JPH06239894A - New non-a-and-non-b hepatitis virus antigen polypeptide and method for diagnosis - Google Patents

Abstract

PURPOSE:To obtain the subject new polypeptide having a specific amino acid sequence, useful for detecting antigens for new non-A-and-non-B hepatitis virus having been unable to be detected by conventional methods, thus usable to diagnose non-A-and-non-B hepatitis. CONSTITUTION:The serum of patients with non-A-non-B hepatitis and negative in HBs antigen and HBV-DNA is pooled; polyethylene glycol is added to the pool to effect precipitation, and viral RNA is then extracted from the resultant precipitate by e.g. guanidine-thiocyanate method, a c-DNA is synthesized using this viral RNA as template and then incorporated in a phage vector to constitute a cDNA library. This library as probe is then screened using a synthetic polynucleotide composed of the 8 bases derived from the complement chain of non-A-and-non-B hepatitis virus polynucleotide followed by restriction enzyme treatment of the DNA of positive clone to bind this DNA to a manifestation vector, and the DNA is manifested in host cells, thus obtaining the objective non-A-non-B hepatitis virus antigen polypeptide of the formula (X is such that the N-terminal is H, Met-Ala or Ala).

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a novel non-A non-B hepatitis virus antigen and a polynucleotide encoding the same. More specifically, the present invention uses a novel antigen polypeptide which shows an antigen-antibody reaction specifically with a serum of a non-A non-B hepatitis patient that does not react with existing HCV antigens, a polynucleotide encoding the antigen polypeptide, and the same. The present invention relates to a diagnostic method for non-A non-B hepatitis.

[0002]

2. Description of the Related Art Non-A non-B hepatitis is a viral hepatitis that is considered to be caused by a transmissible virus, of which hepatitis A virus (HA
V), hepatitis B virus (HBV), hepatitis D virus (HD
V), or hepatitis caused by cytomegalovirus (CMV), Epstein-Barr virus (EBV), adenovirus, etc.
Virologically and serologically excluded. Epidemiological evidence suggests that there are three types of non-A, non-B hepatitis: That is, the waterborne type that is prevalent in developing countries, the post-transfusion (or needle accident) type, and the sporadic (group acquisition) type that is seen in developed countries. The waterborne type was thought to be caused by a virus different from the other two types, but in recent years, gene fragments of the major causative virus (hepatitis E virus) have been identified by Genelabs (US) and US CDC. Isolated by a group of [International Publication No. 89/1
2462, 89/12641 Pamphlet (1990), Reyes, GR, et a
l.Science 247, 1335 (1990)]. In the present specification, unless otherwise specified, the term "non-A non-B hepatitis" means that caused by the remaining post-transfusion type and sporadic type, not including this waterborne type.

According to an estimate by the Ministry of Health and Welfare (1988), 90% or more of acute hepatitis after transfusion and about 50% of sporadic acute hepatitis are non-A.
It is estimated to be non-B hepatitis, but about half of the resulting hepatitis progresses to chronic hepatitis, and 10 to 20% progress to cirrhosis. In the process of progressing to liver cancer, persistent infection with non-A non-B hepatitis virus and / or
Or it is thought that the chronic inflammation accompanying it is related. Therefore, establishing a preventive and therapeutic method for non-A non-B hepatitis virus has been an urgent medical need.

Although identification of such non-A non-B hepatitis virus has been extremely difficult in spite of many years of efforts, 1989
Beginning in the year, two groups reported the isolation of their non-A non-B hepatitis specific antigen genes. One is a group of Chiron (USA) [Choo, QL., Et al. Science.
244,359 (1989), Kuo, G., Et al. Science244,362 (1989),
Japanese Patent Publication No. 2-500880, European Patent Application Publication No. 318216 (1989), No. 388232 (1990)], and another group by Arima et al. At Okayama University (now Kagoshima University). The one [Arima, T., et al. Gastroenterologia Japo
nica 24,685 (1989), Arima, T., et al. Gastroenterologi
a Japonica 25,218 (1990), European Patent Application Publication No. 363025 (1990)]. Antigens (C
100 antigen, clone 14 antigen) both react specifically with 60 to 80% of non-A non-B chronic hepatitis patient serum and sporadic non-A non-B chronic hepatitis patient serum after transfusion, and non-A non-B chronic It has been shown to be useful in the diagnosis of hepatitis patients. The Chiron group has designated the virus encoding this gene as hepatitis C virus (HCV). However, the infectious virus particles and the infectious virus genome have not been isolated yet, and the pathogenicity as a non-A non-B hepatitis virus has not been proved. After that, H
CVcore antigen [Kunitada Shimotono, 38th Japan Virological Society, title 112], peptide fragments CP9 and CP10 containing the epitope [Okamoto, H., et al., Japan J.Ex.
p.Med.60,223 (1990)] and non-A non-B derived from cellular genes.
Hepatitis B-related antigen GOR [Kasahiro Akabane et al., Basic and Clinical 24,70
21 (1990)] has been applied to diagnosis, and in these cases, the detection rate in the serum of non-A non-B chronic hepatitis patients is 7-.
It is 80%, and it is known that there is non-A non-B hepatitis that cannot be detected with existing antigens. Moreover, the presence of such non-A non-B hepatitis virus suggests that existing antigens cannot completely complement healthy HCV carriers. In fact, in blood donation screening using existing antigens, non-A after transfusion
It is considered that the incidence of non-B chronic hepatitis is reduced by only about 50% [Toru Katayama, Chemistry and Biology 28,217 (1990), Est.
eban, JI et al., N Engl J Med., 323, 1107 (1990)].

