAAGTTTAGGTTCATATC-3' (SEQ ID NO: 6)

Unless otherwise noted, the denaturation step in each PCR cycle was set at 94 °C for 1 min, and elongation was at 72^βC for 2 min. The DNA fragment was digested with Clal and BamHl, and cloned into the expression plasmid pST811 vector carrying a tφ promoter and a tφA terminator (Figure 16, Japanese patent, Kokaikoho 63269983) at the unique Clal and B amUl sites. The new plasmid, called pST811-A1.1 TCRαS5 (Figure 17) was transformed into competent RR1 E. coli host cells. Selection for plasmid containing cells was on the basis of the antibiotic (ampicillin) resistance marker gene carried on the pST811 vector. The DNA sequence of the synthetic oligonucleotides and the entire TCRα gene was confirmed by DNA sequencing of plasmid DNA.

Another expression plasmid containing the different truncated form of Al.l TCRα which encodes 26 to 203 amino acids was constructed using the primer of 3'-terminus:

5'-CGTTGGTCTGTTCGAAGTGGATTATCCGTAGGCAA-3' (SEQ ID NO: 7) The amplified DNA was inserted into pST811 vector and generated the expression plasmid, call pST811-Al.l TCRαS3.

10.2 Culture of E. coli producing TCRα

RRl E. coli carrying plasmid pST81 l-Al.lTCRαS5 or pST81 l-Al.lTCRαS3 were cultured in 50 ml of Luria broth containing 50 μg/ml of ampicillin, and grown ovemight at 37^βC. The inoculum culture was aseptically transferred to 1 liter of M9 broth which was composed of 0.8% glucose, 0.4% casamino acid, 10 mg/liter thiamine and 50 mg/liter ampicillin, and culture for 3 hours at 37°C. At the end of this initial incubation, 40 mg of indoleacrylic acid was added and the culture was incubated for an additional 5 hours at 37°C.

11. Expression of recombinant TCRαin E.coli - fusion expression system

11.1 Construction of expression plasmids

Matsuki, et al. has developed a rat calmodulin expression plasmid, pTCAL7, which carries rat calmodulin cDNA and tφ promoter (Matsuki, et al, Biotech. Appl. Biochem., 12:284-291. 1990) (FIGURE 18). In order to express fusion proteins, several cloning sites were generated at the 3'- end of calmodulin cDNA, which also contains a thrombin cleavage sequence. In detail, calmodulin cDNA inserted into pTCAL7 was amplified by PCR using two primers: one encoded 5'-terminus of calmodulin cDNA containing Clal site, the oth_- one provided the sequence of 3'- terminus of calmodulin cDNA, thrombin cleavage site and both BamHl, Xbal, Notl and BgRl sites.

5'CGCAATCGATTAATTTATTAAAACTTAAGGAGGTATATTATGGCA-3^, (SEQ ID NO:

8)

5'-GAAGATCTGCGGCCGCTCTAGAGGATCCACGCGGAACCAGTTTTGCAGTCATC-3' (SEQ ID NO: 9) The amplified DNA fragment was digested with Clal and BgRl, and inserted into the larger fragment of pTCAL7 plasmid which was digested with Clal and BgRl. The new plasmid, called pCFl (Figure 19) was transformed into competent DH5 E. coli host cells. The DNA sequence of the synthetic oligonucleotides was confirmed by DNA sequencing of the synthetic oligonucleotides was confirmed by DNA sequencing.

11.2 Construction of expression plasmids for TCRα

The DNA fragment of 3B3-derived TCRα extracellular region, which encodes amino acid 21 to 241, was amplified from pCR1000-3B3TCRα plasmid by PCR using two primers containing Xbal site for 5'-terminus, stop codon and Notl site for 3'-terminus respectively. The sequences of those primers were:

5'-GCTCTAGAGGACAGCAAGTGCAGCAGAGT-3' (SEQ ID NO: 10) 5'-AAGCGGCCGCTTAGTTTTGAAAGTTTAGGTT-3^* (SEQ ID NO: 11)

The amplified DNA fragment was ligated with Xbal and Notl digested pCFl plasmid. The new plasmid, called pCFl-3B3TCRα (Figure 20) was transformed into competent W3110 E.coli cells, and the DNA sequence was confirmed.

