JPH0638765A - Dna fragment capable of coding non-a, non-b hepatitis virus structural protein - Google Patents

Abstract

PURPOSE:To provide the subject new DNA fragment coding a polypeptide useful for diagnosis of non-A, non-B hepatitis excellent in accuracy of judgment. CONSTITUTION:This invention is a DNA fragment obtained by collecting non-A, non-B hepatitis virus RNA directly from the plasma of a non-A, non-B hepatitis patient and modifying the collected RNA according to the genetic engineering method, containing a base sequence capable of coding a polypeptide constituting non-A, non-B hepatitis virus structural protein and having an amino acid sequence of, e.g. the formula. From the fresh plasma of a Japanese chronic non-A, non-B hepatitis patient infected only with group II, all the RNAs including non-A, non-B hepatitis virus RNA are collected using ELISA method and PCR method and cDNA is synthesized according to random primer method. The resultant cDNA is introduced in lambda phage so as to construct a cDNA library. The obtained cDNA library is subjected to immunoscreening using the above- mentioned plasma of the hepatitis patient and cDNA library constructed from plural patient plasmas is screened by using the resultant DNA fragment as a probe, thus affording the objective cDNA specific to the above-mentioned hepatitis.

Description

Detailed Description of the Invention

The present invention relates to a novel D encoding a constituent polypeptide of a non-A non-B hepatitis virus structural protein.
The present invention relates to an NA fragment, an expression vector containing the DNA fragment, a transformant transformed with the expression vector, an expression polypeptide obtained by culturing the transformant, and a method for producing the same.

Non-A, non-B hepatitis is considered to be a viral infectious hepatitis, is prone to chronicity, and has a high rate of conversion to liver cirrhosis and liver cancer, which is a social problem. However, the virus expression level in patients or healthy carriers is low, and no infectious virus has been identified.
It is very difficult to make a definitive diagnosis because it is not known that more than one species exist. To date, the diagnosis of non-A non-B hepatitis has clinically confirmed elevated levels of alanine aminotransferase and aspartate aminotransferase in the serum, and then hepatitis A, hepatitis B and hepatitis D. Furthermore, it is carried out by a so-called exclusion diagnosis, in which it is diagnosed whether hepatitis is caused by a known virus that causes liver damage, CMV, EBV, etc., and when it does not correspond to these diseases, non-A non-B hepatitis is diagnosed. It was However, the clinical picture of non-A non-B hepatitis is similar to that of other viral hepatitis, and differential diagnosis with other viral hepatitis is difficult by the above-mentioned exclusion diagnosis method. Further, it is more difficult to identify a healthy carrier having no abnormal ALT value. For this reason, it is difficult to prevent infection by transfusion from healthy carriers, and this hepatitis accounts for over 90% of posttransfusion hepatitis.
It is said to reach one million. Many researchers have developed non-A non-B hepatitis diagnostic materials in order to improve such a situation, but many of them have low reliability. The most reliable of these diagnostic materials is believed to have been developed by M. Houghton et al. (Kohron 2-500880) of Chiron. At Chiron, chimpanzees are inoculated with patient plasma to cause non-A non-B hepatitis, and plasma is separated from an individual having high infectious titer plasma, and RNA is recovered from the isolated plasma using a protein expression vector. Screened with patient sera using a λgt11. At Chiron, using the obtained gene, the gene was further cloned, and the hepatitis C virus (HCV
(= Chiron company name)
An antigenic protein obtained by expressing a part of a gene is used to make a kit for diagnosis. Thereafter, in Japan, non-A non-B hepatitis-specific genes have been isolated by immunoscreening. However, the patent of Maki et al.
According to 2-180889), the isolated gene has a low homology with HCV isolated by Chiron, which has high homology with HCV group I which has high homology at the nucleic acid and amino acid level.
It was shown that the virus can be classified into group II, which shows only a homology that can be considered as a virus different from V. group I. It has also been shown that patients infected with group I and patients infected with group II can be classified by an ELISA system using the expression products of the group I and group II genes.

[Problems to be Solved by the Invention]
HCV, which is considered to be one of the causative viruses of non-hepatitis B, was discovered, and it became possible to make an alternative to the exclusion diagnostic method. However, the patient serum screening results using this diagnostic material are not satisfactory at all, and the kit of Chiron shows only about 50 to 70% reaction particularly with Japanese non-A non-B hepatitis patient serum. That is, there are cases in which it does not react with the serum of a patient who is clinically diagnosed with non-A non-B hepatitis or with the serum of a patient whose presence of the HCV gene has been confirmed by gene amplification (PCR). One reason for this is that the isolated viral gene of Chiron is a viral gene belonging to HCV group I, and therefore its expression product is also considered to be group I-specific. Therefore, the sera of patients infected with Group II viruses may not be detected by the kit of Chiron. In addition to group I and group II, there is a possibility that there are viruses located in the middle of them, viruses that do not belong to either of them, such as group III, or viruses that have no homology to HCV at all. . In order to solve these problems, it is necessary to obtain a group II-specific viral gene from plasma of Japanese patients infected with group II. Furthermore, in order to obtain a virus with low homology to HCV group I or group II, many non-A non-B hepatitis virus genes derived from Japanese were obtained from more Japanese patients, and as many as possible were obtained. It is necessary to obtain an antigen that reacts with patient serum. MEANS TO SOLVE THE PROBLEM This invention solves the said subject, the novel DNA fragment which codes the constituent polypeptide of non-A non-B hepatitis virus structural protein, the expression vector containing this DNA fragment, and the transformation transformed by this expression vector. It is an object of the present invention to provide a body, an expressed polypeptide obtained by culturing the transformant, and a method for producing the same.