[0005]

The cause of the existence of such non-A non-B hepatitis that cannot be detected by existing antigens is 1). Is it derived from the diversity of HCV (HCV is known to be a highly variable virus? [Enomoto, N., et al., BBRC 170, 1021 (1990), Shuichi Kaneko et al., Liver 31 suppl.213 (1990), Nobuyuki Kato et al., Liver 31 supp
l.214 (1990)], it is unclear whether all these viruses have a common epitope. ) 2). Is there another virus that causes a similar pathology? 3). It is not fully understood whether it is due to the inaccuracy of the inspection method.

[0006] Thus, studies on immobilization of antigens useful for the development of highly reliable diagnostic methods and therapeutic means for non-A non-B hepatitis have not yet been completed. The present inventors have diligently studied to discover a novel antigen capable of diagnosing non-A non-B hepatitis patients, which cannot be detected by conventional antigens, aiming at a 100% sure diagnosis and prevention method for non-A non-B hepatitis. did. As a result, a novel non-A non-B hepatitis virus antigen gene was obtained from Japanese human plasma. When the nucleotide sequence of the gene was determined, it was found that the previously reported nucleotide sequence of HCV (publication, European Patent Application Publication No. 388232 (1990), 5725th position of the nucleotide sequence shown in FIG. 17).
The present invention has been completed by finding out that it is an antigen derived from a novel non-A non-B hepatitis virus having a homology with (6239th).

[0007]

[Means for Solving the Problems]

Definitions As used herein, "polynucleotide" means a polymer of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. The term also includes both single-stranded and double-stranded forms.
The term "epitope" means an antigenic determinant of a polypeptide. An epitope is generally composed of at least 5-10 amino acids, although it may be formed by 3 amino acids located within a conformation specific to the epitope. "Non-A non-B hepatitis-related antigen" means an antigen that can diagnose non-A non-B hepatitis other than the antigen of the present invention, and includes both antigens derived from viral genomes and cellular genes (for example, Y19 antigen, Y22 antigen, C100
Antigen, Core antigen, Clone 14 antigen, GOR antigen, etc.). "Non-A non-B hepatitis virus antigen" means non-A non-B
Of the hepatitis-related antigens, those derived from the viral genome are meant.

In practicing the present invention, molecular biology, microbiology, known in the art, unless otherwise indicated,
Conventional methods of genetic engineering and immunology are adopted.
For such a method, refer to the following experimental book. Experiment 1: Sambrook. J., Fritsch, EF, and Maniati
s, T. Molecular Cloning2nd Ed .; Cold Spring Harbor
(1989) Experiment 2: DNA cloning Volume 1 (Glover, DM) IRL
Press. (1985) Experiment 3: DNA Cloning Volume 3 (Glover, DM) IRL
Press. (1987) Experiment 4: Handbook of experimental immunology, 4t
ed. Volume 1 ~ IV (Weir, DM), Black-well (1986) Experiment 5: Current Protocols in Molecular Biology (A
usubel, FM et al., ed.) John Wiley & Sons (1988) Experiment 6: Method in Enzymology Volume 185 (Goedd-el, D.
V.) Academic Press (1990)

(1) Preparation of viral RNA a) Preparation of RNA from patient blood virus HBs antigen negative, HBV-DNA negative, high ALT (GPT) activity value (> 3)
Human plasma or non-A non-B hepatitis patient serum showing 5 IU / l) is pooled and used as a starting material for the preparation of viral RNA.
Virus particles are concentrated and recovered as a precipitate by the polyethylene glycol precipitation method, and RNA is extracted from the precipitate by a method such as the guanidine thiocyanate method [Chomczynski, P.
and Sacchi, N .: Analytical Biochemistry 162, 159 (1
987)]. Although chimpanzee serum infected with a non-A non-B hepatitis virus can be used in place of human plasma or serum, in general, when the virus is passaged in a different animal, a mutation occurs in the viral gene, and sometimes pathogenicity occurs. When the antigen is cloned, it is preferable to use human plasma or serum as a starting material because the sex may change.

B) Preparation of RNA from Liver Tissues of Patients From liver tissues excised from liver cancer patients who may have been infected with non-A non-B hepatitis in the past, the conventional method [Experimental Documents 1, 7 ], RNA can be prepared. (2) Construction of cDNA library Gubler-Hoffman method [Gene, 25,263 (1983)] using the obtained RNA as a template and random hexamers as primers
To synthesize double-stranded cDNA. The cDNA is inserted into the λgt11 phage vector by a conventional method. λgt11 is a known vector that was developed to isolate a gene of an antigen corresponding to a specific antibody [Young, RA and Davis,
RW, Proc. Natl. Acad. Sci. USA80, 1194 (1983), Experiment Book 2, p49-78]. In addition to λgt11, λZAP, λZAPII, pUC19,
Vectors such as pUEX1 may be used. .