A 1.1 -derived TCRα cDNA which encodes amino acid 26 to 240 was also inserted into pCFl by the method described above by using two primers; 5'-GATCTAGACAGAGCCCAGAATCCCTCAGTG-3' (SEQ ID NO: 12) S'-AAGCGGCCGCTTATTGAAAGTπAGGTTCATATC-S^* (SEQ ID NO: 13)

and the new expression plasmid pCFl-Al.lTCRαS5 was constructed. A culture of E. coli producing TCRα was described in EXAMPLE 10. In this expression system, the fusion protein of calmodulin-3B3TCRα or calmodulin-Al.lTCRαS5 was expressed in a soluble form, and was approximately 10% of total protein (Figure 21). 12. EXAMPLE: Purification of recombinant TCRα

12.1 Purification and refolding of recombinant TCRα - direct expression system

About 1 g wet weighfof cells expressing Al.l TCRαS5 was suspended in 30 ml of water and broken by French-Press at 8000 psi, 4 times. The broken cell pellet was obtained by centrifugation, 15000 X g, 10 min at 4"C, and washed twice with water. By SDS-polyacrylamide gel electrophoresis analysis, it was evident that the majority of the pellet was Al.l TCRαS5 protein (Figure 22). The pellet fraction containing insoluble Al.l TCRαS5, estimated at 1 to 2 mg, was added to 4 ml of an appropriate mixture such that the final concentrations of components in the mixture were 8 M urea, 50 mM sodium acetate and 0.1 mM EDTA. The mixture was kept at room temperature for 3 hours to solubilize Al.l TCRαS5. Remaining insoluble material was removed by centrifugation, 15000 X g, 10 min at room temperature.

For refolding/reoxidation of the soluble Al.l TCRαS5, the supematant fraction was added slowly, with stirring, to 40 ml of an appropriate mixture such that the final concentration of components in the mixture were 2.5 M urea, 5 mM sodium acetate, 0.01 mM EDTA 50 mM Tris- HC1 pH8.5, 1 mM glutathione (reduced form) and 0.1 mM glutathione (oxidized form). After

16 hours at 4°C, 400 μl of trifluoroacetate (TFA) was added in the mixture. The mixture was applied at room temperature to an reverse phase Vydac C4 column (1 X 10 cm) equilibrated in 0.1% (v/v) TF A/water, at a flow rate of 1 ml per min. After a sample application, the column was washed with 10% (v/v) acetonitrile in 0.1% TFA/water. Al .1 TCRαS5 material, which was bound to the column, was eluted with a gradient of 30 to 40% (v/v) acetonitrile in 0.1%

TFA/water. Aliquots from fractions collected from the C4 column were analyzed by SDS- polyacrylamide gel electrophoresis without reduction of the samples and purified Al.l TCRαS5 protein was identified in fraction 25 to 30. Those fractions were pooled and dried in vacuum condition. The dried protein was dissolved in PBS, however other similar buffers could be used.

Al.l TCRα S3 was purified and refolded by the same procedure described above. 12.2 Purification of recombinant TCRα - fusion expression system

About 1 g wet weight of cells expressing 3B3 TCRα was suspended 100 ml of 50 mM Tris-HCl buffer, pH 8.0, and broken by French Press at 8000 psi, 4 times. The supematant was collected by centrifugation, 15000 X g, 10 min at 4°C, and dialyzed against 50 mM Tris-HCl buffer, pH 8.0, containing 2 mM glutathione (reduced form) and 0.2 mM glutathione (oxidized form) at 4^βC for ovemight. The sample solution was added an appropriate mixture such that the final concentration of components in the mixture were 150 mM NaCl, 1 mM CaCl₂ and 5 mM MgCl₂. This mixture was applied at 4"C to a phenyl sepharose 6 fast flow low sub column (Pharmacia, 3 X 6 cm) equilibrated with 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 1 mM CaCl₂ and 5 mM MgCl₂ and ran at a flow rate of 0.5 ml per min. After washing the column with the same buffer, calmodulin-TCRα fusion protein was eluted with 50 mM Tris-HCl pH8.0 containing 4 mM EDTA at a flow rate of 0.5 ml per min. Aliquots of fractions was analyzed by SDS- polyacrylamide gel electrophoresis, which indicated that the fusion protein was highly enriched (Figure 23).

The elution fraction was dialyzed against 50 mM Tris-HCl buffer pH8.0 containing 150 mM

NaCl at 4^βC for ovemight. CaCl₂ was added to the 50 ml of dialyzed fraction to the final 2.5 mM concentration, and 1% of thrombin (Sigma) was added and incubated at 25 ^βC for 6 hours to digest the fusion protein. In order to stop digestion, EDTA was added to a final concentration of 4mM to the reaction mixture which was then dialyzed against 50 mM Tris-HCl buffer pH8.0. After dialysis, the mixture was concentrated to 5 ml by ultrafiltration and applied to TSK G2000 gel filtration column (Toyo Soda) equilibrated with 2 X PBS buffer and fractionated by HPLC at flow rate of 3 ml per min. The 2 mg of purified 3B3 TCRα protein was collected in fraction 24 to 26. 13. EXAMPLE: Biological activities of recombinant TCRα

