JPH06505164A - Epitope mapping of the c33c region of HCV - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Epitope mapping of the c33c region of HCV Background of the invention Koch's estimates for definitive identification of the causative agent of non-A, non-B hepatitis were not satisfactory. However, hepatitis C virus (HCVI) has been implicated as the main etiological agent of this disease. There is general agreement that HC ■ Genome consists of capsid, matrix and an N-terminal structural gene for the envelope and a carboxy-oriented nonstructural gene. It is organized like a bracken virus with a single reading frame containing. The nucleotide and corresponding amino acid sequences for the nonstructural genes are EP031B 216 (Houghton). Contains sequences for structural genes. Other sequences are disclosed in EPO388232 and EPQ39B74B. There is. Some HCV proteins of diagnostic interest include nonstructural gene products, i.e. amino acids. NS3, which contains amino acid residues from about 1050 to 1640. Of particular interest are , c33c contained within NS3, containing amino acid residues 1l92 to 1457. This is an area known as This is an individual's diagnostically detectable resistance to it. Due to the presence of antigenic determinants that can generate This is because it has been disclosed so far that it has real value. Summary of the invention In the development of an immune response in a viral infection, the earliest and usually strongest response is It is expected that this response will be induced for structural proteins. This is because these molecules are generally exposed to cells of the immune system during intracellular proliferation. others Therefore, the major epitopes of HCV are the capsid, matrix and envelope proteins. would have been expected to be included in the package.

However, a large panel of sera from patients presenting with non-A, non-B hepatitis A significant number of reactions were revealed only for child products. In particular, some serums Remerase chain reaction (PCR) amplification and cloning into λgtll library NS3 region obtained as a beta-galactosidase-c33c fusion product by It was positive only for the differential gene.

c33c to develop improved immunoassays that utilize derivatives of c33c. Various structures of c-sequence proteins have been constructed and tested. Surprisingly, c All 102 immunodominant epitopes discovered in the entire 33c region are located at the carboxy terminal end. It was discovered that it is contained in terminal amino acids.

In the present invention, these 102 carboxy Recombinant proteins are provided that have antigenic determinants contained in their terminal portions. alternative tool In some cases, the recombinant fusion protein is a synthetic peptide containing substantially the same sequence. Replace.

said amino acid sequence, or an M-replacement protein or synthetic exhibiting substantially the same antigenicity. The peptide is combined with an antibody against HCV contained in a patient serum specimen on a solid support. The terminal carboxy 102 of the c33C fragment of the NS3 gene product was coated. Recombinant proteins or synthetic peptides contained in amino acids, or HCV N Antigen of the carboxy-terminal 102 amino acids of the c33c fragment of the S3 gene product The step of contacting the recombinant protein or synthetic peptide that substantially contains the determinant. step and, more specifically, its carboxy-terminus 1 for the c33c fragment. A patient serum standard specific for the 02 amino acid fragment or its antigenic equivalent. Incubate for sufficient time to allow binding with antibodies contained in the book. separating the bound antibody from unbound antibody; and It is used in immunoassays, which consists of the step of detecting antibodies.

Figure 1 I [Skin Figure 1 shows the various fusion proteins obtained from the cloning of selected restriction fragments. This is a map showing the end of the park.

Figure 2 (sequence identification N118 and N119) shows the 102 amino acid flag of NS3. The nucleotide and corresponding derived amino acid sequences of ment.

Figure 3 shows the positions of the various fragments amplified by the indicated primer pairs. This is a nucleotide map.

New The c33c fragment of NS3 contains appropriate proteins flanking the c33cti region. After polymerase chain reaction (PCR) amplification using primers, the known) (CV was cloned from the source into λgtll. A recombinant c33c fragment was then created. and expressed into the λgtll and pcEX vectors. The fusion protein is then solidified. transferred to a phase support and tested for antigenicity against a panel of HCV antibody-containing sera. It was done. Details of molecular cloning and expression of these fusion proteins are provided in the Examples. It's being ignored. c33c as illustrated in Figure 15 of EPO 318216. As shown, it starts from the 484th amino acid (valine) and ends at the 785th amino acid. It consists of a 102 amino acid sequence ending with a noic acid (threonine).

A comparison of fusion proteins containing various lengths of c33c inserts showed that all positive blood compared to a fragment containing only the last 102 carboxy-terminal amino acids. It was shown that the reaction occurred when the target signal was high. This means that the HCV NS3 gene The immunodominant epitope encoded by is present within this fragment. This means that the antigenicity of other proteins is often associated with the N-terminus of the molecule. It was somewhat surprising since they were so similar.

In the assays of the invention, recombinant proteins are prepared in a conventional microtiter plate. The protein can be coated onto a solid support, which may be on the surface of a well, using conventional procedures. It may be attached covalently or passively coated accordingly. This protein is Also, as described in U.S. Patent NCL 4,517,288 of Giegel et al. Pores for assays in radial particulate mats as shown The protein may also be immobilized on a gelatinizer by elution, centrifugation, or precipitation. cross-linked polystyrene or polyacrylamide that can be separated from unreacted molecular species by It may also be deposited on a ground insoluble matrix such as.

In a preferred embodiment, the protein is described in U.S. Patent N11L7/716°144 Paramagnetic microparticles can be coated as described or boridifluorinated vinyl can be transferred to dens membranes and nitrocellulose membranes.