[Means for Solving the Problems] As a result of intensive studies to achieve such an object, the present inventors have found that the plasma of Japanese non-A non-B hepatitis patients infected only with HCV / group II. A pathogenic viral gene that is considered to be the causative virus of non-A non-B hepatitis is purified and isolated, and the gene is used to obtain the viral gene from plasma of a plurality of Japanese non-A non-B hepatitis patients, and the gene is derived from the gene. The present invention was completed by constructing an expression vector containing the selected DNA and obtaining a transformant transformed with the expression vector. The present invention provides a constituent polypeptide of a non-A non-B hepatitis virus structural protein obtained by genetically inducing a non-A non-B hepatitis virus RNA obtained directly from plasma of a non-A non-B hepatitis patient. Provided is a DNA fragment containing a nucleotide sequence encoding An important feature in the preparation of this DNA fragment is that fresh plasma from a chronic non-Japanese non-A non-B hepatitis patient who is infected only with group II using the ELISA method and the PCR method is used as a starting material. Is mentioned. The present inventors directly extracted total RNA including non-A non-B hepatitis virus RNA from this plasma pool and synthesized cDNA by the random primer method.
This cDNA was put into λ phage to prepare a cDNA library. Furthermore, this cDNA library was immunoscreened using sera of non-A non-B hepatitis patients infected only with group II, and a group II-specific DN
A fragment was obtained. Using the obtained DNA fragment as a probe, a cDNA library obtained from a plurality of chronic stage non-A non-B hepatitis patient plasmas was screened by a hybridization assay, and Japanese non-A non-B hepatitis having different homologies. A patient-specific cDNA was isolated. Thus, the method for isolating group II-specific non-A non-B hepatitis virus RNA from the plasma of non-A non-B hepatitis patients infected with group II was adopted, and the obtained DNA fragment Was used to screen a large number of non-A non-B hepatitis patient plasmas. The present invention provides an extremely effective antigen for increasing the detection accuracy of blood for transfusion of a non-A non-B hepatitis virus carrier having hepatitis virus. The cDNA library preparation method of the present invention, DNA fragment isolation, sequence determination, polypeptide expression, purification and isolation, and enzyme antibody method are described in detail below. First, a cell lysate is separated from fresh plasma of a non-A non-B hepatitis patient infected only with group II, and the centrifugation supernatant is further pelletized by centrifugation. From this pellet, total RNA was separated as a precipitate by equilibrium density gradient centrifugation using cesium trifluoroacetate, and phenol / chloroform extraction and ethanol precipitation were carried out.
To purify. From the obtained RNA fraction, Gubler and Hoffma
According to the method of n, cDNA is synthesized using random primers. This is treated with a DNA methylase (for example, EcoRI methylase) to be methylated, and then a DNA linker (for example, EcoRI linker) or a DNA adapter (for example, EcoRI adapter) is ligated, and this is subjected to λ phage (for example, λgt10, λgt11). ) And other cloning vectors to construct a cDNA library. This is designated as cDNA library A. In the same manner, a cDNA library was constructed from fresh plasma of a plurality of non-A non-B hepatitis patients. This is cDNA
This is library B. Next, E. coli is infected with the λ phage cDNA library A and cultured on an agar plate to form plaques. Plaques are transferred to nitrocellulose filters and positive clones are detected by immunoscreening with non-A non-B hepatitis sera that are only infected with group II. From this screening, one clone C11-C21 was obtained. In order to improve the efficiency of screening and to obtain non-A non-B hepatitis-causing virus genes from more people, the obtained positive clones were cloned into a cloning vector such as a plasmid, the fragments were excised, and the random primer method was used. Is labeled with ³² P to prepare a DNA probe, which is then screened by a hybridization assay using the probe to detect a positive plaque from the cDNA library B. Further screening was carried out using the clones thus obtained. This series of screens yielded four additional clones. We have cloned these clones into C10-E1.
2, C10-E13, C10-E24, C10-E15.
These total 5 clones, namely C11-C21, C10-
All of E12, C10-E13, C10-E24 and C10-E15 were transferred into Escherichia coli JM109 strain and formed into transformant strains, respectively, and were produced by Microtechnical Research Institutes, Microbial Research Institute Nos. 11892, 11894 and 11895.
, No. 11896 and No. 11897, December 1990
It has been deposited on the 11th. From the obtained 5 clones of λ phage DNA, a cDNA was obtained by a conventional method and cleaved with an appropriate restriction enzyme (for example, EcoRI, BamHI),
After each cDNA fragment was purified by agarose gel electrophoresis, it was incorporated into pUC119 or M13 phage and Sang
er et al.'s dideoxy chain termination method [Proc. Natl. Acad. Sci. U
SA, 74, 5463 (1977)] was used to determine the nucleotide sequence of each cDNA fragment. The nucleotide sequences of the clones C11-C12, C10-E12, C10-E13, C10-E24 and C10-E15 thus determined and the amino acid sequences deduced therefrom are shown in SEQ ID NOs: 1, 2, 3, 4 and 5 shows. These are 369 BP, 932 BP, 559 BP, 276 BP and 742 BP, respectively.
A DNA fragment having a nucleic acid sequence consisting of Therefore,
According to an embodiment of the present invention, the invention provides a complete amino acid sequence in which the polypeptide constituting the non-A non-B hepatitis virus structural protein is encoded according to the open reading frame represented by SEQ ID NO: 1, 2, 3, 4 or 5. Or a part thereof is provided, which provides a DNA fragment containing a nucleotide sequence encoding the polypeptide. Of course, in these base sequences, any other base sequence consisting of other codons corresponding to each amino acid is included in the present invention.
All 5 clones had open open reading frames and had no stop codons. HCV is known to be a virus similar to flaviurus such as Japanese encephalitis virus by analysis of genomic RNA (protein / nucleic acid / enzyme 35 (12), 2117-2127).
(1990)), it was recognized that the DNA fragment of the present invention encodes an HCV structural protein based on the homology to the known flavivirus gene and polypeptide. In particular, clone C11-C12 is a gene encoding the core of HCV, and clones C10-E12 and C10-E.
13, C10-E24 and C10-E15 are all HCV core
It is recognized that it is a gene encoding env or a region downstream from env from the latter half of the. Nucleic acid sequence 369 BP represented by SEQ ID NO: 1 for the C11-C21 clone and the amino acid sequence translated in open reading frame
Comparing the homology of 3 amino acids with HCV reported by Houghton et al. [Japanese Patent Publication No. 2-11089], the homology was 81.8% at the nucleic acid level and 87% at the amino acid level. Also Okamoto et al. (Japan J. Exp.Med., 60,3, p.
167-177, 1990) also showed homology of 82.1% and 82.7% at the nucleic acid level and 87.8% and 89.4% at the amino acid level, as compared with HCV clones HC-J1 and HC-J4 obtained from Japanese. It was Houghton et al.'S homology in the same region among three clones of HCV and HC-J1 and HC-J4 is well conserved at 92.1% to 97.6% at the nucleic acid level and 95.5% to 96.7% at the amino acid level. , The clones C11-C21 obtained by us have a certain distance in homology from these three clones, and are considered to be genes of different virus groups. 3 of the remaining 4 clones, C10-E12, C10-E13, C
10-E15 shows 83-93% homology at the nucleic acid level and 82-95% homology at the amino acid level with HCV, HC-J1 and HC-J4. C10-E24 is around 63% at the nucleic acid level,
The homology was around 60% at the amino acid level. Thus, the DNA fragment of the present invention is a novel DNA, which is different from the conventionally known DNA fragment. HCV is divided into two groups, group I and group II, but it is highly likely that it is a virus that is susceptible to mutation in the host, and it is divided into groups of intermediate types between group I and group II and other groups. It is possible that some viruses are present.
Therefore, it is difficult to diagnose all non-A non-B hepatitis patients with only an antigen protein made from one kind of DNA fragment. In order to solve this problem, it is important to set a method for preparing DNA and the like to obtain more clones. It is possible to improve the efficiency of diagnosis by using several of the obtained clones in combination for diagnosis. The present invention also provides expression obtained by introducing the DNA fragment obtained as described above into a cloning site in a vector existing downstream of a promoter. As the vector, a commonly used vector such as a plasmid or a phage is used. Expression vectors are constructed using techniques known in the art. FIG. 1 shows an example of construction of an expression plasmid. The construction method will be described below. First, the C11-C21 clone was cloned into pUC
Plasmid pUC.C11-C obtained by incorporating into 119
2 primers from 21 DNA (5'-TTACGAATTCATGGGC
ACGAATCCT -3 ', 5'-TTAATCGATGACCTTACCCACATTGC
3'by the gene amplification method (PCR) using G-3 ')
A DNA fragment having a stop codon at the end is obtained. This DNA fragment was ligated to pUC118 digested with SmaI,
The plasmid pUC118.C11-C21.Sma is obtained. This plasmid was digested with EcoRI and BamHI,
The DNA fragments are separated by agarose gel electrophoresis and purified by the glass powder method. On the other hand, the expression vector Trp.TrpE DNA (Japanese Patent Application No. 2-180889) is digested with BamHI and EcoRI and treated with bacterial alkaline phosphatase (BAP), followed by phenol extraction and ethanol precipitation to obtain a treated vector DNA.
By ligating this vector DNA and the above-mentioned C11-C21 DNA fragment with T4 DNA ligase in a ligation buffer, the DNA encoding the constituent polypeptide of the non-A non-B hepatitis virus structural protein is placed at a position where transcription can be controlled. Expression plasmid Tr with promoter
p.TrpE C11-C21 was obtained. Other clones can be treated with an appropriate restriction enzyme and integrated into an expression vector to obtain a corresponding expression plasmid. Examples of the promoter include those derived from Escherichia coli, phage and the like. For example, tryptophan synthase operon (trp), lactose operon (la)
c), lambda phage P _L , P _R, etc. Further, the transcription termination factor is not always necessary, but it is preferable to make it exist in the expression vector. The present invention further provides a transformant obtained by transforming a host with the expression vector of the present invention. As the host, microorganisms commonly used in this field such as Escherichia coli, Bacillus subtilis, and yeast are used. Transformation is carried out by conventional methods for transferring expression vectors into host cells. When bacteria (eg E. coli) are used as the host, direct uptake method using calcium chloride [Ma
ndel, M. and Higa, A., J. Mol. Bio. 53, 159-162 (1970)] can be used. Further, a host such as Escherichia coli containing the expression vector is inoculated into, for example, ampicillin-containing 2YT medium, cultivated, and subcultured in ampicillin-containing phosphate medium to proliferate the expressed bacterial cells and produce the desired polypeptide. be able to. As a method for purifying a target product from a host, for example, a host cell is disrupted by ultrasonic waves and then centrifuged to contain a polypeptide encoded by a non-A non-B hepatitis virus cDNA or a fusion polypeptide containing the polypeptide. The insoluble fraction can be obtained, and the polypeptide can be solubilized and extracted with a buffer containing urea and subjected to ion exchange column chromatography (for example, S-Sepharose) for purification. Therefore, the present invention also includes SEQ ID NO: 1,
Provided is a method for producing a recombinant polypeptide containing all or part of an amino acid sequence encoded by a nucleotide sequence constituting a 2, 3, 4 or 5 DNA fragment. That is, the method of the present invention comprises the steps of constructing a replicable expression vector capable of expressing the DNA fragment in an appropriate host cell, transferring the expression vector into the host cell to obtain a transformant,
The step of culturing the transformant under conditions capable of expressing the NA fragment to produce the recombinant polypeptide, and the step of recovering the recombinant polypeptide are included. The present invention also provides a recombinant polypeptide thus obtained, which comprises the constituent polypeptide of the non-A non-B hepatitis virus structural protein represented by SEQ ID NO: 1, 2, 3, 4 or 5. In the present specification, the term “recombinant polypeptide” means the polypeptide itself obtained by expressing the DNA encoding the polypeptide constituting the non-A non-B hepatitis virus structural protein in the vector, or the polypeptide and trpE. It means a fusion polypeptide with other peptides such as. The expressed polypeptide of the present invention was subjected to SDS-polyacrylamide gel electrophoresis, and then subjected to antigen-antibody reaction with two samples of normal human serum or non-A non-B hepatitis patient serum by Western blotting. The results are shown in FIG. Thus, it was confirmed that this expressed polypeptide acts as a non-A non-B hepatitis virus-specific antigen because it strongly reacts only with patient serum. In addition, the expressed polypeptide of the present invention TrpE.
C11-C21, a polypeptide Tr expressed from a group I gene obtained in the patent of Maki et al. [Japanese Patent Application No. 2-180889]
pE • C11-7, and kit from Chiron (Ortho H
CV Ab ELISA kit) was used to examine the positive rate by reacting with the serum of a patient clinically judged to be non-A non-B hepatitis. Chiron kit was positive in 23 of 33 cases
69.7%, TrpE.C11-7 in Group I was positive in 26 cases, showing a positive rate of 78.8%. On the other hand, in the case of the expressed polypeptide TrpE.C11-C21 of the present invention, 28 cases were positive.
The positive rate was 84.8%, which was higher than that of the Chiron kit. Furthermore, by combining the expressed polypeptide of group I, TrpE • C11-7, with TrpE • C11-C21, which is considered to be group II,
Out of 31 cases, 30 cases became positive, and the positive rate increased to 93.9%. (See Table 1 and FIG. 2) The present invention will be described in more detail with reference to the following examples.
The present invention is not limited to these examples unless the gist of the present invention is changed.