13.1 In Vitro immunosuppressive activity of recombinant Al.l TCRα

To assess bioactivity of recombinant Al.l TCRα, a simple antigen-specific system was employed (Zheng, etal, J. Immunol, 40:1351-1358, 1988; Zheng, etal, Proc. Nat'lAcad. Sci. USA, £63758-3762, 1989; Bissonette, et al, J. Immunol, 1462898-2907, 1991). 1 X IO⁷ spleen cells from C57B1 6 or C57B1 10 mice were placed into 1 ml cultures in RPM11640 supplemented with 10% FCS and 5 X 10^$ M 2-mercaptoethanol (2-ME). Each culture received 50 μl 1% SRBC coupled with poly- 18 (EYK(EYA)₅) or a substituted polypeptide. Suppressive activity was assessed by adding recombinant TCRα with or without an "accessory component" (10-15%) to the cultures. This accessory component was prepared from cultures of murine T cells from animals immunized to SRBC, followed by absoφtion of the supematant with SRBC. The cultures were incubated at 37°C in humidified 92% air/8% C02 and anti-SRBC PFC (plaque forming cells) assessed 5 days later. In all of the experiments shown herein, Al.l cell cultured supematant was used as a positive control.

The immunosuppressive activity of recombinant Al.l TCRαS5 (c.f. EXAMPLE 10.1) was observed in a dose dependent manner which is shown in Figure 24a. This figure shows the results from two coded experiments, in which the recombinant TCRα molecule was titrated, and then each dilution was coded. The immunosuppressive activity of recombinant Al.l TCRα S3 (c.f. EXAMPLE 10.1) was also observed in a dose dependent manner (Figure 24b).

13.2 Antigen specific immunosuppressive activity of recombinant TCRα

The fine antigenic specificity of the Al.l-derived TCRα chain has been described (Bissonnette, et al, J. Immunol, 146:2898-2907. 1991; Green, et al, Proc. Nat'lAcad. Sci. USA, £8:8475- 8479, 1991). Immunosuppressive activity of the TCRα chain was observed when poly- 18 or EYKEYAEYAEYAEYA was used, but not detected when a substituted peptide such as EYAEYAEYAEYAEYA and EYKEYAEYAAYAEYA was employed. Thus, the antigenic specificity of the recombinant Al.l TCRαS5 wais assessed by using these four peptides. The recombinant TCRα protein showed suppressive activity at a final concentration of 4 X 10"'° M only with poly- 18 or EYKEYAEYAEYAEYA (Figure 25). The figure represents the data from four experiments, in which each of the peptides shown on the left (or saline) were added into coded tubes. The coded samples were then used for coupling to SRBC for the assay culture in the presence of accessory supematant. No suppression was observed in any case in the absence of accessory supematant. The codes for each experiment were different.

13.3 In vivo immunosuppressive activity of recombinant TCRα

In order to assess whether the recombinant TCRα regulate the immune response in vivo, recombinant 3B3 TCRα protein was administered to mice which were immunized with bee venom PLA₂.

As an antigen, DNP (dinitrophenyl) derivatives of bee venom PLA₂ (Sigma) were prepared by standard procedure. Balb/C mice were immunized by an i.p. injection of 10 μg of DNP-PLA₂ absorbed to 2 mg of alum. Recombinant 3B3 TCRα was injected i.p. on day -1, 0, 2, 4, 6 at a dose of 5 μg/injection, and control mice received PBS alone. Two weeks after immunization, serum was obtained from each animal and anti DNP-lgGl and anti DNP-lgE were measured by ELISA (Iwata, etal, J. Immunol, 141:3270-3277. 1988). Anti-DNP-IgGl and anti-DNP-IgE were significantly suppressed (Table 1). To evaluate antigenic specificity, DNP-ovalbumin was used as an antigen and the activity of recombinant 3B3 TCRα was assessed. As expected, anti- DNP antibody response to DNP-OVA was not affected by the treatment of immunized mice with the recombinant TCRα.

These results indicates the immunosuppressive activity of recombinant TCRα protein in an antigen specific manner. None of the animals had adverse reactions to the recombinant TCRα protein, indicating potential use of the recombinant TCRα protein to suppress immune responses which mediate disorders such as autoimmune diseases and allergy. TABLE 1

SUPPRESSION OF THE ANTI-HAPTEN ANTTBODY

RESPONSE OF Balb/c MICE BY RECOMBINANT 3B3 TCRα

|Anti-DNP IgE(μg/ml)^a Anti-DNP IgGl(μg/ml)*

PBS(N=4) p.50±0.26 56.8±9.8 3B3TCR α (N=6) |θ.l2±0.03 ^b 5.8±2.6 ^b

a) 2 weeks after immunization with alum-absorbed DNP-PLA₂ b) p(0.05

The present invention is not to be limited in scope by the exemplified embodiments which are intended as illustrations of single aspects of the invention and any microorganisms which are functionally equivalent are within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

All publications cited herein are incoφorated by reference in their entirety.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: LA JOLLA INSTITUTE FOR ALLERGY AND IMMUNOLOGY and KIRIN BEER KABUSHIKI KAISHA (ii) TITLE OF INVENTION: METHOD FOR ANTIGEN-SPECIFIC IMMUNOREGULATION BY T-CELL ALPHA CHAIN (iii) NUMBER OF SEQUENCES: 28 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Spensley Horn Jubas & Lubitz

(B) STREET: 1880 Century Park East, Suite 500

(C) CITY: Los Angeles

(D) STATE: California

(E) COUNTRY: USA

(F) ZIP: 90067

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: PatentIn Release #1.0, Version #1.25 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: PCT/

(B) FILING DATE: 12 December 1994

(C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Wetherell, Jr., Ph.D., John R.