In this assay, a facial support as previously described is coated with antigen. is contacted with a patient specimen for which antibodies specific for may be present. Specimens are usually loose Patient serum diluted in buffer solution, but antibodies from other body fluids can also be assayed. be. The antigen-antibody mixture is coated with the antigen at a temperature of 15°C to 42°C. Incubate for a sufficient time to ensure complete binding to the solid support.

This generally takes 5 to 30 minutes.

The post-incubation separation step removes any unbound anti-antibody remaining in solution. The antibodies are separated from the antibodies bound to the antigen-coated solid support as described above.

In the case of paramagnetic particles, the particles are separated into pellets or into the reaction volume in which the assay is performed. They are separated by applying a magnetic field to attract them to the side walls of the vessel. The remaining liquid phase is aspirated or otherwise removed by elution or filtration.

Following a wash step in which the phase support is rinsed with buffer, the amount of bound antibody is measured. can do. You can choose any of several detection methods. For example, binding of a second detection antibody with species specificity to the solid support-bound antibody The detection component is incubated with the solid support, separated and washed as described above. be able to. The amount of signal generated by the detection component is determined by the amount of signal generated by the antibody bound to the solid support. directly proportional to the amount of antigen-directed antibody. Detected components include increased fluorescence, chromophor, etc. It may be an enzyme conjugated to a detection antibody that acts on a suitable substrate for It may also be a radioactive molecule or atom, or a compound that exhibits chemiluminescence.

This antigen can be used in Western blot assays by this method. If so, the antigen is passed through a 12% sodium dodecyl sulfate polyacrylamide gel. pneumophoresed and transferred to a membrane.

The membrane was first contacted with c33c-reactive antiserum, washed, and then enzyme-conjugated antiserum. is contacted with antiserum and developed with substrate.

In order to produce the antigen in the form of a synthetic peptide, any reliable combination can be used in the present invention. There are several ways to create this. A particularly effective way to synthesize this antigen is to Toxicarbonyl (FMOC) protection plan and diisopropylcarbodiimide Milligen-Biosearch 9600 using coupling chemistry Utilize a model peptide synthesizer. The synthesized peptide is trifluoro Acetic acid, thioanisole, ethanedithiol, and anisole in 90:5:3: It can be cleaved from the resin support by reagent R in a volume ratio of 2:2.

Those skilled in the art will know that the epitope as a target in this assay does not substantially affect The sequence of this antigen contained in the 102 amino acid carboxy-terminal fragment of c33c It will be understood that slight variations in the columns are equivalent to the present invention, such as In preferred embodiments, the variations include small deletions, insertions or amino acid substitutions. , recombinant proteins are preferred over synthetic peptides. This is a 102 amino acid pep This is because of the difficulty in synthesizing the fusion protein β-galactosidase and The glutathione s-transferase-inducing moiety provides some stability and access to the antigen. This is because it provides security and aids in the purification process.

Further benefits of this antigen and a detailed description of its identification and use are provided below. Described in the Examples.

Example 1 HCV c33c Prototype strain of HCV, Bradley et al, JMed Vuo1 ．． ．． 3:253 (1979) and Choo et al., 5science. , 244:359 (1989), plasma from chimpanzees infected with 15. It was clarified by centrifugation for 20 minutes at 4°C in OOOXg. clarified Plasma was centrifuged at 78°,000×g for 4 hours at 4°C to remove HCV virions. It became a computer. This virus pellet was purified by Chomczynski and 5ac Guani, Chi, Anal, Biochem, 162:156 (1987) The carrier was extracted by the dium isothiocyanate-phenol-chloroform method. It was precipitated with ethanol in the presence of glycogen as a coprecipitant. etal precipitate Before washing and reverse transcription, add 1mM EDTA, 10mM NaCl, 10mM) .

Resuspend in pH 8 solution.

The c33cel region of HCV was developed using phosphoramidite chemistry and Appli For first strand synthesis using the ed Biosystem system c33c-specific oligonucleotide primer, sequence identification l1la1 (5’-CCGGCCGGCCGAATTTCACACGTATTGCAGT CTATCA-3″) using a commercially available RNA kit (Perkin Elmer-Cetus, No. rwalk, CT). Reverse transcription.

Wang et al., PNAS, 86:971 (1989), at 42°C. The instructions for the kit were as follows, except that the transfer incubation was extended to 1 hour. Therefore, it was carried out.

The specifically primed cDNA is injected with a second oligonucleotide primer, sequence Column identification patient 2 (5’-CGCGCGCGCGGAATTCGTGGACTTTATCCCT GGTC; GA-3') was amplified by the polymerase chain reaction method. 94°C 1 minute, 37°C Forty cycles of amplification were performed with a profile of 2 min and 3 min at 72°C.

The amplified products were extracted with phenol/chloroform, precipitated, and the coagulated ends were terminated. Digested with #llN enzyme EcoRI to form . Sambrook et. al,, Mo1eCold Sprjng Harbor, New York (1989), the amplified DNA was then size fractionated in a 1% agarose gel. cut out a band of the expected size (827 bp) of c33c, and Purification was performed using an ar5pin-X filter. Vogelstein, An. al Biochem, ) 160: 115 (1987). Eluted band is a bovine intestinal sulfate-treated λgtll arm (Stratagene San D iego, CA). The ligated DNA was made commercially. Puff caging mixture (Giga-Pack Gold I [, Stratage ne) into the phage head and containing the c33C coding sequence. The containing phages were raised against human HCV antisera, as described more fully later. Identified by immunological screening.