【Example】

 Example 1Of cDMA library from non-A non-B hepatitis patient plasma
Preparation Fresh plasma of Japanese non-A non-B hepatitis patients in the chronic stage,
Group I cDNA clone cloned by Maki et al.
C11-7 expression product and Group II cDNA clone
Screen by ELISA system using C10-14 expression product
To obtain patient plasma that responded only to C10-14
It was This patient plasma is also well preserved in Group I
Region primer (5'-CACATTTGAT
CCCACGATGG-3 ', 5'-CTGGGAGA
GCGTCTTCACAG-3 ') and Group II
Well-conserved region primer (5'-GATGC
CCACTTCCTCTCCCA-3 ', 5'-GTC
AGGGTAACCTCCGTTGGT-3 ') was used.
The gene amplification method (PCR method) was performed. PCR method is Gene
 Amp^TM(DNA Amplification Reagent Kit, Perkin Elme
r Cetus), DNA denaturation 95 ° C, 1.5 minutes, annealing
The conditions were 55 ° C., 2 minutes, DNA synthesis 70 ° C., 3 minutes.
Under this condition, the gene was increased only with the Group II primers.
The pooled patient plasma was used. New for this patient
After preparing the RNA fraction from fresh plasma by the procedure described below,
cDNA library using gt10 and λgt11 phages
Was prepared. First, 1 liter of plasma is equivalent to 50 mM Tri
Cells diluted with s-HCl (pH 8.0) and 1 mM EDTA
Remove the crushed material by centrifuging at 3500g for 20 minutes.
It This supernatant is further added at 4500 rpm (about 100000g) at 4 ℃.
A pellet was obtained by centrifugation for 4 hours. This perez
6M guanidinium thiol which is a protein denaturant according to the conventional method
After dissolution with cyanate, cesium trifluoroacetate
Layered on top of the Tate solution, 33 with a Beckman SW50 rotor
The pellet was obtained by centrifugation at 000 rpm and 20 ° C. for 18 hours. This
Let 10 mM Tris-HCl (pH 7.5), 1 mM
Dissolve in EDTA solution, phenol: chloroform
After extracting twice with the (1: 1) mixture, collect the supernatant and
1/10 volume of M NaCl and 2.5 volumes of ethanol
In addition, it was left to stand at -20 ° C for 2 hours. 15000g after left for 2 hours
Centrifuge for 20 minutes at room temperature and pellet the resulting pellet with diethyl pyrocarbo.
An RNA sample was prepared by dissolving in nate-treated water. RN obtained
Commercially available using the A sample according to the method of Gubler & Hoffman
Use a kit (Amersham or BRL) to randomize
CDNA was synthesized by the Limer method. Synthesized cD
After treating NA with EcoRI methylase, EcoRI
Linker or EcoRI adapter, λg
It was cloned into the EcoRI site of t11 phage. Product
The average number of cDNA libraries produced is 10⁶−10⁷PFU
Of recombinant phages. This cDNA library
The library is designated as cDNA library A. Also ELI
Multiples not screened by SA PCR method
Starting from 5 l of fresh plasma from a non-A non-B hepatitis patient,
CDNA live using λgt10 phage in the same manner
Rally B was constructed. cDNA library B also averages 10
⁶−10⁷It contained PFU recombinant phage. Example 2Isolation of non-A non-B hepatitis-specific cDNA From the cDNA library A prepared in Example 1,
CDNA specific for hepatitis B for immunoscreening
More cloned. Used for immunoscreening
The only sera that can be group II by ELISA and PCR
Non-A non-B hepatitis patient serum confirmed to be infected with
2 samples negative for HBc antibody and HBs antibody
It was used as a pool. First, the E. coli Y1090 strain was added to λgt11
Infection at 37 ° C for 15 minutes, and incubate it at an appropriate density.
Spread on a heaven plate and incubate at 43 ℃ for 3 hours.
To form a ark. On the agar of this plate, 10 mM
Hybond-N nitrocellulose powder impregnated with IPTG
Incubate for 3 hours at 37 ℃ with Luther and induce expression of fusion protein
To do. Nitrocellulose filter with adsorbed expressed protein
Non-A non-B type after blocking with 3% gelatin solution
Hepatitis (abbreviated as NANBH) patient serum and reacted overnight at 4 ° C
To respond. After washing 3 times with TBST solution, peroxidizer
React with ze-labeled anti-human IgG (goat antibody) for 1.5 hours at room temperature
Let Wash this filter 3 times with TBST solution again
And the substrates diaminobenzidine and H₂O₂Mixed with
A positive plaque was obtained by reacting with the liquid. The obtained clone C
11-C21 is positive for HBc antibody and HBs antibody
It did not fit. Next, we will streamline screening
And screen viral genes other than group II
The resulting C11-C21 clone was cloned into pUC11
The product recloned in 9 was digested with restriction enzymes and
By the random primer labeling method³²With P-labeled probe
Used by the hybridization assay
The NA library B was screened. Screen
For the C600 hfl (-) E. coli, 5 × 10^FourP
Infect the recombinant phage of FU at 37 ° C for 15 minutes,
Spread on a 150mm L plate. Incubate at 37 ° C overnight
When plaque appears, leave at 4 ° C for 1 hour. this
Cover the agar plate with Hybond-N filter and let stand for 30 seconds.
Place. Next, a denaturing solution (0.5M NaOH, 1.5M N
Place this filter on a filter paper moistened with aCl),
After standing for 2 minutes, neutralization solution (0.5M Tris-HCl pH
7.0, 1.5M NaCl) for 5 minutes, then 2 × S
After washing in SC, air dry. 3 dry filters
Irradiate with 04nm UV for 2 minutes and UV-crosslink
It was This filter was used as an immunos with NANBH patient serum.
Of the C11-C21 clone obtained by cleaning³²P
Hybridize with labeled DNA probe and
I ran DNA probe
Dilute with buffer and in hybridization buffer
Incubate at 55 ° C overnight to react. After that,
For 10 minutes at 1 x SSC 55 ° C to reduce background
Wash 2 times each. Auto this filter at -70 ℃
Perform radiography to detect positive brakes. F
Put the film and L-plate together, and
Scrape sex plaques into SM buffer. This screenini
Clones obtained by
Screen cDNA library B
It was 4 clones were obtained by this series of screening
C10-E12, C10-E13, C10-E24, C
It was named 10-E15. Example 3Sequencing of non-A non-B hepatitis-specific cDNA The obtained 5 clones of λgt11 or λgt10
Escherichia coli is infected with E. coli and a large amount of phage is recovered.
From this phage, according to the conventional method, DN was applied by the alkaline method.
Extract A. Use this DNA as a restriction enzyme EcoRI, Ba
Digestion with mHI or KpnI and agarose gel electrophoresis
Purify by motion. On the other hand, it is a sequence vector
M13 phage mp18 and mp19 (Messing, J., Me
thod in Enzymology, 101, 20-78) or pUC118
And pUC119 (Vieira, J. and Messing, J., Methods
 in Enzymology, 153, 3-11) with restriction enzymes EcoRI, B
It was linearized by digesting with amHI or KpnI. The above
CDNA fragment and vector DNA of T4
Ligation with E.coli JM109
The strain was transduced or transformed. These E. coli
After culturing, the DNA was recovered by the alkaline method, and the DNA of Sanger et al.
The nucleotide sequence was determined using the deoxy chain termination method. clone
C10-C21, C10-E12, C10-E13, C10-E24 and