(3) Immunoscreening of cDNA library with patient sera Recombinant λgt11 infects host Escherichia coli (for example, Y1090 strain) and grows according to the growth mechanism of bacteriophage under certain conditions. Along with this, the previously integrated cDNA is also amplified. Under certain conditions, the propagated bacteriophage lyses host E. coli to form macroscopically recognizable plaques. The cDNA inserted into the λgt11 phage vector contained β-galactosidase (β-ga
Since it is expressed as a fusion polypeptide with l), a large number of recombinant
By screening gtll, the cDNA encoding a particular antigenic polypeptide can be identified by immunochemical methods. In the present invention, it was produced in (2) above.
It is desirable to screen the cDNA library with various non-A non-B hepatitis patient sera or pooled sera thereof. Specifically, a fusion antigen protein expressed from a culture dish that forms plaques is transferred to a nitrocellulose membrane, and the patient serum described above is reacted as a primary antibody, which is then reacted with peroxidase-labeled goat anti-human (human). I
gG) IgG etc. are reacted as a secondary antibody to isolate the plaques that are positive for the color reaction.

(4) Determination of cDNA Sequence The nucleotide sequence of the antigen gene of the present invention obtained in this manner was analyzed by the Sanger method [Sanger, F., et a, on recombinant λgt11 DNA and on plasmid vector DNA after subcloning.
L., Proc.Natl.Acad.Sci.USA., 74,5463 (1977), Experiment 1,
It can be determined using a commercially available sequence kit to which Chapter 13] is applied. (5) Method for detecting the viral genome in patient serum using the nucleotide sequence of the antigen gene From 8 or more consecutive bases derived from the complementary strand of the non-A non-B hepatitis B polynucleotide of the present invention The polynucleotide as described above hybridizes with the viral genome of the present invention and is useful as a probe for detecting the virus in serum or tissue. These polynucleotides are obtained by the phosphoramidite method [Hunkapiller, M. et al. Nature 310, 105-111 (1984)].
Etc., or commercially available DNA synthesizer (eg, Applied Biosystems (ABI), 380A type DNA synthesizer, etc.)
Can be synthesized using. Further, the non-A non-B of the present invention
It can also be synthesized by using the hepatitis C virus polynucleotide as a template and performing the nick translation method, the random primer labeling method, or the like. When the polynucleotide is used for diagnosis, it can be used as a labeled probe such as a radioactive probe, a biotin fluorescent probe, and a chemiluminescent probe by a conventional method, but the hybridization method, the labeling method, and the signal Amplification and detection methods are both known, and are described by Toyozo Takahashi, DNA
Probe II, CMC (1990) can be carried out.

[0013] In the past non-A, non-B hepatitis virus (1/10 about ⁵ in the case of the hepatitis B virus) poles that does not exist only in trace amounts in a patient serum is known. In such a case, a part of the base sequence of the present invention is used to make one pair or two pairs.
Reverse transcription-PCR method by synthesizing more than one pair of PCR primers [Kawasaki, ES, et al., Proc. Natl. Acad. Sci. USA 85,
5698 (1988), Garson, JA et al., Lancet, 335, 1419 (199
0), Enomoto, N., et al., BBRC, 170,1021 (1990), Okamot
o, H., et al., Japan J. Exp. Med., 60, 215 (1990)], the target virus genome can be detected after amplification. (6) Preparation of non-A non-B hepatitis virus antigen polypeptide and fusion antigen polypeptide a) Expression of recombinant antigen polypeptide and recombinant fusion antigen polypeptide using gene recombination technology:

A fusion antigen polypeptide containing the antigen polypeptide, a polypeptide constituting its epitope, and their sequences can be expressed using a known expression vector. For example, expression in E. coli is described in Chapter 1 of Experiment 1
Experiment Book 3, p59-88, Experiment Book 6, p11-128, Tabor, S. and Ric
Hardson, CC, PNAS 82, 1074 (1985) can be referred to. When the polypeptide of the present invention is expressed in Escherichia coli, Met derived from the start codon is added to the N terminus. When constructing an expression vector, an amino acid derived from the vector may be added to the N-terminus of the polypeptide depending on the restriction enzyme site used (for example, Met Ala). In any case, the non-A non-B hepatitis virus antigen of the present invention is included as long as the reactivity with the non-A non-B patient antibody changes with the addition. The expression in yeast is Experiment 3, p141-161, Experiment 6, p231-484, and the expression method when using mammalian cells as the host is 16 in Experiment 1.
It can be carried out with reference to Chapter, Experiment Book 3, p163-212, Experiment Book 6, p485-598. The expressed recombinant antigen polypeptide can be purified from lysed cells or medium by protein purification methods known in the art (ultrafiltration, centrifugation, dialysis, ion exchange chromatography, hydrophobic chromatography,
Gel filtration, electrophoresis, affinity chromatography, HPLC, etc .; eg Methods in Enzymology 182
Volume (Deutscher, MP) Academic Press (1990) etc.)
Can be used for purification. Further, a simple expression method of the fusion antigen polypeptide is, for example, a method of inducing Escherichia coli Y1089 strain lysogenized with the recombinant λgt11 clone Y30 of the present invention by adding IPTG (isopropylthio-β-galactoside) [Experiment Book 2, p76-77]. Expressed fusion antigen polypeptide is gel filtered and / or β-ga
It can be purified using immunoprecipitation or affinity chromatography using a mouse monoclonal antibody against 1 (Boehringer Mannheim, 1083104), and the above-mentioned method.