Example 2 c33cm Eve-! - screening λgtll is Mierendorl f et al, , Methods Enz mol, , 152:458 (1 987).

Blating host bacteria (E, Co11a Y1090 (r-)Str atagene), Sambrook et al.

Mecular　C1onin　：A　LaboratorManual , Co1d Spring Harbor Press, Co1d 5prin Prepared as described in Harbor, Now York (1989). Ta. Cells were treated with ampicillin (50 μg/d), maltose (0.2%) and Mg It was grown overnight in LB medium containing SO4 (10mM). - night culture as above Added to fresh LB medium with additives and grown to an OD600 of 0.5. cell was centrifuged and the pellet was resuspended in 0.2 volumes of ice-cold 10mM MgSO4.

The titer of the λgtll c33c library is Sambrook et a l,,Mo1ecular Cloning:A Laboratory Ma nual, Cold Spring Harbor Press, ColdSp ring Harbor, New York (1989). , 500 to 1000 black forming units (pfu) in 100 μf of SMII buffer. diluted in fi, Sambrook etal, Molecular C1 onin:A Laborator Manual, Col1d Sprin g Harbor Press, Co1d Spring Harbor, Ne w York (1989), and 150 of Y1090 (r-) cell suspension. μ! added to. This suspension was mixed gently and heated in a 37° C. sinker for 915 min. Incubate and add to top agarose 0.7% 3H1, Sambroo k et al, Mo1ecular C1onin:A Laborat or Manual, Co1d Spring Harbor Press, C oldSpring Harbor, New York (1989), and LB thiampicillin plate was applied before delivery. Plate until black is visible (approx. Incubate at 42°C (3 hours) and invert, during which time the nitrocellulose 10mM IPTG (isopropyl-β-D-thiogalactopyranoside) ) and air-dried. When black becomes visible, place the filter on the plate. Invert and incubate for an additional 3 hours at 37°C. The filter is then oriented Merkle, Tris-buffered saline (TBS = lOmM Tris, 150mM N aCl, pH 7,4) and non-fat dry milk solution (NFDM:TBS, 2 % non-fat dry milk, 0.1% NaN5) for 15 minutes. − The next antibody is Bost.

n Characterized serum, anti-HCV from Biomedica, Boston, MA Mixed titer #8 PHV201 0B. This serum is Boston B iomedica, RIBA 2 test, 0rtho Diagnostic Strongly responsive to c33c, as determined by S, Rari an, N.J. It was both gender and specificity. -The next antibody is 5. E. coli lysate 10 times volume and ink tube, centrifuge to remove insoluble E, colt protein, and NFD. Diluted into another 10 volumes of M. Filter this primary antibody dilution solution (1:1 00) 10 d overnight at room temperature with gentle shaking. - the next antibody is removed; Next, the filter was washed with TBS + 0.05 Tween-20 for 6 x 5 minutes, and then Alkaline phosphatase conjugate diluted 1:3500 in NFDM. Goat anti-human IgG and IgM (Jackson and Jacks).

n, Westgrove, PA). Leave the filter at room temperature for 2.5 hours. Incubate, remove secondary antibody, and wash filters as above.

The filter was then rinsed twice for 5 minutes with 50mM) Lys-HC1, pH 9.5. . Each filter was added to the substrate, 50mM Tris-HCI, pH 9.5 with 5-bronch. Mo-4-chloroindolyl phosphate (BCIP, 50 μ/dDMF) 33 μl and Nitroblue Tetrozolium (NET, 75 μlg/d 70% DM F, Bethesda Research Labs, Gaithersburg g, MD) 44ai! The 0 reaction treated at 10 m after adding 1 removes the substrate and 1 % glacial acetic acid solution. Filters were rinsed with water and air dried 0-reactive black is located by comparison with the corresponding bacteriological plate; removed with a pipette. The agarose stopper containing the phage is chloroform 1 The droplet is placed in SM buffer containing L, and the phage is placed in an agarose stopper. It was allowed to elute for at least 4 hours at 4°C. The eluted phages are The process of immunoscreening continues until the reactive phages are pure (3 rounds total). It was used as a new inoculum for later rounds. c33cmIA, c33c Three clones of λgtll, identified as m3A and c33cm4A, were further tested serologically by immunoscreening using a CV panel Ta. This panel includes anti-HCV sera known to be reactive against c33c; It consisted of serum non-reactive to c33c. Approximately 1000p for each clone fu was plated and circular filters from each clone were cut into strips. as described above, except that each specimen was incubated with was immunoscreened. The immunoreactivity profile for each clone is shown in Table 1 and 2. All of the clones were directed against the expected c33c matched the reactivity pattern and was negative for c33c non-reactive sera. Ta.

Table 1 Immunoreactivity profile of c33c clones against HCV-nonreactive sera. λgtll without this insertion serves as a negative control.