C10-E15 nucleotide sequence and amino acid deduced therefrom
The sequences are shown in SEQ ID NOs: 1, 2, 3, 4 and 5, respectively.
It was as it was. Example 4Polype encoded by non-A non-B hepatitis virus cDNA
Expression and purification of butido (I) Construction of expression plasmid One of the obtained clones, C11-C21, was transformed into E. coli (E.
fusion protein with trpE downstream of the promoter in E. coli.
Expressed as a peptide. First, C11-C21 clone
To pUC119 to obtain a plasmid pUC.
1 ng of C11-C21 DNA was added to two primers (5'-
TTACGAATTTCATGGGGCACGAATCCT
-3 ', 5'-TTAATCGATGACCTTACC
The PCR method is performed using CACATTGCG-3 '). P
CR is Gene Amp^TM(DNA Amplification Reagent Kit, Pe
rkin Elmer Cetus) kit, DNA denaturation 95 ℃,
 1.5 minutes, annealing 50 ℃, 2 minutes, DNA synthesis 70 ℃ 3 minutes
The DNA fragment obtained was subjected to 0.8% agarose
It was decomposed by electrophoresis and purified by the glass powder method.
On the other hand, pUC118 was digested with the restriction enzyme SmaI and PCR was performed.
DNA fragment obtained by the method and T4 liger in buffer
Ligated with the plasmid pUC118.C11-C21.
Sma was obtained. 1 μg of this plasmid DNA is a restriction enzyme
Reaction solution 20 μl [150 mM NaCl, 6 mM Tris-H
Cl (pH7.9), 6 mM MgCl₂, 15 units of EcoRI
Enzyme and 15 units of BamHI enzyme] at 37 ° C for 1 hour
Reaction, followed by 0.8% agarose electrophoresis
The EcoRI-BamHI fragment of approximately 380 bp.
This is the glass powder method (Gene Clean ^TM, Bio-101
Company). Next, the expression vector Trp
・ 1 μg of TrpE DNA was added to 20 ml of reaction solution [150 mM Na
Cl, 6 mM Tris-HCl (pH 7.5), 6 mM MgC
l₂, 15 units of EcoRI enzyme and 15 units of BamH
I enzyme] at 37 ° C for 1 hour and 39 μl of water in the reaction mixture.
And heat treated at 70 ℃ for 5 minutes, then
Reactive phosphatase (BAP) 1 μl (250 units / μl)
Was added and the mixture was kept warm at 37 ° C for 1 hour. Phenol into this reaction
Phenol to extract the resulting aqueous layer.
Knoll was precipitated and the precipitate was dried. The obtained EcoRI
-1 μg of BamHI-treated vector DNA and the above-mentioned C11-
C21 DNA fragment was added to 10x ligase buffer [660 mM T
ris-HCl (pH7.5) 66 mM MgCl₂, 100 mM
Thiosthreitol, 1 mM ATP] 5 μl, T4 liger
Add water to 1 μl (350 units / μl) to make 50 μl, and
The ligation reaction was carried out by keeping the temperature overnight at ℃. 10μ of this reaction solution
1 was used to transform E. coli HB101 strain. Transformation
The sensitive E. coli strain used for
l, M. and Higa, A., J. Mol. Biol. 53, 159-162 (197
0)]. Transformed E. coli with 25 μg / ml
LB-plates containing ampicillin (1% tryptone,
0.5% yeast extract, 0.5% NaCl, 1.5% agar)
It was applied and kept at 37 ° C overnight. Of the germs on the plate
Take one platinum loop of the colony and add 25 μg / ml ampicillin.
LB medium and cultured overnight at 37 ° C. 1.5 ml bacterial culture
The nutrient solution is centrifuged to collect the cells, and the plasmid DNA minipreparation is performed.
The alkaline method (Maniatis et al. Molecular Cloni
ng: A Laboratory Manual, 1982). Obtained
20 μl of reaction solution [150 mM N
aCl, 6 mM Tris-Hcl (pH 7.5), 6 mM Mg
Cl, 15 units of EcoRI and BamHI enzyme]
Digest at 37 ° C for 1 hour and perform agarose gel electrophoresis.
 380b EcoRI-BamHI fragment resulting in Trp
The TrpE C11-C21 expression plasmid was selected. this
The plasmid was transferred to E. coli strain 101 and transformed into a transformant.
And, as of December 11, 1990
Has been deposited. (Ii) Polypeptide encoded by clone C11-C21
Expression and purification of the large plasmid containing the expression plasmid Trp / TrpE C11-C21
3 ml of enterobacteria HB101 strain containing 50 μg / ml of ampicillin
2YT medium (1.6% tryptone, 1% yeast extract, 0.5%
% NaCl) and incubate at 37 ° C. for 9 hours. This culture
1 ml of nutrient solution contains 100 μM of M containing 50 μg / ml of ampicillin
9-CA medium (0.6% Na₂HPO_Four, 0.5% KH₂
PO_Four, 0.5% NaCl, 0.1% NH_FourCl, 0.1m
M CaCl₂, 2 mM MgSO_Four， 0.5% Casamino
Acid, 0.2% glucose) and culture at 37 ℃ for 21 hours.
I nourished. Furthermore, 18 ml of the main culture solution was added to 1.2 l of M9-CA medium.
The cells were subcultured in and cultured at 37 ° C. OD₆₀₀When = 0.3
Add indole acrylic acid to a final concentration of 40 mg / l.
Then, it was further cultured for 16 hours. Centrifuge this culture
The cells were collected. 20 ml of buffer A (50 mA Tri
s-HCl (pH8.0), 1 mM EDTA, 30 mM NaC
l) was added to suspend the cells, and the cells were centrifuged again to express cells.
2.6 g was obtained. Suspend the cells obtained in 10 ml of buffer A
And crush the E. coli membrane by sonication and then centrifuge.
Performed and encoded by a non-A non-B hepatitis virus cDNA
Insoluble containing fusion polypeptide of polypeptide and trpE
A sex fraction was obtained. A buffer containing 10 ml of 6M urea in the fraction
A was added to solubilize and extract the fusion polypeptide. soluble
Ionized column using S-Sepharose
Chromatography NaCl 0M to 0.5M
The fusion polypeptide by a concentration gradient up to
It was Example 5Measurement of HCV antibody in serum of non-A non-B hepatitis patients (I) Measurement by Western blotting The expression product purified in Example 4 was treated with SDS-polyac
Rylamide gel electrophoresis [Laemmli, Nature 277, 680
(1970)], and then perform nitrocellulose
Filter (Bio-rad, Trans-blot)
It was. Blockin this filter with 3% gelatin solution.
After that, normal human serum and non-A non-B hepatitis patient serum were treated at
React with. After washing, peroxidase-labeled human Ig
G (goat antibody) was reacted. Wash the filter again
Then, soak it in the substrate diaminobenzidine solution to develop the color.
confirmed. As shown in FIG.
Although it did not react well, it responded strongly to the patient's serum and
A strange band was seen. (Ii) Measurement by enzyme-linked immunosorbent assay (ELISA method) A means for diagnosing a large amount of serum by Western blotting
The ELISA method can be used as one. The method is the usual method
The purified antigen with PBS (-) at a concentration of 5 μg / ml.
And fix to microplate at 4 ℃ or room temperature
To do. After washing several times with the wash solution, add diluted test serum and incubate at 37 ℃.
Alternatively, incubate at room temperature for 1 hour. After cleaning,
Add luoxidase-labeled anti-human IgG (goat antibody) 37
React at ℃ or room temperature. Wash several more times and
Add 50 μl of Noventidine solution and develop color at 37 ° C. 2
MH₂SO_FourStop the color development and measure with a colorimeter
It was As shown in Table 1, Chiron currently on the market
With company kit (Ortho HCVAb ELISA test)
When comparing the positive rate, 69.7% was that of Chiron.
In contrast, 8 using the expressed antigen according to the present invention
The positive rate was 4.8% (Table 1).