B) Preparation of the antigenic polypeptide by peptide synthesis: The antigenic polypeptide can also be supplied by chemical synthesis based on the amino acid sequence determined in the present invention. Preferably, the entire sequence is divided into fragments (10 to 50 residues) of a length that is relatively easy to synthesize, and adjacent fragments are overlapped by about 5 to 10 residues and synthesized, and all of them are mixed. You may use it. More preferably, if one or more epitopes are identified by epitope mapping, the fragments may be used alone or in combination. Various polypeptides containing the amino acid sequence of the antigenic polypeptide can be chemically synthesized by a liquid phase method or a solid phase method, or can be chemically synthesized by an automatic synthesizer (for example, 430A type peptide synthesizer manufactured by ABI). The polypeptide synthesized by the solid-phase method according to the t-Boc method or the Fmoc method is cleaved from the resin using trifluoromethanesulfonic acid, hydrogen fluoride, trifluoroacetic acid, or the like. These synthetic peptides are preferably purified by preparative reverse phase high performance liquid chromatography (HPLC) in order to enhance the degree of purification.

(7) Method for detecting viral antibody in patient serum by immunoassay The non-A non-B hepatitis virus antigen polypeptide obtained by the present invention, or an antigen polypeptide containing an epitope thereof, can be detected using, for example, an immunoassay. , Non-A, non-B hepatitis virus antibodies in biological samples including body fluid samples such as blood, plasma, serum, spinal fluid and human immunoglobulin preparations. In the immunoassay, the antigen polypeptide is brought into contact with the sample under conditions capable of forming an immunological conjugate (antigen-antibody conjugate) between the antigen polypeptide and the non-A non-B hepatitis B virus antibody in the sample. If even a small amount of the antigen-antibody bound product is formed, it is found that the non-A non-B hepatitis virus antibody is present in the sample, and it can be detected and measured by an appropriate means. Immunoprecipitation, agglutination, radioimmunoassay (RIA),
EIA, ELISA, Western blot assay or binding immunoassay are available. In addition, assay protocols using the antigenic polypeptides can be by competitive or non-competitive binding methods.

The simplest method is, for example, to express the antigen obtained by the present invention as a fusion protein with, for example, β-gal, blotting it on a nitrocellulose membrane and use it as the antigen immobilized on a solid phase, and then by ELISA. This is a method for detecting a non-A non-B hepatitis virus antibody (immunoplaque assay, western blot assay, etc.) (Example 4). The antigenic polypeptide may be labeled with a label depending on the assay method. Known labels can be used for binding to the polypeptide, and examples thereof include fluorescent molecules, luminescent dye molecules, radioactive molecules, enzymes, cofactors, biotin / avidin, gold colloids, and magnetic particles. Further, by chemically modifying the antigen polypeptide of the present invention, it can be bound to a carrier protein or carrier polypeptide or a known support by a known means. As such a support, for example, a microtiter plate or beads made of polystyrene or polyvinyl, a glass tube or glass beads, or a support for chromatography such as paper, cellulose, a cellulose derivative or silica can be used. Of these assays, especially for large-scale screening of patient serum, blood, or blood products,
ELISA, agglutination method or Western blot assay are preferred.

[0018]

INDUSTRIAL APPLICABILITY The antigenic polypeptide of the present invention is useful for detecting a novel antibody against a non-A non-B hepatitis virus, which could not be detected by a conventional test method using an antigen. That is, the antigenic polypeptide is useful for diagnosing non-A non-B hepatitis-related diseases that could not be diagnosed with existing antigens,
Useful for determining treatment policy and epidemiological investigation. In addition, the antigenic polypeptide is a non-A non-B
It is possible to supplement healthy carriers of hepatitis C virus, and is useful for screening blood donors. In addition, the antigen polypeptide of the present invention is further mixed with a non-A non-B hepatitis-related antigen polypeptide, which is formed by a reaction between a mixed antigen and a non-A non-B hepatitis virus antibody present in a biological sample. Immunological conjugates can be measured to detect non-A non-B hepatitis virus antibodies that confirm the presence of non-A non-B hepatitis virus antibodies in the biological sample.