Table 2 against HCV c33c-reactive serum Immunoreactive profile of c33c clone Serum identification Example 3 C33 cDNA and 1 Unless otherwise specified, the operations described here are based on Sambrook eor Pres. s, Colorado Spring Harbor, New York (1989) is referenced. Putative λgtllc33c recombinant, c33cmIA, c33cm 3A, c33cm4A, polymerase chain reaction (PCR) method, 5aiki etc.

, Nature, 324: 163 (1986), and 5aikiet C33 by al., 5science, 239:487 (198B) c was used as a template to isolate the insert. Elute from agarose stopper 20 μl of collected phage (see Example 2) was used directly in each PCR reaction. λ gtll　Sequences located approximately 100 bp on both sides of the EcoRI cloning site Corresponding oligonucleotide primer, sequence identification N113 (5'-CATC CCCATCTCCTCCACGCGGAA-3°) and sequence identification inhibition 4 (5'-TCGGTGGCCC; GCAGTACAATGGA-3' is used It was. PCR reactions used Primer Loop mol in a total reaction volume of 100 ul. and was performed using the Perkin Elmer Cetus PCR kit. 0 reaction in a Perkin Elmer CeLu5 DNA thermal cycler. , 1 min 94°C melting, 2 min 55°C annealing and 3 min 72°C polymerization. The incubation step was performed for 30 cycles.

10μ2 of each PCR reaction was electrophoresed in a TAB agarose gel. All Ku The loan was the expected size of the C33c and flanking λgtll (approximately 800 A DNA fragment of approximately 1°00 bp corresponding to . These PCB-produced DNA fragments were transferred to the DEAE NA45 cellulose membrane. , Dretzen et al, Δ11 Biochem, 112:29 5 (1981) and phenol/chloroform and ether. Tanol was precipitated. Flanking λgtll DNA is removed by digestion, Electrophoresed on TAB agarose gel. All 3 clones are full length C33c gave an 829 bp band consistent with .

DNA fragments were isolated and purified as described above. Has an EcoRI end Approximately 0.5 to 1 ug of the PCR-amplified c33c fragment was added to the T4 DNA rigger. was cloned into the EcoR1 site (50 ng) of PUCI9 using ZE.

The ligated material was obtained from E. coli DH5a competent cells (Bethesda R e5earchLabs, Bethesda, MD) 50=100uj! instructions to Transformed according to the instructions in the book. The transformation reaction is carried out using LB amplicon containing X-gal. Plated on Syrin agar. Predicted recombinant minipretub plasmid D NA alkaline dissolution method, Birnhoim and Doly, Nuclei c　Ac1ds　Res,.

7:1513 (1979), digested with EcoRi, and its Electrophoresis was performed in a TAB agarose gel to verify the presence of the expected insert. moved.

Double-stranded sequencing of C33c containing PUC19 clones was performed using TaqTrac. k sequencing system (Promega, Madison, Wl or 5e quenase 2. OUS Biochemicals, C1ev conducted in 2013 (Eland, OH). Alkaline-denatured template and forward primer (N ew England Biolab #I233) was annealed and These clones from both ends were subjected to deoxynucleotide sequencing. Partial sequencing confirmed that the HCV c33c4N region was successfully cloned. did.

The DNA sequences from all three clones are the same, so only 033cm4A was further analyzed.

Example 4 P to C33c1's λtll The complete C33c@limited endonuclease map is DNA 5TRIDER1, 1 program (Christian Marck, Department of Biology, Comm1ssion of Atomic Energy , France). C33c gene fragment (Figure 1) Specificity restriction sites were chosen to generate . The criteria for selecting a restriction site are l) the restriction site; position is unique or the C33c gene or accompanying vector (pUc19 2) It gave a fragment of about 100-180 bP in length. That's what happened. 033cm4A DNA isolated in Example 3 (PUC1 C33c in 9) is a single or multiple restriction enzyme (Betheda Re5ear ch Labs, Gaithersburg, MD; New EnglandB io Iabs, Beverly, MA) in a total volume of 20 ttl, at least Digested for 3 hours (2-5μ) according to manufacturer's instructions.

Restricted DNA was prepared using 2.5mM dNTP mix luf and T4 DNA polymer. (New England Biolabs.

Bewer Iy, MA) was made blunt-ended by adding 1μ2, and 1 Incubated for 15 minutes at 2°C. The DNA is then treated with phenol/chloroform. and precipitated with ethanol. EcoRI 5’ phosphorylation The linker (C1ontech, Palo Alto, CA) is the E of λgtll. C33c control blunt-ended to facilitate ligation to the coR1 site. Limited fragments were assigned. EcoRI linker of appropriate length is λgtl β-galactosidase gene of l and a link to restore the open reading frame in phase. Gated. EcoRI linker-1 μg and c33c restriction fragments 2-5 μg were ligated with T4 DNA ligase in a total volume of 10 μl and incubated overnight at 12°C. It has been engraved. The ligation mixture destroys T, DNA ligase activity. Heat inactivated for 15 minutes at 65°C to prevent 50-100uj! Eco with a volume of Digested with RI. The DNA during the digestion reaction was prepared using 1-2% agarose TAEjI. Gene was fractionated in the gel, C33c of the expected size was eluted, and Gene C1ean kit (Research Products Inc., Mt. 　Prospect.