[Table 1]

INDUSTRIAL APPLICABILITY The cDNA sequence obtained by the present invention is specific to non-A non-B hepatitis, and is produced by incorporating these genes into a protein expression system utilizing microorganisms such as Escherichia coli. Since the peptide reacts with the sera of many non-A non-B hepatitis patients, a diagnostic kit with extremely high sensitivity and high determination accuracy can be prepared. It is also possible to directly diagnose these by using these as probes or by synthesizing highly specific probes based on these sequences. Furthermore, by combining with a gene amplification method (PCR), it is possible to obtain a diagnosis and obtain a gene specific to non-A non-B hepatitis. Also,
Since these polypeptides have a function as a non-A non-B hepatitis virus antigen, it can be expected that immunization with this polypeptide as a vaccine can protect the non-A non-B hepatitis virus infection. Furthermore, by immunizing rabbits and the like with these polypolypeptides, an antibody useful for detecting and isolating the virus in the patient's body can be obtained.

[Brief description of drawings]

FIG. 1 Expression plasmid Trp / TrpE C11-C21
The construction method of is shown.

FIG. 2 is a photograph showing the results of examining the immunoreactivity of the expression product with normal human serum or non-A non-B hepatitis patient serum by Western blotting.

FIG. 3 is a diagram in which the number of positive ELISAs in Table 1 is rewritten in the figure.