(B) REGISTRATION NUMBER: 31,678

(C) REFERENCE/DOCKET NUMBER: FD-3085 (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (619) 455-5100

(B) TELEFAX: (619) 455-5110

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 5 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..5

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l: Lys Val Pro Arg Gly 1 5

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..15 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..18

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu 1 5 10 15

Tyr Lys

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..18 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Ala Tyr Ala Glu Tyr Ala Glu 1 5 10 15

Tyr Lys

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 63 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..63

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: AACATCGATT AATTTATTAA AACTTAAGGA GGTATATTAT GAGCCCAGAA TCCCTCAGTG 60 TCC 63

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 36 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..36 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: AACGGATCCC TATTATTGAA AGTTTAGGTT CATATC 36

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 35 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..35

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CGTTGGTCTG TTCGAAGTGG ATTATCCGTA GGCAA 35

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 45 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..45

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: CGCAATCGAT TAATTTATTA AAACTTAAGG AGGTATATTA TGGCA 45 (2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 53 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..53

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: GAAGATCTGC GGCCGCTCTA GAGGATCCAC GCGGAACCAG TTTTGCAGTC ATC 53

(2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 29 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..29

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: GCTCTAGAGG ACAGCAAGTG CAGCAGAGT 29 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..31

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: AAGCGGCCGC TTAGTTTTGA AAGTTTAGGT T 31

(2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 30 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..30

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: GATCTAGACA GAGCCCAGAA TCCCTCAGTG 30 (2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 34 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..34

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13: AAGCGGCCGC TTATTGAAAG TTTAGGTTCA TATC 34

(2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1092 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..1092

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

GCTAGCAAAG CTGCTTTTTA GTGTTTCCTA TAGGAGATGT CAAAACTTAT GAACAGCAAC 60

TATATGAGTT TAGGATTGAG AATCTAATCC ACAGCGAAGA GGGAAGAGGA GAGAATGAAA 120

TCCTTGAGTG TTTTACTAGT GGTCCTGTGG CTCCAGTTAA ACTGCGTGAG GAGCCAGCAG 180

AAGGTGCAGC AGAGCCCAGA ATCCCTCAGT GTCCCAGAGA GCATGGCCTC TCTCAACTGC 240

ACTTCAAGTG ATCGTAATTT TCAGTACTTC TGGTGGTACA GACAGCATTC TGGAGAAGGC 300

CCCAAGGCAC TGATGTCCAT CTTCTCTGAT GGTGACAAGA AAGAAGGCAG ATTCACAGCT 360

ACCTCAATA AGGCCAGCCT GCATGTTTCC CTGCACATCA GAGACTCCCA GCCCAGTGAC 420

TCCGCTCTCT ACTTCTGTGC AGCTAGTGAG CCGGGTTACC AGAACTTCTA TTTTGGGAAA 480

GGAACAAGTT TGACGTGCAT TCCAAACGAC ATCCAGAACC CAGAACCTGC TGTGTACCAG 540

TTAAAAGATC CTCGGTCTCA GGACAGCACC CTCTGCCTGT TCACCGACTT TGACTCCCAA 600

ATCAATGTGC CGAAAACCAT GGAATCTGGA ACGTTCATCA CTGACAAAAC TGTGCTGGAC 660

ATGAAAGCTA TGGATTCCAA GAGCAATGGG GCCATTGCCT GGAGCAACCA GACAAGCTTC 720

ACCTGCCAAG ATATCTTCAA AGAGACCAAC GCCACCTACC CCAGTTCAGA CGTTCCCTGT 780

GATGCCACGT TGACTGACAA AAGCTTTGAA ACAGATATGA ACCTAAACTT TCAAAACCTG 840

TCAGTTATGG GACTCCGAAT CCTCCTGCTG AAAGTAGCCG GATTTAACCT GCTCATGACG 900

CTGAGGCTGT GGTCCAGTTG AGGTCTGCAA GACTGACAGA GCCTGACTCC CAAGCTCCAT 960

CCTCCTCACC CCTCCGCTCC TTCTTCAAGC CAAAAGGAGC CCTCCCACCT CGTCAAGACG 1020

GCTGTCTGGG GTCTGGTTGG CCCTGATTCA CAATCCCACC TGGATCTCCC AGATTTGTGA 1080

GGAAGGTTGC TG 1092

(2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE :

(A) NAME/KEY: Peptide

(B) LOCATION: 1..15

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Ala Tyr Ala Glu Tyr Ala 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..18

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu 1 5 10 15

Tyr Ala

(2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 12 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE :

(A) NAME/KEY: Peptide

(B) LOCATION: 1..12

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17: Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala 1 5 10

(2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..15

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE :

(A) NAME/KEY: Peptide

(B) LOCATION: 1..15

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Lys 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..18

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu 1 5 10 15

Tyr Lys

(2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE :

(A) NAME/KEY: Peptide

(B) LOCATION: 1..15

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

Glu Tyr Lys Glu Tyr Ala Glu Ala Ala Glu Tyr Ala Glu Tyr Ala 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..15

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala Glu Tyr Ala 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:23: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE :

(A) NAME/KEY: Peptide

(B) LOCATION: 1..15

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

Glu Tyr Lys Glu Tyr Ala Glu Tyr Ala Ala Tyr Ala Glu Tyr Ala 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:24: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 16 amino acids

(B) TYPE: amino acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE:

(A) NAME/KEY: Peptide

(B) LOCATION: 1..16

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

Asp Tyr Thr Gly Lys lie Met Trp Thr Pro Pro Ala lie Phe Lys Ser 1 5 10 15

(2) INFORMATION FOR SEQ ID NO:25: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 696 base pairs

(B) TYPE: nucleic acid o

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (ii) MOLECULE TYPE: peptide (ix) FEATURE :

(A) NAME/KEY: CDS

(B) LOCATION: 37..681

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:25: CATCGATTAA TTTATTAAAA CTTAAGGAGG TATATT ATG AGC CCA GAA TCC CTC 54

Met Ser Pro Glu Ser Leu 1 5

AGT GTC CCA GAG AGC ATG GCC TCT CTC AAC TGC ACT TCA AGT GAT CGT 102

Ser Val Pro Glu Ser Met Ala Ser Leu Asn Cys Thr Ser Ser Asp Arg

10 15 20

AAT TTT CAG TAC TTC TGG TGG TAC AGA CAG CAT TCT GGA GAA GGC CCC 150 Asn Phe Gin Tyr Phe Trp Trp Tyr Arg Gin His Ser Gly Glu Gly Pro

25 30 35

AAG GCA CTG ATG TCC ATC TTC TCT GAT GGT GAC AAG AAA GAA GGC AGA 198 Lys Ala Leu Met Ser lie Phe Ser Asp Gly Asp Lys Lys Glu Gly Arg

40 45 50

TTC ACA GCT CAC CTC AAT AAG GCC AGC CTG CAT GTT TCC CTG CAC ATC 246 Phe Thr Ala His Leu Asn Lys Ala Ser Leu His Val Ser Leu His lie 55 60 65 70

AGA GAC TCC CAG CCC AGT GAC TCC GCT CTC TAC TTC TGT GCA GCT AGT 294 Arg Asp Ser Gin Pro Ser Asp Ser Ala Leu Tyr Phe Cys Ala Ala Ser

75 80 85

GAG CCG GGT TAC CAG AAC TTC TAT TTT GGG AAA GGA ACA AGT TTG ACG 342 Glu Pro Gly Tyr Gin Asn Phe Tyr Phe Gly Lys Gly Thr Ser Leu Thr

90 95 100

TGC ATT CCA AAC GAC ATC CAG AAC CCA GAA CCT GCT GTG TAC CAG TTA 390 Cys lie Pro Asn Asp lie Gin Asn Pro Glu Pro Ala Val Tyr Gin Leu

105 110 115

AAA GAT CCT CGG TCT CAG GAC AGC ACC CTC TGC CTG TTC ACC GAC TTT 438 Lys Asp Pro Arg Ser Gin Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe 120 125 130

GAC TCC CAA ATC AAT GTG CCG AAA ACC ATG GAA TCT GGA ACG TTC ATC 486 Asp Ser Gin lie Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe lie 135 140 145 150

ACT GAC AAA ACT GTG CTG GAC ATG AAA GCT ATG GAT TCC AAG AGC AAT 534 Thr Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn

155 160 165

GGG GCC ATT GCC TGG AGC AAC CAG ACA AGC TTC ACC TGC CAA GAT ATC 582 Gly Ala lie Ala Trp Ser Asn Gin Thr Ser Phe Thr Cys Gin Asp lie

170 175 180

TTC AAA GAG ACC AAC GCC ACC TAC CCC AGT TCA GAC GTT CCC TGT GAT 630 Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp

185 190 195

GCC ACG TTG ACC GAG AAA AGC TTT GAA ACA GAT ATG AAC CTA AAC TTT 678 Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe

200 205 210

CAA TAATAGGGAT CCGTT 696

Gin 215

(2) INFORMATION FOR SEQ ID NO:26:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 215 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26: Met Ser Pro Glu Ser Leu Ser Val Pro Glu Ser Met Ala Ser Leu Asn