Purified using [,). The purified DNA is then transferred to Protoclone λgtll plus Packgene System (Promega, Madison, WI) and cloned into λgtll. In summary, 0.5ug of λgtll dephosphorylated EcoRI arm (IIlj Riga 1 μg (2 μl) of C33c restriction fragment in a total volume of 5 μl for 3 hours at room temperature. was heligate. Phage packaging extract (50 uj) was added to the mixture. and incubated for an additional 2 hours at 22°C.

The packaging extract was made into a volume of 500 μl and chloroform 2 was added as a preservative. 5 μl was added. Different λg containing C33c fragments produced The tll clone is shown in Figure 1.

This insert was subcloned into pUc19 and their DNA sequences were The expected composition of ff! It was decided to recognize the

Example 5 Suff1-ning of c33c fragment c33c expressed in λgtll Restriction fragments can be used for immunoscreening using the procedures described in Example 2. were analyzed for serological activity. Contains an insert with the correct DNA sequence The resulting clones in Figure 1 were immunoscreened using a pool of three HCV-reactive specimens. Leaned. These results are presented in Table 3. These clones are 1 From 0 anti-HCV c33c-reactive sera and 7 c33c/non-reactive sera. Further immunoscreening was performed with individual sera. Serological profile of this panel The file is shown in Figure 4. This result shows that Ban I[/EcoRI fragment is recognized by all members of the panel that reacts with the full-length c33c antigen. Indicates that it contains one or more epitopes. Panel for c33C full length Immunoreactivity of members was determined using the c33cRIBA test (Ortho Diagnosis). Sticks, Raritan.

N.J.) represents similar relative immunoreactivity as determined by N.J.). BanII/EcoR The complete sequence of the I fragment is presented in FIG.

Table 3 Characterization of c33c constructs 1. This clone was not sequenced, but a PCR fragment of the expected size provided the ragment.

2. These clones contain an EcoR1 site at the 5' end of the insert.

Example 6 High Fugumen by PCR c33cBANII RcoR■ 1゛1 and screen T-ning Synthetic oligonucleotide primers are used in PCR to isolate small fragments. in C33cHCV. Additional bases at the 5' end and R A coRI restriction site is used for cloning and λgtllβ-galactosidase. Added to facilitate accurate in-frame expression.

The sequence of the primer is (sequence identification N115. 6. and 7. nucleotides 5, 8 and 9. and sequence identification magnet 8 (containing nucleotides 1, 2, 3, 4 and 7) )), (EcoR1 site is underlined.) /i 51GCGCCGΩΔΔEee2CGTATTGCAGTCTATCACC GAG-:l’12 51GCGTAT Hiroan:! ! :TCCGTCACTGTG CCCCATCCCAA-3'13 51GCGTAT Hirogane product CATCGCC GσGGTCGGGAT-3zeI7 51GCGTATfigosi: G to TCAT GAGGGCA’l’CGGTT-31in 5’GCGTATn Toni GAG TGGCACTCGTCACAAAT-:l’19　5　’　GCGTATgA Primer used for AGTTCCTTGCCGACGGC-31PCH The pairs are #1 and #2; #2 and #3; #1 and; 44; #3 and #4; #2 and #7 i #4 and #7; #5 and #8; #3 and #9 i #1 and #9.

The location of the viral gene product in the C33C head region is shown in Figure 3. The PCR reaction was 80 pmol of each primer and 5 ng of pUC19c33cm4A as a template. The procedure was carried out as described in Example 3 using The exact size of the PCR product is Concentrated and verified by Matrix Sheen Clean. The purified PCR product was then converted to Ec digested with oRI and cloned into λgull as described in Examples 1 and 4. It was. These clones include c33c-reactive 9 members and C33c-unreactive l Immune screening according to Example 2 using an anti-HCV serum panel consisting of sera. It was done. The results (Table 5) show that clonal production smaller than Bann/EcoRI These results indicate that the substance does not react with all nine members of the c33c reactivity panel. The results showed that Banff/EcoRI was effective at the 5′ end without loss of immunoreactivity. be shortened by 12 or more amino acids or 13 or more amino acids at the 3″ end Instruct what cannot be done.

Example 7 BANI [EcoRIc33c fugument's link to GEX vector- Ronning and Park BAN If/EcoRI c33c DNAt-E removed from the corresponding pUc19 clone by coRr digestion and diluted with 2% TAB agar. It was size fractionated on a rose gel and purified by SheenClean. This flag expression vector pGEX-3Xa, Sm1th & Johnson, Gen Ec, 67:31 (1988). this vector - 26KD Glutathione S from Schistosomajaponicum -) an in-frame insert as a C-terminal fusion of transferase (GST) will be expressed. This recombinant plasmid was prepared according to the manufacturer's protocol. , E. coli DH5a (Bethesda Re5earch Labs , Gaithersburg, MD). GST-c33c The Ban1[/RcoRI fusion gene is expressed and the protein is Sm1th and Johnson, Gene, 67:31 (1988). The method was purified by the following modifications. Contains ampicillin 50μg/d An overnight culture grown in LB Pross was diluted 1:10 into fresh medium and 0D Grow at 37°C to 600 0.4. At this point, isopropyl-β-D-thi Ogalactopyranoside (IPTO) was added to a concentration of 0.1 mM. 37 cultures After growing for an additional 2 hours at °C, cells were pelleted by centrifugation and washed with MTPBS (N aC1150mM, Nag HPOa 16mM, NaHtPo4 4mM, resuspended in 1150 or 1/100 culture volume of Ph 7.3). ice the cells The above solution was dissolved by sonication, and Triton X-100 was added to 1%. Dissolution Things 10. Centrifuged for 5 minutes at 4°C in OOOXg. Prepare the supernatant from centrifugation. 50% glutathione agarose beads washed and diluted in MTPBS. (Sulfur bond.