[Sequence Listing] SEQ ID NO: 1 Sequence length: 369 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear Sequence type: cDNA to genomic RNA Sequence ATG GGC ACG AAT CCT AAA CCT CAA AGA AAA ACC AAA AGA AAC ACT AAC 48 Met Gly Thr Asn Pro Lys Pro Gln Arg Lys Thr Lys Arg Asn Thr Asn 1 5 10 15 CGT CGC CCA CAA GAC GTT AAG TTT CCG GGC GGC GGC CAG ATC GTT GGC 96 Arg Arg Pro Gln Asp Val Lys Phe Pro Gly Gly Gly Gln Ile Val Gly 20 25 30 GGA GTA TAC TTG TTG CCG CGC AGG GGC CCC AGA TTG GGT GTG CGC GCG 144 Gly Val Tyr Leu Leu Pro Arg Arg Gly Pro Arg Leu Gly Val Arg Ala 35 40 45 ACA AGG AAG ACT TCG AAG CGG TCC CAG CCA CGT GGG GGG CGC CGG CCC 192 Thr Arg Lys Thr Ser Lys Arg Ser Gln Pro Arg Gly Gly Arg Arg Pro 50 55 60 ATC CCT AAA GAT CGG CGC TCC ACT GGC AAG TCC TGG GGG AAA CCA GGA 240 Ile Pro Lys Asp Arg Arg Ser Thr Gly Lys Ser Trp Gly Lys Pro Gly 65 70 75 80 TAC CCC TGG CCC CTA TAT GGG AAT GAG GGA CTC GGC TGG GCA GGG TGG 288 Tyr Pro Trp Pro Leu Tyr Gly Asn Glu Gly Leu G ly Trp Ala Gly Trp 85 90 95 CTT CTG TCC CCC CGA GGT TCC CGT CCC TCT TGG GGC CCC ACT GAC CCC 336 Leu Leu Ser Pro Arg Gly Ser Arg Pro Ser Trp Gly Pro Thr Asp Pro 100 105 110 CGG CAT AGG TCG CGC AAT GTG GGT AAG GTC ATC 369 Arg His Arg Ser Arg Asn Val Gly Lys Val Ile 115 120 SEQ ID NO: 2 Sequence length: 932 Sequence type: Nucleic acid Topology: Linear Sequence type: cDNA to genomic RNA sequence CG CGC AAC TTG GGT AAG GTC ATC GAT ACC CTC ACA TGC GGC TTC GCC 47 Arg Asn Leu Gly Lys Val Ile Asp Thr Leu Thr Cys Gly Phe Ala 1 5 10 15 GAC CTC ATG GGG TAC ATT CCG CTT GTC GGC GCC CCC CTA GGG GGT GCT 95 Asp Leu Met Gly Tyr Ile Pro Leu Val Gly Ala Pro Leu Gly Gly Ala 20 25 30 GCC AGG GCC CTG GCA CAT GGT GTC CGG GTT CTG GAG GAC GGC GTG AAC 143 Ala Arg Ala Leu Ala His Gly Val Arg Val Leu Glu Asp Gly Val Asn 35 40 45 TAT GCA ACA GGG AAT TTG CCC GGT TGC TCT TTC TCT ATC TTC CTC TTG 191 Tyr Ala Thr Gly Asn Leu Pro Gly Cys Ser Phe Ser Ile Phe Leu Leu 50 55 60 GCT TTG CTG TCC TGT TTG ACC ATC CCA GCT TCC GCT TAT GAG GTG CGC 239 Ala Leu Leu Ser Cys Leu Thr Ile Pro Ala Ser Ala Tyr Glu Val Arg 65 70 75 AAC GTA TCC GGG ATA TAC CAT GTC ACG AAC GAC TGC TCC AAC TCA AGT 287 Asn Val Ser Gly Ile Tyr His Val Thr Asn Asp Cys Ser Asn Ser Ser 80 85 90 95 ATT GTG TAT GAG GCA GCG GAC ATG ATC ATG CAT ACC CCC GGG TGC GTG 335 Ile Val Tyr Glu Ala Ala Asp Met Ile Met His Thr Pro Gly Cys Val 100 105 110 CCC TGC GTT CGG GAG AAC AAC TCC TCC CGT TGC TGG GCA GCG CTC ACT 383 Pro Cys Val Arg Glu Asn Asn Ser Ser Arg Cys Trp Ala Ala Leu Thr 115 120 125 CCC ACG TTA GCG GCC AGG AAC ACC AGC GTC CCC ACT ACG ACA ATA CGA 431 Pro Thr Leu Ala Ala Arg Asn Thr Ser Val Pro Thr Thr Thr Ile Arg 130 135 140 CGG CAT GTC GAT TTG CTC GTT GGG GCG GCT GCT TTC TGC TCC GCT ATG 479 Arg His Val Asp Leu Leu Val Gly Ala Ala Ala Phe Cys Ser Ala Met 145 150 155 TAC GTG GGG GAT CTC TGT GGA TCT GTC TTC CTC GTT TCC CAG CTG TTC 527 Tyr Val Gly Asp Leu Cys Gly Ser Val Phe Leu Val Ser Gln Leu Phe 160 165 170 175 ACT TTC TCA CCT C GT CGG CAT GAG ACA GTA CAG GAC TGC AAC TGC TCA 575 Thr Phe Ser Pro Arg Arg His Glu Thr Val Gln Asp Cys Asn Cys Ser 180 185 190 ATC TAT CCC GGC CAC TTG ACA GGT CAT CGC ATG GCT TGG GAT ATG ATG 623 Ile Tyr Pro Gly His Leu Thr Gly His Arg Met Ala Trp Asp Met Met 195 200 205 ATG AAC TGG TCA CCT ACA ACA GCC CTA GTG GTG TCG CAT CTA CTC CGG 671 Met Asn Trp Ser Pro Thr Thr Ala Leu Val Val Ser His Leu Leu Arg 210 215 220 ATC CCA CAA GCT GTC ATG GAC ATG GTG GCG GGG GCT CAC TGG GGA GTC 719 Ile Pro Gln Ala Val Met Asp Met Val Ala Gly Ala His Trp Gly Val 225 230 235 CTA GCG GGC CTC GCC TAC TAT TCC ATG GTG GGG AAC TGG GCT AAG GTT 767 Leu Ala Gly Leu Ala Tyr Tyr Ser Met Val Gly Asn Trp Ala Lys Val 240 245 250 255 TTG ATT GTG ATG CTA CTC TTC GCC GGC GTT GAC GGG ACC ACC TAT GTG 815 Leu Ile Val Met Leu Leu Phe Ala Gly Val Asp Gly Thr Thr Tyr Val 260 265 270 ACA GGG GGG ACG ACA GGC CGC ACC ACC AGC TCG TTC GCA TCC CTC TTT 863 Thr Gly Gly Thr Thr Gly Arg Thr Thr Ser Ser Phe Ala Ser Leu Phe 275 280 285 ACA C TT GGG TCG CAT CAG AAG GTC CAG CTT ATA AAT ACC AAT GGC AGC 911 Thr Leu Gly Ser His Gln Lys Val Gln Leu Ile Asn Thr Asn Gly Ser 290 295 300 TGG CAC ATC AAC AGG ACC GCC 932 Trp His Ile Asn Arg Thr Ala 305 310 SEQ ID NO: 3 Sequence length: 559 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear Sequence type: cDNA to genomic RNA sequence CGC CGG TAT GAG ACG GCG CAA GAC TGC AAT TGC TCA CTC TAT CCC GGT 48 Arg Arg Tyr Glu Thr Ala Gln Asp Cys Asn Cys Ser Leu Tyr Pro Gly 1 5 10 15 CAC GTA TCT GGT CAC CGC ATG GCT TGG GAT ATG ATG ATG AAC TGG TCA 96 His Val Ser Gly His Arg Met Ala Trp Asp Met Met Met Asn Trp Ser 20 25 30 CCT ACA ACG GCC CTA GTG GTA TCG CAG CTA CTC CGG ATC CCA CAA GCC 144 Pro Thr