A method for measuring an immunologically bound substance is E
Non-A non-B hepatitis virus antibodies can be detected by the LISA method. A kit for analyzing the presence of an antibody of the antigenic polypeptide Y30 group, which is immunologically identical to the epitope of the antigenic polypeptide Y30 group or the antigenic polypeptide contained in the Y30 group in a suitable container Kits can be made that have antigenic polypeptides with identifiable epitopes. Further, the polynucleotide probe of the present invention can be used to detect a polynucleotide derived from a non-A non-B hepatitis virus by a hybridization method. Further, the polynucleotide primer pair of the present invention can be used to detect a polynucleotide derived from a non-A non-B hepatitis virus by a reverse transcription-PCR method. In addition, the antigenic polypeptide can be used to prepare polyclonal and monoclonal antibodies that can be used for detection of the viral antigen and treatment of non-A non-B hepatitis. In addition, the antigenic polypeptide can be used for the production of a vaccine for the prevention of virus infection and the treatment after infection. INDUSTRIAL APPLICABILITY The non-A non-B hepatitis virus polynucleotide of the present invention is useful as a gene for producing the antigen, and also detects a viral genome (particle) that cannot be measured by the detection sensitivity using a conventional detection method. Can be used for.

[0020]

EXAMPLES The present invention will be described in more detail with reference to examples below, but these do not limit the scope of the present invention. Example 1: Extraction of plasma RNA for cDNA preparation HBs antigen and H were detected with abnormally high ALT activity (> 70 IU / l).
After thawing 2000 ml of frozen plasma showing negative BV-DNA at room temperature, fibrin was removed by centrifugation at 5000 rpm (Hitachi, RPR9-2 rotor) for 20 minutes at 4 ° C. 80 g of polyethylene glycol 4000 was added to the supernatant and dissolved. After ice-cooling for 30 minutes, centrifugation was performed under the same conditions to collect the precipitate. RNA was extracted from the precipitate using guanidine thiocyanate
AGPC method [Chomczynski, P. and Sacchi, N .: Analytic
al Biochemistry, 162, 156 (1987)]. That is, twice the amount of the precipitate (1 g of the precipitate is converted into 1 ml) of solution 6D
(6M guanidine thiocyanate, 25mM sodium citrate, pH7.0, 0.5% sarcosyl, 0.1M 2-mercaptoethanol), and then add 0.1 volume of 2M sodium acetate (pH4.0), and then add equal volume of phenol. , 0.2 volumes of chloroform: isoamyl alcohol mixed solution (49: 1) were used for extraction. After ice-cooling for 15 minutes, centrifugation was performed to collect the upper layer, and an equal amount of 2-propanol was added to precipitate RNA. After centrifugation, the precipitate was dissolved in 0.5 ml of solution 4D (4M guanidine thiocyanate, 25 mM sodium citrate pH 7.0; 0.5% sarcosyl, 0.1M 2-mercaptoethanol), and then 2 volumes of ethanol was added and the solution was added again. RNA was precipitated. After centrifugation, the precipitate was washed with 75% ethanol and dried. The precipitate was dissolved in 50 μl of sterile distilled water and the RNA
It was a solution.

Example 2 Preparation of cDNA Library cDNA synthesis was carried out using 10 μl of RNA solution as a starting material. RN
The double-stranded cDNA was prepared from A using a commercially available cDNA synthesis system Plus (Amersham, RPN-1256Z). Conversion rate from RNA to single-stranded cDNA is about 2%, single-stranded
The conversion rate from cDNA to double-stranded cDNA was about 100%. The synthesized double-stranded cDNA was subjected to ethanol precipitation and then 100 μl of TE solution (10 mM Tris-Cl, pH8.0 1 mM ED
TA). Next, the following reaction was performed using a commercially available cDNA synthesis kit (Pharmacia LKB, 27-9260-01). Sephacryl S-300 with cDNA solution included in the kit
The buffer was exchanged with the 1 × T4 ligase solution by passing through a span column. Next, according to the instructions, EcoRI
An adapter addition reaction and a T4 kinase reaction were performed. c
The adapter that did not bind to DNA was Sephacryl S-300.
Removed using a span column. The cDNA in the eluate is
Ethanol precipitation was performed with 5 μg of carrier tRNA. The precipitate was washed with 75% ethanol and then air dried. Next, a commercially available cDNA cloning system λgt11
The following reaction was performed using the adapter method (Amersham, RPN 1280). Add 5 μl of sterile distilled water to the precipitate, 4 μl (2 μl
g) λgt11 EcoRI arm and 1 μl of L / K buffer were added and dissolved, then 1 μl (2.5 U) of T4 ligase was added and left overnight at 1,5 ° C. Next, GIGAPACKII Gold
Using the λDNA packaging kit (Stratagene, 200216), the above reaction product (containing recombinant λgt11 DNA) was prepared.
In vitro packaging reaction, c, DNA library
(Lot.B) was created.

Example 3: Cloning of non-A non-B hepatitis virus antigen gene by immunoscreening The reaction between the plaques in the cDNA library (Lot.B) and the primary and secondary antibodies was carried out using a commercially available super screen.
Immunoscreening system (Amersham, RPN 1281
It was performed according to the method of Z). The primary antibody used for the screening was the absorption of pooled sera from non-A non-B hepatitis patients (5 acute hepatitis convalescence and 5 chronic hepatitis) with E. coli lysate (Bio-Rad, 17-3205) ( 2 mg lysate / ml serum) was added to solution A (10 mM Tris-Cl, pH 7.5)
Diluted 20-fold with 150 mM NaCl, 2% (W / V) BSA) before use. As a secondary antibody, peroxidase-labeled goat anti- (human IgG) IgG (Kappel, 3201-0081) was diluted 500 times and used. The color reaction was carried out using a commercially available lambda lift detection kit GAR-HRP (Bio-Rad, 17-3556). From about 500,000 plaques, 10 positive plaques (developed blue-violet on a nitrocellulose filter) were isolated. One clone among them was named Y30 and the following analysis was continued.