1/10 of Sigma Chemical Co, St, Louis, MO9 Mix by volume on a rotor at room temperature. After 2-3 minutes of adsorption, add 5 agarose beads. Collected by centrifugation for 2 minutes at 00Xg, pellets were washed three times with MTPBS. . The fusion protein was mixed with reduced glutatid in 50mM Tris-HCI pH 8.0. On (Sigma Chemical Co, St, Louis, MO) 5m Due to competition with M, elution was performed using 2 x 2 minute washes per bead volume.

Example 8 c33c BAN U EcoRI music ζNote GST-c33c Ban II/EcoRI fusion protein purified in Example 7 Western blots were performed to determine the reactivity of . GST-c33c BanI[/EcoRI antigen in 12% SDS polyacrylamide preparation gel, L aemmli, Nature, 227:680 (1970). and the Hoeffer TE50 electrotransfer as described by the manufacturer. Immobilion P membrane (Millipore, MA ). The membrane was incubated with 5% MFDM in TBS for 3 min at room temperature and 3w It was cut into m pieces. Serum specimen (46 anti-HCVc (33 c reactive serum and 29 non-reactive serum) and individually overnight at room temperature. Incubated. These pieces were mixed with 3M NaC + 150mM Tris pH 8. ,010゜01　M　N　a　Ns　solution for 4×5 minutes, and alkaline phosphide. Rinse in sphatase goat anti-human antibody. These pieces were washed and described in Example 2. Incubated with substrate as described above.

Western plot of GST-c33c Ban1l/EcoRI fusion protein The analysis is shown in Table 6.

c33c Bann/EcoRI fusion protein is available in all c33c-reactive sera. (46/46) were immunoreactive. These HC specimens are well characterized. and range from very low anti-HCV titer specimens to high titer specimens. Ru. None of the non-reactive c33c specimens were non-reactive or 0/29. these The results show that the Banff/EcoRI fragment of c33c is the c33c protein. This indicates that the protein retains all of the immunoreactivity of the full-length protein.

Table 6 Western PCR of Ban II/EcoRI fragment compared to full-length c33c. lot immunoreactivity 33c Example 9 1 Immunoa Say GST-Ban ■EcoRI's ・ GST-BanII/EcoRI fusion protein was incubated with full-length c33c protein. The responses were compared by paramagnetic microparticle enzyme immunoassay (MP assay). child The assay uses a paramagnetic solid phase coated with HCV antigen on its surface. Anti-HCV was detected. Paramagnetic particles (MP) are Baxter Dtagnost ics Inc., Pandex, Mandelein, IL. these It consisted of a fluorescent polystyrene paramagnetic core and a polystyrene surface. all The particle formulation was characterized by a narrow particle size distribution (average diameter 4.5 μm).

Examples of C,5T-BanlI/EcoRI and C33c viral gene products Purified as in 7. The full-length C33C protein has 16 amino acids in the pET5a system. Noic acid reader, 5tudier and Moffatt, J Mol Bio l.

189:113 (1982). O, 1M acetate buffer MP of 400 μg protein/M1 virus antigen in buffer pH 5.0 (2.5% w/v) onto the receptor by gently mixing the antigen and MP overnight at room temperature. Dynamically coated. MP was then mixed with PBS (20mM sodium phosphate, 150mM Wash well using centrifugation (5000 rpm, 5 minutes) with NaCl, pH 7.4). Ta. Antigen-coated MPs were diluted in PBS to a working concentration of 0.025% (w/v).

Dilute the specimen to 17100 dilution buffer = 15% neonatal bovine serum, 500ml M NaCl, 100mM Tris-HCI, 0.3% Non1det P -40, pH 7,4) and 50μ2 in a black plastic microtiter Add 20μf of 0MP (0,025% w/v) to each well of the rate. and incubated at 42°C for 30 minutes. Wash the particles in each well with a step 0.05% Tween using a magnetic field to keep it at the bottom of each well during the dip. Washed 5 times with TBS containing -20. Conjugate diluent (8% neonatal bovine serum) , 50mM Tris-HCI, 200mM NaCl, 1mM MgSO4, Goat anti-human Ig (H+L) β-galacto diluted 800 in pH 7.4) Sidase conjugate (American Qualex, La Mirad a.

CA) 50 μl was added to each well and incubated at 42° C. for 15 minutes. pre The plates were washed as before. Substrate (4-methylumbelliferyl β-galactosylate) MUG: 0.5mM MUG, 20mM Tricine, 0.05% T 50μi of ween-20, pH 8°5) was added to each well and the product fluorescence was (365 nm excitation and 450 nm emission) measured at intervals (2 min and 14 min). ).

Fluorescence values were converted to nM coumarin values using coumarin dilutions as a standard curve. Ta. The kinetic value of substrate conversion (the amount of coumarin expressed in nM produced in 12 minutes) is expressed as Q uattro Pro (Borland International, 5cot Valley, CA) using a spreadsheet software program. It was measured.