Thr Ala Leu Val Val Ser Gln Leu Leu Arg Ile Pro Gln Ala 35 40 45 GTC GTG GAC ATG GTG GCG GGG GCC CAC TGG GGA GTC CTA GCG GGC CTT 192 Val Val Asp Met Val Ala Gly Ala His Trp Gly Val Ile Ala Gly Leu 50 55 60 GCC TAC TAT TCC ATG GTG GCG AAC TGG GCT AAG GTC TTG GTT GTG ATG 2 40 Ala Tyr Tyr Ser Met Val Ala Asn Trp Ala Lys Val Leu Val Val Met 65 70 75 80 CTA CTC TTT GCC GGC GTT GAC GAC GGG AAG ACC ACC GTG ACG GGG GGG 288 Leu Leu Phe Ala Gly Val Asp Asp Gly Lys Thr Thr Val Thr Gly Gly 85 90 95 AGC GCA GCC TTC CAG TCC AGG AAG TTA GTG TCC TTC TTC TCA CCA GGG 336 Ser Ala Ala Phe Gln Ser Arg Lys Leu Val Ser Phe Phe Ser Pro Gly 100 105 110 CCG AAA CAA AAT ATC CAG CTT GAT AAC ACC AAC GGC AGC TGG CAC ATC 384 Pro Lys Gln Asn Ile Gln Leu Asp Asn Thr Asn Gly Ser Trp His Ile 115 120 125 AAC AGG ACT GCC CTG AAT TGC AAT GAC TCC CTC CAA ACT GGG TTC ATC 432 Asn Arg Thr Ala Leu Asn Cys Asn Asp Ser Leu Gln Thr Gly Phe Ile 130 135 140 GCT GCG CTG TTC TAC GCG CAC AAG TTC AAT TCG TCC GGA TGC CTA GAG 480 Ala Ala Leu Phe Tyr Ala His Lys Phe Asn Ser Ser Gly Cys Leu Glu 145 150 155 160 CGC ATG GCC AGC TGC CGC CCC ATT GAC AAG TTC GCG CAG GGG TGG GGT 528 Arg Met Ala Ser Cys Arg Pro Ile Asp Lys Phe Ala Gln Gly Trp Gly 165 170 175 CCC ATC ACT CAC GAT ACG CCT AAG ATC CCG G 559 Pro Ile Th r His Asp Thr Pro Lys Ile Pro 180 185 SEQ ID NO: 4 Sequence length: 276 Sequence type: Nucleic acid Number of strands: Double stranded Topology: Linear Sequence type: cDNA to genomic RNA Sequence GA CAC CGT ATG GCA TGG GAC ATG ATG ATG AAC TGG TCG CCC ACG GCT 47 His Arg Met Ala Trp Asp Met Met Met Asn Trp Ser Pro Thr Ala 1 5 10 15 ACC ATG ATT CTG GCG TAT GTG ATG CGC ATC CCC GAG GTC GTC ATG GAC 95 Thr Met Ile Leu Ala Tyr Val Met Arg Ile Pro Glu Val Val Met Asp 20 25 30 ATC ATT GGC GGG GCT CAC TGG GGC GTC ATG TTC GGC TTG GGC TAT TTT 143 Ile Ile Gly Gly Ala His Trp Gly Val Met Phe Gly Leu Gly Tyr Phe 35 40 45 TCT ATG CAG GGG GCT TGG GCA AAA GTC GTT GTC ATC CTT CTG CTG GCC 191 Ser Met Gln Gly Ala Trp Ala Lys Val Val Val Ile Leu Leu Leu Ala 50 55 60 GCT GGG GTG GAT GCG ACT ACC CTC AGC GTT GGG GGC TCT GCC GCG CAC 239 Ala Gly Val Asp Ala Thr Thr Leu Ser Val Gly Gly Ser Ala Ala His 65 70 75 ACC ACC GGC GGC CTT GTC GGC TTG TTC AAG CCT GGC G 276 Thr Thr Gly Gly Leu Val Gly Leu Phe Lys Pro Gly 80 85 90 SEQ ID NO: 5 Sequence length: 742 Sequence type: Nucleic acid Number of strands: Double-stranded topology: Linear Sequence type: cDNA to genomic RNA Sequence CG CTT GTC GGC GCC CCC CTA GGG GGT GCT GCC AGG GCC CTG GCA CAT 47 Leu Val Gly Ala Pro Leu Gly Gly Ala Ala Arg Ala Leu Ala His 1 5 10 15 GGT GTC CGG GTT CTG GAG GAC GGC GTG AAC TAT GCA ACA GGG AAT TTG 95 Gly Val Arg Val Leu Glu Asp Gly Val Asn Tyr Ala Thr Gly Asn Leu 20 25 30 CCC GGT TGC TCT TTC TCT ATC TTC CTC TTG GCT TTG CTG TCC TGT TTG 143 Pro Gly Cys Ser Phe Ser Ile Phe Leu Leu Ala Leu Leu Ser Cys Leu 35 40 45 ACC ATC CCA GCT TCC GCT TAT GAG GTG CGC AAC GTA TCC GGG ATA TAC 191 Thr Ile Pro Ala Ser Ala Tyr Glu Val Arg Asn Val Ser Gly Ile Tyr 50 55 60 CAT GTC ACG AAC GAC TGC TCC AAC TCA AGT ATT GTG TAT GAG GCA GCG 239 His Val Thr Asn Asp Cys Ser Asn Ser Ser Ile Val Tyr Glu Ala Ala 65 70 75 GAC ATG ATC ATG CAT ACC CCC GGG TGC GTG CCC TGC GTT CGG GAG AAC 277 Asp Met Ile Met His Thr Pro Gly Cys Val Pro Cys Val Arg Glu Asn 80 85 90 95 AAC TCC TCC CGT TGC TGG GCA GCG CTC ACT CCC ACG TTA GCG GCC AGG 335 Asn Ser Ser Arg Cys Trp Ala Ala Leu Thr Pro Thr Leu Ala Ala Arg 100 105 110 AAC ACC AGC GTC CCC ACT ACG ACA ATA CGA CGG CAT GTC GAT TTG CTC 383 Asn Thr Ser Val Pro Thr Thr Thr Ile Arg Arg His Val Asp Leu Leu 115 120 125 GTT GGG GCG GCT GCT TTC TGC TCC GCT ATG TAC GTG GGG GAT CTC TGT 431 Val Gly Ala Ala Ala Phe Cys Ser Ala Met Tyr Val Gly Asp Leu Cys 130 135 140 GGA TCT GTC TTC CTC GTT TCC CAG CTG TTC ACT TTC TCA CCT CGT CGG 479 Gly Ser Val Phe Leu Val Ser Gln Leu Phe Thr Phe Ser Pro Arg Arg 145 150 155 CAT GAG ACA GTA CAG GAC TGC AAC TGC TCA ATC TAT CCC GGC CAC TTG 527 His Glu Thr Val Gln Asp Cys Asn Cys Ser Ile Tyr Pro Gly His Leu 160 165 170 175 ACA GGT CAT CGC ATG GCT TGG GAT ATG ATG ATG AAC TGG TCA CCT ACA 575 Thr Gly His Arg Met Ala Trp Asp Met Met Met Asn Trp Ser Pro Thr 180 185 190 ACA GCC CTA GTG GTG TCG CAT CTA CTC CGG ATC CCA CAA GCT GTC ATG 623 Thr Ala Leu Val Val Ser His Leu Leu Arg Ile Pro Gln Ala Val Met 195 200 205 GAC ATG GTG GCG GGG GCC CAC TGG GGA GTC CTA GCG GGC CTT GCC TAC 671 Asp Met Val Ala Gly Ala His Trp Gly Val Leu Ala Gly Leu Ala Tyr 210 215 220 TAT TCC ATG GTG GGG AAC TGG GCT AAG GTT TTG ATT GTG ATG CTA CTC 719 Tyr Ser Met Val Gly Asn Trp Ala Lys Val Leu Ile Val Met Leu Leu 225 230 235 TTC GCC GGC GTT GAC GGG ACC AC 742 Phe Ala Gly Val Asp Gly Thr 240 245