1 5 10 15

Cys Thr Ser Ser Asp Arg Asn Phe Gin Tyr Phe Trp Trp Tyr Arg Gin

20 25 30

His Ser Gly Glu Gly Pro Lys Ala Leu Met Ser lie Phe Ser Asp Gly

35 40 45

Asp Lys Lys Glu Gly Arg Phe Thr Ala His Leu Asn Lys Ala Ser Leu

50 55 60

His Val Ser Leu His lie Arg Asp Ser Gin Pro Ser Asp Ser Ala Leu 65 70 75 80

Tyr Phe Cys Ala Ala Ser Glu Pro Gly Tyr Gin Asn Phe Tyr Phe Gly

85 90 95

Lys Gly Thr Ser Leu Thr Cys lie Pro Asn Asp lie Gin Asn Pro Glu

100 105 110

Pro Ala Val Tyr Gin Leu Lys Asp Pro Arg Ser Gin Asp Ser Thr Leu

115 120 125

Cys Leu Phe Thr Asp Phe Asp Ser Gin lie Asn Val Pro Lys Thr Met

130 135 140

Glu Ser Gly Thr Phe lie Thr Asp Lys Thr Val Leu Asp Met Lys Ala 145 150 155 160

Met Asp Ser Lys Ser Asn Gly Ala lie Ala Trp Ser Asn Gin Thr Ser

165 170 175

Phe Thr Cys Gin Asp lie Phe Lys Glu Thr Asn Ala Thr Tyr Pro Ser

180 185 190

Ser Asp Val Pro Cys Asp Ala Thr Leu Thr Glu Lys Ser Phe Glu Thr

195 200 205

Asp Met Asn Leu Asn Phe Gin 210 215 (2) INFORMATION FOR SEQ ID NO:27: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 807 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE:

(A) NAME/KEY: CDS

(B) LOCATION: 1..804

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:27: ATG AAG AGC CTG CTG AGC TCT CTG CTG GGG CTT CTG TGC ACC CAG GTT 48 Met Lys Ser Leu Leu Ser Ser Leu Leu Gly Leu Leu Cys Thr Gin Val

1 5 10 15

TGC TGG GTG AAA GGA CAG CAA GTG CAG CAG AGT CCT GCA TCC TTG GTT 96 Cys Trp Val Lys Gly Gin Gin Val Gin Gin Ser Pro Ala Ser Leu Val

20 25 30

CTG CAG GAG GGG GAG AAC GCA GAG CTG CAG TGT AAC TTT TCC TCC ACA 144

Leu Gin Glu Gly Glu Asn Ala Glu Leu Gin Cys Asn Phe Ser Ser Thr

35 40 45

GCA ACC CAG CTG CAG TGG TTT TAC CAA CGT CCT GGG GGA AGC CTC GTC 192 Ala Thr Gin Leu Gin Trp Phe Tyr Gin Arg Pro Gly Gly Ser Leu Val

50 55 60

AGC CTG TTG TAC AAT CCT TCT GGG ACA AAG CAC ACT GGA AGA CTG ACA 2 0

Ser Leu Leu Tyr Asn Pro Ser Gly Thr Lys His Thr Gly Arg Leu Thr 65 70 75 80

TCC ACC ACA GTC ACT AAA GAA CGT CGC AGC TCT TTG CAC ATT TCC TCC 288

Ser Thr Thr Val Thr Lys Glu Arg Arg Ser Ser Leu His lie Ser Ser 85 90 95 TCC CAG ATC ACA GAC TCA GGC ACT TAT TTC TGT GCT ATG GAA GAC ACT 336

Ser Gin He Thr Asp Ser Gly Thr Tyr Phe Cys Ala Met Glu Asp Thr

100 105 110

GGA GCT AAC ACT GGA AAG CTC ACG TTT GGA CAC GGC ACC ATC CTT AGG 384

Gly Ala Asn Thr Gly Lys Leu Thr Phe Gly His Gly Thr He Leu Arg

115 120 125

GTC CAT CCA AAC ATC CAG AAC CCA GAA CCT GCT GTG TAC CAG TTA AAA 432

Val His Pro Asn He Gin Asn Pro Glu Pro Ala Val Tyr Gin Leu Lys

130 135 140

GAT CCT CGG TCT CAG GAC AGC ACC CTC TGC CTG TTC ACC GAC TTT GAC 480

Asp Pro Arg Ser Gin Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp 145 150 155 160

TCC CAA ATC AAT GTG CCG AAA ACC ATG GAA TCT GGA ACG TTC ATC ACT 528

Ser Gin He Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe He Thr

165 170 175

GAC AAA ACT GTG CTG GAC ATG AAA GCT ATG GAT TCC AAG AGC AAT GGG 576 Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly

180 185 190

GCC ATT GCC TGG AGC AAC CAG ACA AGC TTC ACC TGC CAA GAT ATC TTC 624

Ala He Ala Trp Ser Asn Gin Thr Ser Phe Thr Cys Gin Asp He Phe

195 200 205

AAA GAG ACC AAC GCC ACC TAC CCC AGT TCA GAC GTT CCC TGT GAT GCC 672

Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala

210 215 220

ACG TTG ACC GAG AAA AGC TTT GAA ACA GAT ATG AAC CTA AAC TTT CAA 720

Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gin 225 230 235 240

AAC CTG TCA GTT ATG GGA CTC CGA ATC CTC CTG CTG AAA GTA GCG GGA 768

Asn Leu Ser Val Met Gly Leu Arg He Leu Leu Leu Lys Val Ala Gly 245 250 255 TTT AAC CTG CTC ATG ACG CTG AGG CTG TGG TCC AGT TGA 807

Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 260 265

(2) INFORMATION FOR SEQ ID NO:28:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 268 amino acids

(B) TYPE: amino acid (D) TOPOLOGY: linear

(ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO-.28: Met Lys Ser Leu Leu Ser Ser Leu Leu Gly Leu Leu Cys Thr Gin Val

1 5 10 15

Cys Trp Val Lys Gly Gin Gin Val Gin Gin Ser Pro Ala Ser Leu Val

20 25 30

Leu Gin Glu Gly Glu Asn Ala Glu Leu Gin Cys Asn Phe Ser Ser Thr

35 40 45

Ala Thr Gin Leu Gin Trp Phe Tyr Gin Arg Pro Gly Gly Ser Leu Val

50 55 60

Ser Leu Leu Tyr Asn Pro Ser Gly Thr Lys His Thr Gly Arg Leu Thr 65 70 .75 80

Ser Thr Thr Val Thr Lys Glu Arg Arg Ser Ser Leu His He Ser Ser

85 90 95

Ser Gin He Thr Asp Ser Gly Thr Tyr Phe Cys Ala Met Glu Asp Thr

100 105 _.. 110

Gly Ala Asn Thr Gly Lys Leu Thr Phe Gly His Gly Thr He Leu Arg

115 120 125

Val His Pro Asn He Gin Asn Pro Glu Pro Ala Val Tyr Gin Leu Lys 130 135 140 Asp Pro Arg Ser Gin Asp Ser Thr Leu Cys Leu Phe Thr Asp Phe Asp 145 150 155 160

Ser Gin He Asn Val Pro Lys Thr Met Glu Ser Gly Thr Phe He Thr

165 170 175

Asp Lys Thr Val Leu Asp Met Lys Ala Met Asp Ser Lys Ser Asn Gly

180 185 190

Ala He Ala Trp Ser Asn Gin Thr Ser Phe Thr Cys Gin Asp He Phe

195 200 205

Lys Glu Thr Asn Ala Thr Tyr Pro Ser Ser Asp Val Pro Cys Asp Ala

210 215 220

Thr Leu Thr Glu Lys Ser Phe Glu Thr Asp Met Asn Leu Asn Phe Gin 225 230 235 240

Asn Leu Ser Val Met Gly Leu Arg He Leu Leu Leu Lys Val Ala Gly

245 250 255

Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 260 265

Claims

CLAIMS:

1. A method for modulating an immune response to an antigen, comprising contacting the antigen with an effective amount of TCRα chain specific for the antigen so that the TCRα chain modulates the immune response in an antigen-specific manner.

2. The method of Claim 1 in which the TCRα chain is contacted with the antigen in the presence of an accessory component.

3. The method of Claim 2 in which the accessory component comprises soluble factors produced by a stimulated T cell which, in the absence of TCRα, has no immune modulatory effect.

4. The method of Claim 3 in which the accessory component comprises soluble factors produced by a stimulated T cell depleted of soluble TCRα chains.

5. The method of Claim 4 in whr the accessory component is produced by a T cell hybridoma.

6. The method according to Claim 1, 2, 3, 4 or 5 in which the TCRα chain suppresses the immune response in an antigen-specific manner.

7. The method according to Claim 1, 2, 3, 4 or 5 in which the TCRα chain augments the immune response in an antigen-specific manner.

8. A method for augmenting an antigen-specific immune response suppressed by a TCRα chain, comprising contacting the TCRα chain with an antibody specific for the TCRα chain in an amount effective to bind the TCRα chain, thereby augmenting the immune response.

9. The method of Claim 8 in which the antibody is immobilized and the TCRα chain is removed.

10. The method of Claim 8 in which the antibody binds to the TCRα chain and neutralizes its activity.

11. A method for augmenting an antigen-specific immune response suppressed by a TCRα chain secreted by a T cell, comprising contacting the T cell with an antisense oligonucleotide complementary to the TCRα chain message, so that expression and secretion of the TCRα chain is inhibited.

12. The method of Claim 11 in which the antisense oligonucleotide complements the variable region of the TCRα chain message.