The kinetic range of kinetic values was O to 5.000 μM coumarin. random Volunteers - from blood donor samples and patients monitored during seroconversion For cutoff calculation by testing a panel of systematic serum samples of A preliminary algorithm was established. This algorithm (positive calibrator) μM coumarin x O175) gives a cutoff of approximately 200-300 μM coumarin. Ta.

The results in Table 7 show that all immunoreactivity for full-length c33c antigen was detected using the MP assay. Some blood sera were also reactive with the BanI[/EcoRI product. The stronger reactivity of full-length c33c with supernatant indicates that the MP assay is E c o represents the fact that it was not optimized for the RI virus product.

An approach to optimize Ban1l/EcoRI products into MP assays is to Cleavage, Smlth and Johnson, Gene, 67:31 (198 B) GST fusion by BanII/Ec.

BanI[/EcoRI was removed from pET5a, 5tudier an d Moffatt, J Mol Biol, 189:113 (1986). loning or otherwise coating the viral product onto a solid phase. .

Table 7 Using paramagnetic microparticle immunoassay Immunoreactivity of Banff/EcoRI pGEX fusion 9*Results are nM coumarin and It is expressed as

Values greater than 300 are reactive.

−【−One and one one Mugi one (1) General information: (i) Applicants: Kink, John ARyan, Terenc E. Todd, John A Saeed, Badr (1. Title of the invention: Epitope mapping of the c33 and c85 regions of HCV (it) Number of arrays: 9 (iv) Contact address: (A) Addressee: Baxter Diagnostics Inc.

(B) Street: One Baxter Parkway.

(C) City: Deerfield (D) State: l11inois (E) Country: USA (F) ZIP code = 60015 (v) Computer readable format: (A) Media type: Floppy disk (B): 17 Viewer: IBM pc Compatible (C) operating system: PC-DO3/MS-DO5 (D) Soft Air: Patentln Re1ease #1.0 Verge Technique # 1.25 (vi) Current application data: (A) Application number: US (B) Application 82 (C) Classification: (vi) Agent information: (A) Name: Barta, Kent (B) Registration number: 29,042 (C) Reference/Docket number: PA-4169 (vi) Telecommunication information Information (A) Telephone: 708/948-3308 (B) Fax: 708/948 -2642 (2) Information about sequence identification Nal (i) Array special 1! ! [: (A) Length: 37 base pairs (B) Type = 1$ acid (C) 21 strands (D) Topology: Linear (ii) Molecule type: cDNA (XI) Sequence description: Sequence identification barrier 1: CCGGCCGGCCGAATTTCACA CGTATTGCAG TCTA T(:＾37(2) Information about 2 for sequence identification (i) Characteristics of array: (A) Length: 36 base pairs (B) Type: Nucleic acid (C) Strand: 1 strand (D) Topology bilinear (ii) Molecule type: cDNA (XI) Sequence description: Sequence identification barrier 2: CGCGCGCGCG GAAT Ding CGTGG ACTTTTATCCCTGTG Information about GA 36 (2) Sequence identification inhibition 3 (i) Sequence characteristics; (A) Length: 24 base pairs (B) Type: Nucleic acid (C) 21 strands (D) Topology: Linear (ii) Molecule type: cDNA (χri sequence description: Sequence identification Nl13: CATCCCCCATCTCCTCCAC GCGGAA　24(2) Information about sequence identification NIIL4 (i) Sequence characteristics : (A) Length: 24 base pairs (B) Type: Nucleic acid (C) 21 strands (D) Topology: II shape (ii) Molecule type: cDNA (Description of X sequence: Sequence identification N [L4: TCGGTGGTCCGGCAGTAC AA TGGA 24 (2) Sequence identification N [Information about L5 (i) Sequence characteristics : (A) Length: 35 base pairs (B) Type: Nucleic acid (C) 21 strands (D) Topology 12 linear (ii) Molecule type: cDNA (XI) Sequence description: Sequence identification Na5: GCGTATGAAT TCCCAGT AGT GCCCCAGAGCTTCCA 35 (2) Regarding sequence identification Nl16 Information (i) Characteristics of the array: (A) Length: 33 base pairs (B) Type: Nucleic acid (C) Strand: 1 strand (D) Topology bilinear (ii) Molecule type: cDNA (XI) Sequence description: Sequence identification step 6: GCGTATGAAT TCGGAGTGGCACTCGTCACA AAT 33(2) Information about sequence identification level 7 (i) Characteristics of array: (A) Length: 30 base pairs (B) Type: Nucleic acid (C) Strand: 1 strand (D) Topology bilinear (ii) Molecule type: cDNA (XI) Sequence description: Sequence identification patient 7: GCGTATGAAT TCAAGT Ding CCT TGCCGACGGC30 (2 ) Information about sequence identification black 8 (i) Characteristics of array: (A) Length: 306 base pairs (B) Type: Nucleic acid (C) Strands: 2 (D) Topology: Linear (j) Molecule type: cDNA (ix) Features: (A) Name/Key: CD5 (B) 11th place...306 (XI) Sequence description: Sequence identification barrier 8 GTCACT GTG CCCCAT CCCAACATCGAG GAG G TT GCT: 15 Val Thr Val Pro His Pro As n engineering 1a clu Glu Val entering 1a1 5 1゜ CTG TCCACCACCGGA GAG ATCCCT TrT TACG GCAAG 72Lau Sir Thr Thr Gly Glu Engineering 1a P ro Pha Tyr Gly Lys15 2゜ GCT ATCCCCTCGAA GT entered TCAAG GGG GGG AGA CAT Engineering 08 people 1a Engineering 1e Pro Leu Glu Val E Air a Lys Gly Gly enter rg) lisLau engineering 1a Pha C ys His Sar Lys Lys Cys Asp GluCT CGCT GCA AAG CTG GTT GCT TTG, GGCATC AAT GCC180Lau with Ala 1a Lys Lau Val with 1a Lau Gly Engineering 1a Asn AlaVal Ala Tyr Tyr Enter rq Gly Leu Asp Val Sar Val Engineering 1eCCG A CCAGCGGCGAT GTT GTCGTCGTG GCA ACCGAT 252GCCCTCATG ACCGGCTAT ACCGGCGACTTC GACTCG 288Ala Lau Mat Thr Gly Tyr Th r Gly Asp Pha Asp 5arGTG ATA GACTG A AT ACG Ko06Val Engineering 1a Asp cys Asnτhr (2) Arrangement Information about column identification Na9 (i) Array special @: (A) Length: 102 amino acids (B) Type: Amino acid (D) Topology two-line cane (ii) Molecule type: protein (XI) Sequence description: Sequence identification N[19Val Thr Val Pro Hi s Pro Asn Engineering 1a Glu Glu Val Ala Lau 5a rGlu Val engineering 1a Lys Gly Gly Arg His Lau engineering 1a Pha Cys His Sar, Ko O35,40 Lys Lys Lys Cys Asp Glu Lau Ala Ala Lys Lau Val Ala Lau45・5055 Gly Engineering 1a Asn entry 1a Val entry 1a 'ryr? /r　Aj″q GIY r,, au Asp Val 5ar60 65, 70 Val Engineering 1a Pro Thr Sar Gly Asp Van Val V al　Val　Ala　Thr　AspA! 1P Cys Asn, Thr l is x te 60 ・−−・−−・・Fist◆−・−・Rei・・Sha・――・・−・−−◆・・・――・＋ ＋＋−Φ−＋−・・・・・・・◆−・−＋畢−・・・◆AV? VPliP)i! K Tomi VA Mu S! 〒〒〒　G　IE! 12061 τ=〒〒120 Ko A F Y CJ K A X P! ,! V X K G OI N ! , XF C40121CA fin’! 'CAATG! AI.