Example 4: Antigen specificity test of clone Y30 a) Immunoplaque assay A mixture of Y30 clone and negative clone (λgt11 parent strain) in a ratio of 2: 8 was plated and the above immunoassay was performed. Using the screening method, C100 antibody, Y19 antibody [HCV NS3-derived Y19 antigen (Japanese Patent Application No. 2-19
5735, filed on July 24, 1990)],
Reactivity with non-A non-B chronic hepatitis patient sera (5 persons), non-A non-B cirrhosis patient sera (5 persons) and control sera (6 persons) of healthy subjects who were negative for both CP9 + CP10 antibodies was examined. . As a result, clone Y30 was
It was shown to react specifically with non-A non-B chronic hepatitis patient serum and liver cirrhosis patient serum that did not react with V antigen (Table 1). That is, it was confirmed that clone Y30 encodes an antigen immunologically recognized by sera derived from a non-A non-B hepatitis patient to which existing HCV antigens do not react.

Table 1 ------------------ N--Positive rate -------------------- −−−−−−−−−− Non-A non-B chronic hepatitis 5 3/5 Non-A non-B type cirrhosis 5 4/5 Healthy subjects control 60/6 ALT high blood donation 20 6/20 --- −−−−−−−−−−−−−−−−−−−−−−

Furthermore, the clone Y30 is a C100 antibody in a blood supply with an abnormally high ALT value (35 IU / L or more),
All of the Y19 antibody and the CP9 + CP10 antibody reacted with 6 of 20 negative samples.

Example 5: Determination of nucleotide sequence of cDNA derived from clone Y30 and sequence of antigen polypeptide encoded in the sequence Clone Y30 was propagated by the plate lysate method described in 2.118 of Experiment Manual 1 and then phages were grown. DNA was prepared. 5 µg of phage DNA was digested with EcoRI, extracted with phenol, and then precipitated with ethanol. 3 μg Ec
After treating oRI digest with alkaline phosphatase, T4
5'end labeling was performed using kinase and γ ³² P-ATP. After the DNA fragment was purified by phenol extraction and ethanol precipitation, 5.0% polyacrylamide gel electrophoresis was performed and the length of the cDNA excised by EcoRI digestion was examined by autoradiography. As a result, the size of the cDNA was found to be about 510 base pairs. Next, the aforementioned EcoR
A T4 ligase reaction was performed between the I digest and pTZ19 (Pharmacia LKB, 27-4986-01) that had been dephosphorylated after digestion with EcoRI. The reaction solution was transfected into Escherichia coli JM109 (Takara Shuzo, 9052), and a plasmid having an insert of about 510 bases was isolated (designated pTZ19-Y30). Deposited as No. 3818.

The nucleotide sequence of the cDNA incorporated into pTZ19-Y30 was determined by performing a sequencing reaction using 7-deaza Sequenase Version 2.0 Kit (Toyobo US70777). M13 primer M4 (Takara Shuzo, 3832), M13
Both strands were read and determined using primer RV (Takara Shuzo, 3830) and four kinds of synthetic primers. . In addition, either strand of the determined sequence was β-gal on recombinant λgt11.
In order to confirm whether it was involved in forming a fusion protein with the protein, λgt11 EcoRI site primer
Nucled Biolabs, 1218, 1222) was used to directly sequence the phage DNA as a template. Based on these results, the nucleotide sequence encoding the antigen that specifically reacts with the serum of non-A non-B hepatitis patients and the amino acid sequence of the antigen were determined as follows.

[0028] The nucleotide sequence: GGAGAGGGGGCGGTCCAGTGGATGAACAGACTGATCGCCTTTGCCTCCAGAGGAAACCATGTTGCACCTAC CCACTACGTGGCGGAATCTGATGCTTCGCTGCGCGTAACGCAGATTCTAAGTTCACTCACAATTACCAGCT TACTTAGGAGGCTACATGCCTGGATCACTGAAGATTGCCCAGTCCCATGTTCGGGGTCTTGGCTCCAGGAC ATTTGGGATTGGGTTTGTTCCATTCTCACAGACTTTAAGAACTGGCTGTCCTCAAAATTGTTCCCCAAAAT GCCCGGCCTTCCCTTTATCTCTTGCCAAAAGGGATACAGGGGTGTATGGGCTGGCACGGGAGTCATGACTA CTCGGTGCCCATGCGGGGCAAACATCTCGGGCCATGTCCGCATGGGTACCATGAAAATAACAGGCCCGAAG ACTTGCTTGAACCTGTGGCAGGGAACCTTCCCCATTAATTGTTACACAGAAGGGCCCTGCGTGCCAAAACC CCCTCCTAATTACAAGACC