13. A method for detecting in a body fluid a soluble antigen-specific TCRα chain which modulates an immune response to the antigen, comprising:

(a) exposing a test culture of spleen cells containing the antigen coupled to a lysable carrier, to a sample suspected of containing the TCRα chain in the presence of the accessory component for a time sufficient for an immune response to occur as indicated by PFC generation; and

(b) comparing the PFC generation in the test culture with a control culture without sample, in which a decrease in PFC generation as compared to the control indicates the presence of a TCRα chain that suppresses the immune response in an antigen-specific manner and an increase in PFC generation as compared to the control indicates the presence of a TCRα chain that augments the immune response in an antigen-specific manner.

14. The method of Claim 13, in which the TCRα chain suppresses the immune response in an antigen-specific manner.

15. The method of Claim 13, in which the TCRα chain augments the immune response in an antigen-specific manner.

16. A purified TCRα chain which is capable of binding to an antigen and which modulates an immune response to the antigen as evaluated in an in vitro assay system comprising:

(a) exposing a test culture of spleen cells containing the antigen coupled to a lysable carrier, to the purified TCRα chain in the presence of the accessory component, for a time sufficient for an immune response to occur as indicated by PFC generation; and

(b) comparing the PFC generation in the test culture with a control culture without the purified TCRα chain, in which a decrease in PFC generation as compared to the control indicates that the TCRα chain suppresses the immune response in an antigen-specific manner, and an increase in PFC generation as compared to the control indicates that the TCRα chain augments the immune response in an antigen-specific manner.

17. The purified TCRα chain of Claim 16 which suppresses the immune response in an antigen-specific manner.

18. The purified TCRα chain of Claim 16 which augments the immune response in an antigen-specific manner.

19. A substantially pure fusion polypeptide of the formula:

R1-[X1]-R2; wherein Rl is a carrier peptide, XI is a proteolytic enzyme recognition sequence and R2 is a polypeptide encoded by a structural gene.

20. The fusion polypeptide of claim 19, wherein the carrier peptide is calmodulin.

21. The fusion polypeptide of claim 19, wherein the polypeptide encoded by the structural gene is T-cell receptor alpha (TCRα) chain.

22. The fusion polypeptide of claim 21, wherein the TCRα chain is the extracellular membrane domain of the polypeptide.

23. The fusion polypeptide of claim 19, wherein the proteolytic enzyme recognition sequence is recognized by thrombin.

24. The fusion polypeptide of claim 23, wherein the proteolytic enzyme recognition sequence is

Lys-Val-Pro-Arg-Gly (SEQ ID NO: 1).

25. An isolated polynucleotide sequence which encodes the fusion polypeptide of claim 19.

26. A recombinant expression vector containing the polynucleotide sequence of claim 25.

27. The vector of claim 26, wherein the vector is a virus.

28. The vector of claim 26, wherein the vector is a plasmid.

29. The vector of claim 28, wherein the vector contains a phenotypic selection marker DNA sequence.

30. The method of claim 29, wherein the phenotypic selection marker is selected from the group consisting of beta- lactamase and chloramphenicol acetyltransferase.

31. A host cell containing the vector of claim 26.

32. The host cell of claim 31 , wherein the host cell is eukaryotic.

33. The host cell of claim 31 , wherein the host cell is prokaryotic.

34. The host cell of claim 33, wherein the prokaryotic cell is selected from the group consisting of Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa.

35. A method of producing substantially pure, biologically active TCRα chain which comprises:

(a) culturing a host cell transformed with a vector containing in operable linkage, a polynucleotide sequence encoding TCRα chain; and

(b) isolating the substantially pure, biologically active TCRα chain.

36. The method of claim 35, wherein the polynucleotide encoding TCRα chain is operably linked to a polynucleotide encoding a polypeptide of the formula:

R1-[X1]; wherein Rl is a carrier peptide and XI is a proteolytic enzyme recognition sequence.

37. The method of claim 36, wherein the carrier peptide is calmodulin.

38. The method of claim 36, wherein the proteolytic enzyme recognition sequence is recognized by thrombin.

39. The method of claim 38, wherein the protease cleavage sequence is Lys-Val-Pro-Arg- Gly (SEQ ID NO: 1).

40. The method of claim 35, wherein the TCRα chain is the extracellular membrane domain of the polypeptide.

41. The method of claim 36, further comprising cleaving the TCRα chain portion from the fusion peptide.

42. A pharmaceutical composition comprising immunosuppressive amounts of substantially purified TCRα chain and a pharmaceutically inert carrier.

43. The pharmaceutical composition of claim 42, wherein the TCRα chain is the extracellular membrane domain.

44. The method of any of claims 1, 8, or 13, wherein the TCRα chain is the extracellular membrane domain.

45. The TCRα chain of claim 16, wherein the TCRα chain is the extracellular membrane domain.