41 irises g K K K CD K L A A K L’V A L G Z 　M　A　g.

All QxtCτshi (〒〒　240 g! V A Y Y RG L D V g V X P? g G D 'V　V　V　1081　V　A　? D A! , M T G Y G D F　D　S　W　X　D　C1100Fi, 2 Submission of translation of written amendment (Article 184-7, Paragraph 1 of the Patent Act) July 7, 1993

Claims (1)

[Claims] 1. substantially contains the carboxy-terminal 102 amino acids of the c33c region of NS3. Hepatitis C consists of a recombinant protein that is an immune system encoded by the NS3 gene. sexual epitope. 2. Carboxy-terminal 102 amino acid flag of c33c region of hepatitis C gene NS3 recombinant protein with antigenic determinants contained in the protein. 3. Hepatitis C: To detect antibodies specific to the c33c region of the NS3 protein. an assay method for detecting the carboxy-terminal 102 amino acids of the c33c region. A solid support coated with the recombinant protein contained in the fragment is injected into serum or blood. contact with the plasma specimen; The specimen and the recombinant protein-coated solid support are combined with the specimen contained in the specimen. to allow antibodies specific for the fragment to bind to the coated solid support. incubate for sufficient time to separating said bound antibody from unbound antibody and detecting such bound antibody; The assay method described above. 4. Hepatitis C: To detect antibodies specific to the c33c region of the NS3 protein. an assay method for detecting the carboxy-terminal 102 amino acids of the c33c region. A solid support coated with the recombinant protein contained in the fragment is brought into contact with the patient specimen. let me, The specimen and the recombinant protein-coated solid support are combined with the specimen contained in the specimen. to allow antibodies specific for the fragment to bind to the coated solid support. incubate for sufficient time to separating said bound antibody from unbound antibody and detecting such bound antibody; The assay method described above. 5. Hepatitis C: Detecting antibodies specific to the c33c region of the NS3 protein The law is Hepatitis C Carboxyl terminal 102 amino acid flag of c33c region of NS3 protein electrophoresing the recombinant protein containing the evitope contained in the The electrophoresed recombinant protein is transferred to a membrane, and the protein is converted into c33c protein. contact with a patient serum specimen containing antibodies to Contact with enzyme-conjugated anti-human antibody, wash, and develop with substrate The assay method described above. Sequence identification no. A synthetic peptide having substantially the sequence shown in 9. The assay method of claims 4 and 5, wherein the solid phase support is a paramagnetic particle. 8. The separation step includes magnetic concentration of paramagnetic particles, so concentrated pellets The assay of claims 4 and 5 carried out by washing and resuspending in a buffer. Say how. 9. The antibody detection utilizes an anti-human antibody conjugated to a signal generating means. The assay method according to claims 4 and 5.