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁵ Identification code Internal reference number FI Technical display location G01N 33/53 D 8310-2J 33/576 Z 9015-2J // (C12N 1/21 C12R 1: 19) (72) Inventor Michiho Ohara 1-3-1 Nishitsurugaoka, Oi-cho, Iruma-gun, Saitama Tonen Research Institute

Claims (12)

[Claims] 1. A non-A non-B hepatitis virus structural protein constituent protein obtained by genetically engineering from a non-A non-B hepatitis virus RNA obtained directly from plasma of a non-A non-B hepatitis patient. DNA containing a nucleotide sequence encoding a peptide
fragment. 2. The DNA fragment according to claim 1, wherein the polypeptide is represented by all or part of an amino acid sequence encoded according to the open reading frame represented by SEQ ID NO: 1. 3. The DNA fragment according to claim 1, wherein the polypeptide is represented by all or part of an amino acid sequence encoded according to the open reading frame represented by SEQ ID NO: 2. 4. The DNA fragment according to claim 1, wherein the polypeptide is represented by all or part of an amino acid sequence encoded according to the open reading frame represented by SEQ ID NO: 3. 5. The DNA fragment according to claim 1, wherein the polypeptide is represented by all or part of an amino acid sequence encoded according to the open reading frame represented by SEQ ID NO: 4. 6. The DNA fragment according to claim 1, wherein the polypeptide is represented by all or part of the amino acid sequence encoded according to the open reading frame represented by SEQ ID NO: 5. 7. D according to any one of claims 1 to 6.
An expression vector obtained by introducing an NA fragment into a cloning site in a vector existing downstream of a promoter. 8. The expression vector according to claim 7, wherein the vector is a plasmid. 9. A transformant obtained by transforming a host with the expression vector according to claim 7 or 8. 10. The transformant according to claim 9, wherein the host is Escherichia coli. 11. A method for producing a recombinant polypeptide containing all or part of an amino acid sequence encoded by a nucleotide sequence constituting the DNA fragment according to any one of claims 1 to 6, comprising: Constructing a replicable expression vector capable of expressing the DNA fragment in a suitable host cell, transferring the expression vector into the host cell to obtain a transformant, under conditions capable of expressing the DNA fragment A method comprising culturing the transformant to produce the recombinant polypeptide, and recovering the recombinant polypeptide. 12. A recombinant polypeptide comprising a constituent polypeptide of a non-A non-B hepatitis virus structural protein, obtained by the method according to claim 11.