Amino acid sequence: N-X Gly Glu Gly Ala Val Gln Trp Met Asn Arg Leu Ile Ala Phe Ala Ser Arg Gly Asn His Val Ala Pro Thr His Tyr Val Ala Glu Ser Asp Ala Ser Leu Arg Val Thr Gln Ile Leu Ser Ser Leu Thr Ile Thr Ser Leu Leu Arg Arg Leu His Ala Trp Ile Thr Glu Asp Cys Pro Val Pro Cys Ser Gly Ser Trp Leu Gln Asp Ile Trp Asp Trp Val Cys Ser Ile Leu Thr Asp Phe Lys Asn Trp Leu Ser Ser Lys Leu Phe Pro Lys Met Pro Gly Leu Pro Phe Ile Ser Cys Gln Lys Gly Tyr Arg Gly Val Trp Ala Gly Thr Gly Val Met Thr Thr Arg Cys Pro Cys Gly Ala Asn Ile Ser Gly His Val Arg Met Gly Thr Met Lys Ile Thr Gly Pro Lys Thr Cys Leu Asn Leu Trp Gln Gly Thr Phe Pro Ile Asn Cys Tyr Thr Glu Gly Pro Cys Val Pro Lys Pro Pro Pro Asn Tyr Lys Thr-C (In the above formula, X is a hydrogen atom at the N-terminal, Met Ala or Ala.
Means that. )

[0030]

[Sequence listing] SEQ ID NO: 1 Sequence length: 516 Sequence type: Nucleic acid Topology: Linear Sequence type: Sequence GGAGAGGGGG CGGTCCAGTG GATGAACAGA CTGATCGCCT TTGCCTCCAG AGGAAACCAT 60 GTTGCACCTA CCCACTACGT GGCGGAATAG CCAGTCCCAT GTTCGGGGTC TTGGCTCCAG GACATTTGGG ATTGGGTTTG TTCCATTCTC 240 ACAGACTTTA AGAACTGGCT GTCCTCAAAA TTGTTCCCCA AAATGCCCGG CCTTCCCTTT 300 ATCTCTTGCC AAAAGGGATA CAGGGGTGTA TGGGCTGGCA CGGGAGTCAT GACTACTCGG 360 TGCCCATGCG GGGCAAACAT CTCGGGCCAT GTCCGCATGG GTACCATGAA AATAACAGGC 420 CCGAAGACTT GCTTGAACCT GTGGCAGGGA ACCTTCCCCA TTAATTGTTA CACAGAAGGG 480 CCCTGCGTGC CAAAACCCCC TCCTAATTAC AAGACC 516

SEQ ID NO: 2 Sequence length: 172 Sequence type: Amino acid Topology: Linear Sequence type: Protein Other information: N-terminal is bound to hydrogen atom, either Met Ala or Ala . Gly Glu Gly Ala Val Gln Trp Met Asn Arg Leu Ile Ala Phe Ala Ser Arg 1 5 10 15 Gly Asn His Val Ala Pro Thr His Tyr Val Ala Glu Ser Asp Ala Ser Leu 20 25 30 Arg Val Thr Gln Ile Leu Ser Ser Leu Thr Ile Thr Ser Leu Leu Arg Arg 35 40 45 50 Leu His Ala Trp Ile Thr Glu Asp Cys Pro Val Pro Cys Ser Gly Ser Trp 55 60 65 Leu Gln Asp Ile Trp Asp Trp Val Cys Ser Ile Leu Thr Asp Phe Lys Asn 70 75 80 85 Trp Leu Ser Ser Lys Leu Phe Pro Lys Met Pro Gly Leu Pro Phe Ile Ser 90 95 100 Cys Gln Lys Gly Tyr Arg Gly Val Trp Ala Gly Thr Gly Val Met Thr Thr 105 110 115 Arg Cys Pro Cys Gly Ala Asn Ile Ser Gly His Val Arg Met Gly Thr Met 120 125 130 135 Lys Ile Thr Gly Pro Lys Thr Cys Leu Asn Leu Trp Gln Gly Thr Phe Pro 140 145 150 Ile Asn Cys Tyr Thr Glu Gly Pro Cys Val Pro Lys Pro Pro Pro Asn Tyr 155 160 165 170. Lys Thr

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display location C12N 15/51 C12P 21/02 C 8214-4B C12Q 1/68 A 7823-4B G01N 33/569 L 9015-2J 33/576 Z 9015-2J // (C12N 1/21 C12R 1:19) (C12P 21/02 C12R 1:19) (72) Inventor Arima Akikatsu 5-1 Hiranocho, Kagoshima City, Kagoshima Prefecture No. 403

Claims (19)

[Claims] 1. A non-A non-B hepatitis virus antigen polypeptide Y30 group N-X Gly Glu Gly Ala Val Gln Trp Met Asn Arg Leu Ile Ala Phe Ala Ser Arg Gly Asn His Val Ala Pro Thr His Tyr Val Ala Glu Ser Asp Ala Ser Leu Arg Val Thr Gln Ile Leu Ser Ser Leu Thr Ile Thr Ser Leu Leu Arg Arg Leu His Ala Trp Ile Thr Glu Asp Cys Pro Val Pro Cys Ser Gly Ser Trp Leu Gln Asp Ile Trp Asp Trp Val Cys Ser Ile Leu Thr Asp Phe Lys Asn Trp Leu Ser Ser Lys Leu Phe Pro Lys Met Pro Gly Leu Pro Phe Ile Ser Cys Gln Lys Gly Tyr Arg Gly Val Trp Ala Gly Thr Gly Val Met Thr Thr Arg Cys Pro Cys Gly Ala Asn Ile Ser Gly His Val Arg Met Gly Thr Met Lys Ile Thr Gly Pro Lys Thr Cys Leu Asn Leu Trp Gln Gly Thr Phe Pro Ile Asn Cys Tyr Thr Glu Gly Pro Cys Val Pro Lys Pro Pro Pro Asn Tyr Lys Thr-C (In the above formula, X is a hydrogen atom at the N-terminal, Met Ala or Ala
Means that. ) 2. An antigenic polypeptide comprising 5 or more consecutive amino acid sequences according to claim 1 having an epitope immunologically identical to the epitope contained in the antigenic polypeptide according to claim 1. 3. The antigen polypeptide according to claim 1 or 2, which is chemically synthesized. 4. A fusion antigen polypeptide having the amino acid sequence according to claim 1 or 2. 5. The antigenic polypeptide is β-galactosidase.
The fusion antigen polypeptide according to claim 4, which is fused with (β-gal). 6. A recombinant λgtll clone Y30 which expresses the fusion antigen polypeptide according to claim 5. 7. A polynucleotide encoding the antigen or fusion antigen polypeptide according to claim 1, 2, 4 or 5. Non-A, non-B hepatitis virus polynucleotide 8. represented by the following nucleotide sequence GGAGAGGGGGCGGTCCAGTGGATGAACAGACTGATCGCCTTTGCCTCCAGAGGAAACCATGTTGCACCTAC CCACTACGTGGCGGAATCTGATGCTTCGCTGCGCGTAACGCAGATTCTAAGTTCACTCACAATTACCAGCT TACTTAGGAGGCTACATGCCTGGATCACTGAAGATTGCCCAGTCCCATGTTCGGGGTCTTGGCTCCAGGAC ATTTGGGATTGGGTTTGTTCCATTCTCACAGACTTTAAGAACTGGCTGTCCTCAAAATTGTTCCCCAAAAT GCCCGGCCTTCCCTTTATCTCTTGCCAAAAGGGATACAGGGGTGTATGGGCTGGCACGGGAGTCATGACTA CTCGGTGCCCATGCGGGGCAAACATCTCGGGCCATGTCCGCATGGGTACCATGAAAATAACAGGCCCGAAG ACTTGCTTGAACCTGTGGCAGGGAACCTTCCCCATTAATTGTTACACAGAAGGGCCCTGCGTGCCAAAACC CCCTCCTAATTACAAGACC 9. A polynucleotide probe for detecting a polynucleotide derived from non-A non-B hepatitis virus, which comprises 8 consecutive bases or more derived from the complementary strand sequence according to claim 8. Polynucleotide probe consisting of length 10. A polynucleotide primer pair for detecting a polynucleotide derived from a non-A non-B hepatitis virus by a reverse transcription-PCR method, which is derived from the sequence according to claim 8 and its complementary strand. Polynucleotide primer pair consisting of consecutive 8 bases or more 11. A host cell transformed with a recombinant expression vector encoding the antigen or the fusion antigen polypeptide according to claim 1, 2, 3, 4 or 5 is cultured under conditions for expressing the polypeptide. A method for producing an antigenic polypeptide, which comprises: 12. The production method according to claim 11, wherein the expression vector is an E. coli expression vector and the host is E. coli. 13. A recombinant antigen polypeptide produced by the production method according to claim 11 or 12. 14. The method of claim 1, 2, 3, 4, 5 or 13
The immunological conjugate formed by the reaction of the described antigenic polypeptide with a non-A non-B hepatitis virus antibody present in the biological sample is measured to determine the non-A non-B type in the biological sample. Method for detecting non-A non-B hepatitis virus antibody for confirming the presence of hepatitis virus antibody 15. A mixed antigen prepared by mixing the antigen polypeptide according to claim 1, 2, 3, 4, 5 or 13 with a non-A non-B hepatitis-related antigen polypeptide and a non-existent antigen present in a biological sample. The immunological conjugate formed in the reaction with A non-B hepatitis virus antibody was measured to determine the non-A non-B content in the biological sample.
Method for detecting non-A non-B hepatitis virus antibody for confirming the presence of hepatitis B virus antibody 16. A method for measuring an immunologically bound substance is ELI.
The detection method according to claim 14 or 15, which is an SA method. 17. A kit for analyzing the presence of an antibody of an antigenic polypeptide Y30 group, which comprises in a suitable container an antigenic polypeptide Y30 group or an epitope of the antigenic polypeptide contained in the Y30 group and immunological Kit having an antigenic polypeptide having an epitope that can be considered to be the same 18. A method for detecting a polynucleotide derived from a non-A non-B hepatitis virus using the polynucleotide probe according to claim 9 by a hybridization method. 19. A method for detecting a polynucleotide derived from a non-A non-B hepatitis virus by the reverse transcription-PCR method using the pair of polynucleotide primers according to claim 10.